first posted online on 10 september 2018 as 10.1242/dev ...€¦ · regulation of energy metabolism...
TRANSCRIPT
![Page 1: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/1.jpg)
Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls
Mitochondrial Transcription
Ram P Kumar1, 6, *, Soma Ray1, Pratik Home1, Biswarup Saha1, 5, Bhaswati Bhattacharya1, Heather M
Wilkins2, Hemantkumar Chavan3, Avishek Ganguly1, Jessica Milano-Foster1, Arindam Paul1, Partha
Krishnamurthy3, Russell H Swerdlow2 and Soumen Paul1, 4, *
1 Department of Pathology and Laboratory Medicine, University of Kansas Medical Center, Kansas City,
KS 66160, USA.
2 University of Kansas Alzheimer's Disease Center and the departments of Neurology, Molecular and
Integrative Physiology, and Biochemistry and Molecular Biology, University of Kansas Medical Center,
Kansas City, Kansas, USA
3 Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, 3901
Rainbow Boulevard, Kansas City, KS 66160, USA
4 Institute of Reproductive Health and Regenerative Medicine, University of Kansas Medical Center,
Kansas City, KS 66160, USA.
5. Current Address: Department of Tumor Biology H Lee Moffitt Cancer Center and Research Institute,
12902 Magnolia Drive, SRB4, 24214, Tampa, Florida 33612-9416
6. Current Address: Department of Developmental Neurobiology, St. Jude Children’s Research Hospital,
262 Danny Thomas Pl Memphis, TN, USA 38105
KEYWORDS
Mammalian development/ mitochondrial transcription/ POLRMT/ TEAD4/ trophoblast stem cell/Electron
Transport Chain.
*CORRESPONDING AUTHORS
Email: [email protected] (SP)
[email protected] (RPK)
D
evel
opm
ent •
Acc
epte
d m
anus
crip
t
http://dev.biologists.org/lookup/doi/10.1242/dev.162644Access the most recent version at First posted online on 10 September 2018 as 10.1242/dev.162644
![Page 2: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/2.jpg)
ABSTRACT
Early mammalian development is critically dependent on the establishment of oxidative energy
metabolism within the trophectoderm (TE) lineage. Unlike inner cell mass (ICM), TE cells enhance ATP
production via mitochondrial oxidative phosphorylation (OXPHOS) and this metabolic preference is
essential for blastocyst maturation. However, molecular mechanisms that regulate establishment of
oxidative energy metabolism in TE cells are incompletely understood. Here, we show that conserved
transcription factor TEAD4, which is essential for pre-implantation mammalian development, regulates
this process by promoting mitochondrial transcription. In the developing TE and TE-derived trophoblast
stem cells (TSCs), TEAD4 localizes to mitochondria, binds to mitochondrial DNA (mtDNA) and facilitates
mtDNA transcription by recruiting mitochondrial RNA Polymerase (POLRMT). Loss of TEAD4 impairs
recruitment of POLRMT, resulting in reduced expression of mtDNA-encoded electron transport chain
components, thereby inhibiting oxidative energy metabolism. Our studies identify a novel TEAD4-
dependent molecular mechanism that regulates energy metabolism in the TE lineage to ensure
mammalian development.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 3: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/3.jpg)
INTRODUCTION
During early mammalian embryogenesis totipotent blastomeres differentiate to ICM and TE
lineages. The ICM develops into the embryo proper, whereas the TE is essential for blastocyst maturation
and implantation (Frum and Ralston, 2015, Cockburn and Rossant, 2010, Zernicka-Goetz et al., 2009).
Development of the TE and ICM lineages are regulated by restricted expression of cell-type specific
transcription factors and spatio-temporal integration of cell signaling events (Frum and Ralston, 2015,
Knott and Paul, 2014). Interestingly, along with differential gene expression programs, TE and ICM
development is also associated with establishment of altered metabolic preferences. ICM cells largely
utilize a glycolytic metabolic pathway for ATP production (Trimarchi et al., 2000, Kaneko and
DePamphilis, 2013). In contrast, TE cells undergo a metabolic switch and utilize OXPHOS for enhanced
ATP production. This metabolic switch in TE cells is necessary for sufficient ATP supply for distinct
metabolic processes and for the activity of the Na+, K+-ATPase pump, which ensure blastocoel formation
and blastocyst maturation (Houghton, 2006). Although the necessity of metabolic transition in TE lineage
during early embryogenesis is well characterized, much less is understood regarding the molecular
mechanism that controls this glycolytic to OXPHOS metabolic transition.
The OXPHOS is dependent on proper redox reactions at the electron transport chain (ETC)
complexes, which are localized at the mitochondrial inner membrane. The components of ETC are
encoded by both nuclear and mitochondrial DNA (mtDNA). Mammalian mtDNA, which is a ~16.5 kbp
closed circular molecule, encodes 13 proteins involved in the ETC (Gustafsson et al., 2016). Therefore,
mtDNA transcription is a key regulatory step for OXPHOS. The mtDNA transcription is mediated by a
mitochondria-specific RNA polymerase, POLRMT, which initiates transcription at both light and heavy
strand mtDNA promoters (Gaspari et al., 2004).
POLRMT cannot initiate transcription on its own from a double stranded mtDNA promoter and
requires mitochondrial transcription factor A (TFAM), and mitochondrial transcription factor B2 (TFB2M)
or B1 (TFB1M) to start promoter-specific transcription initiation (Yakubovskaya et al., 2014, Falkenberg et
al., 2002, Metodiev et al., 2009, Larsson et al., 1998, Kuhl et al., 2016). In vitro reconstitution and
structural analyses with TFAM, POLRMT and TFB2M indicates a multi-step transcription initiation
process, which starts with binding of TFAM near the transcription start sites (TSS) on mtDNA (Hillen et
al., 2017). Then POLRMT is recruited to TFAM-bound mtDNA and positioned near the TSS.
Subsequently, TFB2M is recruited at the initiation complex, which induces opening up the double-
stranded DNA at the promoter region leading to initial RNA synthesis by POLRMT. Thus, TFAM and
TFB2M are implicated in initiating POLRMT-mediated transcription at the double-stranded promoter
region (Hillen et al., 2017, Sologub et al., 2009). However, TFAM and TFB2M are not required for the
transcription of a single-stranded mtDNA template or a template with a single-stranded DNA bubble
covering the TSS (Wanrooij et al., 2008). It is proposed that TFAM and TFB2M are also not required for
the transition from initiation to transcriptional elongation. Rather, the transition involves dissociation of the
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 4: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/4.jpg)
initiation factor TFB2M (Hillen et al., 2017, Sologub et al., 2009) and formation of the elongation complex
involving the elongation factor TEFM (Minczuk et al., 2011). TEFM increases the POLRMT affinity to an
elongation-like DNA-RNA template and POLRMT processivity to form longer mtDNA transcripts (Posse et
al., 2015). Thus, along with POLRMT, TFAM, TFB2M, and TEFM constitute the basic machinery for
mtDNA transcription.
Importance of TFAM in mtDNA transcription, replication and packaging are well documented from
multiple studies (Bogenhagen, 2012, Kukat and Larsson, 2013, Rebelo et al., 2011, Kukat et al., 2015),
However, the function of TFAM in the context of mtDNA transcription remains incompletely understood. A
study with human recombinant mtDNA transcription system indicates that TFAM is dispensable for
transcription initiation from the HSP1 and LSP promoters (Shutt et al., 2010). indicating that TFAM is
not absolutely essential to initiate mtDNA transcription. Rather, it appears that TFAM acts as a
regulator of efficiency of mtDNA transcription, in which varying concentration of TFAM dictates mtDNA
transcripts level. Gene knockout studies in mice indicate that TFAM is essential for embryonic
development (Larsson et al., 1998). However, importance of TFAM in the regulation of mitochondrial
function during pre-implantation mammalian development is yet to be fathomed, as TFAM mutant mouse
embryos do not show pre-implantation phenotype or implantation defect. Rather, they die during post-
implantation embryonic development (Larsson et al., 1998).
It has been established that several other nuclear transcription factors shuttle from nucleus to
cytoplasm and then to the mitochondria and could regulate mtDNA transcription (Rebelo et al., 2011,
Garcia-Ospina et al., 2003, Meier and Larner, 2014). For example, NFATc1 localizes to mitochondria and
binds to mtDNA only during osteogenic differentiation in human mesenchyme stem cells and negatively
regulates mitochondrial transcription (Lambertini et al., 2015). Cyclic AMP response element-binding
protein binds to the mtDNA and directly activates mtDNA-encoded transcripts (Lee et al., 2005).
Mitochondrial MEF2D is required selectively for mitochondrial gene ND6 transcriptional activation in
neuronal cells (She et al., 2011). Also, the transcription factor, signal transducer and activator
of transcription 3 (STAT3), which localizes to mitochondria, has been shown to regulate mtDNA
transcription in a cell-type specific manner. It has been shown that STAT3 negatively regulates mtDNA
transcription in keratinocytes (Macias et al., 2014) but promotes mtDNA transcription during
reprogramming and maintenance of naïve pluripotent stem cells (Carbognin et al., 2016). These
observations indicate that transcription factors beyond the members of the core mtDNA transcriptional
machinery could regulate mtDNA transcription in a cell-type specific manner.
In a recent study, Kaneko et al. (Kaneko and DePamphilis, 2013) elegantly showed that
transcription factor TEAD4 is critical for energy homeostasis during pre-implantation mouse development.
TEAD4 is a member of a highly conserved family of transcription factors containing the TEA/ATTS DNA-
binding domain and is a component of the Hippo signaling pathway (Burglin, 1991). TEAD4 expression is
conserved in the developing TE lineage across multiple mammalian species including human. In mouse
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 5: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/5.jpg)
pre-implantation embryos, TEAD4 is expressed beginning at the four-cell stage and expression is
maintained throughout TE lineage development. TEAD4 is highly expressed in mouse TSCs, and is also
expressed in the ICM lineage and ICM-derived embryonic stem cells (ESCs). However, in comparison to
TE and TSCs, TEAD4 expression is significantly reduced in the ICM and ESCs (Home et al., 2012).
Gene knockout studies in mice showed that TEAD4 is essential for the development of the TE lineage
during pre-implantation development. Mouse developing embryos lacking functional TEAD4 fail to form
blastocoel cavity and fail to implant in the uterus (Kaneko and DePamphilis, 1998, Kaneko and
DePamphilis, 2013, Yagi et al., 2007, Nishioka et al., 2008, Nishioka et al., 2009, Ito and Suda, 2014).
These embryos also fail to maintain Cdx2, Gata3 and other TE-specific gene expression, and multiple
studies implicated that transcriptional activity of TEAD4 is critical to establish a TE/Trophoblast-specific
gene expression program during pre-implantation development (Home et al., 2012, Ralston et al., 2010,
Wu et al., 2010). Loss of TEAD4 in pre-implantation mouse embryos results in reduction of mitochondrial
activity and excessive production of reactive oxygen species (ROS) (Kaneko and DePamphilis, 2013).
However, a TEAD4-dependent molecular mechanism that promotes mitochondrial activity and oxidative
energy metabolism in the developing TE/Trophoblast lineage are yet to be identified.
To understand how TEAD4 regulates energy metabolism during early mammalian development,
we studied mouse pre-implantation embryos and mouse TSCs. We show that higher mitochondrial
activity and oxidative energy metabolism in the TE and TSCs are critically dependent on TEAD4, which
directly regulates expression of mitochondrial electron transport chain (ETC) components by promoting
POLRMT recruitment at the mtDNA. Loss of TEAD4 inhibits POLRMT recruitment, thereby impairing
expression of mtDNA-encoded ETC components. Our results identify TEAD4 as a positive regulator of
the mitochondrial transcription in mammalian cells.
RESULTS
TE and TSCs contain matured mitochondria and, similar to TE cells, TSCs also rely on oxidative
energy metabolism:
During preimplantation development, ICM cells maintain a glycolytic metabolic pathway for ATP
production. As the developing TE is characterized with enhanced OXPHOS, it has been proposed that the TE
contains more matured mitochondria compared to the ICM (Houghton, 2006). However, no published study
exists showing a comparative spatial analysis of mitochondrial structure in the TE vs. ICM of a mouse
blastocyst. Therefore, we performed electron microscopy and found that indeed differences in mitochondrial
morphology exist between the TE and the ICM (Fig. 1A). We confirmed that the mitochondria within the ICM
cells are mostly globular in shape and lack proper cristae formation (Fig. 1A), whereas relatively
elongated mitochondria with proper cristae formation is common within the TE cells including the polar TE
cells (Fig. 1A).
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 6: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/6.jpg)
Although TSCs are used as a model system to understand regulatory mechanisms of TE development
and function, mitochondrial morphology, function and energy metabolism in them are poorly understood.
