fezf2 regulates brn3b in developing retinatranscription regulation; neurodevelopment; mouse ....
TRANSCRIPT
-
Fezf2 regulates Brn3b in developing retina
1
Transient Expression of Fez Family Zinc Finger 2 Regulates Brn3b in Developing Retinal Ganglion
Cells
Chunsheng Qu1,3,#
, Dandan Bian1,#
, Xue Li1, Jian Xiao
1, Chunping Wu
1, Yue Li
2, Tian Jiang
1, Xiangtian
Zhou1, Jia Qu
1, Jie-Guang Chen
1*
1School of Ophthalmology and Optometry and Eye Hospital, Wenzhou Medical University, China State
Key Laboratory Cultivation Base and Key Laboratory of Vision Science, Ministry of Health of China, and
Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, Wenzhou, Zhejiang 325000,
China.
2Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven,
CT 06520
3Clinical laboratory of LiShui People's Hospital, the Sixth Affiliated Hospital of Wenzhou Medical
University, LiShui, Zhejiang 323000, China
# C. Qu and D. Bian contributed equally to this work
Running Title: Fezf2 regulates Brn3b in developing retina
*Corresponding author:
Key Laboratory of Visual Science, and School of Optometry and Ophthalmology,
Wenzhou Medical University, 270 Xueyuan Road, Wenzhou, Zhejiang 325003, P.R. China.
Tel.: +86-577-88067927; Fax: +86-577-88067934.
Email Address: Jie-Guang Chen ,
Keywords:
Fezf2; Brn3b; Retinal Ganglion Cells; In Utero Electroporation; Gene Knockout; Gene Expression;
Transcription Regulation; Neurodevelopment; Mouse
Abstract
Retinal ganglion cells (RGCs) are projection
neurons in the neural retina that relay visual
information from the environment to the central
nervous system. The early expression of MATH5
endows the post-mitotic precursors with RGC
competence and leads to the activation of Brn3b
that marks committed RGCs. Nevertheless, this
fate-commitment process and specifically,
regulation of Brn3b remains elusive. To explore
the molecular mechanisms underlying RGC
generation in the mouse retina, we analyzed the
expression and function of Fez family zinc finger
2 (FEZF2), a transcription factor critical for the
development of projection neurons in the cerebral
cortex. Fezf2 mRNA and protein were transiently
expressed at E16.5 in the inner neuroblast layer
and the prospective ganglion cell layer of retina,
respectively. Knockout of Fezf2 in the developing
retina reduced BRN3B+ cells and increased
http://www.jbc.org/cgi/doi/10.1074/jbc.M115.689448The latest version is at JBC Papers in Press. Published on February 9, 2016 as Manuscript M115.689448
Copyright 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
mailto:[email protected]://www.jbc.org/cgi/doi/10.1074/jbc.M115.689448http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
2
apoptotic cell markers. Fezf2 knockdown by
retinal in utero electroporation diminished BRN3B,
but not the coexpressed ISLET1 and BRN3A,
indicating that the BRN3B decrease was the cause,
not the result, of the overall reduction of BRN3B+
RGCs in the Fezf2 knockout retina. Moreover, the
mRNA and a promoter activity of Brn3b were
increased in vitro by FEZF2, which bound to a 5´-
regulatory fragment in the Brn3b genomic locus.
These results indicate that transient expression of
Fezf2 in the retina modulates the transcription of
Brn3b and the survival of RGCs. This study
improves our understanding of the transcriptional
cascade required for the specification of RGCs and
provides novel insights into the molecular basis of
the retinal development.
Introduction
Retinal ganglion cells (RGCs) are generated from
a pool of retinal progenitor cells (RPCs). In all
vertebrates examined, RGCs are the first-born
neurons in the retina. In mice, multipotent RPCs
begin to exit mitosis and differentiate into RGC-
competent precursors around embryonic day 11
(E11). RGC-competence is fundamentally a cell-
intrinsic process that is activated by the early
expression of basic helix–loop–helix (bHLH)
transcription factor MATH5, a targeted deletion of
which blocks the formation of most RGCs (1).
MATH5 is expressed during or after the terminal
mitosis of RPCs (2), leading to a regulatory
cascade for RGC development. MATH5 induces
the expression of class IV POU-domain
transcription factor Pou4f2 (also known as
BRN3B), which is essential for the survival of
differentiated ganglion cells (3,4). Remarkably,
when Brn3b is selectively deleted, a significant
portion of RGCs dies by an enhanced apoptosis
(5,6). Moreover, BRN3B acts as a safeguard
mechanism by repressing cell differentiation of
amacrine and horizontal cells during the fate
commitment of RGCs (7). Although BRN3B
marks committed RGCs, it regulates RGC
maturation together with LIM-homeodomain
transcription factor ISLET1 that co-expresses with
BRN3B in post-mitotic, differentiating RGCs (8-
10).
MATH5 is critical for the competence and
hence the formation of RGC (1,2,11). The
regulation of fate commitment of RGC from the
competent cells is unclear since MATH5+
progenitors have the potential to give rise to all
seven major retinal cell types (12). In addition,
the temporal expression patterns of Math5 and
Brn3b mRNA are not identical. Brn3b show a
progressive increase starting from E12.5 and
persists at E16.5 when Math5 starts to decline
(2,5,13). A recent lineage tracing study of Math5-
expressing cells in the retina also argues that not
all of RGCs descends from MATH5+ progenitors
(14). Therefore, the precise transcriptional cascade
leading to the generation of RGCs remains to be
explored.
RGCs transmit visual information from the
environment to the central nervous system and are
the sole projection neurons in the retina. The
projection neurons in the cerebral cortex have
been extensively studied by in vivo genetic
manipulations. It was found that transcription
factor FEZF2 (also known as FEZL and ZFP312)
was expressed by the early neural progenitors in
the ventricular zone of the dorsal telencephalon.
Zinc finger protein FEZF2 represses the
expression of Hes5 in the proliferating neural stem
cells (15,16) and regulates the differentiation of
telencephalic precursors from mouse embryonic
stem cells (17). Fezf2 is required for the proper
specification and differentiation of subcerebral
projection neurons in the deep layers of cerebral
cortex (18-20). Overall, these observations led us
to hypothesize that Fezf2 may regulate
specification of the retinal projection neuron,
RGCs.
