REGULAR ARTICLE

Fibronectin promotes migration, alignment and fusionin an in vitro myoblast cell model

Raquel Vaz & Gabriel G. Martins &

Sólveig Thorsteinsdóttir & Gabriela Rodrigues

Received: 23 September 2011 /Accepted: 29 January 2012 /Published online: 18 March 2012# Springer-Verlag 2012

Abstract Myogenesis is a complex process in which com-mitted myogenic cells differentiate and fuse into myotubesthat mature into the muscle fibres of adult organisms. Thisprocess is initiated by a cascade of myogenic regulatoryfactors expressed upon entry of the cells into the myogenicdifferentiation programme. However, external signals such asthose provided by the extracellular matrix (ECM) are alsoimportant in regulating muscle differentiation and morpho-genesis. In the present work, we have addressed the role ofvarious ECM substrata on C2C12 myoblast behaviour invitro. Cells grown on fibronectin align and fuse earlier thancells on laminin or gelatine. Live imaging of C2C12 myo-blasts on fibronectin versus gelatine has revealed that fibro-nectin promotes a directional collective migratory behaviourfavouring cell-cell alignment and fusion. We further demon-strate that this effect of fibronectin is mediated by RGD-binding integrins expressed on myoblasts, that N-cadherincontributes to this behaviour, and that it does not involveenhanced myogenic differentiation. Therefore, we suggestthat the collective migration and alignment of cells seen onfibronectin leads to a more predictable movement and a

positioning that facilitates subsequent fusion of myoblasts.This study highlights the importance of addressing the roleof fibronectin, an abundant component of the interstitial ECMduring embryogenesis and tissue repair, in the context ofmyogenesis and muscle regeneration.

Keywords Myoblast behaviour . Liveimaging . Extracellular matrix . Integrins . C2C12 cells

Introduction

Myogenesis is initiated with the specification of a pool ofcommitted skeletal muscle cells, the myogenic precursorcells (MPCs). Myogenic differentiation is achieved by theexpression of muscle-specific transcription factors that ini-tiate and sustain the myogenic differentiation programmeand culminates in the formation of fusion-competent myo-blasts that fuse into myotubes that then mature into musclefibres (Buckingham 2006). Some of the MPCs specifiedduring development give rise to satellite cells, which arethe quiescent non-differentiated cells of postnatal muscle,and which are important in muscle repair and regeneration(Dhawan and Rando 2005; Zammit et al. 2006). Onceactivated, satellite cells enter a differentiation programmethat resembles embryonic myogenesis (Zammit et al. 2006).

The extracellular matrix (ECM) plays an essential role inseveral cellular processes. It is organized in a dynamicnetwork that not only gives mechanical support to cellsand tissues, but also influences cell behaviour (Goody andHenry 2010; Rozario and DeSimone 2010; Thorsteinsdóttiret al. 2011; Yurchenco et al. 2004). The ECM interacts withcells through ECM receptors, most commonly integrins,which are heterodimers composed of an α and a β subunit(Hynes 1992). Upon binding to the ECM, integrins can

Electronic supplementary material The online version of this article(doi:10.1007/s00441-012-1364-1) contains supplementary material,which is available to authorized users.

R.V. and this work were supported by Fundação para a Ciência eTecnologia (FCT, Portugal) project PTDC/BIA-BCM/67437/2006.

R. Vaz :G. G. Martins : S. Thorsteinsdóttir :G. Rodrigues (*)Centro de Biologia Ambiental/Departamento de Biologia Animal,Faculdade de Ciências, Universidade de Lisboa,1749-016 Lisboa, Portugale-mail: mgrodrigues@fc.ul.pt

G. G. Martins : S. Thorsteinsdóttir :G. RodriguesInstituto Gulbenkian de Ciência,Oeiras, Portugal

Cell Tissue Res (2012) 348:569–578DOI 10.1007/s00441-012-1364-1

modulate a variety of cellular processes such as migration ordifferentiation (Danen and Sonnenberg 2003; Larsen et al.2006; Rozario and DeSimone 2010).

The ECM and integrins play important roles during em-bryonic myogenesis but many questions concerning thecontribution of the ECM to myoblast migration, alignmentand fusion remain to be clarified (Thorsteinsdóttir et al.2011). Expression studies suggest that fibronectin-bindingintegrins are likely candidates for playing a role in myotubeformation during primary myogenesis (Cachaço et al. 2005).Studies of myogenesis in vitro have implicated fibronectinand its receptor α5β1 integrin in myoblast spreading, mi-gration and contact guidance (Disatnik and Rando 1999;Turner et al. 1983) and myoblast proliferation (Boettiger etal. 1995; Sastry et al. 1996; von der Mark and Öcalan 1989).Nevertheless, the modulation of α5β1-fibronectin bindingstrength either by using α5β1-activating antibodies or bychanging the coating process in such a way that it affects theconformation of the fibronectin molecules has an effect onmyoblast differentiation and myotube formation (Boettigeret al. 1995; García et al. 1999; Lan et al. 2005). Laminin hasalso been reported to promote myoblast differentiation andthe formation of myotubes (Sastry et al. 1996; von der Markand Öcalan 1989). For myotubes to form, fusion-competentmyoblasts need to migrate towards each other or towardsexisting myotubes, align and establish close cell-cell contactsso that membranes can fuse (Jansen and Pavlath 2008;Rochlin et al. 2010). N-cadherin (Knudsen et al. 1990) andM-cadherin (Jansen and Pavlath 2008; Zeschnigk et al. 1995)are of utmost importance in this process. Furthermore, theα4β1 integrin, a fibronectin and vascular cell adhesionmolecule-1 (VCAM-1) receptor, through its interaction withVCAM-1, is essential for myoblast alignment and fusionduring secondary myogenesis and in C2C12 cells (Rosen etal. 1992). However, to what extent various ECM substrataaffect the behaviour of myoblasts in vitro and the way thatthey promote myotube formation are unknown. The expres-sion of myogenin is clearly essential for myogenic differenti-ation but the inhibition of ECM synthesis in C2C12 cellsimpairs myotube formation independently of myogenin ex-pression (Osses and Brandan 2002) suggesting that the ECMcontributes directly towards myotube formation.