The morphological differences between ICM and TE mitochondria prompted us to further investigate
mitochondrial structure in mouse TSCs. Electron microscopy revealed that similar to the TE cells,
proliferating TSCs also contain morphologically matured, elongated mitochondria with increased cristae
formation (Fig. 1B). Upon spontaneous differentiation (without FGF4 in culture), mouse TSCs
predominantly leads to trophoblast giant cell (TGCs) formation (Ray et al., 2009a). We also looked at
mitochondrial morphology upon spontaneous TSC differentiation and found large elongated mitochondria
(Fig. 1B, right panel) in differentiated TSCs. Thus, mouse TSC differentiation to TGCs is associated with
extensive mitochondrial fusion, an observation supported by another earlier study, which showed loss of
TGC formation in mitofusin 2 mutant mouse embryos (Chen et al., 2003).
As mitochondrial OXPHOS-dependent oxygen consumption substantially increase between
cleavage-stage embryos and blastocysts and TE-development is associated with induction of oxidative
phosphorylation (Trimarchi et al., 2000, Houghton, 2006, Kaneko and DePamphilis, 2013), and both TE and TSCs
contain morphologically matured mitochondria, we tested whether preferences for cellular energy metabolism differ
in undifferentiated vs. differentiated mouse TSCs vs. mouse ESCs. To characterize the metabolic profiles in
TSCs vs. ESCs, we measured the oxygen consumption rate (OCR), which indicates cellular aerobic
respiration. We found that, under standard culture conditions that maintain stemness of ESCs and TSCs,
basal OCR is higher in TSCs compared to that in ESCs (Fig. 1C, D). To further confirm whether TSCs are
associated with higher OXPHOS, OCR was monitored after cells were metabolically stressed by adding
oligomycin, Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP) and antimycin A/rotenone in
succession. In TSCs, treatment of oligomycin, an ATP synthase inhibitor, induced greater loss of OCR
(Fig. 1C). The greater loss of OCR upon inhibition of mitochondrial ATP synthesis indicated that higher
levels of mitochondrial respiration are coupled with ATP production in TSCs (Fig. 1D). To measure
reserve respiratory capacity, which is an indicative parameter of maximal respiratory efficiency of
mitochondria, we next added FCCP, an ionophore that induces high proton conductance into the
mitochondrial membrane with rapid acceleration of the ETC. FCCP treatment resulted in significantly
higher OCR increase in TSCs than that in ESCs (Fig. 1C and D), indicating higher maximal respiratory
capacity of mitochondria in TSCs. Finally, treatment of antimycin A/Rotenone, inhibitors of ETC complex
III and complex I, respectively, revealed that the rate of oxygen consumption due to non-mitochondrial
sources was minimal in both TSCs and ESCs. We also found that the OCR in mouse TSCs does not
change significantly upon induction of differentiation (Fig. 1C and 1D) indicating that both undifferentiated
and differentiated TSCs rely upon oxidative energy metabolism. These findings indicated that similar to TE,
mouse TSCs maintain a mitochondrial respiration and a preference toward oxidative energy metabolism. The
presence of matured mitochondria and a preferential oxidative energy metabolism also suggested that
mouse TSCs could be utilized as a model system to understand molecular mechanisms that regulate
mitochondrial function within the developing TE lineage.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 7: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/7.jpg)
TEAD4 is critical for maintaining oxidative energy metabolism and mitochondrial ETC function in
TSCs:
To understand molecular mechanisms that are critical for a preferential oxidative energy
metabolism in TSCs, we tested the importance of TEAD4 in energy homeostasis in the developing TE
lineage. TEAD4 is highly expressed in TSCs (Fig. 2A) and regulates TSC-specific gene expression
(Home et al., 2012, Yagi et al., 2007, Nishioka et al., 2008, Ralston et al., 2010, Nishioka et al., 2009). To
test whether depletion of TEAD4 affects oxidative energy metabolism in TSCs, we stably depleted TEAD4
in mouse TSCs by RNA interference using short hairpin RNAs (shRNAs) (Fig. 2A). Depletion of TEAD4
induced a loss of stem-state colony morphology in TSCs for prolong culturing in contrast to the TSC
stably transfected with scramble shRNA (Fig. 2B), indicating that TEAD4 is important to maintain TSC
self-renewal. Gene expression analyses showed that depletion of TEAD4 resulted in loss of stem state
regulators like Cdx2, Gata3 and Elf5 (Fig. S1). However, differentiation markers were not significantly
induced (Fig. S1). Thus, when maintained in TSC culture condition with FGF4, loss of TEAD4 affects the
self-renewal ability of mouse TSCs but does not induce their differentiation. To characterize the metabolic
profiles of TEAD4-depleted TSCs (TEAD4KD), we measured OCR and found that loss of TEAD4 strongly
reduced OCR in TSCs (Fig. 2C). TEAD4KD TSCs showed a significantly reduced basal respiration
compared to control TSCs (Fig. 2C-D). Treatment of oligomycin induced only minor loss of OCR (Fig. 2C)
in TEAD4KD TSCs, indicating that very low levels of mitochondrial respiration are coupled with ATP
production in those cells (Fig. 2C-D). Furthermore, analyses of ATP production confirmed that depletion
of TEAD4 resulted in loss of ATP production in TSCs (Fig. 2D). We also compared the extracellular
acidification rate (ECAR), an indicative parameter for glycolytic energy metabolism, in control vs.
TEAD4KD TSCs. ECAR was monitored after addition of glucose, oligomycin and 2-deoxy-D-glucose
(2DG) in succession (Fig. 2E). We found that, unlike oxidative respiration, glycolytic capacity in TSCs is
not significantly dependent on TEAD4 (Fig. 2E-F). Collectively, these results indicated that TEAD4 is
important for maintaining oxidative energy metabolism in TSCs.
Loss of Tead4 induces mitochondrial ETC dysfunction in TSCs:
Oxidative ATP synthesis relies on proton gradient across the inner mitochondrial membrane. As
the TEAD4KD TSC displayed reduction in OCR and ATP production, we tested whether loss of TEAD4 is
associated with reduction of mitochondrial membrane potential in TSCs. We used a fluorescent vital dye
JC-1, which accumulates within mitochondria in a membrane potential-dependent fashion resulting in a
fluorescence emission shift from green (~529 nm) to red (~590 nm) (St John et al., 2006). TSC stably
transfected with scramble shRNA treated with JC1, exhibited bright red-orange fluorescence, indicating
the presence of healthy mitochondria (Fig. 3A). In contrast TEAD4KD TSCs displayed mostly green
fluorescence representing hypo-polarized mitochondria (Fig. 3A).
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 8: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/8.jpg)
Next, we tested whether mitochondrial ultrastructure in TSCs is altered upon TEAD4 depletion.
Transmission electron microscopy revealed that unlike control TSCs, mitochondria in TEAD4KD TSCs
are more electroluscent, without prominent cristae and often associated with cellular vacuoles (Fig. 3B).
These changes are indicative of mitochondria with reduced folding of mitochondrial inner membrane,
which contains the five complexes of the mitochondrial OXPHOS system. The OXPHOS system includes
four ETC complexes (complex I–complex IV) and the ATP-producing FoF1-ATPase complex, which is
involved in ATP generation. Inhibition of mitochondrial respiration and alteration of mitochondrial
morphology are often associated with ETC dysfunction. Therefore, we tested whether loss of TEAD4
results in functionally impaired ETC complexes in TSCs. We measured complex I activity with control and
TEAD4KD TSCs and found that complex I activity was significantly reduced in TEAD4KD TSCs (Fig. 3C).
We also observed drastic reduction of complex I activity upon TEAD4 depletion (Fig. 3C). However, we
did not notice any significant change in the activity of Citrate Synthase, an enzyme associated with Krebs
cycle, which is localized in the mitochondrial matrix and an indicator of intact mitochondrial mass (Fig.
3D).
Impaired activities of ETC complexes, including complex I leads to excessive ROS production
(Zhou et al., 2011). So, we tested whether loss of TEAD4 is associated with induction of ROS production
in TSCs. Using MitoSox, a probe that detects mitochondrial ROS-production (Zhou et al., 2011), we
observed induced mitochondrial ROS production in TEAD4KD TSCs as compared to that of TSC stably
transfected with scramble shRNA (Fig. 3E). This is in line with the findings from a study by Kaneko et al.
(Kaneko and DePamphilis, 2013), which showed that loss of TEAD4 in preimplantation mouse embryos
induce ROS production. Collectively, these results indicate that TEAD4 is important to maintain proper
ETC function in TSCs.
TEAD4 promotes mtDNA transcription by facilitating POLRMT recruitment at the mtDNA:
Impaired function of mitochondrial ETC complexes in TEAD4KD TSCs prompted us to investigate
a TEAD4-dependent mechanism that regulates expression of mtDNA-encoded ETC components.
Therefore, we asked whether mtDNA transcription is altered upon TEAD4 depletion in TSCs. Quantitative
RT-PCR analyses revealed that loss of TEAD4 in TSCs inhibits expression of mtDNA-encoded genes
(Fig. 4A). However, mRNA expressions of nuclear DNA encoded mitochondrial regulators, including
transcription factor A mitochondrial (TFAM), nuclear respiratory factor 1 (NRF1), cofactor PGC1-,
deacetylase sirtuin-3 (SIRT3) and POLRMT, were not altered upon TEAD4-depletion (Fig. 4A).
To further test TEAD4-dependent regulation of mtDNA-encoded ETC complex members, we
tested protein expressions of MT-CYB, a component of ETC complex III, and MT-CO1 a component of
ETC complex IV. We observed strong down regulation of both MT-CYB and MT-CO1 protein expression
in TEAD4KD TSCs (Fig. 4B). In contrast, protein expression of UQCRC2 (required for the assembly of
ETC complex II), Translocase of Outer Mitochondrial membrane 20 (TOM20), POLRMT and TFAM, which
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 9: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/9.jpg)
are expressed from nuclear DNA, and localize to mitochondria for their function, were unchanged upon
TEAD4 depletion (Fig. 4B). These results confirmed that TEAD4 is important to optimize expression of
mtDNA-encoded ETC components in TSCs.
To further confirm the specificity of TEAD4-dependent regulations of mtDNA transcription in
mouse TSCs, we wanted to rescue TEAD4KD mouse TSCs with a mutant TEAD4, lacking nuclear
localization signal (NLS). However, analyses of mouse TEAD4 protein sequence revealed that the NLS in
TEAD4 overlaps with the functional TEA domain (Fig. S2A), making the approach to selectively delete the
NLS without affecting TEAD4 DNA binding activity not feasible. Thus, we performed two following
experiments. First, we depleted YAP1, a cofactor for TEAD4 to regulate nuclear DNA encoded genes and
tested mtDNA transcription. We found that depletion of TEAD4 cofactor, YAP1, reduced the mRNA
expression of TSC specific genes Cdx2 and Gata3, but did not reduce transcript levels of mtDNA-
encoded ETC components (Fig. S2 B, C, D, E). These results indicated that a TEAD4-YAP1 axis, which
regulates nuclear genes in mouse TSCs, is not involved in the regulation of mtDNA-encoded ETC
component genes. Second, we rescued TEAD4 function in TEAD4KD mTSCs by ectopically expressing a
modified TEAD4 protein, in which a mitochondrial targeting sequence (MTS) from subunit VIII of human
cytochrome c oxidase was attached (Fig. 4C). The modified TEAD4 was also attached to a reporter
EGFP, separated by the self-cleaving 2A peptide from Thosea asigna virus (T2A peptide). Thus, we could
monitor expression of ectopic TEAD4 from EGFP expression (Fig. 4D). We found that rescue of TEAD4
expression in TEAD4KD mouse TSCs rescued expression of mtDNA-encoded ETC components (Fig. 4E
and F).
Transcription from mtDNA generates polycistronic transcripts, which are processed to generate
matured transcripts. However, the processed transcripts of mtDNA-encoded genes often have a shorter
half-life (Wolf and Mootha, 2014, Piechota et al., 2006, Chujo et al., 2012). Therefore, to better assess
inhibition of mtDNA transcription in TEAD4KD TSCs, we analyzed nascent mtDNA transcripts using a
nascent transcript capture kit. Analyses of nascent mtDNA transcripts further confirmed significant down
regulation of mtDNA transcription in TEAD4KD TSCs and expression of ectopic TEAD4 rescued the
process (Fig. 4G-H and Table S1). Collectively, these experiments indicated specific importance of a
TEAD4-dependent mechanism that promotes mtDNA transcription in mouse TSCs.
Mitochondrial transcripts are generated by POLRMT from two heavy strand promoters (HSPs)
and one light strand promoter (LSP), which are localized at the D-loop region of the mtDNA ((Taanman,
1999) and Fig. 4E). In addition, establishment of the transcription initiation complex requires additional
transcription factors, like TFAM (Falkenberg et al., 2002, Larsson et al., 1998). However, our findings
above indicated that, in TSCs, TEAD4 promotes mtDNA transcription via a mechanism, which is
independent of the regulation of TFAM and POLRMT expression (Fig. 4B), mtRNA splicing and mtRNA
degradation (Fig. 4H). Therefore, we asked whether POLRMT recruitment at the mtDNA is dependent
upon TEAD4 function. To test this, we isolated mitochondria from control and TEAD4KD TSCs and
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 10: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/10.jpg)
performed chromatin immunoprecipitation (ChIP) analyses to assess POLRMT recruitment at different
regions of the mtDNA (Fig. 4I). Intriguingly, ChIP analyses detected significant reduction in POLRMT
recruitment at the mtDNA upon loss of TEAD4 (Fig. 4J). We also tested TFAM recruitment at the mtDNA
in TEAD4KD TSCs. We found that, unlike POLRMT, TFAM binding at the mtDNA was not inhibited upon
TEAD4 depletion (Fig. 4K). These findings strongly indicated a novel function of TEAD4, in which it
promotes transcription of mtDNA-encoded ETC components by facilitating POLRMT recruitment to the
mtDNA.
