expression profiles of sex steroid receptors in desmoid …exp. med., 2006, 210(3), 189-198 desmoid...

Sex Steroid Receptors in Desmoid Tumors 189

189

Tohoku J. Exp. Med., 2006, 210, 189-198

Received January 5, 2006; revision accepted for publication August 30, 2006.Correspondence: Masahito Hatori, M.D., Department of Orthopaedic Surgery, Tohoku University School of

Medicine 1-1 Seiryo-machi, Aoba-ku, Sendai 980-8574, Japan.e-mail: [email protected]

Expression Profiles of Sex Steroid Receptors in Desmoid Tumors

MASATO ISHIZUKA, MASAHITO HATORI,1 OSAMU DOHI,1 TAKASHI SUZUKI,2 YASUHIRO MIKI,2 CHIKA TAZAWA,2 HIRONOBU SASANO

2 and SHOICHI KOKUBUN1

Department of Orthopedic Surgery, Tohoku Rosai Hospital, Sendai, Japan1Department of Orthopaedic Surgery, and 2Department of Pathology, Tohoku University School of Medicine, Sendai, Japan

ISHIZUKA, M., HATORI, M., DOHI, O., SUZUKI, T., MIKI, Y., TAZAWA, C., SASANO, H. and KOKUBUN, S. Expression Profiles of Sex Steroid Receptors in Desmoid Tumors. Tohoku J. Exp. Med., 2006, 210 (3), 189-198 ── Desmoid tumors are benign fibrous neoplasms which arise from the fibrous tissue of intra- and extra- abdominal sites, but their clinical management is sometimes difficult because of extensive infiltration into the surrounding tissues. Desmoid tumors commonly occur in women, especially after childbirth. Recent-ly, both clinical and experimental findings indicate the possible roles of sex steroids in the development and progression of desmoid tumors but detailed information is still ambigu-ous. In this study, we first examined immunoreactivity of sex steroid receptors in desmoid tumors (27 cases) by immunohistochemistry and compared the findings with those in reac-tive self-limiting lesions associated with fibrosis (8 cases). Estrogen receptor (ER) α and ERβ immunoreactivities were detected in 7.4% (2/27) and 7.4% (2/27) of desmoid tumors, respectively. One desmoid tumor expressed both ERα and ERβ . Progesterone receptor (PR)-A and PR-B were detected in 25.9% (7/27) and 33.3% (9/27), respectively, and androgen receptor (AR) in 52.9% (14/27). In reactive lesions with fibrosis, only AR was detected in 37.5% (3/8). Sex steroid receptor mRNAs was further examined by reverse transcription and polymerase chain reaction (RT-PCR) analysis using fresh frozen tissues, demonstrating the expression of PR (PR-A and/or PR-B) and AR mRNAs in eight desmoid tumors examined and all cases of reactive fibrosis. These results indicate that sex steroid hormones might play an important role in the pathogenesis of desmoid tumors and could lead to the introduction of novel hormone therapeutic approaches in managing patients with recurrent desmoid tumors. ──── desmoid tumor; sex steroid receptor; fibrosis; immunohistochemistry; RT-PCR© 2006 Tohoku University Medical Press

Desmoid tumors were first described by McFarlane (1832) and the term desmoid is derived from the Greek word “Desmos”, meaning a band or tendon-like consistency (Muller 1838).

Histologically, desmoid tumors belong to a larger family of “fibromatosis” and consist of fibroblast-like cells and abundant collagen. Desmoid tumors are benign proliferative lesions of fibroblasts but

M. Ishizuka et al.190 Sex Steroid Receptors in Desmoid Tumors 191

are histologically and biologically different from reactive fibrosis or the proliferation of fibroblasts that occurs, for example, in decubitus ulcer and scar tissues. The incidence of desmoid tumors in the general population is markedly low, represent-ing less than 0.1% of all the tumors and 3.5% of all fibrous tumors (MacAdam and Goligher 1970; Reitamo et al. 1982). The cause of desmoid tumors is still uncertain and may be related to trauma or hormonal factors, or may be associated with genetic predisposition. Desmoid has been reported in association with familial adenomatous polyposis (FAP), especially with Gardner’s syn-drome (Gardner and Richards 1953). Desmoid tumors are also classified according to the site of occurrence into extra-abdominal or intra-abdomi-nal (Musgrove and McDonald 1948) and abdomi-nal desmoid tumors (Goldblum and Fletcher 2002). In addition, different biological behaviors between sporadic tumors and FAP-associated ones have been postulated (Clark and Phillips 1996). Desmoid tumors are generally benign and have no potential to develop metastatic disease. However, they can be locally invasive and destructive to adjacent normal tissues and struc-tures (Kasukawa et al. 1999), which makes com-plete surgical excision very difficult, resulting in frequent recurrence in such the patients.

