expression patterns of adams in the developing chicken lens

ORIGINAL PAPER

Expression patterns of ADAMs in the developing chicken lens

Xin Yan • Juntang Lin • Arndt Rolfs •

Jiankai Luo

Received: 5 October 2011 / Accepted: 30 December 2011 / Published online: 14 January 2012

� Springer Science+Business Media B.V. 2012

Abstract In the present study the expression patterns of

ADAM (a disintegrin and metalloprotease) genes in the

chicken developing lens were analyzed. Using in situ

hybridization, we found that seven members of the ADAM

family including ADAM9, ADAM10, ADAM12, ADAM13,

ADAM17, ADAM22, and ADAM23 are expressed in the

developing embryonic lens. From embryonic incubation day

(E) 2 to E3, most of the ADAMs investigated here are

expressed in the lens placode and lens vesicle. From E5 to

E7, all seven ADAMs, but predominantly ADAM9 and

ADAM10, are throughly expressed in the central epithelium,

as well as in the proliferating lens epithelium and the equa-

torial lens epithelium. From E9 to E14, expression of

ADAM9, ADAM10, and ADAM17 decreases moderately in

these regions. ADAM12 and ADAM13 are weakly expres-

sed in the central epithelium and the lens epithelium, and are

not detectable from E14 onward. ADAM22 and ADAM23

are expressed in the central epithelium, the lens epithelium

and the equatorial lens epithelium at E5 and decrease grad-

ually afterwards in the same regions. At E16, only weak

ADAM9, ADAM10 and ADAM17 signals are found in the

anterior lens epithelium. The changing spatiotemporal

expression of the seven ADAMs suggests a regulatory role

for these molecules during chicken lens development.

Keywords ADAM � Lens � Gene expression �Chicken development

Introduction

The chicken lens is an avascular organ derived from the

head ectoderm near the optic vesicles. It is composed of

two contiguous cell subpopulations with very different

morphology: (1) the epithelial cells facing the anterior

chamber of the eye and (2) the fiber cells in the posterior

part of the lens. Fiber cells are continually produced

throughout whole life (Lovicu and McAvoy 2005; Tholo-

zan and Quinlan 2007). The embryonic development of the

lens is characterized by the processes of cellular prolifer-

ation, migration and differentiation. Many transcription

and growth factors, e.g., paired box gene (Pax6), bone

morphogenetic protein-4 (BMP4), and fibroblast growth

factor (FGF), are involved in these developmental pro-

cesses by fulfilled different functions (de Iongh and

McAvoy 1993; Furuta and Hogan 1998; Kondoh 1999;

Ashery-Padan et al. 2000; Lovicu and McAvoy 2005;

Donner et al. 2006). For example, Pax6 is expressed in the

epithelium of the forebrain and optic cup at the early stage

of chicken embryonic development, suggesting a role in

lens formation (Li et al. 1994). BMPs participate in the

differentiation of fiber cells and are required for the sur-

vival of lens cells during development (Belecky-Adams

et al. 2002). FGFs stimulate the differentiation of lens

epithelial cells into fiber cells by inducing synthesis of

Xin Yan and Juntang Lin contributed equally to this work and should

be considered co-first authors.

X. Yan � A. Rolfs � J. Luo (&)

Albrecht-Kossel-Institute for Neuroregeneration,

School of Medicine University of Rostock, Gehlsheimer Strasse

20, 18147 Rostock, Germany

e-mail: [email protected]

J. Lin

Institute of Anatomy I, School of Medicine University of Jena,

Teichgraben 7, 07743 Jena, Germany

J. Lin

Department of Life Science and Technology, Xinxiang Medical

University, Xinxiang 453003, China

123

J Mol Hist (2012) 43:121–135

DOI 10.1007/s10735-011-9389-4

specific proteins in fiber cells (Le and Musil 2001). A

dominant-negative FGF receptor inhibits the differentiation

of lens fiber cells (Chow et al. 1995). Furthermore, aberrant

activation of Wnt/b-catenin signaling in the lens placode

prevents lens formation and represses Pax6 expression

(Smith et al. 2005; Donner et al. 2006).