Endogenous Tead4 localizes to mitochondria and physically occupy mtDNA:
Transcription factors often shuttle from the nucleus to the cytoplasm. Although a majority of
transcription factors mediate their function within the nucleus, several of them localize to the mitochondria
and are implicated in regulation of mitochondrial genome transcription in different cellular contexts
(Ralston et al., 2010, Wu et al., 2010, Mahato et al., 2014, Leppens et al., 1996, Leese and Barton,
1984). TEAD4 is a nuclear-cytoplasmic transcription factor (Home et al., 2012) and Kaneko et al. showed
that ectopic TEAD4 colocalizes with mitochondria in the NIH3T3 cell line (Kaneko and DePamphilis,
2013). Therefore, we investigated whether endogenous TEAD4 localizes to mitochondria and regulates
mtDNA transcription in TSCs. Co-immunostaining studies with an anti-TEAD4 antibody along with anti-
TFAM antibody indicated that endogenous TEAD4 localizes to mitochondria in proliferating mouse TSCs
(Fig. 5A and Fig. S3). To further confirm TEAD4 localization in mitochondria in the mouse TSCs, we
performed additional experiments. First, we isolated purified mitochondria from mouse TSCs sub-
fractionated purified mitochondria and confirmed presence of TEAD4 within the mitochondrial nucleoid
fraction via western blot analyses (Fig. 5B). Finally, we performed immunogold transmission electron
microscopy (immuno-TEM) using an anti-TEAD4 antibody and found that TEAD4 is localized in the
mitochondrial matrix surrounded by the inner membrane (Fig. 5C). These experiments confirmed
mitochondrial localization of TEAD4 in mouse TSCs.
Multiple recent studies indicate that site-specific occupancy of nuclear transcription factors on the
mitochondrial genome is critical for the regulation of mtDNA transcription (Wu et al., 2010, Larsson et al.,
1998, Taanman, 1999, Piechota et al., 2006, St John et al., 2006, Zhou et al., 2011, Chujo et al., 2012,
Wolf and Mootha, 2014). As we detected TEAD4 localization in the mitochondria, and presence of several
consensus TEAD motifs throughout the mtDNA (Fig. S4A), we investigated whether endogenous TEAD4
occupies the mtDNA in mouse TSCs. We performed TEAD4 ChIP with isolated mitochondria from mouse
TSCs and screened the mtDNA for TEAD4 binding using multiple primer-pairs. Our screening detected
TEAD4 binding at different regions of the mtDNA, including the D-loop region where mtDNA transcription
starts (Fig. 5D). The specificity of, TEAD4 occupancy was further confirmed by monitoring loss of TEAD4
occupancy at the mtDNA in TEAD4KD TSCs.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 11: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/11.jpg)
Our analyses showed that the TEAD4 binding regions contains several sequences that resemble
the putative consensus TEA motifs (Fig. S4B). Therefore to further gain additional evidence that TEAD4
binds to the TEA target sequences within the mitochondrial genome, we performed electrophoretic
mobility shift assay (Fig. 5E). We incubated mTSC extracts with a ~200 bp mtND1 DNA fragment,
containing a single high affinity TEA (GGAATG) motif along with 3 other overlapping putative low affinity
TEA motifs (Fig. S4C). Formation of multiple DNA-protein complexes with increasing amount of mTSC
extract (Fig. 5E lanes 2-5,) were confirmed via mobility shift of the mtND1 fragment. To confirm that
TEAD4 is responsible for the mobilityl shifts with mTSC extracts, we tested whether the shifted band
could be supershifted by the addition of antibodies directed against the TEAD4 protein. As shown for a
fragment the gel-shifted band seen in the mTSC extracts is supershifted by the addition of anti-TEAD4
factor antibody (Fig. 5E lane 6, green box) but not IgG (Fig. 5E lane 7).
As TEAD4 is an evolutionarily conserved transcription factor and expressed in the TE layers
within the developing blastocyst of multiple mammalian embryos (Home et al., 2012), we asked whether
TEAD4 localization to the mitochondria is a conserved event in trophoblast progenitors of other
mammalian species. To test this, we studied RCHO-1 trophoblast cells, which represent the rat
trophoblast stem cell state (Sahgal et al., 2006). We also studied primary cytotrophoblasts (hCTB) cells of
first-trimester human placenta, which are considered as human trophoblast progenitors (Genbacev et al.,
2016, Zdravkovic et al., 2015, Knofler and Pollheimer, 2013) and depends on OXPHOS for ATP
production (Maloyan et al., 2012). We observed mitochondrial localization of TEAD4 in both RCHO1 and
human first-trimester CTB cells (Fig. S5A-B). Furthermore, ChIP analyses with isolated mitochondria from
RCHO-1 confirmed TEAD4 binding to the mtDNA (Fig. S5C-D). Our results from mouse TSC, rat RCHO-1
and human CTB indicated TEAD4 localization to mitochondria and binding to mtDNA is a conserved
event in mammalian trophoblast progenitors.
Two findings that TEAD4 binds at the mtDNA (Fig. 5D) and loss of TEAD4 leads to loss of
POLRMT recruitment and mtDNA transcription in mouse TSCs, indicated that TEAD4 could be a part of
the mitochondrial transcriptional machinery in mouse TSCs and could directly regulate POLRMT binding
to the mtDNA. Therefore, we next asked whether TEAD4 interacts with POLRMT on the mtDNA. We
performed a sequential ChIP assay (SeqChIP) with isolated mitochondria from mouse TSCs and
confirmed a TEAD4 and POLRMT interaction on mtDNA (Figure 5F). Collectively, these results indicated
that endogenous TEAD4 facilitates mtDNA transcription in mouse TSCs by directly facilitating POLRMT
recruitment to the mtDNA.
We also tested whether loss of TEAD4 affects mtDNA replication in mouse TSCs. The mtDNA
replication is not primed by dedicated primases. Rather, processed mtRNA transcripts, synthesized by
POLRMT serve as primer for mtDNA replication. It has been show that loss of different factors that control
mtDNA transcription leads to varying outcome on mtDNA replication. inhibition of mtDNA transcription
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 12: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/12.jpg)
could be associated with either enhanced mtDNA replication or inhibition of mtDNA replication. For
example, loss of TFAM is shown to reduce both mtDNA transcript levels and inhibits mtDNA replication in
multiple cellular contexts (Wang et al., 1999, Li et al., 2000, Kang et al., 2007). In contrast, loss of
elongation factor TEFM in mammalian cells reduces promoter-distal mtDNA transcripts, but does not
have significant effect on mtDNA replication (Minczuk et al., 2011). So, we tested whether loss of TEAD4
alters mtDNA copy numbers in mouse TSCs. However, in our experimental conditions, we did not notice
any significant alteration of mtDNA copy numbers when TEAD4 is depleted in mouse TSCs (Figure 5G),
indicating that TEAD4 mediated regulation of mtDNA transcription might not be associated with mtDNA
replication process.
Loss of Tead4 impairs POLRMT recruitment and mtDNA transcription in developing pre-
implantation embryo:
Establishment of mitochondrial oxidative phosphorylation in the TE lineage is essential for
blastocyst maturation. Therefore, we asked whether development of the TE lineage is associated with
enhanced mtDNA transcription. We performed blastocyst microsurgery of mouse blastocysts to isolate TE
cells (Fig. 6A) and performed immunosurgery (Saha et al., 2013) to isolate ICM cells from mouse
blastocysts and confirmed higher RNA expressions of mtDNA-encoded genes in TE lineage cells (Fig.
6A-B). Like mTSC and hCTB, TEAD4 also localized within mitochondria in the TE of developing
blastocyst (Fig. 6C).
As we found that TEAD4 co-localizes with POLRMT on mtDNA and is required for optimum
POLRMT recruitment at the mtDNA-encoded ETC genes in mTSCs, we tested whether a similar event is
associated with mtDNA transcription during mouse blastocyst development. We performed sequential
ChIP (SeqChIP) with blastocysts and confirmed a TEAD4 and POLRMT interaction on the same mtDNA
regions in mouse blastocyst (Fig. 6D-E). Second, we performed co-immunoprecipitation analyses with
isolated mitochondrial protein from trophoblast progenitor/stem cells of developing mouse placentas. We
chose to perform this experiment in trophoblast progenitor/stem cells as we found that it is technically
challenging to isolate mitochondria and perform co-immunoprecipitation analyses with limited amount of
cells from the TE of mouse blastocysts. Co-immunoprecipitation experiment confirmed that endogenous
TEAD4 physically interacts with endogenous POLRMT in mitochondria of mouse trophoblast progenitors
(Fig. 6F). We also observed a similar interaction in mouse TSC (data not shown). Collectively, our results
indicated that, similar to that in mouse TSCs, a TEAD4-dependent mechanism could regulate POLRMT
binding to the mtDNA and mitochondrial transcription in TE cells during blastocyst maturation. Therefore,
we utilized a Tead4 conditional knockout sysytem (Tead4F/F/UBC-CreERT2 mice) to delete Tead4 in mouse
embryos (Yagi et al., 2007) and tested its importance in mtDNA transcription and expression of mtDNA-
encoded genes during preimplantation development.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 13: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/13.jpg)
We isolated pre-implantation embryos from Tead4F/F/UBC-CreERT2 mice, treated with 4(OH)
tamoxifen (MHT) to delete Tead4 floxed alleles, and cultured them ex-vivo (Fig. 7A). Interestingly, we
noticed conditional deletion of Tead4 floxed alleles resulted in mixed phenotype (Fig. S6A) as compared
to that of wild-type embryos cultured under similar ex-vivo conditions (Fig. 6D) or Tead4F/F embryos (Fig.
7A, embryo1 and Fig. S6, embryo 1). Several Tead4-deleted embryos failed to mature to the blastocyst
stage even when they were cultured at 5% O2 level and several embryos that matured to the blastocyst
stage showed presence of very small blastocoel cavity (Fig. S6, embryos 2 and 3). Also, several
embryos that matured to the blastocyst stage showed partial presence of the Tead4-floxed alleles even
after MHT treatment, reflecting inefficient cre-mediated recombination efficiency of Tead4-floxed alleles
(Fig. S6B) in those embryos. These results indicated that incomplete deletion of the TEAD4 floxed allele
could lead to mixed phenotype in Tead4-conditional knockout system. To avoid these ambiguities, we
used higher concentration (1.5 µM instead of 1µM) of MHT and cultured embryos in a condition that
mimics the in-vivo condition as proposed by Kaneko et al. (Kaneko and DePamphilis, 2013). We noticed
that these experimental modifications ensured efficient cre-mediated excision of Tead4 floxed alleles and
resulted in impaired blastocyst maturation (Fig. 7A). However, these conditions did not affect maturation
of embryos that lacked Cre expression.
We tested RNA expression of mtDNA-encoded ETC components in TEAD4-null (knock-out) embryos,
which failed to mature to the blastocyst stage. Our analyses confirmed loss of Tead4 mRNA expression
as well as inhibition of mtDNA transcription upon deletion of Tead4 floxed alleles (Fig. 7B-D).
Furthermore, ChIP analyses confirmed a strong loss of POLRMT binding to the mtDNA in TEAD4 null
embryos (Fig. 7E-F). Interestingly, we also noticed significant reduction of mtDNA copy number in TEAD4
null embryos (Fig. 7G), a result that differs from the observation inTEAD4-depleted mouse TSCs, in which
loss of TEAD4 does not alter mtDNA copy number. However, during pre-implantation development, the
first mtDNA replication event is initiated at the blastocyst stage (Thundathil et al., 2005) due to up-
regulated expression of the catalytic subunit of mitochondria DNA polymerase gamma (POLGA) in the TE
lineage (Thundathil et al., 2005, Kelly et al., 2012). As TE development and blastocyst maturation is
impaired in TEAD4-null embryos, it is possible that the reduced mtDNA copy number in TEAD4-null
embryos is due to impaired activation of the replication machinery.
