FD in potato Characterising the role of the transcription

factor FD homologue in potato

Mirjam Storcken

LABORATORY OF PLANT BREEDING,

WAGENINGEN UNIVERSITY

FD in potato Characterising the role of the

transcription factor FD homologue in

potato

Mirjam A. Storcken

920321809030

Master Thesis (MSc) in Plant Breeding

PBR-80436

Supervisors:

Dr. Christian Bachem

Dr. Sara Bergonzi

Dr. Guusje Bonnema

November 2018,

Laboratory of Plant Breeding, Wageningen University and Research Institute,

Wageningen, The Netherlands.

ii

Acknowledgements

I would like to thank Sara Bergonzi for supervising in the lab and help with writing

the report. Secondly I would like to thank my other supervisor Christian Bachem

for his help with writing the report. I would also like to thank Marian Oortwijk for

all her help in the lab and Jose Abelenda Vila for helping me with the yeast-two

hybrid. Lastly I would like to thank my family for believing in me that I was able to

do this and all the support they have given me throughout the whole time

especially to my husband William and my father Ton Storcken.

iii

Abstract

Potato (Solanum tuberosum L.) breeding is becoming more interesting the last

years, mainly due to diseases. However, there is a lot unknown about the

molecular mechanisms regulating potato flowering. It is known that StSP3D (FT

homolog of potato) has a role in flower initiation and in other plant species FT

homologues do this together with FD transcription factors. Potato has two StFD

genes, we named these StFD1 and StFD2. This thesis is about these StFD genes and

whether they are involved in flower initiation. By studying the expression in plant

material and the interaction with StSP3D, we found that StFD1 is mainly

transcribed in the leaves and stolon, and can interact with StSP3D. The expression

of StFD2 is primarily restricted to the apex, suggesting that StFD2 is the canonical

FD in potato that sits in the meristem and waits for the StSP3D. StFD2 and StSP3D

can interact and together they are most likely involved in flower initiation.

Key words: potato, StFD, StSPGB, flower initiation, gene expression, yeast-two

hybrid, StSP3D.

iv

Table of contents

1. Introduction .................................................................................................................... 1

2. Aims of the research ....................................................................................................... 5

3. Materials and methods- .................................................................................................. 6

3.1. Sequence comparison ...................................................................................... 6

3.2. Phenotyping and expression analyses ................................................................ 6

3.2.1. Experimental plant material ........................................................................ 6

3.2.2. Experimental set-up .................................................................................. 6

3.2.3. Experimental measurements and sampling.................................................... 7

3.2.4. 24-hour time course .................................................................................. 8

3.2.5. Primer design, development and validation ................................................... 8

3.2.6. Testing of reference genes .......................................................................... 9

3.2.7. RNA isolation, DNase treatment and cDNA synthesis..................................... 10

3.2.8. Quantitative PCR ..................................................................................... 11

3.3. Protein-protein interaction using Yeast-two-Hybrid assay .................................... 12

3.3.1. Amplification of coding sequences .............................................................. 12

3.3.2. Cloning in expression vector for Yeast-two-Hybrid ........................................ 12

3.3.3. Yeast-two hybrid ..................................................................................... 13

3.4. Data analyses .............................................................................................. 15

3.4.1. Phenotypic data ...................................................................................... 15

3.4.2. qPCR data .............................................................................................. 15

3.4.3. Yeast-two hybrid data .............................................................................. 15

4. Results ........................................................................................................................... 16

4.1 StFD genes in potato ...................................................................................... 16

4.2. Sequence comparison .................................................................................... 17

4.3. Phenotyping and expression analyses .............................................................. 18

4.4. 24-hour time course ...................................................................................... 20

4.5. Gene expression during development .............................................................. 21

4.5.1. Leaves ................................................................................................... 21

4.5.2. Apex enriched material ............................................................................ 23

4.5.3. Stolon ................................................................................................... 24

4.6. Yeast-two hybrid .......................................................................................... 25

5. Discussion ...................................................................................................................... 26

5.1. Sequence comparison .................................................................................... 26

5.2. Phenotyping and expression analyses .............................................................. 26

5.3. Gene expression during development .............................................................. 27

5.4. Yeast-two hybrid .......................................................................................... 28

6. Conclusion ..................................................................................................................... 29

7. Recommendation .......................................................................................................... 30

v

References......................................................................................................................... 31

Appendix 1: Primers .......................................................................................................... 36

Appendix 2: Sequences ..................................................................................................... 37

1

1. Introduction

The vast majority of the research on potato development (Solanum tuberosum L.)

focuses on tuber development and little is known about the flowering process. In

this research we focussed on flowering. Potato is a member of the family

Solanaceae or nightshades, along with other agriculturally important species such

as tomato (Solanum lycopersicum), eggplant (Solanum melongena), pepper

(Capsicum annuum) and Tobacco (Nicotiana tabacum). Potato is the third most

important world food crop, after wheat and rice (Ewing & Struik, 1992). It is

cultivated for the tubers, which are storage organs and represent a vegetative

propagation system. Potato tubers are rich in starch, protein and vitamins

(Augustin et al., 1978; Desborough & Weiser, 1974; Negi & Nath, 2002). The ploidy

level of cultivated potato ranges from diploid to hexaploid (Spooner et al., 2005).

Commercial cultivars are autotetraploid out breeders and as a result are highly

heterozygous and show significant inbreeding depression.

The origin of the modern potato cultivar, is from the high altitudes of the

equatorial Andes in South America (Spooner et al., 2005). The potatoes there,

grow under short days (12h of light), with a high light intensity, cool temperatures,

and relatively high humidity (Levy & Veilleux, 2007). In 1567, it was first recorded

that Andean potatoes were cultivated in Europe (Hawkes & Francisco-Ortega,

1993). It is likely that prior to the late blight epidemics in Ireland in 1845, cultivated

potato was crossed with the Chilean potato (Grun, 1979; Grun, 1990). Thus, most

modern potato cultivars contain Chilean germplasm (Huamán & Spooner, 2002).

The Chilean landraces are more adapted to long-day conditions (16h light/8h

darkness) (Ewing & Struik, 1992). The wild potato can still be found in 16 countries,

the main ones being Argentina, Bolivia, Mexico and Peru (Hijmans & Spooner,

2001).

Traditionally, potato propagation is done mainly via tubers, however, sexual

propagation via seeds has many advantages. Seeds can be stored longer, they are

easier to store and transport them in larger amounts (Hirsch et al., 2013). Plus,

numerous diseases such as viruses are not carried over via the seeds (Valkonen,

2007). Seed production is the easiest with diploids. However, since diploids are

usually self-incompatible, generating and maintaining a homozygous line remains

difficult. Introduction of the Sli gene renders diploid potato self-compatible

(Hosaka & Hanneman, 1988 a, b). Selfing also allows the development of

homozygous diploid parental lines (elite lines) that can be used for potato hybrid

breeding and opens the possibility of true-seed potato cultivar (Lindhout et al.,

2011). Hybrid technology makes the breeding process shorter and propagation via

seeds possible.

2

It has been shown that several

components of the tuberisation

pathway in potato are similar to

Arabidopsis thaliana flowering

pathway (figure 1.1). However, the

regulation of flowering in potato

remains to be elucidated in detail. In

flowering plants, floral development

is initiated by the expression of AP1

(APETALA1), LFY (LEAFY) and FUL

(FRUITFULL) (Abe et al., 2005; Turck

et al., 2008). These genes are

positively regulated by SOC1

(Suppressor of Overexpression Constants 1) and the protein-protein interaction

between FT (FLOWERING LOCUS T), FD mediated by 14-3-3 (Taoka et al., 2011).

This protein-protein interaction forms a hexameric florigen activation complex

(FAC) (Tsuji et al., 2013). A mutation in fd in rice has been identified that abolishes

binding with 14-3-3. In this mutant, the complex is unable to be transported into

the nucleus and therefore unable to function (Taoka et al., 2011). The mutation

was located in the interaction motif at the C-terminus of the FD protein, also

known as SAP (SRF [serum response factor] accessory protein) (Tsuji et al., 2013).

SOC1 is likewise positively regulated by the same protein-protein interaction

(Wigge et al., 2005). In Arabidopsis, FT is produced in the leaves and is transported

to the meristem (Chailakhyan, 1936). The expression is dependent on CO

(CONSTANS) (González-Schain et al., 2012). CO is downregulated by CDF (CYCLING

DOF FACTOR) and CDF is post-transcriptionally regulated by FKF (FLAVIN-BINDING,

KELCH REPEAT, F-BOXPROTEIN1) and GI (GIGANTEA) (Imaizumi et al., 2005). FKF

and GI are both regulated by the circadian clock (Sawa et al., 2007). In Arabidopsis,

FD is expressed primarily in the meristem, as this is the site of FD protein activity.

However, FD expression is also present in the root meristem and at lower levels

throughout the plant (Abe et al., 2005; Wigge et al., 2005). FD is also expressed

before the transition to flowering. This indicates that FD protein is not the limiting

factor for floral transition (Wigge et al., 2005).

FD consist of

three exons

(figure 1.2). The

first exon varies

between species and even between different FD alleles within species. The second

exon encodes a bZIP motif. This motif is present in many gene regulatory proteins

in eukaryotic cells (Tsuji et al., 2013). The bZIP motif contains an array of at least

Figure 1.2 The exons of FD. The first exon is not will conserved and is different between species. The second exon contains the bZIP motif, which is thought to be bind to DNA. Lastly, the third exon contains the SAP, which can bind to 14-3-3.

Figure 1.1 Flowering pathway in Arabidopsis thaliana. The different interaction between the different flowering genes (Andrés & Coupland, 2012).

3

five leucines, located at every seventh position facilitating the formation of eight

helical turns. This structure is thought to bind to DNA (Hakoshima, 2005). The third

exon comprises the SAP 14-3-3 binding domain (Tsuji et al., 2013).

It is thought that FD genes originate from the period in which seed plants emerged

and evolved after the emergence of angiosperms. This is assumed because the FD

gene has not been found in moss (bryophyte; Phycomitrella patens) or in the spike

moss (lycophyte, basal vascular plant; Selaginella moellendorffii) (Banks et al.,

2011; Rensing et al., 2008). If the FD gene did emerge from seed plants, then there

should be some evidence in gymnosperms, however this gene has not yet been

found (Tsuji et al., 2013). The function of FD has diversified during evolution and

FD homologs have acquired different roles that are independent from the

interaction with FT (Tylewicz et al., 2015).

In the potato

reference genome

two StFD

homologues were

annotated on

chromosome 2. We

named these StFD1

and StFD2. The

StFDs are also

known as StSPGBs

(Solanum

tuberosum Self-

pruning G-box)

after its tomato

homologue SPGB.

The protein

partners of StFDs

are FT

homologues. In

potato these

include StSP3D (Solanum tuberosum SELF PRUNING 3D) and StSP6A (Solanum

tuberosum SELF PRUNING 6A). StSP3D is involved in flowering, while StSP6A is

active in tuberigen (Navarro et al., 2011). The photoperiodic pathway has been

characterized with respect to expression of StSP6A and tuberisation. During this

thesis, other research showed that StFD1 interacts with StSP6A and form a FAC

together with 14-3-3. This interaction is thought to regulate the tuber formation

(Teo et al., 2017). The photoperiodic pathway for regulating flowering is quite

conserved between a wide variety of flowering plants (Andrés & Coupland, 2012).