In this study, we have addressed the role of fibronectin inmyoblast behaviour by using C2C12 cells as a model sys-tem. We have found that, when C2C12 cells are grown onfibronectin, they elongate and align much earlier than onlaminin or the gelatine control. Live imaging of these cellshas shown that a fibronectin substratum induces collectivecell migration, with cells migrating longer distances andwith a more persistent directionality than on gelatine. Theblocking of cell-fibronectin binding with RGD peptidesprevents myoblast elongation and alignment, indicating aninvolvement of α5β1 and αvβ1/β3 integrins. Furthermore,

cell-cell binding through N-cadherin aids myoblast align-ment and elongation. Interestingly, culture of C2C12 cellson fibronectin also enhances myoblast fusion without accel-erating myogenin expression, suggesting a mechanism thatdoes not involve differentiation. Together, these observa-tions demonstrate that a fibronectin substratum promotesmyotube formation in C2C12 cells by stimulating a collec-tive and directional migration of myoblasts and their elon-gation and alignment in an RGD-dependent manner.

Materials and methods

Cell culture

C2C12 cells (ATCC, CRL 1772; Yaffe and Saxel 1977;passage number between 20 and 25) were maintained inDMEM GlutaMax supplemented with 10% fetal bovineserum and 100 U/ml streptomycin and penicillin(Invitrogen) at 37°C in a humidified atmosphere of 5%CO2. Glass coverslips were evenly coated with either asolution of 0.1% gelatine in sterilized water or laminin 111(L2020, Sigma) at 5 μg/ml in phosphate-buffered saline(PBS) for 1 h at 37°C. Fibronectin-coated glass coverslipswere obtained from commercial sources (BD BiocoatCellware). Immunostaining of these coverslips for fibronec-tin confirmed that the coating was homogeneous (data notshown). To study myoblast morphology and behaviour,5×104 cells were seeded on these coverslips within cell-culture Petri dishes (30 mm, Nunc) and left to grow until60%, 80% or 90% confluence corresponding to approximate-ly 3.8×104, 5×104 and 6.3×104 cells per cm2, respectively. Tostudy myogenic differentiation after confluence, cells wereleft for 4, 6, 8 or 9 days and the medium was changed everyother day.

Immunocytochemistry

Cells were fixed with 1% (or 2% for cells cultured for 4 ormore days) paraformaldehyde in PBS for 30 min and per-meabilized with 0.5% Triton X-100 in PBS for 5 min. Thecells were then blocked with 2% bovine serum albumin(BSA) in PBS, incubated with primary antibodies, washedwith PBS and incubated with secondary antibodies in blockingsolution.

The primary antibodies used were rabbit anti-α5 integrin(AB1928, Chemicon), rabbit anti-αv integrin (ALX-210-537, Enzo) and mouse anti-N-cadherin (C70320, BDBioscience), all at a 1:100 dilution in blocking solution,and mouse anti-light meromyosin (MF20, D.S.B.H.) diluted1:50. Secondary antibodies were goat anti-rabbit Alexa488and goat anti-mouse Alexa568 (A-11070 and A-11019,Molecular Probes), diluted 1:1000. Nuclei were stained by

570 Cell Tissue Res (2012) 348:569–578

using 4,6-diamidino-2-phenylindole (DAPI; 5 μg/ml inPBS, Sigma).

Cell-ECM and cell-cell adhesion-blocking assays

Fibronectin-α5β1/αvβ1/αvβ3 integrin interactions wereblocked by using a GRGDS peptide (Sigma; Ruoslahti1991; Takahashi et al. 2007) at a concentration of 0.9 mM.Control cultures were treated with SDGRG at the sameconcentration. Fibronectin/VCAM-1-α4β1 integrin interac-tions were blocked by adding PS/2 antibody (Serotec; Rosenet al. 1992) to give a final concentration of 20 μg/ml in theculture medium. The blocking of fibronectin-α4β1 integrininteraction was achieved by adding CS1 peptide (GenScript;May et al. 1993) to give a final concentration of 100 μg/mlin culture medium. N-cadherin homophilic binding wasinhibited with MNCD2 antibody (D.S.H.B.; Linask et al.1998) at a final concentration of 10 μg/ml. In control experi-ments, BSAwas added at 20, 100 or 10 μg/ml. All experimentshad at least one replicate and a minimum of two independentcultures were performed.