Nevertheless, collectively our results indicated that TEAD4 facilitates POLRMT recruitment and
enhances mtDNA transcription during pre-implantation development. We propose that this mitochondrion
associated function of TEAD4 ensure optimal expression of mtDNA-encoded ETC components in TE cells
(as presented in Fig. 7H) and promotes mitochondrial energy metabolism, which is essential for
blastocyst maturation.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 14: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/14.jpg)
DISCUSSION
Over the years, numerous studies implicated mitochondrial regulation in successful embryonic
development. These studies noted dynamic changes in cellular metabolism as well as mitochondrial
structure, rearrangement and function during the course of pre-implantation development (Wilding et al.,
2009, Houghton, 2006). However, almost nothing is known about molecular control of mtDNA
transcription in the context of extraembryonic TE/trophoblast lineage development. In this study, we show
that a TEAD4-dependent molecular mechanism is critical to optimize mtDNA transcription in the TE and
TE-derived TSCs. Our findings are consistent with previous reports that TEAD4 localizes to both
cytoplasm and nuclei in the developing TE lineage and is essential for blastocyst maturation (Kaneko and
DePamphilis, 2013, Home et al., 2012).
TEAD4 and Mitochondrial Energy Metabolism:
Previous work identified the essential role of TEAD4 in early mouse embryogenesis (Hirate et al.,
2012, Home et al., 2012, Kaneko and DePamphilis, 2013, Nishioka et al., 2008, Ralston et al., 2010, Yagi
et al., 2007, Mihajlovic et al., 2015), and we and others showed that TEAD4 directly regulates
transcription of key TE-specific nuclear encoded genes in the TE and TSCs (Ralston et al., 2010, Home
et al., 2012). These findings implicated the importance of TEAD4 in establishment of the TE-specific
transcriptional program. TEAD4 is a nucleo-cytoplasmic transcription factor and ectopic overexpression
studies by Kaneko et al., showed that, among all TEAD family members, TEAD4 has the unique ability to
localize to the mitochondria (Kaneko and DePamphilis, 2013). Also, conditional gene deletion studies by
Kaneko et al. showed that TEAD4-null pre-implantation embryos are defective of mitochondrial function.
Therefore, it was proposed that establishment of energy homeostasis rather than establishment of TE-
specific gene expression could be the main function of TEAD4 during early mammalian development.
However, there exist discrepancies in different studies with different experimental approaches. All studies
that utilized the RNAi to deplete TEAD4 (Home et al., 2012, Mihajlovic et al., 2015, Wu et al., 2010,
Alarcon, 2010) in pre-implantation embryos resulted in impairment of blastocyst maturation and loss of
TE-specific factors upon TEAD4 depletion. Whereas, variable results are obtained with Tead4 conditional
knockout systems. Some studies reported impaired blastocyst development and strong loss of TE-specific
genes upon Tead4-deletion (Nishioka et al., 2008, Yagi et al., 2007). Whereas Kaneko et al., showed that
the blastocyst maturation in Tead4-deleted embryos is dependent upon exposure to the oxygen level,
when cultured ex-vivo. The study also showed heterogeneity in TE-specific gene expression in Tead4 null
embryos. However, our findings of the variation of the cre-mediated recombination efficiency in TEAD4-
conditional knockout system indicates that further studies are needed to make definitive conclusions
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 15: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/15.jpg)
about the importance of TEAD4 in establishing the TE-specific transcriptional program. Nevertheless, the
fact that endogenous TEAD4 migrates to mitochondria in the TE and TSCs and regulates mtDNA
transcription further support the hypothesis that TEAD4 is a critical regulator of mitochondrial function in
early mammalian embryos. Most probably during the initiation of blastocoel cavity formation, TEAD4
localization within mitochondria in nascent TE cells and facilitates POLRMT recruitment at the mtDNA,
This results in induced expression of mtDNA encoded ETC complex components, which are required to
establish OXPHOS to meet the excessive requirement of ATP in TE cells (Fig. 7G).
Interestingly, TEAD4 is also expressed in the ICM and ICM-derived ESCs and are present in the
cytoplasm of those cells (Home et al., 2012). However, TEAD4 function in those cells is yet to be defined.
Although ICM and ESCs utilize non-oxidative energy metabolism matured mitochondria exist in those
cells (Mahato et al., 2014, Leese and Barton, 1984, Mognetti et al., 1996). Furthermore, studies in mouse
ESCs revealed that those mitochondria could mediate oxidative phosphorylation in ESCs, resulting in a
mixed energy metabolism system (Carbognin et al., 2016). Compared to the TE and TSCs, TEAD4
expressions in ICM and ESCs are significantly low. Thus, reduced expression level might lead to less
TEAD4 localization in the mitochondria of those cells leading to inefficient mtDNA transcription,
mitochondrial maturation and establishment of oxidative phosphorylation. Alternatively, inefficiency of
cellular processes that regulate TEAD4 localization to mitochondria could lead to defective mtDNA
transcription in those cells. Nevertheless, it will be interesting to test whether a TEAD4 function is also
important to promote mitochondrial maturation and oxidative phosphorylation in those contexts.
Our findings also raise at least two questions; (i) what mechanisms regulate TEAD4 localization
to the mitochondria? and (ii) whether TEAD4 regulates mtDNA transcription in other cell types. It is well
known that cellular signaling mechanisms differ in TE vs. ICM lineage cells. Also, TEAD4 is expressed in
multiple other cell types including endothelial cells and several cancer cells. Thus, defining signaling
mechanisms that regulate TEAD4 localization to mitochondria and testing TEAD4-mediated regulation of
mtDNA transcription in other cellular contexts are important areas of further study.
TE/Trophoblast Lineage and mitochondrial regulation:
Mammalian reproduction is critically dependent on trophoblast cells, which assure embryo
implantation and placentation. Specification of the TE in a preimplantation embryo initiates trophoblast
lineage development. After implantation of the blastocyst, the polar TE cells form the extraembryonic
ectoderm and its derivatives: the ectoplacental cone (EPC) and the chorionic ectoderm (chorion). The
EPC and chorion contain trophoblast stem and progenitor cells (TSPCs), which generate diverse
trophoblast cell types that are essential for establishing successful pregnancy. Improper development in
TE/trophoblast leads to either pregnancy failure, or pregnancy-associated complications like intrauterine
growth retardation and preeclampsia. Despite of this importance of trophoblast cell lineage, our
understanding of mitochondrial regulation and energy metabolism in trophoblast cells is extremely poor.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 16: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/16.jpg)
For example, molecular mechanisms that regulate TE and trophoblast development largely came from
studies with TSCs. However, prior to this study, metabolic preferences in TSCs were never tested. Our
finding that TSCs rely on oxidative energy metabolism makes them unique from ESCs and epiblast stem
cells (Choi et al., 2015), which rely on glycolytic mechanisms for ATP production. During early stages of
placenta development, TSPCs undergo extensive proliferation and differentiation in an environment that
is associated with dynamic changes in oxygen tension. Thus, it is predictive that TSPC proliferation vs.
differentiation is associated with fine-tuning of mitochondrial energy metabolism. Also, multiple studies
indicated that mitochondrial dysfunction in trophoblast cells is associated with pregnancy-associated
pathological conditions (Shi et al., 2013, Wang and Walsh, 1998, Widschwendter et al., 1998, Xie et al.,
2014). However, at this moment, it is unknown to us whether or not primary TSPCs within
postimplantation mammalian embryos also rely on mitochondrial energy metabolism. Given the
conserved nature of TEAD4 expression in the developing trophoblast lineage, it will be interesting to
study the importance of TEAD4 in mitochondrial energy metabolism in TSPCs of a postimplantation
mammalian embryo.
MATERIALS AND METHODS
Cell culture and reagents:
Mouse TSCs were derived following previously described procedures. Mouse TSCs were cultured on
irradiated MEFs to TSC culture medium supplemented with 20% fetal bovine serum 100 μM β-
mercaptoethanol, 1 mM sodium pyruvate, 2 mM L-glutamine, primocin 1ug/ml) in the presence of 25
ng/ml fibroblast growth factor 4 and 1 μg/ml heparin as described earlier (Home et al., 2012). Mouse
ESCs were cultured in ESC stem state culture conditions as previously described (Mahato et al., 2014).
For experimental purposes, mouse TSCs were expanded in the proliferative state without MEF feeders by
culturing in the presence of MEF-conditioned medium. RCHO-1 cells were cultured similar to TSC
without CM, FGF4 and heparin (Sahgal et al., 2006). Human primary CTB cells were isolated from first
trimester placenta and cultured in hypoxia chamber as described earlier (Douglas and King, 1989, Kliman
et al., 1986, Knofler and Pollheimer, 2013).
Mouse embryos:
Tead4f/f; UBC-cre/ERT2 female mice were super ovulated, mated with the same genotype males to collect
one-cell embryos as described earlier (Saha et al., 2013). The embryos were cultured in KSOM (Millipore)
with and without MHT (Sigma Cat. H7904) at 37°C in a 5% CO2 incubator at 5% oxygen. Embryos were
collected for RNA and chromatin preparation at the blastocyst stage. RNA prepared from individual
blastocyst was used to make cDNA. cDNA were amplified using WGA4 kit (Sigma Cat. WGA4-10RXN)
and subsequently used for genotyping and transcript analysis.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 17: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/17.jpg)
Isolation of ICMs and TEs from blastocysts:
ICMs were isolated by embryo immunosurgery and TE samples were isolated after micro dissection
according to the method described earlier (Saha et al., 2013, Home et al., 2009). Purified ICM cells and
TE samples were further processed for generating samples for either ChIP-WGA or extraction of RNA.
Complex I and complex IV assay:
Complex I and IV activity were determined using Complex I Enzyme Activity Dipstick Assay Kit
(ab109720) and Complex IV Rodent Enzyme Activity Dipstick Assay Kit (ab109878), respectively as per
vendor’s prescription. Band Intensity was measured using ImageJ.
Oxygen Consumption Rate (OCR) and Extracellular Acidification Rate (ECAR) Measurements:
OCR and ECAR were determined by XF cell mito-stress test kit (#101706-100, Seahorse Biosciences)
and XF Glycolysis stress test kit (#102194-100, Seahorse Biosciences) as described previously (Zhou et
al., 2012, Mahato et al., 2014). ECAR and OCR values were normalized against total protein per well.
Immunohistochemistry and microscopy:
Cells were grown on cover slip and processed for immunofluorescence following protocol published
earlier (Home et al., 2012, Mahato et al., 2014). For live cell microscopy cells and embryos at blastocyst
stage were stained with MitoSox red (Cat# M-36008), JC-1 (Cat# M34152) or MitoTracker Green (Cat#
M-7514) from Molecular probes along with Hoechst dye for nuclear staining. Confocal microscopy was
performed on cells using Zeiss LSM PASCAL. All antibodies are listed in Table S2.
TEM protocol for routine morphology and Immunogold:
Samples were fixed in 2% glutaraldehyde and followed the protocol published earlier (Mahato et al.,
2014). For immunogold, samples were fixed with 4% paraformaldehyde and following published protocol
samples were examined in a J.E.O.L. JEM 1400 transmission electron microscope.
RNA Interference:
For RNA Interference, shRNAs against Tead4 and Yap1 were cloned in pLKO.1 lentiviral vectors
following protocols, described (Home et al., 2012). Tead4 target sequence: ‘5
GCTGAAACACTTACCCGAGAA-3’ and Yap1 target sequence 5’- GCAGACAGATTCCTTTGTTAACT-3’
were used. We used scramble shRNA as a negative control (Addgene plasmid Plasmid #1864). After
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 18: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/18.jpg)
culturing, samples were prepared for mRNA and protein analysis. For rescue of TEAD4 function in
TEAD4KD TSCs, a modified TEAD4 protein with a mitochondrial targeting sequence (MTS) from subunit
VIII of human cytochrome c oxidase was ectopically expressed. The MTS sequence was cloned
upstream of mouse Tead4 cDNA in the vector pLKO.Tead4-T2A-GFP by Gibson assembly (Jo et al.,
2015, Home et al., 2012). The targeting sequence is as follows: 5’-
ATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTG
CCGCGCGCCAAGATCCATTCGTTG-3”. Ectopic TEAD4 expression was confirmed via western blot.
Electrophoretic Mobility Shift Assay:
The mtND1 200bp PCR fragment was purified after PCR using hot radioactive P32 dATP. For gel shift,
radiolabeled DNA was incubated with mTSC extract for 30 min in 25 mm HEPES, pH 7.6, 100 mm NaCl,
1 mm DTT, 0.1 mm PMSF, 10% glycerol, 10 μg tRNA, and 0.5 μg poly(dI.dC) at room temperature
following published protocol (Kumar et al., 2013). For super-shift, equal amounts of TEAD4 antibody or
IgG were included in the incubation mix. The mixture was then separated on 4% PAGE (79:1 of
acrylamide:bisacrylamide) containing 2.5% glycerol. The gel was autoradiographed after drying.
Mitochondria purification, sub-fractionation and Immunoprecipitation (IP):
In brief, 20x106 cells were used to isolate mitochondria using mitochondria Isolation Kit for cultured cells
(Cat # 89874, Thermo Scientific). The homogenate was centrifuged twice at 900 × g for 5 min to remove
nuclei and unbroken cells (cell lysate) and then the supernatant was centrifuged 3,000 × g for 15 min. The
resultant pellet was used for the purer mitochondrial fraction for western analysis. Mitochondrial sub-
fractionation was performed following published protocols after mitochondria purification (She et al.,
2011). For IP, mitochondrial fraction was prepared from 10.5e placentae or mTSC by simply incubating
cell lysis buffer from the published protocol (Home et al., 2012). The cell lysate was centrifuged twice at
900 × g for 5 min to remove nuclei and unbroken cells and then the supernatant was centrifuged
3,000 × g for 15 min. The resultant pellet was resuspended in buffer similar to IP conditions used for
ChIP. The immunoprecipitated with different antibodies were directly boiled in protein sample preparation
buffer and used for the western analysis.