Figure 1.3 Flowering pathway and tuberisation pathway in potato. The meristem part is based on tomato and the other parts on potato. StSP3D and StSP6A are produced in the leaves. StSP6A is involved in tuberisation, while in tomato SP3D is involved in flowering together with SPGB and 14-3-3 (Abelenda et al., 2014).

4

Figure 1.3 shows a possible flowering pathway for potato, which is based on the

pathway that is found in tomato. However, it was found that StSP3D promotes

flowering in potato, this based on delayed flowering in StSP3D knock-down plants.

Although the function of StFD is not known, it is likely to act in a similar way as was

shown in Arabidopsis and other plant species.

This research focused on StFD and its role in potato. We tried to recover this role

of both StFDs using six different genotypes. First, by comparing sequences we

looked for similarities between the potato StFDs and other FDs from different

plant species. It is found that StFD2 from potato is more similar to a SPGB from

tomato, than to StFD1. Due to this, it is expected that the function of the former

two will be similar. It is known that the tomato SPGB interacts with SINGLE

FLOWER TRUSS (homologue of SP3D) to trigger flowering (Pneuli et al., 2001).

StFD2 is located in a QTL for the unset of flowering (Hurtado-Lopez, 2012). For

these reasons, it is expected that StFD2 has a role in flowering. StFD1 interacts

with StSP6A via 14-3-3 and causes initiation of the tubers (Teo et al., 2017).

Therefore it is expected that StFD1 is higher expressed in the stolons, just before

tuber initiation.

In this report the aim of the research will be told first, followed by the methods.

The results will come next, tailed by the discussion, conclusion and

recommendation.

5

2. Aims of the research

To investigate the role of StFD1 and StFD2 in potato flowering, the research is split

into two different sections: 1) phenotyping plant growth and correlating the

phenotypes with gene expression analysis, 2) testing the interaction between the

different StFDs and StSP3D.

Phenotyping plant growth together with expression analysis of the genes

Genotype C, E, CE3027, and CE3130 (see Materials and Methods) were

phenotyped for developmental traits, in order to investigate whether differences

in growth correlate with the StFDs expression. With a particular focus on

flowering, plastochron length (i.e. time of appearance of consecutive leaves) and

flowering abortion. If a correlation is found between the observation of the start

of flowering and StFD expression, it is likely that the StFD is then involved in

initiating flowering.

Genes can be dependent on the circadian clock, which can reveal in which way the

gene functions. FD in A. thaliana is independent of the circadian clock (Wigge et

al., 2005). Therefore, it is expected that StFDs are also independent of the

circadian clock. To verify this a 24-hour time course was analysed, the samples

were coming from S. andigena.

Looking for interaction between different StFDs with StSP3D

If StFD is involved in flowering together with StSP3D it is likely that they are

interacting with each other, as found in different plant species (Abe et al., 2005; Li

& Dubcovsky, 2008; Sussmilch et al., 2015). The protein-protein interaction was

examined with a yeast-two hybrid approach, to find out whether the two StFD

proteins of S. andigena are able to form a FAC with StSP3D.

6

3. Materials and methods-

There are six different genotypes used for this research: (1) S. tuberosum group

Phureja DM1-3 516 R44 (hereafter referred to as DM), (2) S. andigena, (3) C, (4)

E, (5) CE3027 and (6) CE3130. DM is a double monoploid whose genome was

sequenced. In this research it is used as a base line to determine the sequence of

the genes. S. andigena is a tetraploid wild type which is used as a model

genotype for potato and is used as a reference for certain parts of this research.

Genotype C and E are heterozygous diploid potato developed for research

purposes. This development was based on the different genetic background of S.

phureja and S. tuberosum, and their phenotypic contrast (Jacobs et al., 1995).

In a previous experiment conducted in the glasshouse E flowered two weeks

earlier than C. Also, E formed tubers a bit quicker than C. The two were crossed

for QTL mapping and CE3027 and CE3130 were created here. CE3027 forms tubers

relatively late and CE3130 forms tubers relatively early, compared to genotype C

and E. However, they flower around the same time, between the flowering time

of genotype E and C.

3.1. Sequence comparison

The amino acid sequence of the StFD conceptually translated proteins and their

allelic variants were aligned with other similar bZIP transcription factors, retrieved

from the public repository NCBI. The alignment program used is Clustal Omega

Multiple Sequence Alignment (http://www.ebi.ac.uk/Tools/msa/clustalo/).

Additional information was used from PGSC and ITAG annotations.

3.2. Phenotyping and expression analyses

3.2.1. Experimental plant material

Plant material was propagated from in vitro plantlets maintained in the

Wageningen Plant Breeding collection. Plants were grown on standard media for

plant growth (Murashige and Skoog MS20 L-1: 4.4g MS+Vitamine, 20g sucrose, pH

5.8 [with KOH] and 8g agar, and final step autoclaving to sterilize). Cuttings were

made consisting out of at least two leaves and transferred onto new standard

media. A second round of only apical propagation was taken a week later to

equalise the developmental stage of the plantlets. All in vitro plant material was

kept in a climate chamber at 24o C and under long day conditions (16h light/8h

darkness; LD). This holds for genotypes: C, E, CE3027 and CE3130 in this research

but also for the plant material from which RNA/cDNA has been used in this

experiment.

3.2.2. Experimental set-up

After four weeks in vitro, the plants were potted in 14cm pots using Potground #4

(supplied by Horticoop). At this time each plant had exactly five leaves. The plants

7

were grown in a climate chamber under LD, with a light intensity of 200μ mol m-2

s-1, 80% relative humidity and a day/night temperature of 20o C/18o C. The

moisture content of the pots was monitored and pots were watered according to

requirements. For the first three days the plants had a transparent plastic cup

covering them to raise the humidity and to prevent dehydration.

For phenotyping 15 individual plants of each genotype were used. For expression

17 plants from genotype E and 24 plants from genotype C were used. The two

groups were (for genotype and expression) kept separate from each other and

they were manually randomized.

3.2.3. Experimental measurements and sampling

Phenotyping

Leaf, flower, stolon and tuber development have been examined over seven

weeks. Plastochron interval was recorded by keeping track of the number of new

leaves developed per week. This was achieved by piercing a hole in the youngest

leaf at every observation. Where the youngest leaf is the leaf that has been formed

latest on the main stem being at least 0.5cm wide.

Flower development was only recorded at the apical meristem on the main stem.

It was examined on a daily basis when the plants had flowering buds, had

undergone anthesis, and flower abortion occurred. Formation of flower buds was

considered as entry into the generative phase. Anthesis on the other hand, is when

the flower opens. Comparison of bud formation and anthesis was done to verify

transition time. This comparison also highlights possible differences between the

genotypes. Flower abortion is when the plants terminates flowering and therefore

flowering stops and the flowers will wilt. This can occur at different stages before

and after anthesis.

Tuber development was phenotyped weekly, only for genotypes E and C. This to

assess a correlation between flowering and tuberisation or flower abortion and

tuberisation. In figure 3.1 shows the different developmental stages of

tuberisation. It was scored when the plants had formed stolon (stage one) and

when tubers were starting to develop (stage three). Plants used for tuber

phenotyping were not used for any further phenotyping.

8

Sampling of a developmental Time course

Samples were taken weekly, from genotypes C and E to examine the gene

expression in different tissues and over time. For each sampled three plants were

pooled together. Except for the second and third sampled where four plants were

pooled together. Each sampling was done in duplicate. The sampling started when

the plants had been in the soil for one week. For genotype E samples were taken

for five weeks after planting, while genotype C was sampled for seven weeks. The

difference of sampling time is based on previous research where C appeared to

flower later then E. Likewise, gene expression from C was carried out longer.

Samples were taken from the apex enriched meristem (in a vegetative o

generative state depending on the time point), the fifth leaf counted from the top

of the plant and the stolon/tubers if present. After harvesting the samples were

immediately frozen in liquid nitrogen and stored at -80o C and the sampled plants

were destroyed.

3.2.4. 24-hour time course

In previous research, a 24-hour time course was sampled using S. andigena,

where, whole above ground plants material was sampled every three hours. The

plants were grown in the same conditions as for the earlier explained time course

(3.2.2. Experimental set-up), except only half of the plants were under LD. The

other half were exposed to short day conditions (8h light/16hrdarkness; SD).

Plants were approximately three weeks on soil. After collection, the samples were

immediately frozen in liquid nitrogen and stored at -80o C.

3.2.5. Primer design, development and validation

Primers were used for qPCR and for cloning of the whole coding sequence (CDS)

for the protein-protein interaction. Some of the primers were already developed

and validated. The other primers were designed based on the information from

previous research. This by comparing the sequences with the transcript sequence

from DM of the PGSC Genome Browser, to determine any differences. The primers

Figure 3.1 Potato tuber development stages, over a time period of 25 days after a switch from a 16 hours light per day to an 8 hours light period (Kloosterman et al., 2005).

9

were designed without any known mismatches to the reference sequence (DM for

S. andigena, for C and E low coverage whole genome sequence is available) and

that the forward and reverse primer do not align to each other’s (primer dimer).

Primer3 software was used to design primer pair when possible. The melting

temperature was calculated with Oligonucleotide Properties Calculator software.

Self-complementarity was checked with the same program. In case there were no

problems the sequence was compared with the PGSC DM Transcripts (v.3.4) using

the BLASTN nucleotide search (Altschul et al., 1997).

Primers were tested on cDNA, using the Thermo Scientific Dream Taq DNA

Polymerase and GeneAmp® PCR System 2700 for amplification of nucleic acids.

Each PCR reaction (25µL) consisted out of 1µL cDNA (10ng µL-1 concentration),

2.5µL DreamTaq buffer (10x), 1µL Forward Primer (10µM), 1µL Reverse Primer

(10µM), 2.5µL dNTP Mix (2mM each), 0.75µL DreamTaq polymerase, and 16.25µL

Milli-Q. Water-controls were included by replacing cDNA with Milli-Q. The initial

denaturation step was at 95o C for 1:00, the denaturation (95o C for 0:30),

annealing (60o C for 0:30) and extension (for this specific gene 72o C for 1:00) steps

were 35 times repeated. The final extension was at 72o C for seven minutes

followed by a hold at 4o C.

Per 5µL PCR product 1µL of loading dye was added to the PCR product, for running

a gel on a 1-2% agarose gel using 0.5 X TBE buffer for ± 45 minutes at 100V with a

1kb+ ladder for reference. After running the gel was photographed and the image

was examined to find out whether the primer pairs gave a single clear band. A full

list of the primers is given in Appendix 1.

Primer amplification efficiency was checked using a twofold dilution series of

pooled cDNA samples. A linear regression was calculated with the Bio-RAD CFX

Manager 3.0 software and the reaction efficiency (E) was calculated. It shows the

amount of target is produced with each cycle, an efficiency of 100% means that

the target amplicon is doubling with each cycle. The coefficient of determination

(R2) measures how correct the regression line describes the data, the closer to one

the better it fits. Efficiencies in the rage of 90-110% are generally deemed

acceptable (Pfaffl, 2001).

3.2.6. Testing of reference genes

Three reference genes were tested: NAC, EIF3e and Actin. They are sourced from

a previous research where they were tested on samples from potato (Bourke,

2014; Kloosterman et al., 2013). For selecting the most suitable reference gene,

they were tested on available cDNA from leaf and apex enriched tissues of S.

andigena. The plants were grown under similar conditions as explained earlier.

The only difference was that half of the plants were transferred after one week in

10

LD conditions to SD conditions and sampling happened over a period of four

weeks.

Figure 3.2 depicts the non-normalized expression of the three reference genes.