The members of the ADAM family belong to type I

transmembrane proteins and possess a metalloprotease

domain and a disintegrin domain. Individual members of

the ADAMs show variable expression patterns regulated

spatiotemporally during embryonic development in several

organ’s systems (Edwards et al. 2008; Lin et al. 2008;

Alfandari et al. 2009), e.g., in the nervous system and in

neural crest cell-derived structures (Goldsmith et al. 2004;

Lin et al. 2008, 2010; Yan et al. 2010), in skeletal muscle

and bones (Yagami-Hiromasa et al. 1995; Lewis et al.

2004; Lin et al. 2007; Yan et al. 2011), in digestive organs

and in the kidney and the heart (Hall and Erickson 2003;

Lin et al. 2007; Yan et al. 2011). Functionally, the ADAMs

are involved in cell–cell and/or cell–matrix interactions and

mediate potentially protease activities, cell adhesion and

cell signal transduction (Blobel 2005; Maretzky et al. 2005;

Edwards et al. 2008; Alfandari et al. 2009). For example,

ADAM10 plays a critical role in neurogenesis and retina

axon extension and is required for a correct optic projection

to the tectum (Chen et al. 2007). The lack of ADAM17 in

mouse embryos induces hemorrhage and impaired vessel

formation (Canau et al. 2010). Furthermore, Neuner et al.

(2009) demonstrated in Xenopus that ADAM23 regulates

the differentiation of neural crest cells during embryonic

development.

Our previous studies showed that several ADAMs are

expressed in the developing chicken brain, spinal cord and

cochlea (Lin et al. 2008, 2010; Yan et al. 2010). However,

little is known about the expression of ADAMs during lens

development. In order to explore whether ADAM genes are

involved in the development of the lens, we therefore,

analyzed the expression pattern of the seven ADAM genes

ADAM9, ADAM10, ADAM12, ADAM13, ADAM17,

ADAM22 and ADAM23 at key stages during the devel-

opment of the chicken lens.

Materials and methods

Chicken embryos

Fertilized eggs from white Leghorn chicken (Gallus

domesticus) were incubated in a forced-draft egg incubator

(BSS160, Ehret, Germany) at 37�C with 60% humidity.

Chicken embryos were staged according to Hamburger and

Hamilton (1951). After the embryos were deeply anesthe-

tized by cooling on ice, they were removed from the shell

for fixation for the embryos at early stages (E2–E7) or

perfused through the heart with 4% formaldehyde in

phosphate-buffered saline (PBS; 13 mM NaCl, 7 mM

Na2HPO4, 3 mM NaH2PO4; pH 7.4) for the old embryos

(E9–E16). Subsequently, embryonic eyes were separated

and collected (at least 5 samples for each stage) for further

study.

In situ hybridization

For in situ hybridization, digoxigenin-labeled sense and

antisense cRNA probes were synthesized in vitro using the

whole ORF full-length sequences of the investigated

ADAMs as templates (Table 1; Lin et al. 2007, 2008)

according to the manufacturer’s instructions (Roche,

Mannheim, Germany). Sense cRNA probes of the ADAMs

were used as a negative control and the antisense chicken

N-cadherin (Ncad) probe was used as a positive control.

In situ hybridization on cryosections was performed

according to the protocol described previously (Luo et al.

2004). In brief, after postfixation with 4% formaldehyde in

PBS, cryostat sections were pretreated with proteinase K

and acetic anhydride. Then sections were hybridized with

cRNA probes at a concentration of about 1–5 ng/ll over-

night at 70�C in hybridization solution (50% formamide,

3 9 SSC, 1 9 Denhardt’s solution, 250 lg/ml yeast RNA

and 250 lg/ml salmon sperm DNA). Alkaline phosphatase-

coupled anti-digoxigenin Fab fragments (Roche) were

added to bind to the cRNA probe. After the unbound cRNA

was removed by RNAse, the sections were incubated with

alkaline phosphatase-conjugated anti-digoxigenin Fab

fragments (Roche) at 4�C overnight. For visualization of

the labeled mRNA, a substrate solution of nitroblue tetra-

zolium salt (NBT) and 5-bromo-4-chloro-3-indoyl phos-

phate (BCIP) was added to develop the signals. Structures

of the embryonic chicken lens were distinguished by a

thionine staining.

Photograph production

The color reaction on sections for in situ hybridization

were viewed and photographed under a transmission

microscope (BX40; Olympus, Hamburg, Germany)

equipped with a digital camera (DP70; Olympus). Photo-

graphs were adjusted in contrast and brightness by the

Photoshop software (Adobe, Mountain View, CA).