Chromatin Immunoprecipitation (ChIP) and Sequential ChIP:
Quantitative ChIP analysis was performed following published protocols (Home et al., 2012, Ray et al.,
2009b). In brief, 20x106 cells were used to isolate mitochondria using mitochondria isolation kit for
cultured cells. Protein-DNA complexes were cross-linked by incubating with 1% formaldehyde (Sigma) for
2 hours at 4°C temperature with gentle rotation (Kucej et al., 2008). Chromatin crosslinking was stopped
by adding glycine (125mM) to the reaction mix. These samples were sonicated. Cross-linked chromatin
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 19: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/19.jpg)
fragments were immunoprecipitated with different antibodies. Quantification of the precipitated DNA was
performed using quantitative PCR (qPCR) amplification. A list of the primers used for ChIP analyses is
provided in Table S3 in the supplemental material. For sequential ChIP, cross-linked chromatin fragment
prepared from isolated mitochondria was immunoprecipitated with antibody rabbit anti-mtRNA
polymerase. Eluted chromatin was re-incubated with mouse anti-Tead4 and mouse IgG1 for overnight at
4°C in the presence of 50 μg/ml yeast tRNA (Dutta et al., 2010). ChIP and SeqChIP on pre-implantation
mouse blastocyst embryo were performed previously described (Saha et al., 2013). Immunoprecipitated
chromatins were purified using Qiagen Kit and amplified using WGA4 kit. Amplified DNA was used for
target validation analysis. All the samples were normalized to their respective IgG controls for each cell
types.
Quantitative RT-PCR:
Total RNA from cells was prepared using RNeasy (Qiagen) Kit following DNAse1 digestion. Purified RNA
was used to prepare cDNA using cDNA preparation kit. For analysis of expression in blastocyst embryos,
total RNA was isolated using PicoPure RNA isolation kit (MDS Analytical Technology, Sunnyvale, CA)
and processed as described earlier (Home et al., 2009). All these samples were analyzed by qRT-PCR
using ABI7500. The oligonucleotides used for qRT-PCR are provided in Table S3 in the supplemental
material. All the samples were normalized to their respective 18S RNA controls for each cell types.
Nascent transcript assay:
Total RNA from cells was prepared as described above. Before preparing cDNA, the nascent RNA was
biotin labeled and purified from total RNA (Molecular Probes: Click-iT® Nascent RNA Capture Kit (C-
10365)). After purification of Nascent RNA, the residual RNA was precipitated using glycogen and
ethanol. Purified RNA was used to prepare cDNA-using cDNA synthesis kit. All these samples were
analyzed by qRT-PCR. The oligonucleotides used for qRT-PCR are provided in Table S3 in the
supplemental material.
Quantitation of mtDNA copy number
The number of mtDNA copies per cell was determined using real-time PCR absolute quantification. For
absolute quantitation, fragments of mouse mtND2 gene and 2 microglobulin gene were cloned in pCR TM
2.1 plasmid vector and number of mtND2 and 2 microglobulin genes in a sample were measured by
quantitated against a standard curve of known amount of plasmid vectors. The number of mtDNA copies
per cell was calculated using the following formula: mtDNA copy number/cell = 2x (copies of mtND2
gene/copies of 2 microglobulin gene).
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 20: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/20.jpg)
Genotyping
Genomic DNA was prepared using tail tissue from mouse using REDExtract-N-Amp Tissue PCR kit
(Sigma-Aldrich). Genotyping was done using REDExtract-N-Amp PCR ReadyMix (Sigma-Aldrich) and
respective primers. Respective primers are listed Table S3 in the supplemental material. Genomic DNA
from individual blastocysts was prepared by the following technique using REDExtract-N-Amp Tissue
PCR kit (Sigma-Aldrich). Each blastocyst was collected into separate PCR tubes and was lysed with 16µl
of Extraction buffer and 4µl of Tissue Prep buffer. Briefly, they were incubated at 42ºC for 10 mins
followed by heat inactivation at 98ºC for 3 mins and neutralization with 16µl of Neutralization buffer. 4µl of
this genomic DNA was used for a 20µl PCR reaction.
Statistical significance:
Statistical significance for experimental data was analyzed using Student’s paired t-test. Although in few
figures studies from multiple groups are presented, the statistical significance were tested by comparing
data of two groups and significantly altered values (p≤0.05) between control and TEAD4-delpeted
conditions are highlighted in figures.
ETHICAL ASPECT
This project proposal involves usage of mice and mouse embryos as the vertebrate animal model.
Experiments have been designed taking into consideration of all the rules and regulations of the
Institutional Animal Care and Use committee.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 21: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/21.jpg)
ACKNOWLEDGEMENT
Financial support: This work was supported by NIH research grants HD062546, HD079363, and NIH
COBRE grant GM104936. We would like to thank Jackson laboratory for providing mice. We would like to
thank Michael J Soares from KUMC for providing rat RCHO-1 cells. We would like to thank Sumedha
Gunewardena from KUMC for TEAD4 motif analysis. We would like to thank KUMC Electron Microscopy
Research Lab (EMRL) facility for assistance with the electron microscopy. The JEOL JEM-1400 TEM
used in the study was purchased with funds from NIH grant S10RR027564. We would like to thank
Melissa Larson from KUMC transgenic core facility for assistance with the mouse blastocyst isolation,
microsurgery and in vitro culture. We thank Drs. Inge Kühl and Nils-Göran Larsson from Max-Planck-
Institute for Biology of Ageing for providing anti mouse POLRMT antibody and valuable comments.
CONTRIBUTIONS
SP and RPK conceived and designed the experiments: RPK performed all the experiments, SR from SP
lab performed mitochondrial subfractionation, mitochondrial Tead4 rescue and EMSA, PH from SP lab
cloned MTS-Tead4 construct, HW from RHS lab, HC from PK lab, B. B. from SP lab helped in
mitochondrial function assay, BS, AG, AP from SP lab helped in maintaining mouse, SP and RPK wrote
the manuscript and JMF from SP lab helped in manuscript editing.
CONFLICT OF INTEREST
The authors declare no conflict of interests.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 22: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/22.jpg)
REFERENCES
ALARCON, V. B. 2010. Cell polarity regulator PARD6B is essential for trophectoderm formation in the preimplantation mouse embryo. Biol Reprod, 83, 347-58.
BOGENHAGEN, D. F. 2012. Mitochondrial DNA nucleoid structure. Biochim Biophys Acta, 1819, 914-20.
BURGLIN, T. R. 1991. The TEA domain: a novel, highly conserved DNA-binding motif. Cell, 66, 11-2.
CARBOGNIN, E., BETTO, R. M., SORIANO, M. E., SMITH, A. G. & MARTELLO, G. 2016. Stat3 promotes mitochondrial transcription and oxidative respiration during maintenance and induction of naive pluripotency. EMBO J, 35, 618-34.
CHEN, H., DETMER, S. A., EWALD, A. J., GRIFFIN, E. E., FRASER, S. E. & CHAN, D. C. 2003. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J Cell Biol, 160, 189-200.
CHOI, H. W., KIM, J. H., CHUNG, M. K., HONG, Y. J., JANG, H. S., SEO, B. J., JUNG, T. H., KIM, J. S., CHUNG, H. M., BYUN, S. J., HAN, S. G., SEO, H. G. & DO, J. T. 2015. Mitochondrial and metabolic remodeling during reprogramming and differentiation of the reprogrammed cells. Stem Cells Dev, 24, 1366-73.
CHUJO, T., OHIRA, T., SAKAGUCHI, Y., GOSHIMA, N., NOMURA, N., NAGAO, A. & SUZUKI, T. 2012. LRPPRC/SLIRP suppresses PNPase-mediated mRNA decay and promotes polyadenylation in human mitochondria. Nucleic Acids Res, 40, 8033-47.
COCKBURN, K. & ROSSANT, J. 2010. Making the blastocyst: lessons from the mouse. J Clin Invest, 120, 995-1003.
DOUGLAS, G. C. & KING, B. F. 1989. Isolation of pure villous cytotrophoblast from term human placenta using immunomagnetic microspheres. J Immunol Methods, 119, 259-68.
DUTTA, D., RAY, S., HOME, P., SAHA, B., WANG, S., SHEIBANI, N., TAWFIK, O., CHENG, N. & PAUL, S. 2010. Regulation of angiogenesis by histone chaperone HIRA-mediated incorporation of lysine 56-acetylated histone H3.3 at chromatin domains of endothelial genes. J Biol Chem, 285, 41567-77.
FALKENBERG, M., GASPARI, M., RANTANEN, A., TRIFUNOVIC, A., LARSSON, N. G. & GUSTAFSSON, C. M. 2002. Mitochondrial transcription factors B1 and B2 activate transcription of human mtDNA. Nat Genet, 31, 289-94.
FRUM, T. & RALSTON, A. 2015. Cell signaling and transcription factors regulating cell fate during formation of the mouse blastocyst. Trends Genet, 31, 402-10.
GARCIA-OSPINA, G. P., JIMENEZ-DEL RIO, M., LOPERA, F. & VELEZ-PARDO, C. 2003. [Neuronal DNA damage correlates with a positive detection of c-Jun, nuclear factor kB, p53 and Par-4 transcription factors in Alzheimer's disease]. Rev Neurol, 36, 1004-10.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 23: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/23.jpg)
GASPARI, M., FALKENBERG, M., LARSSON, N. G. & GUSTAFSSON, C. M. 2004. The mitochondrial RNA polymerase contributes critically to promoter specificity in mammalian cells. EMBO J, 23, 4606-14.
GENBACEV, O., LAROCQUE, N., ONA, K., PRAKOBPHOL, A., GARRIDO-GOMEZ, T., KAPIDZIC, M., BARCENA, A., GORMLEY, M. & FISHER, S. J. 2016. Integrin alpha4-positive human trophoblast progenitors: functional characterization and transcriptional regulation. Hum Reprod, 31, 1300-14.
GUSTAFSSON, C. M., FALKENBERG, M. & LARSSON, N. G. 2016. Maintenance and Expression of Mammalian Mitochondrial DNA. Annu Rev Biochem, 85, 133-60.
HILLEN, H. S., MOROZOV, Y. I., SARFALLAH, A., TEMIAKOV, D. & CRAMER, P. 2017. Structural Basis of Mitochondrial Transcription Initiation. Cell, 171, 1072-1081 e10.
HIRATE, Y., COCKBURN, K., ROSSANT, J. & SASAKI, H. 2012. Tead4 is constitutively nuclear, while nuclear vs. cytoplasmic Yap distribution is regulated in preimplantation mouse embryos. Proc Natl Acad Sci U S A, 109, E3389-90; author reply E3391-2.
HOME, P., RAY, S., DUTTA, D., BRONSHTEYN, I., LARSON, M. & PAUL, S. 2009. GATA3 is selectively expressed in the trophectoderm of peri-implantation embryo and directly regulates Cdx2 gene expression. J Biol Chem, 284, 28729-37.
HOME, P., SAHA, B., RAY, S., DUTTA, D., GUNEWARDENA, S., YOO, B., PAL, A., VIVIAN, J. L., LARSON, M., PETROFF, M., GALLAGHER, P. G., SCHULZ, V. P., WHITE, K. L., GOLOS, T. G., BEHR, B. & PAUL, S. 2012. Altered subcellular localization of transcription factor TEAD4 regulates first mammalian cell lineage commitment. Proc Natl Acad Sci U S A, 109, 7362-7.
HOUGHTON, F. D. 2006. Energy metabolism of the inner cell mass and trophectoderm of the mouse blastocyst. Differentiation, 74, 11-8.
ITO, K. & SUDA, T. 2014. Metabolic requirements for the maintenance of self-renewing stem cells. Nat Rev Mol Cell Biol, 15, 243-56.
JO, A., HAM, S., LEE, G. H., LEE, Y. I., KIM, S., LEE, Y. S., SHIN, J. H. & LEE, Y. 2015. Efficient Mitochondrial Genome Editing by CRISPR/Cas9. Biomed Res Int, 2015, 305716.
KANEKO, K. J. & DEPAMPHILIS, M. L. 1998. Regulation of gene expression at the beginning of mammalian development and the TEAD family of transcription factors. Dev Genet, 22, 43-55.
KANEKO, K. J. & DEPAMPHILIS, M. L. 2013. TEAD4 establishes the energy homeostasis essential for blastocoel formation. Development, 140, 3680-90.
KANG, D., KIM, S. H. & HAMASAKI, N. 2007. Mitochondrial transcription factor A (TFAM): roles in maintenance of mtDNA and cellular functions. Mitochondrion, 7, 39-44.