Sex steroids have been considered to play some role in the development of soft tissue lesions such as lymphangioleiomyomatosis (Sullivan 1998). Therefore, several investigators have examined the presence of sex steroid recep-tors in desmoid tumors. Sex steroids exert many of their effects through interaction with an intra-cellular receptor protein, which is a transcriptional activator (Beato and Klug 2000). It is therefore important to study the expression of sex steroid receptors for determining the biological actions of sex steroids in sex steroid-dependent tissues. Expression of estrogen receptors (ER) has been reported in 25 to 75% of desmoid tumors (Lim et al. 1986; Alman et al. 1992), but the absence of estrogen receptors in such tumors has also been reported (Fong et al. 1993; Serpell et al. 1999; Sorensen et al. 2002). Progesterone receptors (PR) have been reported to be present in desmoid

tumors by several investigators (Hayry et al. 1982; Fong et al. 1993), but no consistent results have been reported. In contrast, the androgen receptor (AR) has not been examined at all in des-moid tumors. Therefore, in this study, we exam-ined the expression of ERα , ERβ , PRA, PRB and AR by reverse transcription and polymerase chain reaction (RT-PCR) and immunohistochemistry in desmoid tumors and reactive self-limiting lesions associated with fibrosis as a control in order to study the possible involvement of sex steroids in the clinical or biological features of desmoid tumors.

MATERIALS AND METHODS

Tissue samplesTissue samples for immunohistochemical study

were obtained from twenty-seven patients with primary extra-abdominal and abdominal desmoid tumors. The sites of occurrence were the neck in one patient, the upper extremity in one patient, the chest wall in two patients, the back in seven patients, the lower extremity in ten patients, and the abdominal wall in six patients. No mesenteric (intra-abdominal) desmoid tumors were included. Of these twenty-seven, 8 were males and 19 were females and their ages at the time of diagnosis ranged from 13 to 72 years (37 ± 11 years) (Table 1). For RT-PCR analysis, fresh frozen desmoid tissues were obtained from eight of the twenty-seven patients, 2 males and 6 females (33 ± 14 years). None of the desmoid tumors were associated with FAP or Gardner’s syndrome. Reactive lesions associated with fibrosis, but showing no inflammation, were obtained from decubitus ulcer and scar tissues of 6 males and 2 females, means 46 ± 11 years old. All of these tissues were examined by both RT-PCR and immunohistochemistry. For RT-PCR study, these tissue samples were dissected into small pieces, frozen in liquid nitrogen and stored at –80°C. All speci-mens for immunohistochemical examination were fixed in 10% neutral formalin for 18h at room temperature and embedded in paraffin. These specimens were subse-quently sectioned at 3 μm and mounted on silane-coated glass slides (Matsunami Co. Ltd., Tokyo). This investi-gation was approved by the Ethics Committee on Human Study at Tohoku University School of Medicine (2002-168B).

ImmunohistochemistryThe monoclonal antibody for ERα (NCL-ER-6F11)


was obtained from Novocastra Laboratories (Newcastle, United Kingdom) and that for ERβ (06-629) was obtained from Genetex Biotechnology. Monoclonal anti-bodies for two isoforms of PR-A (hPRa 7) and PR-B (hPRa 2) were purchased from NeoMarkers (Fremont, CA, USA). These antibodies were raised in mouse against PR isoforms obtained from a human endometrial carcinoma (EnCa 101). PR-A and PR-B differ in that the PR-B protein contains an additional squence of at its amino terminus (Kastner et al. 1990). The hPRa2 anti-body recognizes only the PR-B receptor isoform, where-as the hPRa7 antibody employed in this study recognizes PR-A in 10% formalin-fixed and paraffin-embedded tis-sue specimens even following antigen retrieval (Mote et al. 1999). Monoclonal antibody for AR (AR411) was obtained from DAKO Corp (Carpinteria, CA, USA).