In this study, we have examined the
expression and function of Fezf2 in the developing
retinas. We found that Fezf2 was transiently
expressed in retinas during the generation of
RGCs. To investigate the role of Fezf2, we
inhibited its expression by RNA interference and
deleted the gene by conditional Fezf2-knockout in
the retina. Our results showed that knockdown and
knockout of Fezf2 led to BRN3B inhibition and
impaired the formation of RGCs. Moreover,
FEZF2 regulated the transcription of Brn3b by
binding to a 5’-regulatory sequence of the Brn3b
locus.
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
3
Experimental Procedures
Animals and Genotyping
Animal procedures were performed by the
protocol approved by Animal Care Committee of
Wenzhou Medical University. Tg (Fezf2-EGFP)
mice were created by the GENSAT project
(http://www.gensat.org/index.html) and obtained
from Mutant Mouse Regional Resource Center
(MMRC, USA). Fezf2flox/flox
mice were kindly
provided by Nenad Sestan at Yale University. The
exon 2, which encodes amino acids 1-279 of 455
in FEZF2, was targeted for removal (21). Tg(Six3-
cre)69Frty mouse was created by Yasuhide Furuta
at RIKEN Center for Developmental Biology in
Japan (22), and was initially obtained from Lin
Gan at University of Rochester Medical Center.
Dr. Furuta kindly granted permission for its use by
our group. The Fezf2 second exon was deleted in
retinas by crossing Fezf2flox/flox
and Six3-Cre mice.
The retina-specific knockout of Fezf2 was
identified by PCR genotyping using three primers
located in exon 1-3 of Fezf2 as described before
(21). The loss of Fezf2 expression was further
confirmed by quantitative PCR (q-PCR) or
Western blot in one eye whereas the counterpart
eye from the same embryo was taken for the
knockout study.
Tissue preparation
Mouse pups were put on ice to induce
hypothermia while pregnant dams were
anesthetized with Ketamine 100 mg/kg and
Xylazine 10mg/kg. Eyes from prenatal mice were
enucleated under a dissecting microscope and
fixed by immersion in 4% paraformaldehyde
(PFA). All tissues were cryoprotected in 30%
sucrose at 4°C, frozen by liquid nitrogen vapor,
and then embedded in OCT compound (Sakura
Tissue Tek, Torrance, CA). Cryosections of 16 μm
were mounted in Superfrost microscope slides
(Fisher Scientific, PA) for in situ
hybridization(ISH) and immunofluorescence (IF)
staining.
Immunostaining
We performed IF staining in the developing
retinas to determine the expression of molecular
markers of retinal cells. Cryosections of retinas
were washed and blocked at room temperature for
2 hours in a blocking solution (5% donkey normal
serum plus 1% BSA, 0.2% glycine, 0.2% lysine
and 0.3% Triton). The sections were incubated
overnight at 4°C with primary antibodies diluted
in the blocking solution. The antibodies used in
this study were mouse anti-SMI32 (1:200,
Covance, #14942601), goat anti-BRN3B (1:50,
Santa Cruz Biotechnology, sc-31989), rabbit anti-
MATH5 (1:200, Abcam, ab78046), rabbit anti-
ISLET1 (1:200, Abcam, ab20670), rabbit anti-
CASPASE III (1:200, Cell Signaling Technology,
#9622), goat anti-BRN3A (1:50, Santa Cruz
Biotechnology, sc-31984), and rabbit anti-FEZF2
(1:500, Abcam, ab69436). The samples were
processed with secondary antibodies: CyTM
3-
conjugated anti-rabbit IgG and dylightTM
549-
conjugated anti-Goat IgG (Jackson
ImmunoResearch, Laboratories, PA) at a 1:400
dilution. Fluorescence images were taken using a
laser scanning confocal microscope (Zeiss).
RNA in situ hybridization
Nonradioactive RNA in situ hybridizations of
Fezf2 were performed as described previously (18).
Digoxigenin (DIG)-labeled Fezf2 riboprobe
(corresponding to nucleotides 1241–1734 of
NM_080433) was generated by in vitro
transcription from a linearized TopoII-Fezf2
plasmid. The cryosections were hybridized with
the probe in a hybridization buffer (50%
formamide, 4XSSC, 50 mM NaH2PO4, 100 μg/ml
t-RNA, 7.5% Dextran Sulfate, 1X Denharts and
500 μg salmon sperm DNA) overnight at 65°C.
After high-stringency post-hybridization washes,
the hybridization signal was detected with an
alkaline phosphatase-conjugated anti-DIG
antibody and developed using NBT/BCIP
chromogen (Roche, IN). Hybridization pictures
were taken using a Nikon microscope (SMZ1500)
and an Olympus microscope (EX41).
Plasmid Constructs
For in vivo inhibition of Fezf2 expression, we
used Zfp312 siRNA-1 and Zfp312 siRNA-2 with
targeting sequence
GGAGAACTCGGCCTTGACA at 775-793, and
GGTGTTCAATGCTCACTAT at 886-904, of the
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
4
coding region of Fezf2, respectively. The
scrambled scRNA-1 and scRNA-2 were created by
introducing three mutations in the target sequences.
The Zfp312 siRNA-1 and its scramble were cloned
in the lentiviral vector pLVTH while Zfp312
siRNA-2 and its scramble were created based on
pCGLH. All these constructs have been verified
in the previous study of Fezf2 functions in the
cerebral cortex (18). For Fezf2 expression, full-
length Fezf2 was cloned into pCAGEN (Addgene)
that harbors a CAG promoter. For chromatin
immunoprecipitation (ChIP), a V5 tag
(GKPIPNPLLGLDST) was inserted into Fezf2-
pCAGEN and pCAGGS-GFP following the
startup codon ATG of Fezf2 and GFP, respectively,
by PCR in-frame cloning.