Reverse transcription followed by the polymerase chainreaction

For reverse transcription (RT), the innuPREP Micro RNAKit (AnalytikJena—Biometra) was used to extract totalmRNA from C2C12 cells seeded on fibronectin and grownto 90% confluency. cDNA was synthesized by using anoligo (dT)15 primer (Promega) and Superscript II reverse-transcriptase (Invitrogen). For the detection of integrin sub-units, we designed and used the following primers: α4subunit 5′ GTTGGGAGCATGAAGACCAT 3′ forwardand 5′ GCCATGCTAATCCCAGTGTT 3′ reverse; α5 sub-unit 5′ CAAGAACGCACTGAACCTGA 3′ forward and 5′TGCTGAGTCCTGTCACCTTG 3′ reverse; αv subunit 5′CAGAGGACATTTGACACATGTGAGG 3′ forward and 5′CACCTTGGCCTTCTGTTGCCCTAC 3′ reverse. The poly-merase chain reaction (PCR) conditions were as follows: aninitial denaturation at 94°C for 5 min, 40 cycles at 94°C for15 s, 50°C (α4/α5) or 57°C (αv) for 30 s and 72°C for 45 sand a final extension at 72°C for 5 min.

Image acquisition and analysis

For nuclear quantifications and cell differentiation studies,fixed and immunostained cells were imaged on an OlympusBX60 microscope equipped with an Olympus DP50 digitalcamera, by using either a 10×0.4NA or 20×0.7NA lens. Toobserve cell behaviour, C2C12 myoblasts were passaged ontogelatine or fibronectin-coated coverslips and time-lapse-imagedunder subconfluence (approximately 60%) or confluence (morethan 90%). The medium was supplemented with 20 mM

HEPES. The Petri dishes were sealed and placed in a custom-built incubation chamber maintained at 37°C. Images wereacquired on a Zeiss LUMAR Stereoscope with oblique illumi-nation, coupled to an Axiocam-cooled charge-coupled devicecamera. Images were acquired every 3 min and the first 10 h ofthe movies were used to analyse and compare cell behaviour.

To quantify myogenic differentiation and myotube for-mation, myogenin-or myosin-positive cells were countedper 1.2×106 μm2 (10×lens) or 3×105 μm2 (20×lens) fields.

Analysis of nuclear shape To estimate cell shape in confluentcultures (in which it was not possible to identify cell bound-aries accurately), we used ImageJ software and the “Analyseparticles” function to measure nuclear shape. Elongatedspindle-shaped cells have elongated nuclei aligned along themajor axis of the cells, whereas cells with a more stellatemorphology have round nuclei. Nuclei were selected automat-ically by the software as particles of 100-500 μm2, thusrejecting smaller particles and overlapping nuclei. To comparethe nuclear shape of cells grown on various substrata, we usedthe Fit ellipse measurement of ImageJ, which represents themajor and minor measurements corresponding to the primaryand secondary axis of the best fitting ellipse for the nuclei. Theratio between these measurements was used for comparisons.A ratio of 1 was interpreted as being from a cell that was notelongated and a ratio of >1 as being from cells that wereelongated. For each comparison, at least one replicate and aminimum of two independent cultures were performed. Aminimum of five fields per condition was used, each containingmore than 300 cells.

Analysis of cell movements Before cell movement analysis,time-lapse images were aligned by using Amira v.4.2 (VisageInc.) to correct for drift during acquisition. Brightness andcontrast were adjusted for the optimal identification of indi-vidual cells, after which the movies were analysed and cellmovements tracked by using Imaris v.5.7.2 software(Bitplane). To randomize cell sampling, we overlaid a gridof 100-μm squares on the time-lapse images and tracked onlycells at grid intersections at t00, following 15 cells per movie.Cells were then tracked by manually selecting the cell bodycentre. We then used the Imaris v5.7 software to calculate thetrack length, the net displacement and an estimate of thepredictability of movement (ARMean parameter). This lastparameter estimates the overall probability of each movementmaintaining the trend of the previous movement. If the valuecalculated for a certain time-point approaches 1, the speed anddirection of the cell are maintained according to the previousmovement, whereas if the value is closer to 0, the directiontaken by the cell is different.

Statistical analysis Student’s t-test and two-way analysis ofvariance followed by contrast analysis were used to test for

Cell Tissue Res (2012) 348:569–578 571

differences between experiments. Results were plotted with95% confidence intervals. Statistical tests were computed byusing STATISTICA StatSoft software v. 10.

Results

Fibronectin promotes C2C12 elongation and alignment in vitro

To assess the influence of various substrata on C2C12behaviour, we seeded C2C12 cells on fibronectin, lamininand gelatine. After 2 days of culture (80% confluence), cellson gelatine and laminin displayed a mesenchymal morphol-ogy with predominantly polygonal shapes (Fig. 1a, c),whereas cells on fibronectin had acquired an elongatedshape and aligned with their neighbours forming largestreams of uniformly aligned cells (Fig. 1b). Such an orga-nization was only observed in cells on gelatine or lamininwell after confluence (more than 6 days). Using nuclearstaining (Fig. 1a–c), we were able to measure differencesin nuclear shape and found that cells on fibronectin had ahigher nuclear major/minor ratio than cells seeded on gela-tine or laminin (P<0.001; Fig. 1d). These results show thatfibronectin promotes early elongation and alignment ofC2C12 myoblasts in vitro.