Immunohistochemical staining was performed using the streptavidin-biotin amplification method with a Histofine Kit (Nichirei, Tokyo). Details of the immuno-histochemical procedures used in this study were previ-ously described (Ishizuka et al. 2004). Antigen retrieval for all the receptors was performed using autoclave treat-ment at 120°C for 5 min. Dilutions of the primary anti-bodies used in our study were as follows: ERα , 1 :50; ERβ , 1 :50; PR-A, 1 :200; PR-B, 1 :200; and AR, 1 :100. The antigen-antibody complex was visualized with 3,3’-diaminobenzidine (DAB) solution (1 mM DAB, 50 mM Tris-HCl buffer [pH 7.6], and 0.006% H2O2), and coun-terstained with hematoxylin. Tissue sections of an inva-sive ductal carcinoma of the breast were used as positive

controls for ERα , ERβ , PR-A, PR-B and normal prostate tissue were used as a positive control for AR. As a nega-tive control, normal rabbit or mouse IgG was used instead of the primary antibodies. No specific immuno-reactivity was detected in these tissue sections. Two of the authors initially determined the fields simultaneously using a double-headed light microscope. The evaluation of ERα , ERβ , PR-A, PR-B and AR positive cells was performed on high-power fields (× 400) using a standard light microscope. Only distinctive intranuclear immuno-reactivity was considered positive. In each case, more than 500 cells were counted and the percentage of immu-noreactivity was independently determined. When inter-observer differences were greater than 5%, the immunos-tained slides were re-examined simultaneously using a double-headed light microscope and the percentage of positive cells was determined. When interobserver dif-ferences were less than 5%, the mean value was obtained as the positive rate. When more than 10% positive cells were detected, the case was considered positive.

RT-PCRTotal RNA was extracted from frozen samples using

TRIzol reagent (Invitrogen, Tokyo). The RNA concen-trations were determined spectrophotometrically. Total RNA (2 μg) was denatured at 70°C for 10 min and then reverse transcribed using oligo (dT) primers and SuperScript II reverse transcriptase (Invitrogen) in a final reaction volume of 20 μ l at 42°C for 60 min. The reac-tion was terminated by heating at 70°C for 15 min. Real-

TABLE 1. Oligonucleotide primer sequences used for real-time RT-PCR analysis. The PR primers employed can detect both PR-A and PR-B mRNAs.

mRNA Primer Sequence Gene bank/EMBLAccession number

Nucleotide number

ERα Sense AAGAGCTGCCAGGCCTGCC M12674 995-1161Antisense TTGGCAGCTCTCATGTCTCC

ERβ Sense GCTCAATTCCAGTATGTACC AB006590 1313-1554Antisense GGACCACATTTTTGCACT

PR Sense TGGAAGAAATGACTGCATCG M15716 1987-2182Antisense TAGGGCTTGGCTTTCATTTG

AR Sense CTCACCAAGCTCCTGGACTC M23263 3103-3349Antisense CAGGCAGAAGACATCTGAAG

GAPDH Sense TGAACGGGAAGCTCACTGG M33197 731-1038Antisense TCCACCACCCTGTTGCTGTA


time PCR amplification was performed on a LightCycler (Roche Diagnostics, Mannheim, Germany) using LightCycler FastStart DNA Master SYBR Green I (Roche). A master mix of the following reaction compo-nents was prepared at the indicated end-concentration: 13.4 μ l water, 1.6 μ l MgCl2 (3 mM), 1.0 μ l forward primer (1.0 μM), 1.0 μ l reverse primer (1.0 μM) and 2.0 μ l the LightCycler FastStart DNA Master SYBR Green I. Nineteen microliters of master mix was introduced into the glass capillaries and 20 ng cDNA in 1 μ l were added as PCR template. The primer sequences and optimal variables used in this study are listed in Table 1 (Greene et al. 1986; Tokunaga et al. 1987; Chang et al. 1988; Kastner et al. 1990; Ogawa et al. 1998). Gene specific primers for human glyceraldehyde-3-phosphate dehydro-genase (GAPDH) were used as an internal control. To avoid amplification of any genomic DNA, the forward and reverse primers for each gene were chosen from dif-ferent exons. An initial denaturing step at 95°C for 10 min was followed by 40 cycles of denaturing at 95°C for 15 sec, annealing at optimal temperature (ERα , 62°C; ERβ , 66°C; PR, 70°C and AR, 66°C) for 10 sec and extension at 72°C for 8 sec (PR) or 10 sec (ERα , ERβ and AR). PR is represents PR-A and/or PR-B, and the primers employed could detect both PR-A and PR-B mRNAs. Real-time PCR monitoring was achieved by measuring the fluorescent signal at the end of the anneal-ing phase for each cycle. Each run consisted of 5 exter-nal standards, a negative control without a template and patient samples with unknown mRNA concentrations. External standards for these receptor mRNAs were pre-pared by 5-fold serial dilutions of positive control cDNA. As a positive control, frozen tissues of breast carcinoma were used for ERα , ERβ and PR and those of normal testis were used for AR. Following RT-PCR, the reaction products were resolved on a 2%-agarose gel by electro-phoresis. Gels were stained with ethidium bromide to visualize the PCR product size. Negative control experi-ments lacked the cDNA substrate to check for the possi-bility of exogenous contaminant DNA. No amplified products were detected under these conditions.