To measure the promoter activity in the 5’-
regulatory region of Brn3b, a conservative one kb
fragment upstream from starting site of Brn3b was
amplified by PCR using primers
(tcgctttcttccttctctgaa and
cggcaataatctaataatagctgtcaa). The PCR product
was cloned into pGL4.18, a promoterless firefly
luciferase vector co-expressing neomycin
resistance gene (Promega). Mouse neuroblastoma
N2a cells were transfected with the pGL4.18-
promoter and cultured in the presence of G418 for
two months to select the cells stably expressing the
plasmid. All constructs were confirmed by
sequencing prior to the in vivo and in vitro
experiments.
Retinal in utero electroporation
Plasmids were delivered to the developing
retina by retinal in utero electroporation (IUE)
(23). Briefly, E13.5 pregnant mice were
anesthetized and attached to a clean table. The
abdominal cavity was opened to expose the uterine
horns. DNA solution (4 μg/μl in Tris-EDTA buffer
containing 0.1% fast green) were injected through
the uterus wall using a polished pulled glass
micropipette. The head of each embryo was placed
between tweezer-type electrodes, and five square
electric pulses (38 V, 50 ms) were passed at one-
second intervals using a BTX electroporator. The
wall and skin of the abdominal cavity were aligned
and sutured. The embryos were allowed to develop
in vivo until E17.5 or P7. Then the mice were
sacrificed to remove the brains together with eyes
for fixation in PFA.
FACS sorting:
To study the effect of Fezf2, we isolated
E17.5 retinas from the Fezf2-siRNA-transfected
mice. Retinas were peeled from the eyeballs and
collected under a stereomicroscope (ZEISS).
The tissues were minced and incubated with 0.05%
trypsin for 8 min at 37°C. Single cell suspensions
were prepared by trituration, suspension, and
filtration. GFP+ cells were separated by
fluorescence-activated cell sorting (FACS) using
FACSAria II cell sorter (BD Biosciences) and
were taken for measuring the gene expression by
quantitative PCR (q-PCR).
Real-time RT-PCR
To quantitate the gene expression of Fezf2
and Brn3b, we synthesized cDNA from the RNA
isolated from the retina (SuperScriptTM
First-
Strand Synthesis System, Invitrogen).
Quantitative PCR (q-PCR) was performed using
an ABI 7900 system (Applied Biosystems) and
monitored based on SYBR Green I dye detection
with the primer sets for Fezf2
(accatggtctccagggaag; tcggaacgcatctccttg) and
Brn3b (tcgctttcttccttctctgaa;
cggcaataatctaataatagctgtcaa). The primer sets are
unique to the targeted genes and do not map to any
other genes in the mouse genome according to
blast search. Gene expression levels were
normalized to a reference gene Actin. The Ct
value was defined as the number of PCR cycles
required for the fluorescent signal to grow beyond
a threshold.
Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) was
performed by following the protocol of EZ CHIP
KIT (Millipore, 17-371). N2a cells were
transfected with pCAG-V5-Fezf2 and pCAG-V5-
GFP. The cells were crosslinked with 1% PFA
and lysed on the ice. The lysates were sonicated to
shear the chromatin and incubated overnight at
4°C with anti-V5 antibody bound to Dynal Protein
A/G beads (1:10; Abcam, ChIP Grade ab9116).
The precipitate from V5-FEZF2 and V5-GFP in
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
5
Dynabeads was extensively washed and eluted at
65°C for 15 min with Elusion Buffer (1% SDS, 10%
1M NaHCO3 in H2O). The eluted protein-
chromatin complexes were reverse-crosslinked by
incubation with 5M NaCl overnight at 65°C. Both
ChIPed and input DNA were treated with RNaseA,
proteinase K and then followed by DNA
purification.
PCR and q-PCR of ChIP DNA
To determine if FEZF2 binds to Brn3b
genomic DNA, we amplified a tentative regulatory
region of Brn3b (-315 ~ +310) (chr8: 78436342-
78436967) by PCR with a primer set
(GTGCAGGCTGCCTGCGTGA;
CCGAAGCACCGACCTGGCTAG). The input
DNA from the transfected cells was taken as a
positive control for gel analysis of ChIP DNA. In
a similar manner, the region covering FEZF2
binding motifs (CAGCAACC) (-230~-137) was
examined by q-PCR with primers
(GCAGGCTCCGGTCCTT;
ACAGCAGAGCGCCTGC). A part of 3’UTR of
Brn3b (1507 to 1595) was amplified as a negative
control by primers
(ACCGGAATTGTTTTCTGATAGC;
CTTTCCCTTCGCCCTCTTT).
Data analysis
For all q-PCR and the luciferase assay, data
were presented as mean±SD from three
independent experiments with duplication of
reading. For cell counting from the
immunostaining, mean and standard deviation
were calculated from 12 sections based on 3-4
samples (eyes). Control and the experimental
group were compared by Independent-Samples T
Test using SPSS 17.0 software (SPSS Inc, USA).
* designates a statistic difference with *p
-
Fezf2 regulates Brn3b in developing retina
6
compared with the control at E17.5 (Fig 3C).
Knocking out Fezf2 attenuated Brn3b mRNA
levels (Fig 3C) and reduced BRN3B protein in the
isolated retina (Fig 3D). The number of BRN3B+
cells was reduced in the retinal sections from the
knockout mice (Fig 3E). The wild-type retina had
42.6 ± 3.0 BRN3B+ cells (per field, 40x) in the
GCL, which decreased to 23.8 ± 2.1 when Fezf2
was deleted (Fig 3F). We also noticed an almost
complete reduction of BRN3B+ cells in the NBL
(Fig 3E and 3F). A few of BRN3B+ cells
scattered in NBL of the wild-type mice represent
the newly generated ganglion cells en route to the
GCL.
Previous studies have established that Brn3b
is required for preventing nascent RGCs from
apoptotic cell death during retinal development
(5,26). Therefore, we investigated apoptotic cells
in control and Fezf2-null retinas by the activation
of CASPASE III. The cells with activated
CASPASE III were found in the GCL of Fezf2-/-
retina (Fig 3E). Fezf2-deleted retina had a 2.5-fold
more of CASPASE III+ cells than did the wild-
type at E17.5 (Fig 3G) when maximum apoptosis
occurs in the Brn3b-knockout mice (5). The
number of apoptotic cells in the Fezf2 knockout
retina is comparable with that in the Brn3b-deleted
retina at E17.5 (5). The increase in apoptosis in
the Fezf2-/- retina suggests that Fezf2 is needed for
the proper function of Brn3b in the developing
retina.