Fibronectin promotes C2C12 migration

On the basis of the effect of fibronectin on cell alignment, wenext wished to determine the way that fibronectin affects

C2C12 behaviour in culture. We filmed cells grown on fibro-nectin or gelatine, at the time that they were subconfluent(approximately 60% confluence) and already confluent (morethan 90% confluence), obtaining time-lapse image sequencesthat we later used to perform cell movement analysis (15 cellswere tracked in each condition; see tracks in Fig. 2a, b, d, e; seeFig. 2c, f for merged tracks; also see complete movies inElectronic supplementary material). Comparisons were carriedout on the first 10 h of all movies. Cells on fibronectin migratedsignificantly longer distances, showed a larger cell displace-ment and a more consistent path directionality than cells ongelatine (Fig. 2g-i). Confluence did not affect cell behaviour(Fig. 2g-i). Contrast analysis showed that cells on fibronectinmigrated significantly more than those on gelatine, both undersubconfluent and confluent conditions (P00.045, P00.002,respectively; Fig. 2g). They also showed a larger net displace-ment than cells on gelatine, although the difference was onlystatistically significant in confluent cultures (P00.135,P00.002, respectively; Fig. 2h). This could be clearly appreci-ated when viewing merged tracks (Fig. 2c, f); cells on gelatinemoved more randomly without a constant direction, whereascells on fibronectin tended to migrate with a more constantpath, displaying collective cell movements seen in the moviesas “streams” of cells (Fig. 2a-f; Electronic supplementary ma-terial: Supplementary Movie S1, Supplementary Movie S2,Supplementary Movie S3, Supplementary Movie S4). Cellson fibronectin also maintained their movement in a morepredictable manner than cells cultured on gelatine, both undersubconfluent and confluent conditions (P00.001, P00.026,respectively; Fig. 2i). We therefore conclude that cell-

Fig. 1 C2C12 cells cultured onfibronectin align into streams ofcells. C2C12 cells cultured for2 days on gelatine (a),fibronectin (b) or laminin (c).Cells cultured on fibronectin aremore aligned than cells grownon the other substrata.Measurements of nuclear shape(nuclei visualized with 4,6-diamidino-2-phenylindole[DAPI]). Nuclei of cellscultured on fibronectin aresignificantly more elongatedthan those of cells grown ongelatine or laminin. Nodifference is detected betweenthe nuclear shape of cells ongelatine and laminin (d).Number of cells analysed:gelatine, n04259; fibronectin,n02025; laminin, n04049(error bars 95% confidenceintervals). Bars100 μm

572 Cell Tissue Res (2012) 348:569–578

fibronectin interactions promote C2C12 cell collective motilityand directionality.

C2C12 cells interact with fibronectin through the RGD-bindingsite for cell elongation and alignment

To test which integrin(s) mediated the above-mentionedbehaviour, we searched for the expression of fibronectin-binding integrins in these cells. In agreement with previousstudies (Rosen et al. 1992; van der Flier et al. 1997; Yao et

al. 1996), RT-PCR analysis showed that α5 and αv wereexpressed in undifferentiated 80% confluent C2C12 cells(Fig. 3a). Conversely, α4 mRNAwas absent during the firstdays of culture (Fig. 3a) but was later expressed in differ-entiating C2C12 cells (not shown; Rosen et al. 1992).Furthermore, we verified by immunocytochemistry thatC2C12 cells at 80% confluence expressed the α5 (Fig. 3b)and αv (Fig. 3c) integrin subunits on their surface.

To determine whether α5β1 and/or αv integrins mediatethe observed behaviour of C2C12 cells on fibronectin, we

Fig. 2 C2C12 cells migrate further and with more constant directionalityon fibronectin than on gelatine. C2C12 cells were cultured on gelatine (a,d) or fibronectin (b, e) in subconfluent (a, b) or confluent (d, e) con-ditions. Cells were then time-lapsed and cell paths were drawn, shown ona time colour scale (j). Isolated cell tracks were re-centred by usingImageJ software and depicted as if all cells had started from the samestarting point (c, f are merged images of a, b and d, e tracks, respectively).A two-way analysis of variance analysis showed that the substrate

influenced the track length, cell displacement and path predictability butthat confluence did not affect these parameters. Contrast analysis ofpredicted differences revealed that cells on fibronectin migrated signifi-cantly longer distances (g), were displaced further from the original point(h) and maintained a more consistent path directionality (i) than cellscultured on gelatine (Gel gelatine,Fn fibronectin, Subconf subconfluence,Conf confluence, error bars 95% confidence intervals; 15 cells wereanalysed per condition). Bars 100 μm