Actin variates in expression over different time points, between LD, SD, and

especially different tissue with about two Cts difference between leaves and

apices. EIF3e and NAC do not fluctuate much over time and different light regimes

lead to similar expressions. However, there is a difference in expression between

different tissues, this difference is bigger for NAC than for EIF3e. Due to this EIF3e

was chosen for the reference gene.

3.2.7. RNA isolation, DNase treatment and cDNA synthesis

For RNA isolation the frozen samples were grinded using liquid nitrogen, in order

to prevent RNA degradation. RNA was extracted from the frozen powder using a

Qiagen RNeasy Mini Kit (Cat. No. 74104 and 74106). The RLT buffer was used,

which is a lysis buffer for lysing cells and tissues prior to RNA isolation. This by

placing the RNeasy spin column in a new 2mL collection tube and discard the old

collection tube with the flow-through. The samples are then centrifuged on full

speed for one minute. Purified on-column RNA was collected in 30µL of RNase-

free water in a sterile Eppendorf tube. This was done twice resulting in a final

volume of 60µL. For the stolon tissue, which are rich in starch, another buffer was

used instead of RLT buffer, due to that this tissue contains more starch. To make

this buffer, 600µL Z-6 buffer (8M guanidinium-HCl, 20mM MES, 20mM EDTA [pH

7.0] and 0.7% [v/v] 2-mercaptoethanol) was thoroughly mixed with 500µL PCI

solution (phenol: chloroform: isoamylalcohol= 25:24:1) and subjected to

centrifugation (20,000xg, 10 minutes, 4o C) for phase separation. Only the upper

layer is used for buffer.

15,00

17,00

19,00

21,00

23,00

25,00

27,00

29,00

LDw1

LDw2

SDw2

LDw3

SDw3

LDw4

SDw4

LDw1

LDw2

SDw2

LDw3

SDw3

LDw4

SDw4

Leaves Apical meristem

Ct

EIF3e

Actin

NAC

Figure 3.2 Expression in different leaves and apex enriched material tissue over time, of the reference genes: EIF3e, Actin and NAC. LD stands for long day and SD for short day.

11

RNA concentration was measured with Thermo Scientific’s NanoDropTM 1000

Spectrophotometer. The concentrations of a 1µL sample of the purified RNA was

measured in ng µL-1 and the sample purity was assessed by examining the

absorbance ratio at 280/260nm and 260/230nm. The quality of the RNA was then

checked with a gel electrophoresis.

Estimated from the values obtained using the Nanodrop spectrohotomerter, 1µg

of RNA was treated with Deoxyribonuclease I (Amplidication grade) to eliminate

any residual DNA in the samples. This was done by adding 4µL RNA (with a

concentration of 250ng µL-1), 1µL 10X DNase I Reaction Buffer, 1µL DNAse I (Amp

Grade 1U µL-1) and 4µL Milli-Q water. The tubes were incubated at room

temperature (22o C) for 15 minutes. 1µL of 25mM EDTA solution was added to the

mixture to inactivate DNase I. The samples were heated for ten minutes at 65o C.

To synthesize cDNA (iScript cDNA Synthesis kit, Biorad), the following was added

to the RNA: 4µL 5x iScript reaction, 1µL iScript Reverse Transcriptase and sufficient

RNase-free water to make up a total reaction volume of 20µL. The samples were

kept for five minutes at 25o C, for 30 minutes at 42o C, for five minutes at 85o C, for

five minutes at 4o C, and finally for five minutes at 85o C. Thereafter they were

cooled down to 4o C. Synthesised cDNA was diluted with 130µL deionised water

(MQ), making a final concentration of 6.67ng µL-1. The samples prepared for the

dilution curve (in qPCR) were kept at higher concentration by diluting them with

100µL MQ, making a final concentration of 8.33ng µL-1. All samples were stored at

-4o C and placed at 4o C before using it for PCR.

3.2.8. Quantitative PCR

Quantitative (Real-Time) PCR (qPCR) was performed on a 96-well Bio Rad C1000

Thermal Cycler using iQ-SYBR-green super mix. All reactions were performed in

triplicate (technical replicates) and water-controls (containing MQ instead of

cDNA) were included for all primer pairs. Each well contained 10µL consisting out

of: 5µL SYBR-green, 0.25µL forward primer (10µM), 0.25µL reverse primer (10µM),

0.5µL MQ, and 4µL diluted cDNA.

The qPCR programme was in four stages: 1) 95o C for 30 minutes; 2) 40 cycles of

95o C for 15 seconds and 60o C for one minute followed by plate read; 3) 95o C for

10 seconds; 4) melting-curve analysis from 65o C-95o C in 0.5o C increments.

This was all done for genotypes C, E and S. andigena. With sample tissues coming

from apex enriched material and leaves for all three genotypes. Further for

genotype C and E stolon samples were taken. The RNA expression was measured

for the genes EIF3e, StFD1, StFD2, StSP3D and StAP1 in the eight different sample

tissues, with an exemption for StAP1 in the stolon sample tissues. All together

forming 38 different tests.

12

3.3. Protein-protein interaction using Yeast-two-Hybrid assay

3.3.1. Amplification of coding sequences

The coding sequences of the gene of interest were amplified from the cDNA of S.

andigena, C and E. This was achieved using a Thermo Scientific Phusion High-

Fidelity DNA Polymerase and GeneAmp® PCR System 2700 for amplification of

nucleic acids. Each PCR reaction (50µL) consisted out of: 3µL cDNA (10ng µL-1

concentration), 10µL 5X Phusion HF Buffer, 2µL Forward Primer (10µM), 2µL

Reverse Primer (10µM), 1µL dNTPs mix (10mM), 0.5µL Phusion DNA Polymerase,

31.5µL Milli-Q. Water-controls were included by replacing cDNA with Milli-Q.

The initial denaturation step was at 98o C for 30 seconds, the denaturation (98o C

for 10 seconds), annealing (61o C for 30 seconds) and extension (72o C for 15

seconds) steps were repeated 35 times in the cycle. The final extension was at 72o

C for seven minutes followed by a hold at 4o C. Per 5µL PCR product 1µL of loading

dye was added to the PCR product, for running a gel on a 1-2% agarose gel using

0.5 X TBE buffer for ±45 minutes at 100V with a 1kb+ ladder for reference. After

running the gels were photographed and the image was examined and the

amplified DNA was extracted from the gel.

The amplified fragment was purified from the gel by using a ZymocleanTM Gel DNA

Recovery Kit. Using the Nanodrop spectrophotometer the concentration of DNA

was measured and validated. In the gel, 1µL of the DNA was runned again to make

sure that only one band was purified. The gel was made the same way and run in

the same conditions as previously described. When only one single band was

visible the DNA was ready to be transferred into Escherichia coli. This was done for

one of the alleles of StFD1, StFD2, StSP3D and StTFL1 coming from S. andigena.

3.3.2. Cloning in expression vector for Yeast-two-Hybrid

The first step for the cloning is a ligation in the gateway donor vector using TOPO®

Cloning Reaction. The ligation mix consisted of: 1µL Salt Solution, 1µL TOPO®

vector, 0.5-4µL fresh PCR product, and MQ water was added till a final volume of

6µL. The molar ratio PCR to product:TOPO® vector should be between 0.5:1 and

2:1. The reaction was gently mixed and incubated at room temperature (22o C) for

30 minutes.

To chemically transform competent E. coli cells 3µL of the earlier mentioned

reaction was put together with 15-20µL of E. coli TOP10 cells and put on ice for 30

minutes, heat-shocked at 42o C for 30 seconds and immediately transferred back

to ice. Per reaction 250µL S.O.C. Medium was added and was shaken horizontally

(200 rpm) at 37o C for one to three hours. Of the reaction was 100µL on a LB agar

plates with 50µg mL-1 kanamycin (for pENTR/TOPO) and left overnight at 37o C.

Growing colonies were picked and grown, overnight, in LB liquid media containing

antibiotics.

13

The plasmids were extracted using plasmid miniprep (QIAprep Spin Miniprep Kit)

and the presence of the wanted gene tested using M13 primers (designed on the

plasmids) in a PCR reaction. The plasmids of the positive amplified clones were

sent for sequencing to check whether the gene is complete and whether it was

correctly situated in the plasmid. The correct plasmids were used for the gateway

LR reaction, to transfer the genes in the destination vectors (pGADT7 [150ng µL-1]

and pGBKT7 [300ng µL-1]). This by making two different mixtures with both 1µL

PCR product (20ng µL-1), and either 2µL destination vector pGADT7 or 1µL of

pGBKT7 and 1µL 1X TE buffer (pH 8.0) for pGADT7 or 2µL for pGBKT7, making an

end volume of 4µL for both mixtures. LR ClonaseTM II Plus enzyme mix was kept on

ice for 2 minutes. Afterwards 1µL was added to every mix and incubate the

reaction for one hour at 25o C. After this 1µL of proteinase K solution was added,

mixed briefly and incubated for ten minutes at 37o C. Transformation into E.coli

cells was performed by heat-shock at 42o C for 30 seconds and immediately

transferred back to ice. Per reaction 250µL S.O.C. Medium was added and was

shaken horizontally (200 rpm) at 37o C for one to three hours. Of the reaction

100µL was plated on LB agar plates with 50µg mL-1 kanamycin (pGBKT7) or

ampicillin (pGADT7) and left overnight at 37o C. Growing colonies were picked and

grown, overnight, in LB liquid media containing antibiotics. The plasmids were

extracted using small scale plasmid preparation (QIAprep Spin Miniprep Kit) and

the presence of the wanted gene tested using the T7 forward primer (on the

plasmid) and the specific reverse primer in a PCR reaction. The plasmids of the

positive amplified clones were sent for sequencing, to determine whether the

gene is complete and whether it was correctly situated in the plasmid. The

confirmed plasmids were used for the yeast-two hybrid (Y2H).

3.3.3. Yeast-two hybrid

The Y2H system was used to determine whether different proteins can interact

with each other within a cell. In our case for example, it was used to find this out

for FD proteins and StSP3D protein. The target protein was fused to a DNA binding

domain that directs the fusion protein to the regulatory region of a reporter gene

as “bait” (pGBKT7). In case this target protein binds to another specially designed

protein (“prey”, pGADT7) in the cell nucleus of the yeast, their interaction binds

two halves of a transcriptional activator. This then switches on the expression of

the reporter gene. The pGADT7 (prey) contains TRP1 nutritional marker and

pGBKT7 (bait) contains LEU2 nutritional marker. Therefor the plates used to check

yeast grow, showing that it was carrying both plasmids, contained histidine and

adenine. If there was growth it was grown on plates without histidine and adenine,

to get a better population.

Preparation of fresh yeast competent cells

14

For yeast transformation the lithium acetate method was followed. The Gold yeast

strain was used from a stock plate with separate colonies (with a diameter of 2-

3mm) and grown in YPD (this is liquid media that contains per 250mL: 12.5g Difco

YPD Broth, 7.5g purified agar and 245MQ). The sample was vortexed vigorously

for five minutes to disperse any clumps. Then, the sample was then put in a flask

containing 50mL of YPD and thereafter was incubated at 30o C for 16-18 hours

while being shaken at 250rpm to a stationary phase (OD600>1.5). In a new flask

containing 100mL YPD, the sample was added to reach an OD600 concentration

between 0.2-0.3 and incubated at 30o C for three to five hours while being shaken

(230rpm). The incubation time was depending on the OD600 value. This value

should get to an OD600 of 0.4-0.6. The cells were placed in a 50mL tube and

centrifuged at 3000xg for five minutes at room temperature (22o C). The

supernatant was discarded and the cell pellet was re-suspended with TE and after

that transferred to a new tube. It was centrifuged again at 3000xg for five minutes

at room temperature (washing step). The supernatant was discarded and the cell

pellet re-suspended with 1.5mL of freshly prepared 1X TE/1X lithium acetate (LiAc)

(competent cells ready for transformation).