Results

During chicken embryonic development, distinct anatom-

ical structures and cell types of the lens can be detected

morphologically by thionine staining (Figs. 3a, 4a–i). For

122 J Mol Hist (2012) 43:121–135

123

example, in transverse sections of the lens, the optic vesicle

including the presumptive retina (pr) and presumptive

pigmented retinal epithelium (prpe) covers the lens vesicle

(Lv) at embryonic incubation day (E) 3 (Fig. 3a). At E5,

the anterior lens epithelium covers the anterior surface of

the primary fiber cells (Fig. 4a). Distinct zones of the lens,

such as the central lens epithelium (CE in Fig. 4) con-

taining proliferating cells, the lens epithelium (LE in

Fig. 4) beside the CE containing migrating cells and the

equatorial lens epithelium (eLE in Fig. 4), can be distin-

guished according to their anatomical positions. As cells

from the LE zone migrate along the eLE region, they dif-

ferentiate gradually into primary fiber cells (LFp) recog-

nized by their elongated morphological shape (Fig. 4c).

From E7 onwards, the cortical fiber cells (LFc) are found

around the equatorial region (in Fig. 4d, g), while the

primary fiber cells (LFp in Fig. 4a–c) shift to the central

region of the lens to become the lens nucleus (LFn in

Fig. 4d, g).

The goal of this study is to analyze the expression pat-

terns of the seven members of the ADAM family in the

developing lens from E2 (stage 13) via a transitional phase

of lens development (E3–E14) to the late stage of E16

(stage 42). Figure 1 showed the difference of the ADAM

ORF full-length sequences used as templates for the cRNA

probe synthesis. Expression patterns of each ADAM as

detected by in situ hybridization were described according

to the stages (from early to later), as shown for E2 in Fig. 2,

E3 in Fig. 3, for E5 in Fig. 5, for E7 in Fig. 6, for E9 in

Fig. 7, for E14 in Fig. 8, and for E16 in Fig. 9. Antisense

Ncad cRNA probe was used as a positive control for all in

situ hybridization analyses. As an example staining at E9 is

shown in Fig. 4j–l. For all in situ hybridization, sense

ADAM cRNA probes were used as negative controls, as

demonstrated for ADAM9 at E2 (Fig. 2a) and E9 sections

(Fig. 4m–o).

Embryonic incubation day 2 (E2)

At about E2, the presumptive lens ectoderm extends and

thickens to form the dish-shaped lens placode (Lp), and

then invaginates in a coordinated manner with the optic

vesicle to form lens pit and optic cup respectively (Thol-

ozan and Quinlan 2007). At this stage, ADAM9,

ADAM10, ADAM12 and ADAM17 mRNAs are moder-

ately expressed in the Lp (Fig. 2) and the surface ectoderm

(Ec; Fig. 2), and ADAM13 and ADAM23 mRNAs weakly

(Fig. 2e, h), but ADAM22 signals are not detectable in the

Lp (Fig. 2g).


At E3, most of ADAMs investigated here are expressed in

the primary eye with different intensities. In the Lv,

ADAM9, ADAM10, ADAM17 and ADAM23 signals are

wide and strong (Fig. 3b, c, f, h), while ADAM12 is

expressed moderately in the dorsal part of the Lv

(Fig. 3d). In the pr and prep, ADAM9, ADAM10 and

ADAM17 mRNAs are strongly expressed (Fig. 3b, c, f),

while ADAM23 is moderate (Fig. 3h). In the presumptive

corneal ectoderm (pce), ADAM9 and ADAM17 mRNA

are detected strongly (Fig. 3b, f), ADAM10 mRNA

moderately (Fig. 3c), ADAM12 and ADAM23 mRNAs

Table 1 Information of RNA probes synthesis for ADAM in situ hybridization

Name (accession no.) Primer sequence for ORF ORF size (bp) Digestion enzyme RNA polymerase

ADAM9

(NM_001031396)

U: 50 atggctcgggcg gcg cgga 30

L: 50 ctataaggagtggtaggacca 302,124 Xba I Sp6

ADAM10

(NM_204261)

U: 50atggatctagcgaggacgat 30

L: 50tcaatgtctcatatgtccca 302,250 Xba I Sp6

ADAM12

(NM_001142850.1)