Cell Tissue Res (2012) 348:569–578 573

cultured cells on fibronectin in the presence of the BMB5antibody (Vellón et al. 2010), which specifically blocksα5β1-fibronectin interactions, or with the GRGDS peptide,which blocks both α5β1 and αvβ1/αvβ3 binding(Ruoslahti 1991; Takahashi et al. 2007; Fig. 3e). Althoughthe BMB5 antibody perturbed the alignment of cells onfibronectin compared with the control (Electronic supple-mentary material: Supplementary Fig. S1), treatment of thecells with the GRGDS peptide resulted in a much moredramatic effect (Fig. 3d-f). Fewer cells attached to the sub-strate and the cells that attached did not align (Fig. 3e). Incontrast, treatment with the control peptide SDGRG resultedin a cell organization indistinguishable from cells grown onfibronectin (cf. Figs. 3d, 1b). The nuclei of C2C12 myo-blasts cultured on fibronectin with GRGDS until 80% con-fluence were significantly less elliptical than those culturedwith SDGRG (P<0.001; Fig. 3f), a finding consistent with aless elongated cell morphology. We therefore conclude that

cell elongation and alignment of C2C12 cells on fibronectinis mediated by RGD-binding integrins.

Cell-cell adhesion mediated by N-cadherin promotes cellelongation and alignment

The cell-cell adhesion molecule N-cadherin is present alongthe membrane of cells seeded on fibronectin (Fig. 3g,arrows) suggesting that this molecule is used by C2C12cells to adhere to each other during their alignment.Previous studies have shown that myoblasts overexpressingα5β1 integrin upregulate N-cadherin and adhere more ex-tensively to each other (Huttenlocher et al. 1998).

To test whether N-cadherin participated in the fibronectin-mediated alignment of C2C12 cells in vitro, cells were seededon fibronectin-coated coverslips in the presence of an N-cadherin blocking antibody (MNCD2) and cultured until80% confluence. In the presence of this antibody, cells were

Fig. 3 RGD-mediated interactions and N-cadherin cell-cell binding areresponsible for the elongation and alignment of C2C12 cells on fibronec-tin. RT-PCR analysis of C2C12 cells at 80% confluence on fibronectinshows no expression of the α4 integrin subunit, whereas α5 and αv areexpressed (a). Furthermore, α5 (b) and αv (c) integrin subunits aredetectable by immunocytochemistry. Cells cultured with SDGRG alignnormally on fibronectin (d), whereas cell cultured with GRGDS do notalign (e). The nuclei of cells cultured with GRGDS are significantly lesselongated than those of cells with SDGRG (f). C2C12 cells on fibronectin

are stained with DAPI (blue) and immunolabelled for N-cadherin (green,g), which is enriched along apposed cell membranes (g, arrows). Cellsseeded on fibronectin with an antibody blocking N-cadherin homophilicinteractions (MNCD2; i) show significantly less elongated and alignednuclei than the control, bovine serum albumin (BSA; h,j). Number of cellsanalysed: SDGRG, n02309; GRGDS, n02075; BSA, n01406; MNCD2,n01406 (cDNA reverse-transcribed mRNA, RNA total RNA, Ctrl+cDNA from mouse liver as a positive control, W water as a negativecontrol, error bars 95% confidence intervals). Bars100 μm

574 Cell Tissue Res (2012) 348:569–578

not as well aligned as in control cultures (Fig. 3h, i) and theirnuclear shape was significantly less elongated than that incells in control cultures (P<0.001; Fig. 3j). We thereforeconclude that N-cadherin aids the elongation and alignmentbehaviour of C2C12 cells grown on fibronectin.

Myotube formation is enhanced by a fibronectin substrate

Having determined that C2C12 cells elongated earlier on fibro-nectin, we sought to evaluate the effect of fibronectin onmyogenic differentiation and myotube formation. C2C12 cellsmaintained for 8 days on fibronectin differentiated less wellthan on gelatine, as measured by the number of myogenin-positive cells in the cell cultures (Electronic supplementarymaterial: Supplementary Fig. S2), although the total number

of cells was identical (not shown). Thus, a fibronectin substra-tum does not enhance C2C12 cell differentiation.

Nevertheless, when cells were maintained in culture for 8–9 days, we detected significantly more myotubes in cultureson fibronectin (Fig. 4b) when compared with gelatine(P00.001; Fig. 4a, c). The myotubes on fibronectin were alsolonger (Fig. 4a, b) and contained more nuclei per myotube(P<0.001; Fig. 4d). We therefore conclude that the culture ofC2C12 cells on fibronectin promotes not only myoblast elon-gation and alignment, but also the formation of myotubes.

We next tested the role of integrins in the fusion of cellsgrown on fibronectin. Treatment with GRGDS peptide toinhibit the engagement of fibronectin with RGD-bindingintegrins resulted in the complete detachment of cells afteran initial period of 4-5 days, demonstrating a dependence on