Yeast transformation and selection

For transformation 0.1µg plasmid DNA (10µL per plasmid: pGADT7 [100ng] or

pGBKT7 [100ng]) and 0.1µg Fish (before using needs to be desaturated by boiling

for two to five minutes at 95o C) were added. This was done separately for all the

genes. Thereafter this was put in a 2mL tube and mixed. 0.1mL of yeast competent

cells was added and vortexed before adding 0.6mL of TE/LiAc/PEG (1mL TE 20X

1mL-1 LiAc10x 8mL-1 PEG 50%) solution and vortexed for ten seconds. The tubes

were then incubated at 30o C for 30 minutes (where being shaken at 200rpm).

From DMSO was 70µL added and mixed gently by inversion. The samples received

a heat shock for 30 minutes in a 42o C water bath, followed by a cool down on ice

for one to two minutes. The supernatant was removed after centrifuging the cells

for five seconds at 14,000rpm at room temperature. The cells were re-suspended

with 0.25mL 1X TE buffer and then 100µL plated on SD agar plates (-2aa [3.35g

nitrogen base, 10g glucose, 0.3 ODD supplement, 0.22g adenine, 0.22g histidine,

and MQ added to 500µL] and -4aa [3.35g nitrogen base, 10g glucose, 0.3 ODD

supplement, and MQ added to 500µL]). This was to select for the desired

transformation (-2aa) and for the interaction (-4aa). The plates were incubated for

two to four days at 30o C. Colonies were picked and diluted 10, 100 and 1000 times.

They were drop plated in triple on -2aa liquid media and grown overnight. If

growth is observed it indicates that an interaction is found, while if there is no

growth it indicates an absence of interaction between the two proteins.

15

3.4. Data analyses

3.4.1. Phenotypic data

Data was exported in Excel and analysed with IBM SPSS Statistics version 22. The

means were analysed for significant differences between genotypes using ANOVA

and LSD with an α=0.05.

3.4.2. qPCR data

qPCR data was extracted with CFX Manager (Bio-Rad) version 3.0 and imported

into Excel for further analysis. The mean of the estimated starting quantity (SQ)

and the associated standard deviation (SD) are used for expression analysis. The

expression of the gene of interest is the SQ of this gene divided by the SQ of the

reference gene. With the associate SD calculated by:

√𝑆𝑄 𝑔𝑒𝑛𝑒 𝑜𝑓 𝑖𝑛𝑡𝑒𝑟𝑒𝑠𝑡

𝑆𝑄 𝑟𝑒𝑓𝑒𝑟𝑒𝑛𝑐𝑒 𝑔𝑒𝑛𝑒𝑋 (

𝑆𝐷 𝑔𝑒𝑛𝑒 𝑜𝑓 𝑖𝑛𝑡𝑒𝑟𝑒𝑠𝑡

𝑆𝑄 𝑔𝑒𝑛𝑒 𝑜𝑓 𝑖𝑛𝑡𝑒𝑟𝑒𝑠𝑡)

2

+ (𝑆𝐷 𝑟𝑒𝑓𝑒𝑟𝑒𝑛𝑐𝑒 𝑔𝑒𝑛𝑒

𝑆𝑄 𝑟𝑒𝑓𝑒𝑟𝑒𝑛𝑐𝑒 𝑔𝑒𝑛𝑒)

2

T-test and ANOVA, both with LSD, were used to statistically analyse the data with

α=0.05. This to find out whether there was a significant difference between the

genotypes and between the different samples within a genotype. The SD is based

on two biological replicates and for each biological replicate has 3 technical

replicates. IMB SPSS Statistics version 22 was used for this.

3.4.3. Yeast-two hybrid data

To calculate the cotransformation of one of the plasmid types, the amount of

growing colonies have to be counted (cfu). This from the dilution drop plates. The

formula to calculate the cotransformation (cfu ng-1 DNA) is:

𝑉𝑜𝑙. 𝑝𝑙𝑎𝑡𝑒𝑑 (𝜇𝐿)𝑋 𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛 𝑓𝑎𝑐𝑡𝑜𝑟 𝑋 𝑎𝑚𝑜𝑢𝑛𝑡 𝑜𝑓 𝐷𝑁𝐴 𝑢𝑠𝑒𝑑 (𝜇𝑔)

16

4. Results

4.1 StFD genes in potato

During genome sequencing two StFD homologues genes were annotated, both are

located on chromosome 2. We named these StFD1 (PGSC0003DMT00061403; also

known as StFDL1) and StFD2 (PGSC0003DMT00009393; also known as StFD; Teo

et al., 2017) (figure 4.1). StFD2 is located in a QTL interval found by Hurtado-Lopez

(2012) for the onset of flowering and is therefore a potential candidate gene for

being involved in flowering. Looking at the publicly available gene expression data,

from the potato genome browser (solanaceae.plantbiology.msu.edu), StFD1

appears to be more expressed throughout the plant, while StFD2 is mainly

expressed in the meristem. While the role of the two StFD genes in potato

flowering has not yet been established, it was found that StFD1 is involved in the

regulation of tuber formation together with StSP6A (Teo et al., 2017).

Previous flowering phenotyping showed that genotype E flowers earlier than

genotype C, while both genotypes form tubers around the same time. StFD1 and

StFD2 loci have different allelic variants in C and E genotypes (Willemsen,

unpublished). The sequences of the different alleles are shown in Appendix 2.

These differences in flowering phenotype and gene sequences of E and C make

them ideal to determine possible expression differences and to find out whether

there is a correlation between the StFDs and flower initiation. Due to limited time,

however, no distinction was made in allelic expression and was only looked at the

difference of gene expression from StFD1 and StFD2.

Figure 4.1 Chromosome 2 with the two StFD genes. StFD1 is the first one (positioned at around 20 Mb) and StFD2 is the second (positioned at about 39 Mb; solanaceae.plantbiology.msu.edu).

17

4.2. Sequence comparison

Next to sequences of StFD from genotype S. andigena and DM, 50 other sequences

were found of different plant species, which all contain a bZIP motif at the c-

terminus part of the encoded transcription factor. Figure 4.2 shows a tree where

all the available sequences are compared with each other. It is clear that the

sequences from Solanaceae and Brassicaceae form individual clades. StFD2 is

more similar to the SPGB gene from tomato (S. lycopersicum), than to StFD1. This

might indicate that the function of StFD2 is the same as the function of the SPGB

gene in tomato.

Figure 4.2 The of the StFD conceptually translated proteins and their genetic variants compared with other similar bZIP transcription factors gathered from the public repository NCBI.

18

4.3. Phenotyping and expression analyses

In order to find out if the StFD genes were involved in flowering, the growth and

development of the plants were measured and observed. It was found that the

flowering times of the four genotypes (C, E, CE3027, and CE3130) differed

maximally two days, where E and CE3027 were the earliest and C was the latest

(table 4.1). The same difference is observed for anthesis. For genotype CE3130

only two plants had opened one flower before both plants aborted flowering, the

rest of the plants had flower abortion before anthesis could happen. The E and

CE3027 genotypes formed more side shoots than CE3130 and C. Though the C

genotypes were forming side shoots at the end of the experiment. Next to this C

finished with flowering at the earliest time after 52 DAP (days after planting).

When examining the tuberisation, genotype E had formed stolons after 18 DAP,

while only 50% of the C plants had formed stolons. After 25 DAP, all plants from

both these genotypes had formed stolons. At 32 DAP these stolons developed into

tubers, while the C genotypes had fewer but larger tubers than the E genotypes.

Table 4.1 Observations of apical flower bud, anthesis and flower abortion for genotype E, CE3027, CE3130 and C.

As described in section 3.2.2. Experimental set-up each plant had five leaves at

the time of transplanting from in vitro media to soil. Over time, leaf development

shows that genotype E formed significantly (p<0.002) more leaves than the other

genotypes (figure 4.3). After 23-25 DAP the plants started flowering. It is well

known that leaf development stops if on the same shoot the plant starts flowering.

However, here the plants still formed four to five leaves. This was because these

leaves were undersized before they were counted.

We can conclude that there is a small difference in flowering time between

genotype E and C. Further, genotype CE3130 was the only genotype with flower

abortion. Also was found, that genotype E forms more leaves than the other

genotypes, which all formed a similar amount of leaves and were grown under the

Apical flower bud (days) Anthesis (days) Aborts flowering (days)

E 23 ± 0 37 ± 0.41

CE3027 23 ± 0.26 37 ± 1.68

CE3130 24 ± 0.88 40 ± 2.83 43 ± 0.26

C 25 ± 1.13 40 ± 1.96

19

same conditions. An explanation for this could be that the plastochrone length for

genotype E is shorten than the plastochrone length of the other genotypes.

5

7

9

11

13

15

17

19

21

0 11 18 25 32 39 46 52

Nu

mb

er

of

leav

es

DAP

E

CE3027

CE3130

C

Figure 4.3 Number of leaves during development. Genotype E forms quicker and more leaves than the other genotypes. The other genotype from the same amount of leaves in the end, but CE3027 and CE3130 are a bit quicker in forming the leaves than C.

20

4.4. 24-hour time course

Genes can be dependent on the circadian clock, which might reveal their function.

In order to find out if StFD1 and StFD2 are regulated by the circadian clock a 24-

hour time course was performed. We found that the relative expression of StFD1

was higher than the relative expression of StFD2 this for both LD and SD (figure

4.4). The StFD1 relative expression goes down throughout the day and goes up

during the night. Indicating that it is regulated by the circadian clock, this for both

LD and SD conditions. However, we can’t conclude whether StFD2 is regulated by

the circadian clock, as the relative expression is too low.

Figure 4.4 The relative expression of StFD1 and StFD2 in S. andigena, over a period of 24 hours. Zt means zeitgeber time. The dark grey part is the dark period for the long day (LD). The light and dark grey parts form together the dark period for the short day (SD).

21

4.5. Gene expression during development

To find out whether the StFD genes were involved in flowering, the mRNA

production in different plant tissue was measured. In previous research it was

found that E flowered approximately two weeks earlier than C. Based on these

results we chosen to grow E for only five weeks and C for seven weeks. In order to

find out where StFD1, StFD2, StSP3D, and StAP1 are expressed, we took samples

from different plant material: leaf, apex enriched material, and stolon.

4.5.1. Leaves

In the leaf samples was found that StFD1 is significantly higher expressed than

StFD2, this is especially the case in genotype C (figure 4.5). StFD1 mRNA expression

increased in the leaves during development and reached a maximum after five

weeks, which is just one week after the floral buds were first observed and is

significant from the rest of the weeks (P<0.01). For StFD2 there was no difference

between the two genotypes and it was very low expressed in the leaves. StSP3D

mRNA was also low expressed but there were two significant peaks for E (P<0.02).

These peaks occurred just after the plants started flowering. As StFD2 also StAP1,

which is a marker for the floral transition in the meristem, is least expressed in the

leaves. Although in genotype E increased in expression and had a peak in week

four which was significant to all of the other time point except for week five

(P<0.03). The expression of StSP3D is low, except in genotype E which has an

increase in expression in week 4 and 5.