The reduction of RGC marker BRN3B was
similarly observed in the P7 retina. In Fezf2-null
retinas, BRN3B+ cells were reduced to about 47.3%
of those in wild-type littermates (Fig 4A and 4B).
As an alternative approach to determining the cell
types that reduced in Fezf2 (-/-) retinas, we
immunostained retinas with anti-SMI-32, which
predominantly labels the axons of RGCs (6). As
shown in Fig 4C, Fezf2(-/-) retinas had a
decreased population of SMI-32 immunoreactive
processes, suggesting a loss of RGC axons.
Consistently, the optic nerve appeared thinner in
the Fezf2-deleted retina as compared with the
control (Fig 4D). In addition, we noticed that
axons from Fezf2 knockout RGCs occasionally
bifurcated within the retina (Fig 4C), reminiscence
of aberrant axonal trajectories as seen in the Brn3b
knockout retina (27). All these results support that
the transient expression of Fezf2 is essential for
the proper expression of Brn3b and formation of
RGCs.
3. Fezf2 knockdown inhibits BRN3B
expression
Fezf2 knockout reduced BRN3B+ RGCs in
the retina, either as direct effects of inhibition of
Brn3b expression or as effects of developmental
changes leading to loss of BRN3B+ RGCs
indirectly. To determine whether the loss of
BRN3B+ RGCs was caused by a cell autonomous
or a non-cell autonomous mechanism, we knocked
down Fezf2 in a small population of retinal cells
within the context of a healthy environment by
retinal in utero electroporation (IUE). Fezf2 in the
developing retina was knocked down with
lentiviral shRNA that specifically inhibit Fezf2
expression by RNA interference (18). Plasmid
pLVTH-Fezf2-siRNA-1 that harbors a reporter
gene Gfp was delivered into the eyecups of E13.5
embryos by IUE. The consequences of Fezf2
inhibition were examined in the transfected retinas
at E17.5, one day after the maximal expression of
endogenous Fezf2 (Fig 1 and 2). The cells
expressing the siRNA moved to the GCL normally
as those expressing pLVTH-Fezf2-scRNA-1, a
scramble RNA that does not target to any
sequences. This result suggests that the inhibition
of Fezf2 does not interfere with the normal
migration of RGCs. We analyzed the expression
of marker genes, MATH5, ISLET1, BRN3B in the
transfected cells by IF. Substantial populations of
scramble RNA-electroporated cells expressed
MATH5, ISLET1, and BRN3B as measured by
their colocalization with the co-transfected GFP
(Fig 5A). MATH5 and ISLET1 were expressed
similarly in the Fezf2-siRNA-transfected cells as
in the scramble transfectants (MATH5 siRNA
24.8%, scRNA23.2%; ISLET1 siRNA 23.8%,
scRNA21.4%). In contrast, compared to the
scrambled control, introducing Fezf2-siRNA-1
resulted in a massive reduction of BRN3B-positive
cells (siRNA 1.1%, scRNA17.2%) (Fig 5B).
Likewise, Fezf2-siRNA-2, but not the
correspondent scramble control, diminished the
BRN3B+ cells in the developing retina (data not
shown). The similar effect introduced by two
siRNAs that target to different locations in the
FEZF2 supports that the inhibition of BRN3B was
attributed to the knockdown of FEZF2 specifically.
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
7
Fezf2 inhibition abolished BRN3B+ cells, but not
ISLET1 that coexpresses with BRN3B,
demonstrating that Fezf2 is essential for the
expression of Brn3b, rather than controls the
survival of BRN3B + RGCs directly.
In mature retinas, BRN3A and BRN3B are
each expressed in approximate 70% RGCs in an
overlapping pattern. Since Brn3a was considered
as a downstream target of Brn3b (28), we
evaluated the expression of BRN3A in the cells
knocking down with Fezf2-siRNA-2. Fezf2
inhibition did not change significantly the ratio of
colocalization of BRN3A+ and the transfectants
(Fig 5D and 5E), indicating that Fezf2 inhibition
had no effect on the expression of BRN3A. Our
result is consistent with the previous study with a
knock-in alkaline phosphatase to visualize
individual genetically altered RGCs. It was found
that Brn3b is not required for the maintenance of
Brn3a expression in the RGCs. The loss of Brn3a
in Brn3b-null retinas is more likely due to an
overall reduction of the BRN3A+ RGC number
rather than the inhibition of Brn3a expression (27).
Since FEZF2 is a transcription factor, we
envisioned that the transcription and mRNA level
of Brn3b may be subject to the regulation by
FEZF2. To test this, we inhibited the Fezf2
expression by electroporating pLVTH-Fezf2-
siRNA-1 and pLVTH-Fezf2-scRNA-1 plasmids
into the eyecups of E13.5 embryos. The
electroporated cells were dissociated from the
retinas at E17.5 and isolated by FACS on the basis
of expression of the reporter GFP. Assays with q-
PCR revealed that Fezf2-siRNA-expressing cells
had a decreased level of Brn3b mRNA relative to
those expressing the scramble control, following
the inhibited expression of Fezf2 by the
interference RNA (Fig 5C). This data suggests that
Brn3b depends on the transient expression of
Fezf2 during the retinal development.
To determine if FEZF2 is a determinant of
Brn3b expression in vivo, we also performed a
gain of functional study by in utero
electroporation of Fezf2-pCAGEN into the
developing retina. Expression of Fezf2 under a
CAG promoter resulted in overall inhibitions of
RGC-related genes including Math5, Islet1 and
Brn3b (Fig 6). A strong ectopic expression of this
transcription factor may alter the phenotype of
host cells dramatically. It was found that striatal
progenitors change their fate from medium spiny
neurons to cortical-like projection neurons after
ectopic expression of Fezf2 (29). The intrinsic
transient expression, but not a high and sustained
expression of Fezf2, is essential for RGC
development in the retina.