KELLY, R. D., MAHMUD, A., MCKENZIE, M., TROUNCE, I. A. & ST JOHN, J. C. 2012. Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 24: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/24.jpg)
methylation of the nuclear-encoded DNA polymerase gamma A. Nucleic Acids Res, 40, 10124-38.
KLIMAN, H. J., NESTLER, J. E., SERMASI, E., SANGER, J. M. & STRAUSS, J. F., 3RD 1986. Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology, 118, 1567-82.
KNOFLER, M. & POLLHEIMER, J. 2013. Human placental trophoblast invasion and differentiation: a particular focus on Wnt signaling. Front Genet, 4, 190.
KNOTT, J. G. & PAUL, S. 2014. Transcriptional regulators of the trophoblast lineage in mammals with hemochorial placentation. Reproduction, 148, 14-0072.
KUCEJ, M., KUCEJOVA, B., SUBRAMANIAN, R., CHEN, X. J. & BUTOW, R. A. 2008. Mitochondrial nucleoids undergo remodeling in response to metabolic cues. J Cell Sci, 121, 1861-8.
KUHL, I., MIRANDA, M., POSSE, V., MILENKOVIC, D., MOURIER, A., SIIRA, S. J., BONEKAMP, N. A., NEUMANN, U., FILIPOVSKA, A., POLOSA, P. L., GUSTAFSSON, C. M. & LARSSON, N. G. 2016. POLRMT regulates the switch between replication primer formation and gene expression of mammalian mtDNA. Sci Adv, 2, e1600963.
KUKAT, C., DAVIES, K. M., WURM, C. A., SPAHR, H., BONEKAMP, N. A., KUHL, I., JOOS, F., POLOSA, P. L., PARK, C. B., POSSE, V., FALKENBERG, M., JAKOBS, S., KUHLBRANDT, W. & LARSSON, N. G. 2015. Cross-strand binding of TFAM to a single mtDNA molecule forms the mitochondrial nucleoid. Proc Natl Acad Sci U S A, 112, 11288-93.
KUKAT, C. & LARSSON, N. G. 2013. mtDNA makes a U-turn for the mitochondrial nucleoid. Trends Cell Biol, 23, 457-63.
KUMAR, R. P., KRISHNAN, J., PRATAP SINGH, N., SINGH, L. & MISHRA, R. K. 2013. GATA simple sequence repeats function as enhancer blocker boundaries. Nat Commun, 4, 1844.
LAMBERTINI, E., PENOLAZZI, L., MORGANTI, C., LISIGNOLI, G., ZINI, N., ANGELOZZI, M., BONORA, M., FERRONI, L., PINTON, P., ZAVAN, B. & PIVA, R. 2015. Osteogenic differentiation of human MSCs: Specific occupancy of the mitochondrial DNA by NFATc1 transcription factor. Int J Biochem Cell Biol, 64, 212-9.
LARSSON, N. G., WANG, J., WILHELMSSON, H., OLDFORS, A., RUSTIN, P., LEWANDOSKI, M., BARSH, G. S. & CLAYTON, D. A. 1998. Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat Genet, 18, 231-6.
LEE, J., KIM, C. H., SIMON, D. K., AMINOVA, L. R., ANDREYEV, A. Y., KUSHNAREVA, Y. E., MURPHY, A. N., LONZE, B. E., KIM, K. S., GINTY, D. D., FERRANTE, R. J., RYU, H. & RATAN, R. R. 2005. Mitochondrial cyclic AMP response element-binding protein (CREB) mediates mitochondrial gene expression and neuronal survival. J Biol Chem, 280, 40398-401.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 25: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/25.jpg)
LEESE, H. J. & BARTON, A. M. 1984. Pyruvate and glucose uptake by mouse ova and preimplantation embryos. J Reprod Fertil, 72, 9-13.
LEPPENS, G., GARDNER, D. K. & SAKKAS, D. 1996. Co-culture of 1-cell outbred mouse embryos on bovine kidney epithelial cells: effect on development, glycolytic activity, inner cell mass:trophectoderm ratios and viability. Hum Reprod, 11, 598-603.
LI, H., WANG, J., WILHELMSSON, H., HANSSON, A., THOREN, P., DUFFY, J., RUSTIN, P. & LARSSON, N. G. 2000. Genetic modification of survival in tissue-specific knockout mice with mitochondrial cardiomyopathy. Proc Natl Acad Sci U S A, 97, 3467-72.
MACIAS, E., RAO, D., CARBAJAL, S., KIGUCHI, K. & DIGIOVANNI, J. 2014. Stat3 binds to mtDNA and regulates mitochondrial gene expression in keratinocytes. J Invest Dermatol, 134, 1971-1980.
MAHATO, B., HOME, P., RAJENDRAN, G., PAUL, A., SAHA, B., GANGULY, A., RAY, S., ROY, N., SWERDLOW, R. H. & PAUL, S. 2014. Regulation of mitochondrial function and cellular energy metabolism by protein kinase C-lambda/iota: a novel mode of balancing pluripotency. Stem Cells, 32, 2880-92.
MALOYAN, A., MELE, J., MURALIMANOHARA, B. & MYATT, L. 2012. Measurement of mitochondrial respiration in trophoblast culture. Placenta, 33, 456-8.
MEIER, J. A. & LARNER, A. C. 2014. Toward a new STATe: the role of STATs in mitochondrial function. Semin Immunol, 26, 20-8.
METODIEV, M. D., LESKO, N., PARK, C. B., CAMARA, Y., SHI, Y., WIBOM, R., HULTENBY, K., GUSTAFSSON, C. M. & LARSSON, N. G. 2009. Methylation of 12S rRNA is necessary for in vivo stability of the small subunit of the mammalian mitochondrial ribosome. Cell Metab, 9, 386-97.
MIHAJLOVIC, A. I., THAMODARAN, V. & BRUCE, A. W. 2015. The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent. Sci Rep, 5, 15034.
MINCZUK, M., HE, J., DUCH, A. M., ETTEMA, T. J., CHLEBOWSKI, A., DZIONEK, K., NIJTMANS, L. G., HUYNEN, M. A. & HOLT, I. J. 2011. TEFM (c17orf42) is necessary for transcription of human mtDNA. Nucleic Acids Res, 39, 4284-99.
MOGNETTI, B., LEPPENS, G. & SAKKAS, D. 1996. The development of preimplantation mouse parthenogenones in vitro in absence of glucose: influence of the maternally inherited components. Mol Reprod Dev, 43, 421-7.
NISHIOKA, N., INOUE, K., ADACHI, K., KIYONARI, H., OTA, M., RALSTON, A., YABUTA, N., HIRAHARA, S., STEPHENSON, R. O., OGONUKI, N., MAKITA, R., KURIHARA, H., MORIN-KENSICKI, E. M., NOJIMA, H., ROSSANT, J., NAKAO, K., NIWA, H. & SASAKI, H. 2009. The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Dev Cell, 16, 398-410.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 26: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/26.jpg)
NISHIOKA, N., YAMAMOTO, S., KIYONARI, H., SATO, H., SAWADA, A., OTA, M., NAKAO, K. & SASAKI, H. 2008. Tead4 is required for specification of trophectoderm in pre-implantation mouse embryos. Mech Dev, 125, 270-83.
PIECHOTA, J., TOMECKI, R., GEWARTOWSKI, K., SZCZESNY, R., DMOCHOWSKA, A., KUDLA, M., DYBCZYNSKA, L., STEPIEN, P. P. & BARTNIK, E. 2006. Differential stability of mitochondrial mRNA in HeLa cells. Acta Biochim Pol, 53, 157-68.
POSSE, V., SHAHZAD, S., FALKENBERG, M., HALLBERG, B. M. & GUSTAFSSON, C. M. 2015. TEFM is a potent stimulator of mitochondrial transcription elongation in vitro. Nucleic Acids Res, 43, 2615-24.
RALSTON, A., COX, B. J., NISHIOKA, N., SASAKI, H., CHEA, E., RUGG-GUNN, P., GUO, G., ROBSON, P., DRAPER, J. S. & ROSSANT, J. 2010. Gata3 regulates trophoblast development downstream of Tead4 and in parallel to Cdx2. Development, 137, 395-403.
RAY, S., DUTTA, D., RUMI, M. A., KENT, L. N., SOARES, M. J. & PAUL, S. 2009a. Context-dependent function of regulatory elements and a switch in chromatin occupancy between GATA3 and GATA2 regulate Gata2 transcription during trophoblast differentiation. J Biol Chem, 284, 4978-88.
RAY, S., DUTTA, D., RUMI, M. A. K., KENT, L. N., SOARES, M. J. & PAUL, S. 2009b. Context-dependent function of regulatory elements and a switch in chromatin occupancy between GATA3 and GATA2 regulate Gata2 transcription during trophoblast differentiation. The Journal of biological chemistry, 284, 4978-88.
REBELO, A. P., DILLON, L. M. & MORAES, C. T. 2011. Mitochondrial DNA transcription regulation and nucleoid organization. J Inherit Metab Dis, 34, 941-51.
SAHA, B., HOME, P., RAY, S., LARSON, M., PAUL, A., RAJENDRAN, G., BEHR, B. & PAUL, S. 2013. EED and KDM6B coordinate the first mammalian cell lineage commitment to ensure embryo implantation. Mol Cell Biol, 33, 2691-705.
SAHGAL, N., CANHAM, L. N., CANHAM, B. & SOARES, M. J. 2006. Rcho-1 trophoblast stem cells: a model system for studying trophoblast cell differentiation. Methods Mol Med, 121, 159-78.
SHE, H., YANG, Q., SHEPHERD, K., SMITH, Y., MILLER, G., TESTA, C. & MAO, Z. 2011. Direct regulation of complex I by mitochondrial MEF2D is disrupted in a mouse model of Parkinson disease and in human patients. J Clin Invest, 121, 930-40.
SHI, Z., LONG, W., ZHAO, C., GUO, X., SHEN, R. & DING, H. 2013. Comparative proteomics analysis suggests that placental mitochondria are involved in the development of pre-eclampsia. PLoS One, 8, e64351.
SHUTT, T. E., LODEIRO, M. F., COTNEY, J., CAMERON, C. E. & SHADEL, G. S. 2010. Core human mitochondrial transcription apparatus is a regulated two-component system in vitro. Proc Natl Acad Sci U S A, 107, 12133-8.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 27: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/27.jpg)
SOLOGUB, M., LITONIN, D., ANIKIN, M., MUSTAEV, A. & TEMIAKOV, D. 2009. TFB2 is a transient component of the catalytic site of the human mitochondrial RNA polymerase. Cell, 139, 934-44.
ST JOHN, J. C., AMARAL, A., BOWLES, E., OLIVEIRA, J. F., LLOYD, R., FREITAS, M., GRAY, H. L., NAVARA, C. S., OLIVEIRA, G., SCHATTEN, G. P., SPIKINGS, E. & RAMALHO-SANTOS, J. 2006. The analysis of mitochondria and mitochondrial DNA in human embryonic stem cells. Methods Mol Biol, 331, 347-74.
TAANMAN, J. W. 1999. The mitochondrial genome: structure, transcription, translation and replication. Biochim Biophys Acta, 1410, 103-23.
THUNDATHIL, J., FILION, F. & SMITH, L. C. 2005. Molecular control of mitochondrial function in preimplantation mouse embryos. Mol Reprod Dev, 71, 405-13.
TRIMARCHI, J. R., LIU, L., PORTERFIELD, D. M., SMITH, P. J. & KEEFE, D. L. 2000. Oxidative phosphorylation-dependent and -independent oxygen consumption by individual preimplantation mouse embryos. Biol Reprod, 62, 1866-74.
WANG, J., WILHELMSSON, H., GRAFF, C., LI, H., OLDFORS, A., RUSTIN, P., BRUNING, J. C., KAHN, C. R., CLAYTON, D. A., BARSH, G. S., THOREN, P. & LARSSON, N. G. 1999. Dilated cardiomyopathy and atrioventricular conduction blocks induced by heart-specific inactivation of mitochondrial DNA gene expression. Nat Genet, 21, 133-7.
WANG, Y. & WALSH, S. W. 1998. Placental mitochondria as a source of oxidative stress in pre-eclampsia. Placenta, 19, 581-6.
WANROOIJ, S., FUSTE, J. M., FARGE, G., SHI, Y., GUSTAFSSON, C. M. & FALKENBERG, M. 2008. Human mitochondrial RNA polymerase primes lagging-strand DNA synthesis in vitro. Proc Natl Acad Sci U S A, 105, 11122-7.
WIDSCHWENDTER, M., SCHROCKSNADEL, H. & MORTL, M. G. 1998. Pre-eclampsia: a disorder of placental mitochondria? Mol Med Today, 4, 286-91.
WILDING, M., COPPOLA, G., DALE, B. & DI MATTEO, L. 2009. Mitochondria and human preimplantation embryo development. Reproduction, 137, 619-24.
WOLF, A. R. & MOOTHA, V. K. 2014. Functional genomic analysis of human mitochondrial RNA processing. Cell Rep, 7, 918-31.