22

0

2

4

6

8

10

1 2 3 4 5 6 7

StFD

1/E

IF3

e

Time (weeks)

StFD1E

C

0,00

0,05

0,10

0,15

0,20

1 2 3 4 5 6 7

StFD

2/E

IF3

e

Time (weeks)

StFD2E

C

0,00

0,10

0,20

0,30

0,40

0,50

1 2 3 4 5 6 7

StSP

3D

/EIF

3e

Time (weeks)

StSP3DE

C

0,000

0,005

0,010

0,015

0,020

0,025

1 2 3 4 5 6 7

StA

P1

/EIF

3e

Time (weeks)

StAP1E

C

Figure 4.5 Expression of different genes in leave tissue of genotype E and C. Genotype E started flowering just after three weeks DAP and C just before four weeks DAP. The expression of the genes in genotype E was only measured for the first five weeks and for C the expression was measured for seven weeks.

23

4.5.2. Apex enriched material

In the apex enriched material StFD1 is less expressed (figure 4.6) compared to the

expression of StFD2 in the apex enriched material and the expression of StFD1 in

the leaves (figure 4.5). StFD2 was highly expressed in the apex enriched material,

with a peak in week two which was significant different for both genotypes (E,

P<0.04; C, P<0.01). This peak was just before the plants started flowering. StSP3D

was the least expressed, even lower than in the leaves. StAP1 expression increased

overtime for both genotypes, which is in agreement with the flowering data and a

role for StAP1 expression as marker for floral meristem identity, as used in other

plant species. Moreover, StAP1 mRNA levels are very similar in the two genotypes

E and C in agreement with the similar flowering time data recorded in this

experiments.

0,0

0,5

1,0

1,5

2,0

1 2 3 4 5 6 7

StFD

1/E

IF3

e

Time (weeks)

StFD1E

C

0

2

4

6

8

10

1 2 3 4 5 6 7

StFD

2/E

IF3

e

Time (weeks)

StFD2E

C

0,0

1,0

2,0

3,0

4,0

5,0

1 2 3 4 5 6 7

StA

P1

/EIF

3e

Time (weeks)

StAP1E

C

0,00

0,05

0,10

0,15

0,20

1 2 3 4 5 6 7

StSP

3D

/EIF

3E

Time (weeks)

StSP3DEC

Figure 4.6 Expression of different genes in apex enriched tissue of genotype E and C. Genotype E started flowering just after three weeks DAP and C just before four weeks DAP. The expression of the genes in genotype E was only measured for the first five weeks and for C the expression was measured for seven weeks.

24

4.5.3. Stolon

StFD1, StFD2 and StSP3D are all less expressed in the stolon (figure 4.7). StFD1

expression decreased over time, while the expression of StFD2 fluctuated over

time. StSP3D had a peak in week two for genotype C and for the rest of the weeks

the expression was low.

We conclude that StFD1 is highest expressed in leaves and stolon. The expression

of StSP3D is low in the leaves. Which was expected as it is known that that LD

conditions have a negative effect on this expression (Navarro et al., 2011). StFD2

and StAP1 are mainly expressed in the apex enriched material and the expression

of StAP1 increases after the peak of StFD2.

0,0

0,5

1,0

1,5

2,0

2,5

2 3 4 5 6 7

StFD

1/E

IF3

e

Time (weeks)

StFD1EC

0,0

1,0

2,0

3,0

4,0

5,0

2 3 4 5 6 7

StFD

2/E

IF3

e

Time (weeks)

StFD2EC

0,00

0,05

0,10

0,15

0,20

0,25

0,30

2 3 4 5 6 7

StSP

3D

/EIF

3e

Time (weeks)

StSP3DEC

Figure 4.7 Expression of different genes in stolon tissue of genotype E and C. The expression of the genes in genotype E was only measured for the first five weeks and for C the expression was measured for seven weeks. The vertical blue line represents the time that genotype E got stolons, the vertical red line represents when genotype C got stolons and the vertical green line represents when the stolons from both genotypes were starting to become tubers.

25

4.6. Yeast-two hybrid

To gather information about the function of the StFDs several yeast-two hybrids

were performed to find an interaction with StSP3D. The yeast-two hybrids were

two times performed. The first time only an interaction was found between StFD1

and StSP3D from S. andigena. However, the colonies took a week to grow. The

second time was done after the research thesis by Bergonzi & Gol (unpublished)

and an interaction was found between StFD1 and StSP3D, but also between StFD2

and StSP3D (figure 4.8). We concluded that StSP3D can interact with both of the

StFDs, which indicates that they might be involved in the initiation of flowering.

Figure 4.8The culture growth from the yeast-two hybrid (Bergonzi & Gol, unpublished). Growth on SD -3aa, means that an interaction between the two proteins is possible. Therefore, StFD1 can interact with StSP3D and StFD2 can also interact with StSP3D. All the potato genes are coming from S. andigena.

SD -2aa (–H-A)

SD -3aa (-H) 4 mM 3AT

102

102

10 102

102

10

26

5. Discussion

5.1. Sequence comparison

Comparing the different FD genes, the exon with the bZIP motif was generally well

conserved. This was expected as this part can bind specifically to the short

palindromic or pseudo palindromic target DNA sequence and as a result is

required for the functioning of the FD as transcription factor (Hakoshima, 2005).

The same is true for the SAP exon, which is required for the binding to 14-3-3, as

it was shown in different plant species including rice (Taoka et al., 2011). The first

exon of FD is not that well conserved as it varies between different families. There

are two families for which this difference stands out Solanaceae and Brassicaceae.

The reason why these families stood out is because more sequences of the

different FD genes from these families are available. Nevertheless, the gene in

general is well conserved, which indicates that it has an important function in the

angiosperms.

StFD2 is more similar to a SPGB gene from tomato than to StFD1, which might

indicate that the function of the protein is similar. In tomato SPGB interacts with

SP3D and triggers flowering (Cao et al., 2016; Pneuli et al., 2001). So, it is likely

that StFD2 is involved initiating flowering in potato.

5.2. Phenotyping and expression analyses

In order to find out whether the StFD genes were involved in flowering, the growth

and development of the plants were measured and observed. A difference was

observed in flowering times between genotype C and E, but the difference was

less than what was to be expected based on previous researches. This could be

due to the growing condition used in the earlier and described experiments,

glasshouse and climatic chamber respectively. Additionally, Celis-Gamboa et al.,

(2003) found that genotype C and E flowered and formed stolons within a

narrower than anticipated time period, relative to each other also when

genotypes were grown in the open field. Indicating that the observed flowering

time difference between genotype C and E in this research is possible.

Genotype CE3130 was the only genotype that showed flower bud abortion and

flower abortion. Kooman (1995) found that the rate at which the complete shift

of assimilate partitioning from shoot to tuber occurs, varies between cultivars and

depends on temperature and photoperiod. Meaning that the assimilates were

redirected towards tubers rather than the flowers. CE3130 is strongly induced to

tuberisation due to the condormation of the StCDF1 alleles and promotion of

StSP6A expression (kloosterman et al 2013). Flowering and tuberisation are in

competition for assimilates and the signals for initiating both are similar

(Almekinders & Struik, 1996).

27

5.3. Gene expression during development

In genotype C and E StFD2 was highest expressed in the apex enriched material,

with a peak expression one week before flowering was observed. This indicated

that it is likely that StFD2 is involved in flowering, which is in agreement with the

found QTL for the unset of flowering where StFD2 is in located (Hurtado-Lopez,

2012). After the peak expression, the amount expressed degrades over time.

There is a difference in the degradation of StFD2 between the genotypes. In E the

increase of StFD2 occurs quickly and it degrades even quicker. In genotype C the

change in the expressions from the week before and after the peak was less than

in genotype E. A possible explanation for this is that there is a slight difference in

flowering time between the plants from genotype C of one day, while in genotype

E there was no gap. The rapid reduction of FD has also been noticed in Arabidopsis

(Seedat et al., 2013). It could be that FD is only needed to start up flowering and

thereafter it no longer needed and expression reduces.

From our results we can’t conclude if StFD2 is regulated by the circadian clock, due

to that the relative expression levels are low. The results from the later

experiments show that the samples we took are inappropriate.

The highest expression of StSP3D was found in the leaves. This was expected as

StSP3D is produced in these (Navarro et al., 2011). It is similar to tomato where all

four FT-like genes (including SFT which is the homologue of StSP3D) are expressed

exclusively in leaf tissue (Cao et al., 2016). However, the expression levels were

low, likely because the plants were growing under LD conditions and StSP3D is

mainly produced during SD conditions (Navarro et al., 2011). Despite the low

levels, genotype E showed higher expression of StSP3D than genotype C. This

could be due to differences in StCDF1 alleles. StCDF1 indirectly downregulates the

production of StSP3D. Genotype E has alleles StCDF1.1 and StCDF1.2 and genotype

C has alleles StCDF1.1 and StCDF1.3. StCDF1.2 has an insertion resulting in a frame-

shift introducing a premature stop codon, which causes earlier flowering and

tuberisation (Kloosterman et al., 2013).

The expression of StAP1 mRNA was tested as a possible marker for the floral

transition. In Arabidopsis is AP1 produced in the apex, where it specifically marks

the presence of flower meristems (Wigge et al., 2005). In different plant species it

is shown that FD and FT initiate this expression (Abe et al., 2005; Taoka et al., 2011;

Wigge et al., 2005). We found that StAP1 is mainly expressed in the apex enriched

material and the expression starts after StFD2 is produced. The expression of

StAP1 kept increasing over the measuring time. This suggests that the StAP1

expression is conserved in potato, just like in other plant species (Abe et al., 2005;

Parmentier-Line & Coleman, 2015; Wigge et al., 2005).

28

We found that StFD1 is controlled by the circadian clock, where it decreases during

the day time and increases during the night time. Also was found that StFD1 was

highest expressed in the leaves and stolon. In the leaves of genotype C was a peak

expression a week after floral buds were observed. In tomato there is a FD

homolog found (SPGBi) which is mainly expressed in the leaves. It is thought that

the high FD expression in the leaves makes it unnecessary for SFT RNA to travel

towards its interacting partners as implied for Arabidopsis (Lifschitz et al., 2006).

This could also be the function of StFD1 in potato, accounting for the higher

expression in the leaves for genotype C.

The transition of stolon to tuber is a highly regulated process, involving

components from the photoperiod-dependent transition which are also shared

with the flowering regulatory pathway (Rodríguez-Falcón et al., 2006). However,

at the time of this research it had not been shown that FD is involved in

tuberisation. Later, Teo et al. (2017) published that StFD1 is involved in the

regulation of tuber formation together with StSP6A. Which could explain the high

expression in the stolon during the first sampling time. Also, a week after the high

expression the first stolons were observed.

5.4. Yeast-two hybrid

In this research an interaction was found between StFD1 and StSP3D, and StFD2

and StSP3D (Bergonzi & Gol, unpublished). The FT-FD complex interaction has

already been reported in other plant species including: rice, tomato, Arabidopsis,

wheat, pea and kiwi (Li & Dubcovsky, 2008; Lifschitz et al., 2006; Pnueli et al., 2001;

Sussmilch et al., 2015; Tsuji et al., 2013; Varkonyi-Grasic et al., 2013; Wigge et al.,

2005). This would suggest that it is a general mechanism for FT-mediated gene

activation in the shoot apical meristem in all higher plants.