4. FEZF2 binds to and activates a 5’-
regulatory region of Brn3b
Since both knockout and knockdown of Fezf2
decreased Brn3b mRNA in retinas (Fig 3C and
4C), Fezf2 may regulate Brn3b at the transcription
level. FEZF2 acted as a histone deacetylase-
associated repressor down-regulating multiple
oncogenes through direct binding to their
promoters (30). In zebrafish, FEZF2 binds to a
core consensus-binding site (CAGCAACC), by
which the transcription factor drives a forebrain
enhancer activity of reporter genes both in vitro
and in vivo (31). Four contiguous FEZF2 binding
motifs are located at -274, -195, +21, +211 of the
transcriptional starting site of Brn3b locus (Fig
7A). We cloned this tentative regulatory region
containing the Fezf2-binding motifs into pGL4.18,
a luciferase reporter vector for measuring
promoter activity. The pGL4.18-Brn3b-promoter
was stably expressed in Neuroblastoma N2a cells,
which then were transiently transfected with
Fezf2-pCAGEN and pCAGEN, or pLVTH-Fezf2-
siRNA-1 and pLVTH-Fezf2-scRNA-1. The
relative luciferase activity of Fezf2-transfected
cells was 2.1-fold higher than that of control.
Conversely, the activity of Fezf2-siRNA-
transfected group was decreased by 51.6% as
compared to those of the scrambled control (Fig
7B). The results indicate that this regulatory
sequence near the five prime untranslated region
(5’UTR) is positively regulated by FEZF2 and
constitutes a part of Brn3b promoter.
To investigate whether the increased
transcriptional activity mediated by the Brn3b-
promoter resulted from FEZF2 binding, we
generated V5-tagged GFP and Fezf2 expression
constructs and expressed the fusion proteins into
the N2a cells. The DNA fragments bound to
FEZF2 were isolated by chromatin
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
8
immunoprecipitation (ChIP) with a V5 antibody
and analyzed by q-PCR and gel electrophoresis
following PCR. The region by which FEZF2
activated the reporter activity was successfully
amplified by PCR using the ChIP DNA as a
template (Fig 7C). Consistently, the predicted
binding fragment of FEZF2 was enriched by 3.7-
fold when compared to the 3’UTR as assayed by
q-PCR (Fig 7D). In contrast, V5 antibody failed
to pull-down the Brn3b promoter region from the
cells expressing V5-GFP (Fig 7C). The data
suggest that FEZF2 binds to a promoter region that
contains FEZF2 consensus-binding sites and helps
to drive the transcription of Brn3b.
Discussion:
Retinal neurons start to generate from
neuroepithelial cells in the optic cup during the
middle gestation. Newly generated neurons exit
the cell cycle and migrate toward the inner (vitreal)
side of the optic cup. By E13.5, the retina begins
to transform from a uniform sheet of
neuroepithelial cells into two layers of prospective
GCL and NBL. The present study examined the
expression and function of FEZF2, a key
transcription factor regulating the cortical
projection neurons, in the developing retina. We
found that a peak of transient expression of Fezf2
mRNA occurs at E16.5 in the NBL where the
retinal progenitors are located (Fig 1).
Interestingly, FEZF2 protein was found in the
GCL and colocalized with the RGC marker
BRN3B (Fig 2). The transient expression of Fezf2
in the migrating retinal cells may allow its protein
to accumulate in the post-migratory neurons in
GCL. The pattern of Fezf2 expression is spatially
analog to that of Math5. A knock-in lacZ at Math5
locus appeared in the retina including GCL (2),
despite that Math5 mRNA was expressed in the
NBL at E15.5 (11). The expression of Fezf2 at
E16.5 supports it as a later regulator of Brn3b;
Fezf2 may not regulate the peak formation (E11.5-
14.5) but help the survival of RGC around E17.5
when the maximal apoptosis occurs (5).
The roles of Fezf2 in the developing retina
were examined by the studies of loss of function.
We found that Fezf2 knockout retina had a reduced
BRN3B+ RGCs (Fig 3 and 4). To determine if this
reduction is an effect of inhibition of Brn3b
expression, or developmental changes leading to
the loss of BRN3B+ RGCs, we knocked down
Fezf2 in a small population of retinal cells with
RNA interference by in utero electroporation (18).
The results supported that the knockdown of Fezf2
repressed BRN3B cell-autonomously. The
inhibition of BRN3B was not accompanied by any
loss of ISLET1 and BRN3A, two RGC markers
that largely overlap with the expression of BRN3B
(Fig 5). This observation indicates that reduction
of BRN3B is the cause, not the result, of the
decrease in BRN3B+ RGCs in the knockout retina.
The BRN3B deficit increased the apoptosis of
RGCs and reduced the optic nerve fibers (Fig 3
and 4), as expected for its function in the
maintenance and survival of RGCs (5,6).
Our data revealed that Fezf2 was essential for
the proper expression of BRN3B while it had no
effects on BRN3A (Fig 5D and 5E), a closely
related protein in the family of class IV POU-
domain transcription factor, indicating a specific
action of Fezf2 on Brn3b. A recent study found
that the high-mobility-group domain-containing
transcription factors SOX4 / SOX11 express in the
developing mouse retina and function redundantly
to regulate the generation and survival of RGCs
(32). SOX4 and SOX11 transactivate Fezf2 by
competing with the specific repressor SOX5 in the
cerebral cortex (33). It is not clear whether SOX4
and SOX11 participate in the transient activation
of Fezf2 in the retina. However, our results are
consistent with the observation that targeted
disruption of SOX4 or SOX11, positive regulators
of Fezf2 (33), caused a reduction of RGCs in
retinas (32).
The mechanisms responsible for the FEZF2
regulation of Brn3b were explored in the present
study. A 5’-regulatory region of Brn3b containing
putative FEZF2 binding motif was enriched in the
DNA-protein complex in the N2a cells expressing
V5-FEZF2, but not those expressing V5-GFP (Fig
7). This observation suggests that FEZF2 may
bind to a tentative promoter of Brn3b. In vitro
assay found that FEZF2 activated a reporter
construct carrying the 5'-regulatory part of Brn3b.