RESULTS

ImmunohistochemistryThe results of immunohistochemistory of sex

steroid receptors were summarized in Table 2. ERα and ERβ immunoreactivities were detected in 7.4% and 7.4% of the desmoid tumors, respec-tively, PR-A and PR-B in 25.9% and 33.3%,

respectively, and AR in 52.9% of the desmoid tumors (Fig. 1). PR-A and PR-B were simultane-ously detected in six cases of these desmoid tumors (3 males and 3 females). AR immunore-activity was detected in reactive fibrosis (37.5%). None of the eight reactive fibrosis cases demon-strated ERs or PRs immunoreactivities (Fig. 2) (Table 3). There were no statistically significant correlations between the immunoreactivity and the sex or age of the patients in the desmoid tumors or reactive fibrosis.

RT-PCR studyRT-PCR analysis demonstrated the expres-

sion of PR and AR mRNAs in all eight desmoid tumors and reactive fibrosis tissues. The exam-ined desmoids are No. 4, 5, 6, 7, 13, 18, 19 and 21 in Table 2. No mRNA expression for ERα and ERβ was detected in any desmoid tumors and reactive fibrosis tissues (Fig. 3). PCR samples, No. 1, 2, 3, 4, 5, 6, 7 and 8, correspond to case No. 18, 4, 5, 7, 6, 19, 21 and 13 in Table 2, respectively.

DISCUSSION

An association of desmoid tumors with the endogenous hormonal environment, especially that of sex hormones has been proposed by sever-al investigators. These tumors occur in all age groups but the hormonal influence especially that of sex steroids, has been proposed as one of the most important factors associated with the onset of desmoid tumors (Reitamo et al. 1982). McAdam and Goligher (1970) suggested that the growth of desmoid tumors is stimulated by estro-gens, based on a higher incidence of their occur-rence in women of childbearing age and their association with pregnancy. Lipschutz and Grismail (1944) and others (Nadel 1950; Jadrivevic et al. 1956) induced abdominal wall desmoid tumors in experimental animals by injecting them with high-dose estrogen pellets. This possible dependency of desmoid tumors on sex steroids, especially estrogens, may lead to new insights on the biological behavior of des-moid tumors including their development and proliferation, and also to the possible use of a


TABLE 2. Clinical characteristics and immunoreactivity in 27 desmoid tumors and 8 reactive fibrosis.

No. Age Sex SitesImmunohistochemistry

ERα ERβ PRA PRB AR

Desmoid tumors1 13 F Thigh N N N N N2 18 F Calf N N P P P3 24 F Back N N P P N4 27 F Back N N N P P5 28 F Back N N N P P6 33 F Thigh N N P N P7 40 F Buttock N N N P P8 42 F Forearm N P P N P9 49 F Chest wall N N N N N

10 59 F Neck N N N N N11 62 F Foot N N N N N12 69 F Back N N N N N13 19 M Back N N N N P14 23 M Calf N N N P P15 35 M Chest wall N N N N P16 40 M Back P P P P P17 57 M Toe N N N N P18 20 F Thigh N N N N P19 72 F Thigh N N P P N20 16 M Thigh P N P N P21 17 M Thigh N N N N N22 20 F Abdominal wall N N N N N23 32 F Abdominal wall N N N N N24 35 F Abdominal wall N N N N N25 48 F Abdominal wall N N N P P26 67 F Abdominal wall N N N N N27 31 M Abdominal wall N N N N N

Reactive fibrosis1 58 M Decubitus ulcer, sacrum N N N N P2 71 M Decubitus ulcer, sacrum N N N N N3 68 F Decubitus ulcer, sacrum N N N N N4 61 M Decubitus ulcer, sacrum N N N N P5 48 M Skin ulcer, lower leg N N N N P6 23 M Scar tissue, lower leg N N N N N7 15 F Keloid N N N N N8 25 M Operation scar N N N N N

P, positive; N, negative.