WU, G., GENTILE, L., FUCHIKAMI, T., SUTTER, J., PSATHAKI, K., ESTEVES, T. C., ARAUZO-BRAVO, M. J., ORTMEIER, C., VERBERK, G., ABE, K. & SCHOLER, H. R. 2010. Initiation of trophectoderm lineage specification in mouse embryos is independent of Cdx2. Development, 137, 4159-69.
XIE, Y., ZHOU, S., JIANG, Z., DAI, J., PUSCHECK, E. E., LEE, I., PARKER, G., HUTTEMANN, M. & RAPPOLEE, D. A. 2014. Hypoxic stress induces, but cannot sustain trophoblast stem cell differentiation to labyrinthine placenta due to mitochondrial insufficiency. Stem Cell Res, 13, 478-91.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 28: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/28.jpg)
YAGI, R., KOHN, M. J., KARAVANOVA, I., KANEKO, K. J., VULLHORST, D., DEPAMPHILIS, M. L. & BUONANNO, A. 2007. Transcription factor TEAD4 specifies the trophectoderm lineage at the beginning of mammalian development. Development, 134, 3827-36.
YAKUBOVSKAYA, E., GUJA, K. E., ENG, E. T., CHOI, W. S., MEJIA, E., BEGLOV, D., LUKIN, M., KOZAKOV, D. & GARCIA-DIAZ, M. 2014. Organization of the human mitochondrial transcription initiation complex. Nucleic Acids Res, 42, 4100-12.
ZDRAVKOVIC, T., NAZOR, K. L., LAROCQUE, N., GORMLEY, M., DONNE, M., HUNKAPILLAR, N., GIRITHARAN, G., BERNSTEIN, H. S., WEI, G., HEBROK, M., ZENG, X., GENBACEV, O., MATTIS, A., MCMASTER, M. T., KRTOLICA, A., VALBUENA, D., SIMON, C., LAURENT, L. C., LORING, J. F. & FISHER, S. J. 2015. Human stem cells from single blastomeres reveal pathways of embryonic or trophoblast fate specification. Development, 142, 4010-25.
ZERNICKA-GOETZ, M., MORRIS, S. A. & BRUCE, A. W. 2009. Making a firm decision: multifaceted regulation of cell fate in the early mouse embryo. Nat Rev Genet, 10, 467-77.
ZHOU, R., YAZDI, A. S., MENU, P. & TSCHOPP, J. 2011. A role for mitochondria in NLRP3 inflammasome activation. Nature, 469, 221-5.
ZHOU, W., CHOI, M., MARGINEANTU, D., MARGARETHA, L., HESSON, J., CAVANAUGH, C., BLAU, C. A., HORWITZ, M. S., HOCKENBERY, D., WARE, C. & RUOHOLA-BAKER, H. 2012. HIF1alpha induced switch from bivalent to exclusively glycolytic metabolism during ESC-to-EpiSC/hESC transition. EMBO J, 31, 2103-16.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 29: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/29.jpg)
Figures
Figure 1: Trophectoderm (TE) and TE-derived TSCs contain mature mitochondria for oxidative
energy metabolism.
(A) Electron Microscopy (EM) showing mitochondrial (Mito) ultrastructural differences between ICM and
TE in a mouse blastocyst (scale bar: 10m), (B) EM showing mitochondria in undifferentiated [mTSC(U)]
and differentiated [mTSC(D)] mouse TSCs (scale bar: 500nm). (C) Undidfferentiated and differentiated
mouse TSCs and mouse ESCs were subjected to mitochondrial stress test by adding oligomycin, FCCP,
and AntimycinA/Rotenone at different time intervals and changes in OCRs were measured. Basal
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 30: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/30.jpg)
respiration, mitochondrial ATP synthesis-coupled respiration (light pink shade) and spare respiratory
capacity (deep pink shade) are indicated. (D) Plots show that undifferentiated mouse TSCs maintain
significantly (*p<0.001, three independent experiments) higher oxidative respiration compared to
undifferentiated ESCs and oxidative respiration does not significantly alter upon TSC differentiation.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 31: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/31.jpg)
Figure 2: TEAD4 is important for oxidative respiration in mouse TSC.
(A) Quantitative RT-PCR and Western blot analyses showing depletion of TEAD4 mRNA and protein
expressions in TSCs upon shRNA-mediated RNAi (TEAD4KD). (B) Micrographs of control and TEAD4-
depleted TSC colonies (passage 2 after RNAi) in TSC culture condition. The TEAD4KD TSCs are
characterized with more visible cellular boundaries in cell colonies and presence of higher number of
differentiated trophoblast giant cells (TGCs, arrows), indicating propensity toward differentiation (scale
bar: 100m). (C) Mitochondrial stress test was performed to measure OCR in control and TEADKD TSCs.
(D) Quantitative analyses of OCR in control vs. TEAD4KD TSCs. Plots show strong reduction in oxidative
respiration in TEAD4KD TSCs. (E) Control and TEAD4KD TSCs were subjected to glycolysis stress test
by adding glucose, oligomycin, and 2-Deoxy Glucose (2-DG) at different time intervals and changes in
ECARs were measured. The graphs show representative ECAR profiles. (F) Plots show only modest
changes in glycolysis rate and maximal glycolytic capacity in TSCs upon TEAD4 depletion.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 32: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/32.jpg)
Figure 3. Loss of TEAD4 results in impaired mitochondrial function in mouse TSCs.
(A) Control and TEAD4KD TSCs were stained with a mitochondrial membrane potential probe JC-1 and
excited simultaneously for observing hypo-polarized membrane potential (monomeric form excited by 488
nm laser, Green) and hyper-polarized membrane potential (J-aggregate form excited using the 568nm
argon-krypton laser, Red) (scale bar: 20m). (B) TEM pictures showing mitochondrial ultrastructural
differences in control and TEAD4KD TSCs. Micrographs show presence of increased number of vacuoles
and mitochondrial structural abnormalities in TEAD4KD TSCs (scale bar: 500 nm). (C-D) Activities of
mitochondrial electron-transport chain (ETC) complex I, ETC complex IV, and actin and Citrate synthase
were measured in control and TEAD4KD TSCs. Data show reduced ETC complex I and IV activities in
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 33: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/33.jpg)
TEAD4KD TSCs without any significant change in citrate synthase activity. (E) Control and TEAD4KD
TSCs were stained with mitochondrial ROS indicator MitoSox Red (Red) and Hoechst (Blue) to monitor
mitochondrial distribution of reactive oxygen species accumulation (scale bar: 20m).
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 34: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/34.jpg)
Figure 4: TEAD4 promotes mtDNA transcription and POLRMT recruitment.
(A) RT-PCR analysis of mtDNA-encoded transcript in control and TEAD4KD TSCs (*p<0.01, three
independent experiments). (B) Western blot analyses showing expressions of mtDNA- encoded ETC
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 35: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/35.jpg)
complex members, MT-CO1 and MT-CYB, and nuclear DNA encoded mitochondrial proteins, TFAM,
TOM20 and UQCRC2 in control and TEAD4KD TSCs. (C) Schematic representation of the ectopic
TEAD4 expressing lentiviral construct. A mitochondrial transport signal was added to the N terminal end
of the Tead4-coding sequence to ensure efficient mitochondrial localization of the ectopically expressed
TEAD4 protein. A reporter EGFP was attached to the C-terminal end of the Tead4 along with a self-
cleaving T2A peptide. (D) Protein expression from the ectopic TEAD4 expressing construct in TEAD4KD
mTSCs were monitored via EGFP expression. (E) Western blot analyses showing rescue of TEAD4 and
MTCYB expression in TEAD4KD TSCs after transduction with ectopic TEAD4 expressing lentiviral
construct. (F) RT-PCR analysis of mtDNA-encoded transcripts in TEAD4KD TSCs without and with the
rescue of TEAD4 expression (*p<0.01, three independent experiments) (G) Schema of measuring
nascent mtDNA transcripts in TSCs. (H) Plots show reduction of nascent mtDNA transcripts in TEAD4KD
TSCs (*p<0.01, three independent experiments) and rescue of nascent transcripts upon expression of
ectopic TEAD4. Primers were designed to amplify polycistronic cDNA. For example, ND6-TrnE; primer
pair amplifying NADH dehydrogenase subunit 6 and the adjacent transfer RNA (Glu) (tRNA). (I)
Schematic diagram showing mtDNA-encoded genes and localization of primer pairs (1-7), which are used
for quantitative ChIP assay. (J and K) Quantitative ChIP assay in control and TEAD4KD TSCs were
performed to determine POLRMT and TFAM occupancy at different regions of the mtDNA. Plots show
significant reduction in POLRMT occupancy (J) but maintenance of TFAM occupancy at different regions
of mitochondrial genome upon TEAD4 depletion in mTSCs (*p<0.01, three independent experiments).
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 36: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/36.jpg)
Figure 5: TEAD4 localizes to mitochondria and occupy mtDNA along with POLRMT.
(A) Mouse TSCs were co-stained with TEAD4 (green) and TFAM (Red). Confocal images show both
TEAD4 and TFAM localization in mitochondria (arrowheads) (scale bar: 10m). Note that TEAD4 also
localizes at high levels in the nuclei, whereas TFAM localization in the nuclei are at much reduced levels.
(B) Purified Mitochondria from mTSCs were sub-fractionated and western blot analyses were performed
to determine localizations of TEAD4 and other mitochondrial proteins. The cytoplasmic and nuclear
fractions of mTSCs were used as controls. (C) Immuno-TEM showing TEAD4 within mitochondria
(arrowheads). Dotted line shows the boundary of mitochondrial membrane (scale bar: 500nm). (D)
Quantitative ChIP analysis showing TEAD4 occupancy along mitochondrial genome (*p<0.001, three
independent experiments). For simplicity only one IgG is shown although IgG was used for both control
and TEAD4KD chromatin. (E) EMSA to test TEAD4 binding at TEA motifs of mtDNA. A ~200bp mtND1
fragment, containing TEA motifs, was incubated without (lane 1) or with increasing amounts of mTSC
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 37: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/37.jpg)
extract (lane 2-5). TEAD4 containing DNA-protein complexes were tested by monitoring mobility super
shifts with anti-TEAD4 antibody (lane 6) or IgG (lane 7). (F) Sequential ChIP showing co-occupancy of
TEAD4 and POLRMT at different mtDNA regions (*p<0.001, three independent experiments). (G) The
plot shows mtDNA copy numbers in mouse TSCs with or without TEAD4 depletion.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 38: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/38.jpg)
Figure 6: Endogenous TEAD4 localizes to mitochondria and occupies mtDNA within the TE
lineage of a preimplantation mammalian embryo.
(A) Micrographs showing isolation of TE via microsurgery from a mouse blastocyst. (B) Plots show
induction of mtDNA-encoded transcripts (ND5 and MT-CO1) in TE lineage cells during blastocyst
development (*p<0.05, three independent experiments). (C) Mouse blastocyst stained with TEAD4
(Green), Mitotracker (Red) and DAPI (Blue), magnified portion of the TE cell showing TEAD4
colocalization with mitotracker (arrows). (D) Schema showing sequential ChIP-WGA with mouse
blastocysts to test TEAD4-POLRMT co-occupancy at mtDNA. (E) Plot shows quantitative assessment of
TEAD4 and POLRMT co-occupancy at mtDNA-encoded genes within mouse blastocysts (*p<0.01, three
independent experiments). (F) Western blot showing Co-IP between TEAD4 and POLRMT in trophoblast
progenitor/stem cells isolated from mouse placenta (e10.5).
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 39: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/39.jpg)
Figure 7: TEAD4 directly regulates POLRMT recruitment to promote mtDNA transcription during
preimplantation mammalian development.
(A) Conditional deletion of Tead4 in preimplantation mouse embryos. Loss of Tead4 expression
abrogated blastocyst maturation in ex-vivo culture condition. Deletion of Tead4 alleles was confirmed by
genotyping. (B) Strategy for Quantitative RT PCR analyses in Tead4-deleted embryos. (C) RT-PCR
analyses showing loss of Tead4 mRNA expression upon Cre-mediated excision of Tead4F/F alleles
(*p<0.001, ten individual embryos). (D) Plot shows loss of mtDNA-encoded transcripts in Tead4-deleted
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 40: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/40.jpg)
preimplantation embryos (*p<0.01, ten individual embryos). (E) Schema of POLRMT recruitment analysis
in preimplantation embryos. (F) Plot shows significant reduction in POLRMT recruitment at mtDNA-
encoded genes in Tead4-deleted embryos (*p<0.001, three individual experiments with ≤25 embryos in
each experiment. (G) The plot shows reduced mtDNA copy numbers in Tead4-deleted preimplantation
embryos (*p<0.01, twelve individual embryos). (H) The model illustrates significance of mitochondrial
TEAD4. In nascent TE cells of an early blastula, TEAD4 promotes expression of mtDNA-encoded ETC
components by facilitating POLRMT recruitment. This promotes oxidative phosphorylation and ATP
synthesis. The induced ATP production facilitates cellular processes including the activity of Na+, K+-
ATPase pump, thereby ensuring blastocyst maturation.