U: 50atgtcaaagcgtctccttgcg 30

L: 50 atcatttcacatcagcagtagc 302,769 Xba I Sp6

ADAM13a

(NM_001082418)

U: 50atggcgaggttggccccccacg30

L: 50 taaaccatttcccagatggcttcg302,151 Hind III T7

ADAM17

(NM_001008682)

U: 50 atgagactccggctgtggct 30

L: 50 tcagcactccgtctccttgc 302,490 Xba I Sp6

ADAM22

(NM_001145228.1)

U: 50 atgaatgctacatcacagaagtttg30

L: 50gcagaacagccttgtcacgtcc 302,478 Spe I T7

ADAM23

(NM_001145230)

U: 50atgccgcagaaagactacaa 30

L: 50 ttacttaaagccccatcctg 302,277 BamH I T7

a Compared to mouse and human homologues, chicken ADAM13 was also be termed as ADAM33

J Mol Hist (2012) 43:121–135 123

123

Fig. 1 Phylogenetic analysis of the difference of the known investigated chicken ADAMs, based on multiple nucleotide sequence alignment of

their open reading frame (ORF). The length of each pair of branches represents the difference of the nucleotides between the ADAMs

Fig. 2 Expression patterns of chicken ADAM9 (b), ADAM10 (c),

ADAM12 (d), ADAM13 (e), ADAM17 (f), ADAM22 (g) and

ADAM23 (h) by in situ hybridization in the lens placode (Lp) at

embryonic day 2. Sense ADAM9 cRNA probe is used as negative

control for in situ hybridization (a). A ADAM, Ec surface ectoderm,

Lp lens placode, pr presumptive retina. Scale bars 50 lm in a for a–h

Fig. 3 Thionine staining (a) and expression patterns of chicken

ADAM9 (b), ADAM10 (c), ADAM12 (d), ADAM13 (e), ADAM17

(f), ADAM22 (g) and ADAM23 (h) by in situ hybridization in the

primary eye at embryonic day 3. A ADAM, pr presumptive retina, pcepresumptive corneal ectoderm, lv lens vesicle, prpe presumptive

pigmented retinal epithelium. Scale bars 100 lm in a for a–h

124 J Mol Hist (2012) 43:121–135

123

are weakly (Fig. 3d, h). At this stage, ADAM13 is weakly

expressed in the different parts (Fig. 3e) but ADAM22 is

not detectable in the primary eye (Fig. 3g).


At E5, ADAM9 and ADAM10 mRNAs are strongly and

widely expressed by the cells in the CE, the LE and the eLE,

and moderately expressed in the LFp (Fig. 5a-f). At this

stage, ADAM12 and ADAM17 signals are strong in the CE

and LE, moderate in the eLE, but weak in the LFp (Fig. 5g–i,

m–o). ADAM13 mRNA in the CE is very weak, but mod-

erate in LE, eLE and LFp (Fig. 5j–l). ADAM22 and

ADAM23 belong to the uncatalytical members of the

ADAM family and are closely related phylogenetically

(Yang et al. 2006; Lin et al. 2008). ADAM22 is weakly

expressed in the entire lens, but ADAM23 is moderately

(Fig. 5p–u).

Expression of ADAMs is also seen in tissues around the

lens. For example, in the corneal epithelium (Cep) and

presumptive iris epithelium (PI), expression is strong for

ADAM9 and ADAM10 (Fig. 5a–f), moderate for ADAM17

(Fig. 5m–o), and weak for ADAM12, ADAM13, ADAM22

and ADAM23 (Fig. 5g–l, p–u). In the periocular mesen-

chyme (PM), ADAM13 mRNA is found to be expressed

strongly (Fig. 5j).


At E7, the expression of the ADAMs is generally localized in

the CE, the LE and eLE regions with differing intensities. In

the CE, ADAM9 and ADAM10 signals are strongly

expressed (Fig. 6b, e), ADAM12 and ADAM17 mRNAs

moderately (Fig. 6h, n), but ADAM13, ADAM22 and

ADAM23 weakly (Fig. 6k, q, t). In the LE and eLE, ADAM9

and ADAM10 signals are strong (Fig. 6c, f), ADAM17

mRNAs moderate (Fig. 6o), but ADAM12, ADAM13,

ADAM22 and ADAM23 are very weak (Fig. 6i, l, r, u). In the

LFc, only ADAM9 and ADAM17 signals can be detected

weakly (Fig. 6a, c, m, o). At this stage, no ADAMs are

detectable in the LFn (Fig. 6a–u).