29

6. Conclusion

The aim of this research was to investigate the role of StFD1 and StFD2 in potato

flowering, this was done by splitting the research into two different sections: 1)

phenotyping plant growth and correlating the phenotypes with gene expression

analysis, 2) testing the interaction between the different StFDs and StSP3D with a

yeast-two hybrid. We found that the expression of StFD2 is primarily restricted to

the apex, with a peak expression one week before flowering. After this peak, the

expression levels degraded over time. We also found that StFD2 can interact with

StSP3D and form a FAC. Overall, it is most likely that StFD2 is the canonical FD in

potato that sits in the meristem and interacts with StSP3D. Together they are most

likely involved in flower initiation.

We found that StFD1 is regulated by the circadian clock. StFD1 is mainly

transcribed in the leaves and can interact with StSP3D. It is unclear why StFD1 is

expressed in the leaves in a diurnally regulated manner. However, since FD

proteins are unknown to be transported, it is unlikely that this expression is linked

with flower transition. A peak expression was found in the stolon just a few weeks

before tuberisation was observed.

However, the functional characterisation, through generation of mutants and

transgenic lines is needed to elucidate the role of StFD1 and StFD2 in potato.

30

7. Recommendation

More research is needed to find the cause of flower abortion. It can be due to

genetic differences, to abiotic, to biotic influences, or to a combination of these.

In this research, we observed that the genotype with high tuberisation aborted all

the flowers. Indicating that it could be a problem in resource allocation and that

the plant allots more energy to tuberisation than to flowering, resulting in flower

abortion.

It is unclear whether StFD2 is regulated by the circadian clock, as samples that

were used were coming from whole vegetative plants. StFD2 is mainly produced

just before flowering and is in low levels expression in the leaves. Therefore, a new

24-hour time course of apex enriched material with plants that are almost

flowering could give more insight in whether StFD2 is dependent of the circadian

clock.

Only one S. andigena allele of StFD1 and one allele from StFD2 were used in the

yeast-two hybrid, however, there are more alleles from StFD1 and StFD2.

Particularly C and E present interesting allelic variation in StFD2 which is

hypothesis to underline the QTL for onset of flowering mapped in the CxE

population (Hurtado et al., 2012). To give a better view on the protein-protein

interaction, these different alleles have to be tested whether they can interact in

a yeast-two hybrid with StSP3D.

It is unknown whether FD can interact with TFL1, as different researches proven

opposite results (Abe et al., 2005; Wigge et al., 2005) but generally TFL1

homologues act as floral repressors. The interaction between StFD and StTFL1

might be interesting with regard to flowering in potato, as it could play a role in

repression of flowering and flower abortion.

In this research two protein-protein interactions were found between StFD1 and

StSP3D, and StFD2 and StSP3D. To prove that this is correct and possible it should

also be proven with the other systems pull down and BiFC. To finalise the

functional role of the two StFDs involves a transgenic approach. It is the only way

to understand the biological function of a given gene. All the previous results are

only correlation suggesting relations. Plants have to be down regulated in either

StFD1, StFD2 and both to understand existence of redundant roles, in order to find

the different effects between different StFD expressions. It is expected that the

results will show that StFD2 is involved in flowering, because it expresses highest

in the apex enriched material and it can form a FAC with StSP3D.

31

References

Abe M., Kobayashe Y., Yamamoto S., Daimon Y., Yamaguchi A., Ikeda Y., Ichinoki

H., Notaguchi M., Goto K. & Araki T. (2005) FD, a bZIP Protein Mediating Signals

form the Floral Pathway Integrator FT at the Shoot Apex. Science Vol. 309 No. 5737

Pp. 1052-1056.

Abelenda J.A., Navarro C. & Prat S. (2014) Flowring and tuberization: a tale of two

nightshades. Trends in Plant Science Vol. 19, No. 2, Pp. 115-122.

Almekinders C.J.M. & Struik P.C. (1996) Shoot development and flowering in

potato (Solanum tubersorum L.). Potato Research Vol. 39 No. 4 Pp. 581-607.

Altschul S.F., Madden T.L., Schäffer A.A., Zhang J., Zhang Z., Miller W. & Lipman

D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database

search progreams. Nucleic acids research Vol. 25 No. 17 Pp. 3389-3402.

Andrés F. & Coupland G. (2013) The genetic basis of flowering responses to

seasonal cues. Nature revieuws Genetics Vol. 13 Pp. 627-639.

Augustin J., Johnson S.R., Teitzel C., True R.H., Hogan J.M., Toma R.B., Shaw R.L. &

Deutsch R.M. (1978) Changes in nutrient composition of potatoes during home

preparation: II. Vitamins. American Potato Journal Vol. 55 Pp. 653-662.

Banks J.A., Nishiyama T., Hasebe M., Bowman J.L., Gribskov M., dePamphilis C.,

Albert V.A., Aono N., Aoyama T., Ambrose B.A., Ashton N.W., Axtell M.J., Barker

E., Barker M.S., Bennetzen J.L., Bonawithz N.D., Chapple C., Cheng C., Correa

L.G.G., Dacre M., DeBarry J., Dreyer I., Elias M. Engstrom E.M., Estelle M., Feng L.,

Finet C., Floyd S.K., Frommer W.B., Fujita T., Gramzow L., Gutensohn M., Harholt

J., Hattori M., Heyl A., Hirai T., Hiwatashi Y., Ishikawa M., Iwata M., Karol K.G.,

Koehler B., Kolukisaoglu U., Kubo M., Kurata T., Lalonde S., Li K., Li K., Li Y., Litt A.,

Lyons E., Manning G., Maruyama T., Michael T.P., Mikami K., Miyazaki S., Morinaga

S., Murat T., Mueller-Roeber B., Nelson D.R., Obara M., Oguri Y., Olmstead R.G.,

Onodera N., Petersen B.L., Pils B., Prigee M., Rensing S.A., Riaño-Pachón D.M.,

Robers A.W., Sato Y., Scheller H.V., Schulz B., Schulz C., Shakirov E., Shibagaki N.,

Shinohara N., Shippen D.E., Sørensen I., Sotooka R., Sugimoto N., Sugita M.,

Sumikawa N., Tanurdzic M., Theißen G., Ulvskov P., Wakazuki S., Weng J.K., Willats

W.W.G.T., Wipf D., Wolf P.G., Yang L., Zimmer A.D., Zhu Q., Mitros T., Hellsten U.,

Loqué D., Otillar R., Salamov A., Schmutz J., Shapiro H., Lindquist E., Lucas S.,

Rokhsar D. &Grigoriev I. (2011) The compact Selaginella genome identifies

changes in gene content associated with the evolution of vascular plants. Science

Vol. 332 No. 6032 Pp. 960-963.

Bergonzi S. & Gol D. (unpublished) Yeast-two hybrid results.

Bourke P. (2014) Tuber inhibition under abiotic stress. Master Thesis University

Wageningen.

Cao K., Cui L., Zhou X., Ye L., Zou Z. & Deng S. (2016) Four Tomato FLOWERING

LOCUS T-Like Proteins Axt Antagonistically to Regulate Floral Initiation. Frontiers

in Plant Science Pp. 6.

32

Celis-Gamboa C., Struik P.C., Jacobsen E. & Visser R.G.F. (2003) Temporal dynamics

of tubers formation and related processes in a crossing population of potato

(Solanum tuberosum). Ann. appl. Biol. Vol. 143 Pp. 175-186.

Chailakhyan M.K. (1936) New facts in support of the hormonal theory of plant

development. C. R. Acad. Sci. URSS No. 13 Pp. 79-83.

Desborough S.L. & Weiser C.J. (1974) Improving potato protein. I. Evaluation of

selection techniques. American Potato Journal Vol. 51 Pp. 185-196.

Ewing E.E. & Struik P.C. (1992) Tuber formation in potato: induction, initiation and

growth. Horicultural Reviews Vol. 14 Pp. 89-197.

González-Schain N.D., Díaz-Mendoza M., Zurczak M. & Suárez-López P. (2012)

Potato CONSTANS is involved in photoperiodic tuberization in a graft-transmissible

manner. Plant Journal Vol. 70 PP. 678-690.

Grun P. (1979) Evolution of the cultivated potato: a cutoplasmic analysis. Hawkes

J.G., Lester R.N., Skelding A.D. ed(s). The biology and taxonomy of the Solanaceae.

Pp. 655-665.

Grun P. (1990) The evolution of the cultivated potatoes. Economic Botany Vol. 44

No. 3 Pp.39–55.

Hakoshima, T. (2005). Leucine Zippers. Encyclopedia of Life Science Pp. 1-5.

Hawkes J.G. & Francisco-Ortega J. (1993) The early history of the potato in Europe.

Euphytica Vol. 70 Pp. 1-7.

Hijmans R.J. & Spooner D.M. (2001) Geographic distribution of wild potato

species. American Journal of Botany Vol. 88 No. 11 Pp. 2101-2112.

Hirsch C.N., Hirsch C.D., Felcher K., Coombs J., Zarka D., Deynze van A., Jong De

W., Veilleux R.E., Jansky S., Bethke P., Douches D.S. & Buell C.R. (2013)

Retrospective View of North American Potato (Solanum tuberosum L.) Breeding in

the 20th and 21st Centuries. G3: Genes| Genomes| Genetics Vol. 3 No. 6 Pp. 1003-

1013.

Hosaka K. & Hanneman R.E. (1998a) Genetics of self-compatibility in a self-

incompatible wild diploid potato species Solanum chacoense. 1. Detection of an S

locus inhibitor (Sli) gene. Euphytica Vol. 99 Pp.191–197.

Hosaka K. & Hanneman R.E. (1998b) Genetics of self-compatibility in a self-

incompatible wild diploid potato species Solanum chacoense. 2. Localization of an

S locus inhibitor (Sli) gene on the potato genome using DNA markers. Eutphytica

Vol. 103 Pp. 265–271.

Huamán Z. & Spooner D.M. (2002) Reclassification of landrace populations of

cultivated potatoes (Solanum Sect. Petota). American Journal of Botany Vol. 89 Pp.

947-965.

33

Hurtado P.X., Schnabel S.K., Zaban A., Veteläinen M., Virtanen E., Eilers P.H., van

Eeuwijk F.A., Visser R.G.F. & Maliepaard C. (2012) Dynamics of senescence-related

QTLs in potato. Euphytica Vol. 183 No. 3 Pp. 289-302.

Hurtado-Lopez P.Z. (2012) Investigating genotype by environment and QTL by

environment interactions for developmental traits in potato.Imaizumi T., Schultz

T.F., Harmon F.G., Ho L.A. & Kay S.A. (2005) FKF1 F-box protein mediates cyclic

degradation of a repressor of CONSTANS in Arabidopsis. Science Vol. 309 No. 5732

Pp. 293-297.

Jacobs J.M.E., Van Eck H.J., Arens P., Verkerk-Bakker B., te Lintel Hekkert B.,

Bastiaanssen H.J.M., El-Kharbotly A., Pereira A., Jacobsen E. & Stiekema W.J.

(1995) A genetic map of potato (Solanum tuberosum) integrating molecular

markers, inclurding transposons, and classical markers. Theoretical and Applied

Genetics Vol. 91 Pp. 289-300.

Kloosterman B., Vorst O., Hall R.D., Vissers R.G.F. & Bachem C.W. (2005) Tuber on

a chip: differential gene expression during potato tuber development. Plant

Biotechnology Jounal Vol. 3 Pp. 505-519.

Kloosterman B., Abelenda J.A., Gomez M.M.C., Oortwijn M., de Boer J.M.,

Kowitwanich K., Horvath B.M., van Eck H.J., Smaczniak C., Prat S., Visser G.F. &

Bachem C.W.B. (2013) Naturally occurring allele diversity allows potato cultivation

in northern latitudes. Nature Vol. 495 Pp. 246-252.