The result indicates that FEZF2 enhances the
transcription of Brn3b by binding to the genomic
locus of Brn3b. Notably, the Wilms’ tumor gene Wt1, which encodes a zinc-finger transcription factor,
also activates the transcription from 5’ regulatory
sequence of Brn3b (34). The 5’ sequence including
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
9
5’UTR may contain positive control elements
driving the transcription of Brn3b. Mouse embryos with targeted disruption of Wt1 exhibit thinner
retinas and enhanced apoptotic cell death of RGCs
(34). This is in parallel to our observation that
Fezf2-null retinas had increased apoptosis and
reduced optic nerve (Fig 3 and 4). Future studies are
needed to determine whether Fezf2 knockout leads to
a visual deficiency in the mice.
Although a transient expression of Fezf2 is
required for Brn3b, the sustained expression
completely blocked BRN3B (Fig 6). The underlying
mechanisms responsible for the inhibition of Brn3b
are not clear. It remains to be excluded that the
genomic locus of Brn3b may harbor unknown regions mediating the inhibition by FEZF2. On the
other hand, the sustained expression of Fezf2 blocked MATH5 in addition to BRN3B and ISLET1
(Fig 6). We speculate that the Fezf2 could function
as a repressor of Math5, and thereafter, inhibit its
downstream targets. It is known that a targeted
deletion of Math5 abolishes the retinal expression of
Brn3b (2), despite that Fezf2 expresses transiently in the developing retina. Therefore, if Math5 were depressed by a sustained Fezf2, Brn3b would be
blocked. With the inhibition of Math5, the phenotype of retinal cells may be altered by the
ectopic expression of Fezf2, a fate-determining gene
of dorsal telencephalic progenitors and the cortical
projection neurons (17, 29).
In conclusion, we have determined the
expression and function of Fezf2 in the developing
retina. The transient expression of Fezf2 is
essential for the development and survival of
BRN3B+ RGCs by regulating the transcription of
Brn3b. This study provides novel insights into the
molecular mechanisms underlying the RGC and
retinal development.
Acknowledgements
The authors thank Yasuhide Furuta at RIKEN Center for Developmental Biology in Japan for granting the
permission for using the Tg(Six3-cre)69Frty mouse, and Nenad Sestan at Yale University for providing
Fezf2 floxed mouse and reagents. We would also like to thank former students in the lab, Huaping Tao,
Yuee Zhao, Huateng Cao and Yong Li, who helped with the experiments during this study. The work was
supported by Natural Science Foundation of China (grants: #31500850 to C Qu and #81571096 to JG
Chen) and Zhejiang Provincial Natural Science Foundation of China (Grant NO. LQ16H120001 to C
Qu).
Conflict of interest
The authors declare that they have no conflicts of interest with the contents of this article.
Author contributions
JGC designed the research; CQ, DB, JX and CW performed the research; CQ, DB, XL, JX, YL and TJ
analyzed data; JGC and XL wrote the paper; XZ and JQ contributed reagents/materials.
References
1. Yang, Z., Ding, K., Pan, L., Deng, M., and Gan, L. (2003) Math5 determines the competence
state of retinal ganglion cell progenitors. Developmental biology 264, 240-254
2. Wang, S. W., Kim, B. S., Ding, K., Wang, H., Sun, D., Johnson, R. L., Klein, W. H., and Gan, L.
(2001) Requirement for math5 in the development of retinal ganglion cells. Genes Dev 15, 24-29
3. Hutcheson, D. A., and Vetter, M. L. (2001) The bHLH factors Xath5 and XNeuroD can
upregulate the expression of XBrn3d, a POU-homeodomain transcription factor. Developmental
biology 232, 327-338
4. Liu, W., Mo, Z., and Xiang, M. (2001) The Ath5 proneural genes function upstream of Brn3 POU
domain transcription factor genes to promote retinal ganglion cell development. Proceedings of
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
10
the National Academy of Sciences of the United States of America 98, 1649-1654
5. Gan, L., Wang, S. W., Huang, Z., and Klein, W. H. (1999) POU domain factor Brn-3b is essential
for retinal ganglion cell differentiation and survival but not for initial cell fate specification.
Developmental biology 210, 469-480
6. Gan, L., Xiang, M., Zhou, L., Wagner, D. S., Klein, W. H., and Nathans, J. (1996) POU domain
factor Brn-3b is required for the development of a large set of retinal ganglion cells. Proceedings
of the National Academy of Sciences of the United States of America 93, 3920-3925
7. Qiu, F., Jiang, H., and Xiang, M. (2008) A comprehensive negative regulatory program
controlled by Brn3b to ensure ganglion cell specification from multipotential retinal precursors.
The Journal of neuroscience : the official journal of the Society for Neuroscience 28, 3392-3403
8. Mu, X., Fu, X., Beremand, P. D., Thomas, T. L., and Klein, W. H. (2008) Gene regulation logic
in retinal ganglion cell development: Isl1 defines a critical branch distinct from but overlapping
with Pou4f2. Proceedings of the National Academy of Sciences of the United States of America
105, 6942-6947
9. Pan, L., Deng, M., Xie, X., and Gan, L. (2008) ISL1 and BRN3B co-regulate the differentiation
of murine retinal ganglion cells. Development 135, 1981-1990
10. Elshatory, Y., Deng, M., Xie, X., and Gan, L. (2007) Expression of the LIM-homeodomain
protein Isl1 in the developing and mature mouse retina. The Journal of comparative neurology
503, 182-197
11. Brown, N. L., Patel, S., Brzezinski, J., and Glaser, T. (2001) Math5 is required for retinal
ganglion cell and optic nerve formation. Development 128, 2497-2508
12. Feng, L., Xie, Z. H., Ding, Q., Xie, X., Libby, R. T., and Gan, L. (2010) MATH5 controls the
acquisition of multiple retinal cell fates. Molecular brain 3, 36
13. Brown, N. L., Kanekar, S., Vetter, M. L., Tucker, P. K., Gemza, D. L., and Glaser, T. (1998)
Math5 encodes a murine basic helix-loop-helix transcription factor expressed during early stages
of retinal neurogenesis. Development 125, 4821-4833
14. Brzezinski, J. A. t., Prasov, L., and Glaser, T. (2012) Math5 defines the ganglion cell competence
state in a subpopulation of retinal progenitor cells exiting the cell cycle. Developmental biology
365, 395-413
15. Shimizu, T., Nakazawa, M., Kani, S., Bae, Y. K., Kageyama, R., and Hibi, M. (2010) Zinc finger
genes Fezf1 and Fezf2 control neuronal differentiation by repressing Hes5 expression in the
forebrain. Development 137, 1875-1885
16. Ohtsuka, T., Sakamoto, M., Guillemot, F., and Kageyama, R. (2001) Roles of the basic helix-
loop-helix genes Hes1 and Hes5 in expansion of neural stem cells of the developing brain. The