Fig. 1. Immunohistochemistry for sex steroid receptors in 18 years old female desmoid tumor. Benign fibroblast-like cells (arrows) in the fibrous stroma (☆) are evident (A, stained with hematoxylin-eosin). Distinctive intranuclear immunoreactivity was not detected for ERs (B, ERα . C, ERβ ). PR-A, PR-B, and AR immunoreactivity were detected (D, PR-A. E, PR-B. F, AR).

　　G, Negative control. AR, androgen receptor; ER, estrogen receptor; PR, progesterone receptor.


Fig. 2. Histopathology and immunohistochemistry for sex steroid receptors in 58 years old male reactive fibrosis (A, stained with hematoxylin-eosin). Only immunoreactivity for AR was positive (F) and others were negative (B, ERα . C, ERβ . D, PR-A. E, PR-B).


novel hormonal treatment for managing the post-operative recurrence of desmoid tumors. The desmoid tumors examined in this study arose in extra-abdominal sites, which are the most com-mon sites of desmoid tumors. In our study none of the desmoid tumors examined expressed ERs mRNA in the RT-PCR analysis. Serpell et al. (1999) also reported the absence of ERs and PRs in a series of desmoid tumours. Therefore, estro-gen itself is not considered to play an important role in the biological behavior of this tumor, at least in desmoid tumors arising in extra-abdomi-nal sites.

Several cases of desmoid tumors have been reported to undergo regression after treatment with progestational agents (Lanari 1983; Eagel et al. 1989; Wilcken and Tattersall 1991). Fibrous tumors were experimentally induced in guinea pig

treated with estrogens, and regression occurred when the hormonal therapy was suspended or fol-lowed by treatment with progesterone and testos-terone (Lipschutz and Grismail 1944). The treat-ment of desmoid tumors with progesterone has also been reported by several authors (Lipschutz and Grismail 1944; Nadel 1950; Dahn et al. 1963; Lanari 1983). Clinically, pregnancy has been well-known to ameliorate the course of abdominal desmoid tumors (Ober et al. 1955; McDougall and McGarrity 1979; Way and Culham 1999). This clinical observation has raised questions concerning the most appropriate hormonal treat-ment for these tumors.

In our present study, PR mRNA was detected in both 8 desmoid tumors and 8 reactive lesions. In the immunohistochemical study, 25.9% of the desmoid tumors were positive for PR-A and 33.3% for PR-B. Alman et al. (1992) examined cases of aggressive fibromatosis of the extremities for the presence of estrogen and progesterone receptors and for the expression of the c-sis onco-gene and platelet-derived growth factor (PDGF), potent mitogens for fibrocytes. They also report-ed about two thirds of the tumors examined expressed ERs or PRs. All tumors examined were associated with the over-expression of c-sis and PDGF. This over-expression may be responsible

TABLE 3. Immunoreactivity of sex steroid receptor.

Desmoid tumors Reactive fibrosis

ERα 7.4% (2/27) 0% (0/8)ERβ 7.4% (2/27) 0% (0/8)PRA 25.9% (7/27) 0% (0/8)PRB 33.3% (9/27) 0% (0/8)AR 51.9% (14/27) 37.5% (3/8)

Fig. 3. RT-PCR analysis of total RNA extracted from the desmoid tumor and reactive fibrosis. The examined desmoids are case No. 4, 5, 6, 7, 13, 18, 19 and 21 in Table 2. Bands of the correct size for PR, AR and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were detected in all the des-moid tumor and reactive fibrosis samples. ERα and ERβ were not detected in all the examined samples. PCR No. 1, 2, 3, 4, 5, 6, 7 and 8 correspond to case No. 18, 4, 5, 7, 6, 19, 21 and 13 in Table 2, respectively. PC, positive controls. NC, negative controls.


for the underlying pathobiology and uncontrolled growth in aggressive fibromatosis. Progesterone has been considered to inhibit the proliferation of desmoid tumors but further investigations are required to clarify the detailed involvement of progesterone in the biological behavior of des-moid tumors, because extra-abdominal desmoid tumors most frequently occur in the anterior abdominal wall, typically in females of childbear-ing age when serum progesterone levels were ele-vated (Musgrove and McDonald 1948; Dahn et al. 1963; McDougall and McGarrity 1979; Reitamo et al. 1982).