Fig. 4 Culture of C2C12 cells on fibronectin enhances myotubeformation. Culture of C2C12 cells on gelatine (a) or fibronectin (b,e–g) for 8-9 days in growth medium, followed by immunostaining withMF20 (red) and nuclear DAPI staining (cyan). C2C12 cells cultured onfibronectin form a significantly larger number of myotubes (number offields analysed with an area of 3×105 μm2: gelatine, n0154; fibronec-tin, 0131; c) with more nuclei than those on gelatine (number ofmyotubes analysed: gelatine, n02187; fibronectin, n02302; d).C2C12 cells cultured with PS/2 (f) had significantly fewer myotubes

than the control culture (number of fields analysed with an area of1.2×106 μm2: BSA, n017; CS1, n021; e, h) and fewer nuclei permyotube (number of myotubes analysed: BSA, n01301; PS/2,n0236; i). When cells were cultured with CS1, significantly fewermyotubes (number of fields analysed with an area of 1.2×106 μm2:BSA, n013; CS1, n013; g, j) with fewer nuclei per myotube (numberof myotubes analysed: BSA, n01017; CS1, n02175; k) were formedthan the control, although the difference was smaller than that with PS/2 (error bars 95% confidence intervals). Bars100 μm

Cell Tissue Res (2012) 348:569–578 575

RGD-binding integrins for attachment and survival. α4β1-VCAM-1 interactions had previously been implicated inmyoblast fusion (Rosen et al. 1992), but whether α4β1binding to fibronectin played a role was unclear. To addressthis issue, we cultured cells in the presence of PS/2 (Rosenet al. 1992), an antibody inhibiting α4β1 binding to bothVCAM-1 and fibronectin, or with CS1, a peptide reported toblock only fibronectin-α4β1 binding (May et al. 1993).When CS1 was present in the culture medium (Fig. 4g),fewer myotubes with fewer nuclei per myotube (P00.029and P<0.001, respectively; Fig. 4j, k) were formed.However, the PS/2 antibody produced a much more dramat-ic effect on the number of myotubes formed (P<0.001;Fig. 4f, h) and on the number of nuclei per myotube(P<0.001; Fig. 4i). These results show that the process offusion itself appears to be primarily dependent on α4β1-VCAM-1 interactions but raise the possibility that α4β1-fibronectin engagement might also contribute, albeit to alesser extent.

Discussion

Although confluent C2C12 cells are known to align and formmyotubes (Burattini et al. 2004), we have found that, whenC2C12 cells are seeded on fibronectin, they alignmuch earlier,well before reaching confluence. Additionally, we have shownthat this effect is RGD-dependent, suggesting interactionswithfibronectin via α5β1 and αv integrins, and that cell-celladhesion through N-cadherin plays an auxiliary role in thisprocess.

Previous studies have shown that α5β1 is the majorintegrin involved in the attachment and spreading of myo-blasts on a fibronectin substrate (Boettiger et al. 1995;Disatnik and Rando 1999; García et al. 1999; Lan et al.2005). Fine tuning of the activation state of this integrin isparticularly important for myoblast migration, since α5-nullcells fail to spread on fibronectin (Disatnik and Rando 1999)and, when α5β1 binding to fibronectin is artificially in-creased, myoblast migration is perturbed, leading to defectsin cell-cell alignment resulting in branched myotube mor-phology (Boettiger et al. 1995). Our results further showthat cells on fibronectin align collectively forming a wavypattern and that this organization is achieved well beforeconfluence. When the cell culture substrate is coated withstripes of fibronectin, myoblasts align and fuse along thosestripes (Turner et al. 1983). However in our case, the fibro-nectin is evenly distributed on the coverslips (see Materialsand Methods) and the cells form wave-like streams, ratherthan the straight lines of aligned cells as observed by Turneret al. (1983), indicating that cell behaviour, and not a fibro-nectin pre-pattern, is responsible for this organization.

Observation of live C2C12 cell behaviour on fibronectinhas revealed that the cells migrate and align collectively,forming streams of cells, a behaviour that, to our knowl-edge, has not previously been reported for myoblasts. Itnevertheless resembles that seen in neural crest cells forwhich N-cadherin mediates directional collective cell migra-tion on a fibronectin substrate (Theveneau et al. 2010), andthe N-cadherin-dependent migration of zebrafish cerebellargranule precursors cells in vivo (Rieger et al. 2009). Severallines of evidence point to a cross-talk between adhesion tofibronectin through RGD-binding integrins and N-cadherinexpression and/or subcellular localization. For example, theoverexpression of the α5 integrin subunit in cultured quailmyoblasts results in N-cadherin upregulation and a block incell migration (Huttenlocher et al. 1998), whereas the basalengagement of fibronectin through α5β1 polarizes N-cadherin to the apical cell domain in epithelializing somites(Martins et al. 2009). Both fibronectin and N-cadherin ap-pear to be important for the migration of MPCs duringdevelopment, since antibodies against N-cadherin (Brand-Saberi et al. 1996) and the cell-binding domain of fibronec-tin (Brand-Saberi et al. 1993) block the migration of MPCsinto the developing limb bud. Our results are thus consistentwith a model in which collaboration between RGD-bindingintegrins and N-cadherin promotes directional collective cellmigration of C2C12 cells on fibronectin.

We have also found that a larger number of myotubeswith more nuclei per myotube form when C2C12 cells aregrown on fibronectin rather than on gelatine. Furthermore,this increase in myotube formation occurs without an in-crease in myogenin expression. This suggests that the direc-tional collective migration and the subsequent alignment ofC2C12 cells potentiate cell-cell interactions and increase theprobability of fusion. We therefore hypothesize that thecross-talk between RGD-binding integrins and N-cadherinplays a significant role in aiding cell alignment and cell-cellcontact. The consequent close apposition of cells might thenfacilitate further adhesion through α4β1-VCAM-1 bindingand subsequent fusion. Furthermore, our data raise the pos-sibility that α4β1-fibronectin engagement also plays a mi-nor role in promoting myoblast fusion, for example, bystabilizing the aligned cells on the substrate. Indeed, α4β1has been shown to mediate binding to a fibronectin substratein cells lacking the α5 integrin subunit (Disatnik and Rando1999).