Journal of biological chemistry 276, 30467-30474
17. Wang, Z. B., Boisvert, E., Zhang, X., Guo, M., Fashoyin, A., Du, Z. W., Zhang, S. C., and Li, X.
J. (2011) Fezf2 regulates telencephalic precursor differentiation from mouse embryonic stem cells.
Cerebral cortex 21, 2177-2186
18. Chen, J. G., Rasin, M. R., Kwan, K. Y., and Sestan, N. (2005) Zfp312 is required for subcortical
axonal projections and dendritic morphology of deep-layer pyramidal neurons of the cerebral
cortex. Proceedings of the National Academy of Sciences of the United States of America 102,
17792-17797
19. Chen, B., Schaevitz, L. R., and McConnell, S. K. (2005) Fezl regulates the differentiation and
axon targeting of layer 5 subcortical projection neurons in cerebral cortex. Proceedings of the
National Academy of Sciences of the United States of America 102, 17184-17189
20. Molyneaux, B. J., Arlotta, P., Hirata, T., Hibi, M., and Macklis, J. D. (2005) Fezl is required for
the birth and specification of corticospinal motor neurons. Neuron 47, 817-831
21. Han, W., Kwan, K. Y., Shim, S., Lam, M. M., Shin, Y., Xu, X., Zhu, Y., Li, M., and Sestan, N.
(2011) TBR1 directly represses Fezf2 to control the laminar origin and development of the
corticospinal tract. Proceedings of the National Academy of Sciences of the United States of
America 108, 3041-3046
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
11
22. Furuta, Y., Lagutin, O., Hogan, B. L., and Oliver, G. C. (2000) Retina- and ventral forebrain-
specific Cre recombinase activity in transgenic mice. Genesis 26, 130-132
23. Garcia-Frigola, C., Carreres, M. I., Vegar, C., and Herrera, E. (2007) Gene delivery into mouse
retinal ganglion cells by in utero electroporation. BMC Dev Biol 7, 103
24. Ohsawa, R., and Kageyama, R. (2008) Regulation of retinal cell fate specification by multiple
transcription factors. Brain research 1192, 90-98
25. Farah, M. H. (2006) Neurogenesis and cell death in the ganglion cell layer of vertebrate retina.
Brain Res Rev 52, 264-274
26. Farah, M. H., and Easter, S. S., Jr. (2005) Cell birth and death in the mouse retinal ganglion cell
layer. The Journal of comparative neurology 489, 120-134
27. Badea, T. C., Cahill, H., Ecker, J., Hattar, S., and Nathans, J. (2009) Distinct roles of transcription
factors brn3a and brn3b in controlling the development, morphology, and function of retinal
ganglion cells. Neuron 61, 852-864
28. Mu, X., Fu, X., Sun, H., Beremand, P. D., Thomas, T. L., and Klein, W. H. (2005) A gene
network downstream of transcription factor Math5 regulates retinal progenitor cell competence
and ganglion cell fate. Developmental biology 280, 467-481
29. Rouaux, C., and Arlotta, P. (2010) Fezf2 directs the differentiation of corticofugal neurons from
striatal progenitors in vivo. Nature neuroscience 13, 1345-1347
30. Shu, X. S., Li, L., Ji, M., Cheng, Y., Ying, J., Fan, Y., Zhong, L., Liu, X., Tsao, S. W., Chan, A.
T., and Tao, Q. (2013) FEZF2, a novel 3p14 tumor suppressor gene, represses oncogene EZH2
and MDM2 expression and is frequently methylated in nasopharyngeal carcinoma.
Carcinogenesis 34, 1984-1993
31. Chen, L., Zheng, J., Yang, N., Li, H., and Guo, S. (2011) Genomic selection identifies vertebrate
transcription factor Fezf2 binding sites and target genes. The Journal of biological chemistry 286,
18641-18649
32. Jiang, Y., Ding, Q., Xie, X., Libby, R. T., Lefebvre, V., and Gan, L. (2013) Transcription factors
SOX4 and SOX11 function redundantly to regulate the development of mouse retinal ganglion
cells. The Journal of biological chemistry 288, 18429-18438
33. Shim, S., Kwan, K. Y., Li, M., Lefebvre, V., and Sestan, N. (2012) Cis-regulatory control of
corticospinal system development and evolution. Nature 486, 74-79
34. Wagner, K. D., Wagner, N., Vidal, V. P., Schley, G., Wilhelm, D., Schedl, A., Englert, C., and
Scholz, H. (2002) The Wilms' tumor gene Wt1 is required for normal development of the retina.
The EMBO journal 21, 1398-1405
Figure legends
Figure 1, Expression of Fezf2 in the developing retina. (A), Sections of mouse retinas at the
designated developmental stages were processed for Fezf2 ISH. Fezf2 was transiently expressed in the
retinas with maximal expression occurring at E16.5. (B), Fezf2 was expressed in the inner NBL at E16.5.
(C), Coronal section of the E16.5 brain showing expression of Fezf2 in the cortex (arrow) and the retina
(arrowheads). All bars, 200 μm.
Figure 2, Expression of FEZF2 in the developing retina. (A), FEZF2 expressions were determined in
the retinal sections by IF at the indicated developmental stages. FEZF2 was expressed in prospective
GCL of the retina at E16.5. (B), FEZF2 expression colocalized with BRN3B. Bar of the figure, 200μm.
Bar in the insert: 50μm.