Dev
elo
pmen
t • A
ccep
ted
man
uscr
ipt
![Page 41: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/41.jpg)
Table S1: Tead4 dependent mtDNA encoded relative nascent transcript levels
To detect splicing, we used primers that amplify cDNA including the junction between the two
genes. For example, 12SRNA-TrnV; primer pair amplifying 12SRNA and the adjacent transfer
RNA (Val) (tRNA(V)). mtDNA genome organization and primer pairs used for real time PCR (1-7)
(E). RT PCR showing POLRMT occupancy along mitochondrial genome, which is affected upon
TEAD4 knockdown (F).
Name Control (%) TEAD4KD (%) Complex I ND1 100 51.5 ND2 100 30.9 ND3 100 30.6 ND4 100 32.7 ND5 100 44.9 ND6 100 52.5 Complex III MT-CYB 100 44.0 Complex IV MT-CO1 100 40.5 MT-CO2 100 46.9 Complex V ATP6 100 37.4 Transcript Joining two genes 12SRNA-TrnV 100 39.0 TrnL-ND1 100 42.8 MT-CO1-TrnS 100 83.5 ATP6-MT-CO3 100 33.6 ND6-TrnE 100 65.1 MT-CYB-TrnT 100 44.0
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 42: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/42.jpg)
Table S2: List of Antibodies
Primary antibody Species raised in Vendor Catalog number
anti-TEAD4 Mouse Abcam Ab58310
anti-Lamin B Goat Santa Cruz Biotechnology Sc-6216
anti-TFAM Rabbit Santa Cruz Biotechnology Sc-28200
anti-CYTB Rabbit Santa Cruz Biotechnology Sc-11436
anti-TOM20 Rabbit Cell Signaling #13929
Anti-POLRMT Rabbit Abcam Ab93102
Anti-POLRMT Mouse Abcam ab167368
Anti-POLRMT Rabbit Gift (mouse specific) (Kuhl et al.,
2014)
Anti-Actin Mouse Sigma #AC-74
Purified IgG Mouse BD Biosciences #554121
Secondary antibody Species raised in Vendor Catalog number
Alexa Fluor 568 anti-goat IgG
Donkey Life Technologies A11057
Alexa Fluor 488 anti-mouse IgG
Donkey Life Technologies A21202
anti-Goat IgG-HRP
Donkey Santa Cruz Biotechnology Sc-2033
anti-Mouse IgG-HRP
Goat Santa Cruz Biotechnology Sc-2005
anti-Rabbit IgG-HRP
Goat Santa Cruz Biotechnology Sc-2004
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 43: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/43.jpg)
Table S3: List of primers used for ChIP, transcript and genotyping
RT PCR primers for mouse transcript Forward Primer (5’-3’) Reverse Primer (5’-3’)
TEAD4 ATCCTGACGGAGGAAGGCA GCTTGATATGGCGTGCGAT 18SrRNA AGTTCCAGCACATTTTGCGAG TCATCCTCCGTGAGTTCTCCA ND1 CATTTGCAGACGCCATAAAA TGATAGGGTGGGTGCAATAA ND2 AACCCACGATCAACTGAAGC GTACGATGGCCAGGAGGATA MT-CO1 GCAACCCTACACGGAGGTAA CCGGTTAGACCACCAACTGT MT-CO2 TCTCCCCTCTCTACGCATTC TCATTGGTGCCCTATGGTTT MT-CYB TGAGGGGGCTTCTCAGTAGA TAGGGCCGCGATAATAAATG ATP6 CCTTCCACAAGGAACTCCAA TGCTAATGCCATTGGTTGAA ND3 GCATTCTGACTTCCCCAAAT TGCAGAGCTTGTAGGGTCAA ND4 GGAACCAAACTGAACGCCTA ATGAGGGCAATTAGCAGTGG ND5 TAGAAGGCCCTACCCCAGTT AGTCGTGAGTGGGTGGAATC ND6 TTGGCATTAAAGCCTTCACC TCCACCAAACCCTAAAACCA ATP6-MT-CO3 GCCTACGTATTCACCCTCCT CAGTTAATGGTCATGGACTTGG TrnL-NDI AGCCAGGAAATTGCGTAAGA TAGAATGGGGACGAGGAGTG
MT-CYB-TrnT TCTTATACCAATCTCAGGAATTATCG TTCATTTCAGGTTTACAAGACCA
12SrRNA-TrnV CCGTTTATGAGAGGAGATAAGTCG GGGTGTAGGCCAGATGCTT MT-CO1-TrnS CCCTCCACCATATCACACATT GGCTTGAAACCAATTTTAGGG ND6-TrnE AATGCTAACCCAAGACAACCA TCATGTCATTGGTCGCAGTT POLRMT TGGGCGCAAAAGCTAGAGG GTGAAGGGTCCAGAACTCCTG
Nrf1 TATGGCGGAAGTAATGAAAGACG CAACGTAAGCTCTGCCTTGTT Sirt3 ATCCCGGACTTCAGATCCCC CAACATGAAAAAGGGCTTGGG Yap1 TGGCCAAGACATCTTCTGGT GCCATGTTGTTGTCTGATCG Pgc1a TATGGAGTGACATAGAGTGTGCT CCACTTCAATCCACCCAGAAAG Cdx2 GCAGTCCCTAGGAAGCCAAGTGA CTCTCGGAGAGCCCGAGTGTG Gata3 CGGGTTCGGATGTAAGTCGA GTAGAGGTTGCCCCGCAGT Elf5 ATGTTGGACTCCGTAACCCAT GCAGGGTAGTAGTCTTCATTGCT Gcm1 CTGACTGGTTCCAGGAGTGG TGTCGTCCGAGCTGTAGATG
Ascl2 AAGTGGACGTTTGCACCTTCA AAGCACACCTTGACTGGTACG Prl3b1 GGGGCACTCCTGTTGCTGGCA GGACTTGCTCGCTGTTTTCTGGA TFAM ATTCCGAAGTGTTTTTCCAGCA TCTGAAAGTTTTGCATCTGGGT ChIP primers for rat Genome 1 CCTGTCCCCAATTGGTCTCT TATAGTCACCCCCAGGACGA 2 TCCCGACACAAAATCTTTCC TGCTTTGCTTTGTTATTAAGCTACA 3 CGGCGTAAAACGTGCCAACT ATTACTTTCGTTATTGGGCTTAGG 4 ATACCGCCATCTTCAGCAAA CCATTTCTTTCCGCTTCATT 5 TATGACCAACTAATGCACCTCCT GGTTCAATTCCTATTGTCCTAGAAA 6 GAAGCCACTCTAATCCCAACA GGGATGGAGCCAATTAGTGT
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 44: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/44.jpg)
ChIP primers for mouse Genome 1(ND6) AAACCTCTATAATCACCCCCAAT GGGATGTTGGTTGTGTTTGG 2(MT-CYB) GCAATCGTTCACCTCCTCTT TTGTATAGTAGGGGTGAAATGGAA 3(D-Loop) ATCAAACCCTATGTCCTGATCAAT TTTTGGTTCACGGAACATGA 4(12S rRNA) CGGCGTAAAACGTGTCAACT AGAATTACTTTCGTTATTGAGTTTAG 5(ND1) CATTTGCAGACGCCATAAAA TGATAGGGTGGGTGCAATAA 6(MT-CO1) GCAACCCTACACGGAGGTAA CCGGTTAGACCACCAACTGT 7(MT-CO3) TAACCCTTGGCCTACTCACC ATAGGAGTGTGGTGGCCTTG Genotyping primers TEAD4FF CTAGCATTAAGGAATGTCCCGA CGTATAGCATACATTATACGAAG TEAD4KO CTCAACATACAGTTTGAAGCAC GTGTTCTTAGAGGTACAGTCA Cre CATTTGGGCCAGCTAAACAT CCCGGCAAAACAGGTAGTTA Internal Control Interleukin 2 CTAGGCCACAGAATTGAAAGATCT GTAGGTGGAAATTCTAGCATCATCC For mtDNA quantitation mtND2 CGCCCCATTCCACTTCTGATTACC TTAAGTCCTCCTCATGCCCCTATG β2microglobulin CCTTCAGCAAGGACTGGTCT CAGTCTCAGTGGGGGTGAAT
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 45: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/45.jpg)
mR
NA
Lev
els
(Rel
ativ
e un
it)
*
mTSC (U)TEAD4KD
0.5
0
1.0
*
Gat
a3
Cdx
2
Elf5
* mTSC (D)
Stem-state markers
mR
NA
Lev
els
(Rel
ativ
e un
it)0.5
0
1.0
Gcm
1
Prl3
b1
Differentiation markers
Asc
l2Figure S1: RT-PCR analyses showing mRNA expressions of stem-state and differentiation markers in control and TEAD4KD mouse TSCs. For stem-state markers, mRNA expression in undifferentiated mouse TSCs [mTSC(U)] were used as standard. For differentiation markeres, mRNA expression in differen-tiated mouse TSCs [mTSC (D)] were used as standard (mean + SEM, three independent experiments, p≤0.01).
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 46: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/46.jpg)
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 47: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/47.jpg)
1 2 3
4 5 6
TEAD4/TFAM/NUCLEI
Figure S3: Z-Stack confocal images showing localizations of TEAD4 and TFAM in mouse TSCs. Six merged stacks are shown. TEAD4 localization in nuclei are evident from stacks 1-4. Cytoplasmic localization of TEAD4 are evident in stacks 1-2, whereas mitochondrial localization is eveident from stacks 3 and 4 (white ring). Unlike TEAD4, TFAM is predominantly localized within mitochondria (Stacks 3 and 4). Z-stack 4 is used for panels figure 5A of the main manuscript.
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 48: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/48.jpg)
C
B Consensus TEA motifs
MT-CYB
ND6
ND2ND1 ND3MT-CO1ATP8ATP6
12S 16S
DloopMT-CO2
MT-CO3
ND5ND4
ND4LtRNA genes
protein coding genesrRNA coding genes
A
Figure S4: Endogenous TEAD4 physically interacts with POLRMT in mouse TSC.(A-B) mouse mtDNA genome showing putative TEA motifs, identified using the JASPAR database. (C) 200 bp mtND1 fragment from mouse mtDNA genome, which was used for EMSA. PutativeTEA motifs tare highlighted.
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 49: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/49.jpg)
TFAM / TEAD4 T
EAD
4 an
d PO
LRM
T R
elat
ive
Enric
hmen
t
16
24
32
8
1 2 3 4 5 6
MT-CYB
ND6
ND2ND1 ND4ND3 ND5
ND4L
MT-CO1 MT-CO2
ATP8 ATP6 MT-CO3
12S 16S
2 3 4 651
D-loop
Primer pairs
DPOLRMTTEAD4
IgG
Who
le ce
llMito
chon
dria
LAMIN-B
TEAD4
A B
Human First-Trimester Cytotrophoblast
RCHO1
tRNA genes
protein coding genesrRNA coding genes
C
0
RCHO1
CYTB
Figure S5. Endogenous TEAD4 localizes to mitochondria in rat trophoblast stem cell line (RCHO-1) and human primary cytotrophoblast cells. (A) Western blot showing TEAD4 in mitochondrial fraction in rat RCHO-1 cells. (B), Human first trimester cytotrophoblasts were stained with TEAD4 (green) and mitochondria specific transcription factor TFAM (red) showing TEAD4 localization in mitochondria (scale bar: 10μm). (C) Schematic diagram of mtDNA and localization of primer pairs (1-6) that were used for quantitative ChIP analyses in RCHO-1 cells. (D) Plot shows quantitative assessment of TEAD4 and POLRMT occupancy at diferent regions of mtDNA in RCHO-1 cells.
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion
![Page 50: First posted online on 10 September 2018 as 10.1242/dev ...€¦ · Regulation of Energy Metabolism during Early Mammalian Development: TEAD4 Controls Mitochondrial Transcription](https://reader033.vdocuments.us/reader033/viewer/2022042310/5ed8a6bd6714ca7f476851ec/html5/thumbnails/50.jpg)
A B1
2
3
KO
Flox
Cre
Control
1 2 3
1
Figure S6: Differential recombination efficiency of Tead4-floxed allele is associated with differential blastocyst maturation. (A and B) In-vitro culture and genotyping of mouse Tead4F/F:UbcERT2-Cre or Tead4F/F preimplantation embryos in the presence of tamoxifen. Representative images of blastocysts with mixed phenotype are shown. Tead4F/F embryo fomed a matured blastocyst (Embryo 1, white arrow in A) in the presence of tamoxifen. In contrast, Tead4F/F:UbcERT2-Cre embryos showed mixed phenotype with tamoxifen due to differential recombination efficiency of the floxed Tead4 alleles. Recomibination efficency was low in embryo 2, resulting in maintenance of the floxed Tead4 allele (panels 2 in B) and matured blastocyst with a defined but less expanded blastocoel cavity. High recombination efficiency in embryo 3 resulted in an immature blastocyst with very small blastocoel cavity (White arrow in embryo 3 in A).
Development: doi:10.1242/dev.162644: Supplementary information
Dev
elo
pmen
t • S
uppl
emen
tary
info
rmat
ion