Kooman P. (1995) Yielding ability of potato crops as influenced by temperature

and daylength. Proefschrift Wagenigen University.

Levy D. & Veilleux E. (2007) Adaptation to High Temperatures and Salinity – A

Review. Amer J of Potato Res Vol. 84 Pp. 487-506.

Li C. & Dubcovsky J. (2008) Wheat FT protein regulates VRN1 transcription through

interactions with FDL2. The Plant Journal Vol. 55 Pp. 543-554.

Lifschitz E., Eviatar T., Rozman A., Shalit A., Goldshimdt A., Amsellem Z., Alvarez

J.P. & Eshed Y. (2006) The tomato FT ortholog triggers systemic signals that

regulate growth and flowering and substitute for diverse environmental stimuli.

PNAS Vol. 103 No. 16 Pp. 6398-6403.

Liljegren S.J., Gustafson-Brown C., Pinyopich A., Ditta G.S. & Yanofsky M.F. (1999)

Interactions among APETALA1, LEAFY, and TERMINAL FLOWER1 Specify Meristem

Fate. The Plant Cell Vol. 11 Pp. 1007-1018.

Lindhout P., Meijer D., Schotte T., Hutten R.C.B., Visser R.G.F. & Eck van H.J. (2011)

Towards F1 Hybrid seed Potato Breeding. Potato Research Vol. 54 Pp. 301-312.

Navarro C., Abelenda J.A., Cruz-Oró E., Cuéllar C.A., Tamaki S., Silva J., Shimamoto

K. & Prat S. (2011) Control of flowering and storage organ formation in potato by

FLOWEING LOCUS T. Nature Vol. 478, Pp. 119-123.

Negi P. & Nath N. (2002) Effect of partial dehydration on quality of canned

potatoes. European Food Research and Technology Vol. 215 No. 3 Pp. 231-234.

34

Parmentier-Line C.M. & Coleman G.D. (2015) Constitutive expression of the Poplar

FD-like basic leucine zipper transcription factor alters growth and bud

development. Plant Biotechnology Journal Pp. 1-11.

Pfaffl M.W. (2001) A new mathematical model for relative quantification in real-

time RT-PCR. Nucleic acids research Vol. 29 No. 9 Pp. e45-e45.

Pnueli L., Gutfinger T., Hareven D., Ben-Naim O., Ron N., Adir N. & Lifschitz E.

(2001) Tomato SP-Interacting Proteins Define a Conserved Signaling System That

Regulates Shoot Architecture and Flowering. The Plant Cell Vol. 13 Pp. 2687-2702.

Rensing S.A., Lang D., Zimmer A.D., Terry A., Salamov A., Shapiro H., Nishiyama T.,

Perroud P.F., Lindquist E.A., Kamisugi Y, Tanahashi T., Sakakibara K., Fujita T., Oishi

K., Shin-I T., Kuroki Y., Toyoda A., Suzuki Y., Hashimoto S., Yamaguchi K., Sugano

S., Kohara Y., Fujiyama A., Anterola A., Aoki S., Ashton N., Barbazuk B., Barker E.,

Bennetzen J.L., Blankenship R., Cho S.H., Dutcher S.K., Estelle M., Fawcett J.A.,

Gundlach H., Hanada K., Heyl A., Hicks K.A., Hughes J., Lohr M., Mayer K.,

Melkozernov A., Murata T., Nelson D.R., Pils B., Prigge M., Reiss B., Renner T.,

Rombauts S., Rushton P.J., Sanderfoot A., Schween G., Shiu S.H., Stueber K.,

Theodoulou F.L., Tu H., Van de Peer Y., Verrier P.J., Waters E., Wood A., Yang L.,

Cove D., Cuming A.C., Hasebe M., Lucas S., Mishler B.D., Reski R., Grigoriev I.V. &

Quatrano R.S. Boore J.L. (2008) The Physcomitrella Genome Reveals Evolutionary

Insights into the Conquest of Land by Plants. Science Vol. 319 Pp. 64-69.

Rodríguez-Falcón M., Bou J. &Prat S. (2006) Seasonal Control of Tuberizion in

Potato: Covnseved Elements with the Flowering Response. The Annual Review

Plant Biology Vol. 57 Pp. 151-180.

Sawa M., Nusinow D.A., Kay S.A. & Imaizumi T. (2007) FKF1 and GIGANTEA

complex formation in required for day-length measurement in Arabidopsis.

Science Vol. 318 No. 5848 Pp. 261-265.

Seedat N., Dinsdale A., Ong E.K. & Gendall A.R. (2013) Acceleration of flowering in

Arabidopsis thaliana by Cape Verde Islands alleles of FLOWERING H is dependent

on the floral promoter FD. Journal of Experimental Botany Vol. 64 No. 10 Pp. 2767-

2778.

Spooner D.M., McLean K., Ramsay G., Waugh R. & Bryan G.J. (2005) A single

domestication for potato based on multilocus amplified fragment length

polymorphism genotyping. PNAS Vol. 102 No. 41 Pp. 14694-14699.

Sussmilch F.C., Berbel A., Hecht V., Vander Schoor J.K., Ferrándiz C., Madueño F &

Weller J.L. (2015) Pea VEGETATIVE2 Is an FD Homolog That Is Essential for

Flowering and Compound Inflorescence Development. The Plant Cell Vol. 27 Pp.

1046-1060.

Taoka K.I., Ohki I., Tsuji H., Furuita K., Hayashi K., Yanase T., Yamaguchi M.,

Nakashima C., Purwestri Y.A., Tamaki S., Ogaki Y., Shimada C., Nakagawa A., Kojima

C. & Shimamoto K. (2011) 14-3-3 proteins act as intracellular receptors for rice

Hd3a florigen. NATURE Vol. 476 Pp. 332-338.

35

Teo C.J., Takahashi K., Shimizu K., Shimamoto K. & Taoka K. (2017) Potato Tuber

Induction in Regulated by Interactions Between Components of a Tuberigen

Complex. Plant Cell Physiology Vol. 58 No. 2 Pp. 365-374.

Tsuji H., Nakamura H., Taoka K. & Shimamoto K. (2013) Functional Diversification

of FD Transcription Factors in Rice, Components of Florigen Activation Complexes.

Plant cell Physiol. Vol. 54 No. 3 Pp. 385-397.

Turck F., Fornara F. & Coupland G. (2008) Regulation and identity of Florigen:

FLOWERING LOCUS T Moves Center Stage. Annual Review Plant Biology Vol. 59 Pp.

573-594.

Tylewicz S., Tsuji H., Miskolczi P., Petterle A., Azeez A., Jonsson K., Shimamoto K.

& Bhalerao R.P. (2015) Dual role of tree florigen activation complex component

FD in photperiodic growth control and adaptive response pathway. PNAS Vol . 112

No. 10 Pp. 3140-3145.

Valkonen J.P (2007) Viruses: economical losses and biotechnological potential.

Potato biology and biotechnology Pp. 619-641.

Varkonyi-Gasic E., Moss S.M.A., Voogd C., Wang T., Putterill J. & Hellens R.P. (2013)

Homologs of FT, CEN and FD respond to developmental and environmental signals

affecting growth and flowering in the perennial vine kiwifruit. New Phytologist Vol.

198 Pp. 732-746.

Wigge P.A., Kim M.C., Jaeger K.E., Busch W., Schmid M., Lohmann J.U. & Weigel D.

(2005) Integration of Spatial and Temporal Information During Floral Induction in

Arabidopsis. Science Vol. 309 Pp. 1056-1059.

36

Appendix 1: Primers Table App 1.1 Primers that were used, the usage of the primers are all for potato

Primer Sequence

FD1 forward for qPCR and cloning CACCATGTGGTCATCAAGTAATGAAG

FD1 reverse for cloning TCAAAATGGGGCCGTTGATG

FD1 reverse for qPCR TGGGATGATTATAGCTACAAGATGT

FD2 forward DM for cloning CACCATGTGGTCATCAAGCAGGTC

FD2 reverse for cloning TCAAAATGGAGCGGTTGACG

FD2 forward C1 for cloning CACCATCTGGTCATCAAGCAGGTC

FD2 forward C2 for cloning CACCATGGAAGAAGTGTGGAAAG

FD2 forward C3 for sequencing CATTCCCAACTCTTTGTTCTC

FD2 forward E cloning CACCATGTGGTCATCAAGCAGTGAC

FD2 negative control reverse cloning TCAATGAAGAGAGTTCTTTTTTG

FD2 forward for qPCR TTCCCCATTTTCTCCAAGAC

FD2 reverse for qPCR TCCACCAAAATTAGCACCTTG

StSP3D forward for qPCR GGACCCAGATGCTCCAAGTC

stSP3D reverse for qPCR CTTGCCAAAACTTGAACCTG

TFL1 forward for cloning CACCATGGCTTCCAAAATGTGTGAAC

TFL1 reverse for cloning TCAACGCCTTCTAGCGGCAG

AP1 forward for qPCR GGCACCAGCAAACTAATCAAG

AP1 reverse for qPCR CTCCTTGCTTCTGCTGCTTC

ELF3e (349C1) forward for housekeeping gene

GGAGCACAGGAGAAGATGAAGGAG

ELF3e (349C1) reverse for housekeeping gene

CGTTGGTGAATGCGGCAGTAGG

NAC forward for housekeeping gene ATATAGAGCTGGTGATGACT

NAC reverse for housekeeping gene TCCATGATAGCAGAGACTA *Since for S.andigena we have no genome information, primers were designed on the reference genome DM.

37

Appendix 2: Sequences

The sequences highlighted in yellow are the introns of the gene sequences, the

not highlighted parts are the exons.