Figure 3, Targeted disruption of Fezf2 leads to a reduction of BRN3B+ RGCs and an increase in
apoptosis. (A), The Fezf2 second exon harbors two loxp sites flanking the second exon. P1, P2, and P3
are the three genotyping primers located in the exon 1-3 of Fezf2 locus. (B), Gel electrophoresis of the
PCR products from the genotyping. The presence of first loxp site and the absence of exon 2 were
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
12
determined by PCR with the primer sets of P1-P2 and P1-P3, respectively. Expression of Cre was also
confirmed in the knockout mice by PCR (data not shown). (C), E17.5 retinas were isolated from wild-
type and Fezf2-null mice, and the relative expressions of Brn3b and Fezf2 were measured by q-PCR. The
knockout mice had a diminished expression of Fezf2 and Brn3b. (D), The expression of BRN3B and
FEZF2 were measured in the isolated retinas from control and Fezf2-null retinas by Western blots with α-
tubulin as an internal control. (E), Immunostaining of BRN3B and activated CASPASE III at E17.5 in
control and Fezf2 knockout retinas. Knocking out Fezf2 reduced BRN3B+ cells and increased apoptotic
cells. Bar of the figures in IF of BRN3B: 200μm and 50 μm for low and high magnitude, respectively.
Bar of the figure in CASPASE III: 50 μm. (F), Histogram showed the numbers of BRN3B+ in GCL and
NBL per field (40x). (G), A total of CASPASE III+ cells per section in control and Fezf2-null retinas.
Figure 4, Reduced BRN3B+ cells and axons in Fezf2-/- mice at P7. (A), Whole mount retinas from
wild-type and Fezf2-/- mice at P7 were examined for the expression of BRN3B. Inserts were enlarged
images at 40x. Bar of the figure: 5000μm. Bar in the insert: 30μm. (B), A histogram shows that the
number of BRN3B+ cells per field (40x) was significantly reduced in the knockout mice. (C), SMI32
staining in the whole mount of retinas from wild-type and Fezf2-/- mice at P7. The knockout retina had
weakened axonal processes as compared to the wild-type. The arrow in the Fezf2-/- retinal section points
to an aberrant axon bifurcation. Bar of the figure: 30μm. (D), The eyes with attached optic nerves were
dissected out. The optic nerve in the Fezf2-/- mice was thinner than the wild-type. The image was a
representative from 4 samples (eyes).
Figure 5, Inhibition of BRN3B expression by Fezf2-siRNA. (A), Fezf2-scRNA-1 or Fezf2-siRNA-1
was delivered to one eyecup of E13.5 embryos (Green). Retinal sections were examined for the
expression of MATH5, ISLET1 and BRN3B (Red) at E17.5. Similar to those expressing Fezf2-scRNA-1,
Fezf2-siRNA-1 transfected cells was partially colocalized with MATH5 and ISLET1 (arrowheads). In
contrast, the retinal cells expressing Fezf2-siRNA were mostly BRN3B-negative. (B), Histogram showed
the percentages of colocalization in the Fezf2-siRNA-1 and Fezf2-scRNA-1-transfected cells. (C), Single
cell suspensions prepared at E17.5 from the transfected retinas were sorted by FACS. The relative
expression of Brn3b and Fezf2 was measured in GFP+ cells by q-PCR. (D), Fezf2-scRNA-2 or Fezf2-
siRNA-2 was delivered to eyecups of E13.5 embryos (Green). Retinal sections were examined for the
expression of BRN3A (Red) at E17.5. Arrowheads indicate colocalizations of BRN3A and the transfected
GFP. (E), No significant difference in the percentage of colocalization between the scramble and the
siRNA-transfected cells. Bar of the figure, 200μm. Bar in the insert: 20μm.
Figure 6, Over-expression of Fezf2 alters phenotype of the retinal cells. (A), The retinas transfected
with pCAGEN and Fezf2-pCAGEN were examined at E17.5 with IF. The colocalization of MATH5,
ISLET1 and BRN3B (Red) with GFP were determined by IF. (B), Histogram showed the percentages of
colocalization in pCAGEN and Fezf2-pCAGEN groups. Over-expression of Fezf2 abolished the
expression of MATH5, ISLET1 and BRN3B. Bar of the figure, 200μm. Bar in the insert: 20μm.
Figure 7, FEZF2 binds to 5’ regulatory sequence in Brn3b. (A), Schematic diagram of the genomic
structure of Brn3b. A tentative promoter including the 5’UTR of Brn3b contains predicted FEZF2
binding motifs (yellow bar). (B), Relative luciferase activities measured in the lysates of N2a cells. N2a
cells stably expressing pGL4.18-Brn3b-promoter were assayed for the luciferase activities after transient
expression of the indicated constructs for two days. Fezf2-pCAGEN increased whereas Fezf2-siRNA
decreased the luciferase activities. (C)-(D), ChIP with an anti-V5 antibody precipitated FEZF2-bound
DNA from the N2a cells expressing V5-tagged FEZF2, but not those expressing V5-GFP. The DNA was
analyzed by gel electrophoresis (C) of the PCR products for the presence of the tentative promoter and
measured by q-PCR (D) for the enrichment of the binding sequence. The input of ChIP and the pull-
down without V5 antibody were taken as a positive and a negative control of the PCR, respectively. The
control sequence for the q-PCR in Fig 7D is a region in the 3’UTR of Brn3b locus.
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
13
Figure 1
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
14
Figure 2
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
15
Figure 3
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
16
Figure 4
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
17
Figure 5
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
18
Figure 6
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Fezf2 regulates Brn3b in developing retina
19
Figure 7
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/
-
Xiangtian Zhou, Jia Qu and Jie-Guang ChenChunsheng Qu, Dandan Bian, Xue Li, Jian Xiao, Chunping Wu, Yue Li, Tian Jiang,
Retinal Ganglion CellsTransient Expression of Fez Family Zinc Finger 2 Regulates Brn3b in Developing
published online February 9, 2016J. Biol. Chem.
10.1074/jbc.M115.689448Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on May 31, 2020
http://ww
w.jbc.org/
Dow
nloaded from
http://www.jbc.org/lookup/doi/10.1074/jbc.M115.689448http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M115.689448v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2016/02/09/jbc.M115.689448http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2016/02/09/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2016/02/09/jbc.M115.689448http://www.jbc.org/cgi/alerts/etochttp://www.jbc.org/