In our present study, PR immunoreactivity was detected only in desmoid tumors, which sug-gests that PR expression is more pronounced in desmoid than in reactive fibrosis. Testosterone has been clinically employed in the treatment of recurrent extra-abdominal tumors (Waddell 1975), but AR expression in desmoid tumors has not been reported in the literature. In our present study, AR expression was demonstrated by both RT-PCR and immunohistochemistry. We also detected AR mRNA, but few cases demonstrated AR immunoreactivity in granulation tissue obtained from reactive fibrosis. Therefore, the present study indicates that reactive fibrosis has less functional AR than do desmoid tumors. Considering the clinical efficacy of androgen treatment in controlling recurrent desmoid tumors, androgen may provide inhibitory effects on des-moid tumors.

ReferencesAlman, B.A., Goldberg, M.J., Naber, S.P., Galanopoulous, T.,

Antoniades, H.N. & Wolfe, H.J. (1992) Aggressive fibro-matosis. J. Pediatr. Orthop., 12, 1-10.

Beato, M. & Klug, J. (2000) Steroid hormone receptors: an update. Human Reproduction Update, 6, 225-236.

Chang, C.S., Kokontis, J. & Liao, S.T. (1988) Structural analy-sis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc. Natl. Acad. Sci. USA, 85, 7211-7215.

Clark, S.K. & Phillips, R.K. (1996) Desmoids in familial ade-nomatous polyposis. Br. J. Surg., 83, 1494-1504.

Dahn, I., Jonsson, N. & Lundh, G. (1963) Desmoid Tumours. A series of 33 cases. Acta Chir. Scand., 126, 305-314.

Eagel, B.A., Zentler-Munro, P. & Smith, I.E. (1989) Mesenteric desmoid tumours in Gardner’s syndrome-review of medical treatments. Postgrad. Med. J., 765, 497-501.

Fong, Y., Rosen, P.P. & Brennan, M.F. (1993) Multifocal des-

moids. Surgery, 114, 902-906.Gardner, E.J. & Richards, R.C. (1953) Multiple cutaneous and

subcutaneous lesions occurring simultaneously with heredi-tary polyposis and osteomatosis. Am. J. Hum. Genet., 5, 139-147.

Goldblum, J. & Fletcher, J.A. (2002) Desmoid-type fibromato-ses. In: Pathology and Genetics of Tumours of Soft Tissue and Bone, edited by C.D.M. Fletcher, K.K. Unni & M. Fredrik. LARC Press, Lyon, pp. 83-84.

Greene, G.L., Gilna, P., Waterfield, M., Baker, A., Hort, Y. & Shine, J. (1986) Sequence and expression of human estro-gen receptor complementary DNA. Science, 231, 1150-1154.

Hayry, P., Reitamo, J.J., Vihko, R., Janne, O., Scheinin, T.M., Totterman, S., Ahonen, J., Norio, R. & Alanko, A. (1982) The desmoid tumor. III. A biochemical and genetic analy-sis. Am. J. Clin. Pathol., 77, 681-685.

Ishizuka, M., Hatori, M., Suzuki, T., Miki, Y., Darnel, A.D., Tazawa, C., Sawai, T., Uzuki, M., Tanaka, Y., Kokubun, S. & Sasano, H. (2004) Sex steroid receptors in rheumatoid arthritis. Clin. Sci., 106, 293-300.

Jadrivevic, D., Mardones, E. & Lipschutz, A. (1956) Antifibro-matogenic activity of 19-Nor-A-Ethinyltestosterone in the guinea pig. Proc. Soc. Exp. Biol. Med., 91, 38-39.

Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Gronemeyer, H. & Chambon, P. (1990) Two distinct estro-gen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J., 9, 1603-1614.