Although our results strongly argue for a role of RGD-binding integrins in the directional collective migration andalignment of C2C12 myoblasts, further studies are neces-sary to determine whether such a mechanism occurs in the invivo activated satellite cell. Live imaging of primary satel-lite cells on isolated muscle fibres cultured in vitro show thatactivated satellite cells migrate through the basal laminasurrounding the muscle fibre and then use this basal lamina

576 Cell Tissue Res (2012) 348:569–578

as a migration substrate (Siegel et al. 2009). Nevertheless,fibronectin is abundantly present not only close to the basallamina of the myofibres in vivo, but also in the interstitialtissue between fibres, in the endomysial, perimysial andepimysial connective tissue of the muscle (Sanes 1982).Interestingly, myoblasts, which do not produce much fibro-nectin themselves, are known to use fibronectin producedby other cells to migrate and align (Turner et al. 1983).Thus, fibronectin, alone or in combination with the myofibrebasal lamina, might play a role in guiding satellite cells invivo, thereby promoting their migration and alignment.

In conclusion, our results reveal the importance of fibronec-tin as a substrate for the migration, alignment and fusion ofC2C12 cells. We also show that C2C12 cells use RGD-bindingintegrins to adhere to the substrate, to migrate in a collectiveand directional manner and to align in preparation for fusion.This behaviour in turn enhances myotube formation in a pro-cess independent of myogenic differentiation.

Acknowledgements We are grateful to the members of our group forhelpful discussions and to our laboratory rotation students, MárcioMadureira and Ana Rita Leitoguinho, for help with RT-PCR. TheMF20, F5D and MNCD2 antibodies developed by D.A. Fishman, byW.E. Wright and M. Takeichi and by H. Matsunami, respectively, wereobtained from the Developmental Studies Hybridoma Bank, developedunder the auspices of the NICHD and maintained by The University ofIowa, Department of Biology, Iowa City, IA52242.

References

Boettiger D, Enomoto-Iwamoto M, Yoon HY, Hofer U, Menko AS,Chiquet-Ehrismann R (1995) Regulation of integrin α5β1 affinityduring myogenic differentiation. Dev Biol 169:261–272

Brand-Saberi B, Krenn V, Grim M, Christ B (1993) Differences in thefibronectin-dependence of migrating cell populations. AnatEmbryol (Berl) 187:17–26

Brand-Saberi B, Gamel AJ, Krenn V, Müller TS, Wilting J, Christ B(1996) N-Cadherin is involved in myoblast migration and muscledifferentiation in the avian limb bud. Dev Biol 178:160–173

Buckingham M (2006) Myogenic progenitor cells and skeletal myo-genesis in vertebrates. Curr Opin Genet Dev 16:525–532

Burattini S, Ferri P, Battistelli M, Curci R, Luchetti F, Falcieri E (2004)C2C12 murine myoblasts as a model of skeletal muscle develop-ment: morpho-functional characterization. Eur J Histochem48:223–233

Cachaço AS, Pereira CS, Pardal RG, Bajanca F, Thorsteinsdóttir S(2005) Integrin repertoire on myogenic cells changes during thecourse of primary myogenesis in the mouse. Dev Dyn 232:1069–1078

Danen EHJ, Sonnenberg A (2003) Integrins in regulation of tissuedevelopment and function. J Pathol 200:471–480

Dhawan J, Rando TA (2005) Stem cells in postnatal myogenesis:molecular mechanisms of satellite cell quiescence, activationand replenishment. Trends Cell Biol 15:666–673

Disatnik MH, Rando TA (1999) Integrin-mediated muscle cell spreading.The role of protein kinase C in outside-in and inside-out signalingand evidence of integrin cross-talk. J Biol Chem 274:32486–32492

García AJ, Vega MD, Boettiger D (1999) Modulation of cell prolifer-ation and differentiation through substrate-dependent changes infibronectin conformation. Mol Biol Cell 10:785–798

Goody MF, Henry CA (2010) Dynamic interactions between cells andtheir extracellular matrix mediate embryonic development. MolReprod Dev 77:475–488

Huttenlocher A, LakonishokM, Kinder M,Wu S, Truong T, Knudsen KA,Horwitz AF (1998) Integrin and cadherin synergy regulates contactinhibition of migration and motile activity. J Cell Biol 141:515–526

Hynes RO (1992) Integrins: versatility, modulation, and signaling incell adhesion. Cell 69:11–25

Jansen KM, Pavlath GK (2008) Molecular control of mammalianmyoblast fusion. Methods Mol Biol 475:115–133

KnudsenKA,Myers L,McElwee SA (1990) A role for the Ca2+-dependentadhesion molecule, N-cadherin, in myoblast interaction during myo-genesis. Exp Cell Res 188:175–184