>StFD1_Genome.DNA.allele_DM

ATGTGGTCATCAAGTAATGAAGAACATCAAGGGTTAAACAAAAACCTTGCAACTAACTC

TTCAAAATCATCATCATCATCATCATCTACATCTTGTAGCTATAATCATCCCATTAATCCT

ATACTAATAAATAGTAAAACCATGGAAGAAGTATGGAAAGACATAAATCTTTCATGTTC

TAGAGATCCACAAAATACAACTGCTGGTGGTATAATTTTGCAAGATTTATTGGCAAGAC

CATTTGCTAATAACCCTTCAACAGCAGCAGCTTATGGTTCCCCTGTTCCTCCCCTGCCTCC

TCCCCCTGTTACCATGTTGACATTGAACTCTGGCCCTGAATTTCATTTCTTTAGCACCTTA

AACCCAATCAGACAAACTCAACAAAAAAACATTTCTAATGAGGGATTAGCTTCACCAGC

TCCTGGAAGAAAAAGACATCCTGAATCAAATAACAACAATTCTGGTGACCAGAAAAGC

AAGAGGATGATAAAGAACCGTGAGTCCGCTGCTCGATCCCGGGCTCGAAAGCAGGTA

AGTTTTTATTCTCTTCTTATAATAAAATGCATCATTGCCTGATTGAACAGTCACCTGTACA

TCATAATCTTACTCCTTATAAATGGAGTGACATATTATAGTTGACAAGTTCAAACTTGTTT

GAGACTGAAACGTAGTAATCGAGACTCTTTTGGTCAGTTTTGCTGATTTTAGTAGTGAT

ATGTTTTCATATAACTTGCAGGCTTACACGAATGAATTAGAGATGGAAGTAGCCAATTT

GATGGAAGAAAATGCCAGGCTCAAGAGGCAGCAGCAACAGGTTACTTTTTATGGTTTA

GCTAAATCTTTTGGAGTGTAAAAAACTCATCTTTTTTCTCATACATCTGTGTCCTTTTTCAT

GTGGTGGTCAGTTATGCTTAGCTTCAGCTGGTGCTCTACTTCCAAAAATGAAGTCACTC

AATAGAACATCAACGGCCCCATTTTGA

>StFD1_Genome.DNA.Allele_E

ATGTGGTCATCAAGTAATGAAGAACATCAAGGGTTAAACAAAAACCTTGCAACTAACTC

TTCAAAATCATCATCATCATCATCATCTACATCTTGTAGCTATAATCATCCCATTAATCCT

ATGCTAATAAATAGTAAAACCATGGAACAAGTATGGAAAGACATAAATCTTTCATGTTC

TAGAGATCCACAAAATACAACTGCTGGTGGTATAATTTTGCAAGATTTATTGGCAAGAC

CATTTGCTAATAACCCTTCAACAGCAGCAGCAGCAGCTTATGGTTCCCCTGTTCCTCCCT

TGCCTCCTCCCCCTGTTACCATGTTGACATTGAACTCTGGCCCTGAATTTCATTTCTTTAG

CACCACCTTAAACCCAATCAGACAAACTCAACAAAAAAACATTTCTATTGAGGGATTAG

CTTCACCAGCTCCAAGAAGAAAAAGACATCCTGAATCAAATAACAACAATTCTGGTGAC

CAGAAAAGCAAGAGGATGATCAAGAACCGTGAGTCCGCTGCTCGATCCCGGGCTCGAA

AGCAGGTAAGTTTTTATTCTCTTCTTATAATAAAATGCATCATTGCCTGATTGAACAGTC

ACCTGTACATCATAATCTTACTCCTTATAAATAGAGTGACATATTATAGTTGACAAGTTC

AAACTTGTTTGAGACTGAAACGTAGTAATCGAGACTCTTTTGATCAGTTTTGCTGATTTT

AGTAGTGATATGTTTTCATATAACTTGCAGGCTTACACGAATGAATTGGAGATGGAAGT

AGCCAATTTGATGGAAGAAAATGCCAGGCTCAAGAaGCAGCAGCAACAGGTTACTTTT

TATGGTTTAGCTAAATCTGTTGGAGTGTAAAAAACTCATCTTTTTTCTCATTCATCTGTGC

CCTTTTTCATGTGGTGGTCAGTTATGCTTAGCTTCAGCTGGTGCTCAACTTCCAAAAATG

AAGTCATCACTCAATAGAACATCAACGGCCCCATTTTGA

38

>StFD1_Genome.DNA.allele_C

ATGTGGTCATCAAGTAATGAAGAACATCAAGGGTTAAACAAAAACCTTGCAACTAACTC

TTCAAAATCATCATCATCATCATCATCTACATCTTGTAGCTATAATCATCCCATTAATCCT

ATGCTAATAAATAGTAAAACCATGGAAGAAGTATGGAAAGACATAAATCTTTCATGTTC

TAGAGATCCACAAAATACAACTGCTGGTGGTATAATTTTGCAAGATTTATTGGCAAGAC

CATTTGCTAATAACCCTTCAACAGCAGCAGCTTATGGTTCCCCTGTTCCTCCCCTGCCTCC

TCCCCCTGTTACCATGTTGACATTGAACTCTGGCCCTGAATTTCATTTCTTTAGCACCTTA

AACCCAATCAGACAAACTCAACAAAAAAACATTTCTAATGAGGGATTAGCTTCACCAGC

TCCAAGAAGAAAAAGACATCCTGAATCAAATAACAACAATTCTGGTGACCAGAAAAGC

AAGAGGATGATCAAGAACCGTGAGTCCGCTGCTCGATCCCGGGCTCGAAAGCAGGTAA

GTTTTTATTCTCTTCTTATAATAAAATGCATCATTGCCTGATTGAACAGTCACCTGTACAT

CATAATCTTACTCCTTATAAATGGAGTGACATATTATAGTTGACAAGTTCAAACTTGTTT

GAGACTGAAACGTAGTAATCGAGACTCTTTTGGTCAGTTTTGCTGATTTTAGTAGTGAT

ATGTTTTCATATAACTTGCAGGCTTACACGAATGAATTGGAGATGGAAGTAGCCAATTT

GATGGAAGAAAATGCCAGGCTCAAGAAGCAGCAGCAACAGGTTACTTTTTATGGTTTA

GCTAAATCTGTTGGAGTGTAAAAAACTCATCTTTTTTCTCATTCATCTGTGCCCTTTTTCA

TGTGGTGGTCAGTTATGCTTAGCTTCAGCTGGTGCTCAACTTCCAAAAATGAAGTCACT

CAATAGAACATCAACGGCCCCATTTTGA

>FD2.1_Genomic.DNA.Allele_C

>ATC mutation in the start codon

AATAGTTCAACATAAAAAGAGTACATTCTCCTCGTTTTGTTCTCTATATACTGTATTTTTT

TTCAAGAATCCAATTATCTGGTCATCAAGCAGGTCTTCTTCATCTTCATCTCATTCCCCAT

TTTCTCCAAGACTCAAAACAATGGAAGAAGTGTGGAAAGATATTAATCTTTCTTCACTTC

AAGATCACACTACTAATTACTCGAAAGACCATCAACATCATCTTCATGATCATAATCATC

AAGGTGCTAATTTTGGTGGAATGATTTTACAAGATTTTTTGGCTAGGCCTTTTGCTAAG

GAATCTTCAGCAGCAGCAGCAGCCTCCTCTGTTTCAGCTACAACTATGCTGAATTTGAAC

TCTGTTCCAGAGCTTCATTTCTTTGATAACCCTTTAAGGCAAAACTCAATCTTGCACCAAC

CAAATGTTAGTGGAAGAAAAAGGGTTGTCCCTGAAACAGAGGACAATTCTACAGGGG

ACAGAAGAAATCAGAGGATGATCAAGAACAGAGAGTCTGCTTCTAGATCAAGAGCTAG

AAAGCAGGAAAGTGACACTCTCTTTATCTTAATCATCATTTGTTCTTTTCTGTTGTCCTGT

CGATTTTAAATTATGTTTCTTCATAAAAACACAACAGATAAACTATGTTGCTTCAATATGC

TGATTTTCTCTGTTTTCTTTTTTGGCCATTGATGATTTTTGCAGGCCTATTTGAATGAGTT

GGAGACGGAAGTGGCACATTTAGTTGAAGAAAATGCAAGGCTCAAGAAGCAGCAGCA

ACAGGTCCTTTTATCTTTTATTACACCATGTTTTAAATTCTGTTTATAACTAATGACTTTCT

TTAATTAGAACAAACAAATAAATGACTCAGAATTGATTGGTGTTTTTCTTAATTTGGACA

GTTACGCTTAGCTGCAGCTATTCAAGTTCCAAAAAAGAACTCTCTTCATCGGACGTCAAC

CGCTCCATTTTGA

>FD2.2_Genomic.DNA.Allele_E

39

AATAGTTCAACATAAAAAGAGTACATACCCCACTCTTTGTTCTCTATATATTTTTTTTGAA

GAATCCAATTATGTGGTCATCAAGCAGTGACAACAGGTCTTCTTCATCTTCATCTTCATC

TCATTCCCCATTTTCTCCAAGACTCAAAACAATGGAAGAAGTGTGGAAAGATATTAATC

TTTCTTCACTTCAAGATCACACTACTAATTACTCTAAAGACCATCAACATCATCTTCATGA

TCATAATCATCAAGGTGCTAATTTTGGTGGAATGATTTTACAAGATTTTTTGGCTAGGCC

TTTTGCTAATGAATCTTCAGCAGCAGCCTCCTCTGTTTCAGCTACAACTATGCTGAATTT

GAACTCTGTTCCAGAGCTTCATTTCTTTGATAACCCTTCAAGGCAAAACTCAATCTTGCA

CCAACCAAATGTTAGTGGAAGAAAAAGGGTTGTCCCTGAAACAGAGGACAATTCTACA

GGGGACAGAAGAAATCAGAGGATGATCAAGAACAGAGAGTCTGCTTCTAGATCAAGA

GCTAGAAAGCAGGAAAGTGACACTCTCTTTATCTTAATCATCATTTGTTCTAGTATAAAT

CTTTTCTGTTGTCCTGTCGATTTTTAGCAATAAATTATGTTTCTTTATAAAAACACAACAG

ATAAACTGTGTTGCTTCAATATGCTGATTTTCTCTGTTTTCTTTTTTGGCCATTGATGATTT

TTGCAGGCCTATTTGAATGAGTTGGAGACAGAAGTGGCACATTTAGTTGAAGAAAATG

CAAGGCTCAAGAAGCAGCAGCAACAGGTCCTATTATCTTTTATTACACCATGTTTTAAAT

TCTATTTATAACTAATGACTTTCTTTAATTAGAACAAACAAATAAATGACTCAGAATTGA

TTGGTGTTTTTCTTAATTTGGACAGTTACGCTTAGCTGCAGCTATTCAAGTTCCAAAAAA

GAACTCTCTTCATCGGACGTCAACCGCTCCATTTTGAGAAAA

>FD2.3_Genomic.DNA.Allele_C&E

AATAGTTCAACATAAAAAGAGTACATTCCCAACTCTTTGTTCTCTATATATTTTTTTTCAA

GAATCCAATTATGTGGTCATCAAGCAGGTCTTCTTCATCTTCATCTTCATCTCATTCCCCA

TTTTCTCCAAGACTCAAAACAATGGAAGAAGTGTGGAAAGATATTAATCTTTCTTCACTT

CAAGATCACACTACTAATTACTCTAAAGATCATCAACATCATCTTCATGATCATAATCAT

CAAGGTGCTAATTTTGGTGGAATGATTTTACAAGAATTTTTGGCTAGGCCTTTTGCTAAT

GAATCTTCACCAGCAGCAGCAGCCTCCCCTGTTTCAGCTACAACTATGCTGAATTTGAAC

TCTGTTCCAGAGCTTCATTTCTTTGATAACCCTTTAAGGCAAAACTCAATCTTGCACCAAC

CAAATGTTAGTGGAAGAAAAAGGGTTGTACCTGAAACAGAGGACAATTCTACAGGGG

ACAGAAGAAATCAGAGGATGATCAAGAACAGAGAGTCTGCTTCTAGATCAAGAGCTAG

AAAGCAGGAAAGTGACACTCTCTTTATCTTAATCATCATTTGTTCTTTTCTGTTGTCCTGT

CGATTTTTAGCAATAAATTATGTTTTTTTATAAAAACACAACAGATAAACTATGTTGCTTC

AATATGCTGATTTTCTCTGTTTTCTTTTTTGGCCATTGATGATTTTTGCAGGCCTATTTGA

ATGAGTTGGAGACGGAAGTGGCACATTTAGTTGAAGAAAATGCAAGGCTCAAGAAGC

AGCAGCAACAGGTCCTTTTATCTTTTATTACACCATGTTTTAAATTCTGTTTATAACTAAT

GACTTTCTTTAATTAGAACAAACAAATAAATGACTCAGAATTGATTGGTGTTTTTCTTAA

TTTGGACAGTTACGCTTAGCTGCAGTTATTCAAGTTCCAAAAAAGAACTCTCTTCATCGG

ACGTCAACCGCTCCATTTTGAGAAAA