Kasukawa, Y., Okada, K., Hashimoto, M. & Sageshima, M. (1999) Extra-abdominal desmoid tumor of the hand: a case report and review of the literature. Tohoku J. Exp. Med., 189, 163-170

Lanari, A. (1983) Effect of progesterone on desmoid tumors (aggressive fibromatosis). N. Engl. J. Med., 309, 1523.

Lim, C.L., Walker, M.J., Mehta, R.R. & Das Gupta, T.K. (1986) Estrogen and antiestrogen binding sites in desmoid tumors. Eur. J. Cancer Clin. Oncol., 22, 583-587.

Lipschutz, A. & Grismail, J. (1944) On the antifibromatogen activity of synthetic progesterone in experiments with the 17-caprylic and dipropionic esters of estradiol. Cancer. Res., 4, 186-190.

MacAdam, W.A. & Goligher, J.C. (1970) The occurrence if desmoids in patients with familial polyposis coli. Br. J. Surg., 57, 618-631.

McDougall, A. & McGarrity, G. (1979) Extra-abdominal des-moid tumours. J. Bone Joint Surg., 61-B, 373-377.

McFarlane, J. (1832) Clinical reports on the surgical practice of the Glasgow Royal Infirmary. Grasgow, 63-66.

Mote, P.A., Balleine, R.L., McGowan, E.M. & Clarke, C.L. (1999) Colocalization of progesterone receptors A and B by dual immunofluorescent histochemistry in human endo-metrium during the menstrual cycle. J. Clin. Endocrinol. Metab., 84, 2963-2971.

Muller, J. (1838) Ueber den Feinern Bau und die Formen der Krankhaften Geschwulste. G. Reimer., 1-60.

Musgrove, J.E. & McDonald, J.R. (1948) Extra-abdominal desmoid tumors: their differential diagnosis and treatment. Arch. Path., 45, 513-540.

Nadel, E.M. (1950) Histopathology of estrogen-induced tumors in guinea pig. J. Nathl. Cancer Inst., 10, 1043-1065.

Ober, W.B., Velardo, J.T., Greene, R.T. & Taylor, R.J. (1955) Desmoid tumor of the popliteal space occurring during pregnancy: report of a case with bioassays. J. Natl. Cancer

M. Ishizuka et al.198

Inst., 16, 569-577.Ogawa, S., Inoue, S., Watanabe, T., Hiroi, H., Orimo, A., Hosoi,

T., Ouchi, Y. & Muramatsu, M. (1998) The complete pri-mary structure of human estrogen receptor beta (hER beta) and its heterodimerization with ER alpha in vivo and in vitro. Biochem. Biophys. Res. Commun., 243, 122-126.

Reitamo, J.J., Hayry, P., Nykyri, E. & Saxen, E. (1982) The desmoid tumor. I. Incidence, sex-, age- and anatomical dis-tribution in the Finnish population. Am. J. Clin. Pathol., 77, 665-673.

Serpell, J.W., Tang, H.S. & Donnovan, M. (1999) Factors pre-dicting local recurrence of desmoid tumours including pro-liferating cell nuclear antigen. Aust. NZ J. Surg., 69, 782-789.

Sorensen, A., Keller, J., Nielsen, O.S. & Jensen, O.M. (2002) Treatment of aggressive fibromatosis: a retrospective study of 72 patients followed for 1-27 years. Acta Orthop.

Scand., 73, 213-219.Sullivan, E.J. (1998) Lymphangioleiomyomatosis. A review.

Chest, 114, 1689-1703.Tokunaga, K., Nakamura, Y., Sakata, K., Fujimori, K., Ohkubo,

M., Sawada, K. & Sakiyama, S. (1987) Enhanced expres-sion of a glyceraldehyde-3-phosphate dehydrogenase gene in human lung cancers. Cancer Res., 47, 5616-5619.

Waddell, W.R. (1975) Treatment of intra-abdominal and abdominal wall desmoid tumors with drugs that affect the metabolism of cyclic 3′,5′-adenosine monophosphate. Ann. Surg., 181, 299-302.

Way, J.C. & Culham, B.A. (1999) Desmoid tumour. The risk of recurrent or new disease with subsequent pregnancy: a case report. Can. J. Surg., 42, 51-54.

Wilcken, N. & Tattersall, M.H. (1991) Endocrine therapy for desmoid tumors. Cancer, 68, 1384-1388.

expression profiles of sex steroid receptors in desmoid …exp. med., 2006, 210(3), 189-198 desmoid...

Documents