Lan MA, Gersbach CA, Michael KE, Keselowsky BG, García AJ(2005) Myoblast proliferation and differentiation on fibronectin-coated self assembled monolayers presenting different surfacechemistries. Biomaterials 26:4523–4531

Larsen M, Artym VV, Green JA, Yamada KM (2006) The matrixreorganized: extracellular matrix remodeling and integrin signaling.Curr Opin Cell Biol 18:463–471

Linask KK, Ludwig C, Han MD, Liu X, Radice GL, Knudsen KA(1998) N-cadherin/catenin-mediated morphoregulation of somiteformation. Dev Biol 202:85–102

Martins GG, Rifes P, Amândio R, Rodrigues G, Palmeirim I,Thorsteinsdóttir S (2009) Dynamic 3D cell rearrangements guidedby a fibronectin matrix underlie somitogenesis. PLoS One 4:e7429

May MJ, Entwistle G, Humphries MJ, Ager A (1993) VCAM-1 is aCS1 peptide-inhibitable adhesion molecule expressed by lymphnode high endothelium. J Cell Sci 106:109–119

Osses N, Brandan E (2002) ECM is required for skeletal muscledifferentiation independently of muscle regulatory factor expression.Am J Physiol Cell Physiol 282:C383–C394

Rieger S, Senghaas N, Walch A, Köster RW (2009) Cadherin-2 controlsdirectional chain migration of cerebellar granule neurons. PLoS Biol7:e1000240

Rochlin K, Yu S, Roy S, Baylies MK (2010) Myoblast fusion: when ittakes more to make one. Dev Biol 341:66–83

Rosen GD, Sanes JR, LaChance R, Cunningham JM, Roman J, DeanDC (1992) Roles for the integrin VLA-4 and its counter receptorVCAM-1 in myogenesis. Cell 69:1107–1119

Rozario T, DeSimone DW (2010) The extracellular matrix in develop-ment and morphogenesis: a dynamic view. Dev Biol 341:126–140

Ruoslahti E (1991) Integrins. J Clin Invest 87:1–5Sanes JR (1982) Laminin, fibronectin, and collagen in synaptic and

extrasynaptic portions of muscle fiber basement membrane. J CellBiol 93:442–451

Sastry SK, Lakonishok M, Thomas DA, Muschler J, Horwitz AF (1996)Integrin α subunit ratios, cytoplasmic domains, and growth factorsynergy regulate muscle proliferation and differentiation. J Cell Biol133:169–184

Siegel AL, Atchison K, Fisher KE, Davis GE, Cornelison DD (2009)3D timelapse analysis of muscle satellite cell motility. Stem Cells27:2527–2538

Takahashi S, Leiss M, Moser M, Ohashi T, Kitao T, Heckmann D,Pfeifer A, Kessler H, Takagi J, Erickson HP, Fässler R (2007) TheRGD motif in fibronectin is essential for development but dis-pensable for fibril assembly. J Cell Biol 178:167–178

Theveneau E, Marchant L, Kuriyama S, Gull M, Moepps B, ParsonsM, Mayor R (2010) Collective chemotaxis requires contact-dependent cell polarity. Dev Cell 19:39–53

Thorsteinsdóttir S, Deries M, Cachaço AS, Bajanca F (2011) Theextracellular matrix dimension of skeletal muscle development.Dev Biol 354:191–207

Cell Tissue Res (2012) 348:569–578 577

Turner DC, Lawton J, Dollenmeier P, Ehrismann R, Chiquet M (1983)Guidance of myogenic cell migration by oriented deposits offibronectin. Dev Biol 95:497–504

van der Flier A, Gaspar AC, Thorsteinsdóttir S, Baudoin C, Groene-veld E, Mummery CL, Sonnenberg A (1997) Spatial and temporalexpression of the β1D integrin during mouse development. DevDyn 210:472–486

Vellón L, Royo F, Matthiesen R, Torres-Fuenzalida J, Lorenti A,Parada LA (2010) Functional blockade of α5β1 integrin inducesscattering and genomic landscape remodeling of hepatic progenitorcells. BMC Cell Biol 11:81

von der Mark K, Öcalan M (1989) Antagonistic effects of laminin andfibronectin on the expression of the myogenic phenotype. Differ-entiation 40:150–157

Yaffe D, Saxel O (1977) Serial passaging and differentiation of myogeniccells isolated from dystrophic mouse muscle. Nature 270:725–727

Yao CC, Ziober BL, Sutherland AE, Mendrick DL, Kramer RH (1996)Laminins promote the locomotion of skeletal myoblasts via thealpha 7 integrin receptor. J Cell Sci 109:3139–3150

Yurchenco PD, Amenta PS, Patton BL (2004) Basement membraneassembly, stability and activities observed through a developmentallens. Matrix Biol 22:521–538

Zammit PS, Partridge TA, Yablonka-Reuveni Z (2006) the skeletalmuscle satellite cell: the stem cell that came in from the cold. JHistochem Cytochem 54:1177–1191

Zeschnigk M, Kozian D, Kuch C, Schmoll M, Starzinski-Powitz A(1995) Involvement of M-cadherin in terminal differentiation ofskeletal muscle cells. J Cell Sci 108:2973–2981

578 Cell Tissue Res (2012) 348:569–578