At E9, the expression of the ADAMs is retained in the CE,

the LE and the eLE region, but with a lower intensity. In the

CE, ADAM9 and ADAM10 signals are moderate (Fig. 7b,

e) and ADAM12, ADAM13, ADAM17 and ADAM23

signals are weak (Fig. 7h, k, n, t). The expression of

ADAM12 mRNA is detected mainly on the apical (Ca) part

of the CE (Fig. 7h). ADAM22 signal is absent from the CE

at this stage (Fig. 7q). In the LE and eLE, ADAM9 and

ADAM10 are still expressed strongly (Fig. 7c, f), ADAM17

moderately (Fig. 7o), but ADAM12, ADAM22 and

ADAM23 show very weak signals (Fig. 7i, r, u).

Embryonic incubation day 14 (E14) and E16

At E14, ADAM9, ADAM10 and ADAM17 signals main-

tain moderate or weak expression in the CE, the LE and the

eLE (Fig. 8a–f, m–o), but ADAM23 is weakly expressed in

these regions (Fig. 8s–u). Signals of ADAM12, ADAM13

and ADAM22 are no longer detectable in the lens from this

stage (Fig. 8g–l).

At E16, ADAM9, ADAM10 and ADAM17 mRNAs are

moderately expressed in the CE, the LE and the eLE

(Fig. 9a–l), while ADAM22 and ADAM23 signals are not

detectable (Fig. 9m–t).

In summary, the seven ADAM mRNAs are expressed in

different anatomical structures in the developing chicken

lens, and gradually disappear towards later stages. All the

ADAMs investigated exhibit a restricted and spatiotem-

porally regulated expression pattern in the developing lens,

but share a partial overlap at different stages (Table 2).

Discussion

To our knowledge, this study for the first time maps the

developmental expression of the seven ADAMs (ADAM9,

ADAM10, ADAM12, ADAM13, ADAM17, ADAM22 and

ADAM23) in the developing chicken lens. In contrast to

previous studies (Watabe-Uchida et al. 2004; Chen et al.

2007), our results show in detail that several ADAMs are

expressed throughout the processes of the lens morpho-

genesis. Each of the ADAMs investigated demonstrates a

spatial and temporal expression patterns in the different

cell types of the lens with partial overlap between each

other.

To distinguish whether the expression overlap between

the different ADAMs is caused by the sequence similarity

of the ADAM cRNA probe, we compared the whole ORF

full-length sequence, which is used for the cRNA ADAM

probe synthesis, by the phylogenetic analysis using the

MegAlign program of DNASTAR (Fig. 1; Table 1). The

results showed that, for example, although the expression

patterns of ADAM9 and ADAM10 are similar strongly

with partial overlap (Figs. 2, 3,5, 6, 7, 8, 9), the difference

of the nucleotides between them is much large at about

85% (Fig. 1); In contrast, although the expression patterns

of ADAM12 and ADAM13 are strong different (Figs. 2, 3,

5, 6), the difference of the nucleotides between them is

lower at about 28% (Fig. 1). Therefore, these data sug-

gested that the similarity of the expression patterns (partial

overlap) between the ADAMs are not resulted from the

J Mol Hist (2012) 43:121–135 125

123

126 J Mol Hist (2012) 43:121–135

123

similar probe sequences themselves, but the expression

patterns per se.

Expression of ADAMs in the central lens epithelium

and cell proliferation

The central lens epithelium, facing the anterior chamber of

the eye and bathed in the aqueous humor, is a monolayer of

epithelial cells where cells proliferate (Tholozan and

Quinlan 2007). In the present study, the seven members of

ADAM family ADAM9, ADAM10, ADAM12, ADAM13,

ADAM17, ADAM22 and ADAM23 all are expressed by

the cells in the CE, and as embryos develop, the expression

of the individual ADAM decreases gradually (Figs. 3, 5, 6,

7, 8, 9). It is known that ADAMs play roles in cell pro-

liferation (Gschwind et al. 2003; Schafer et al. 2004; Itoh

et al. 2005), for example, ADAM17 can regulate cardiac

cell proliferation and is required for murine cardiac

development and modeling (Shi et al. 2003). Lacking of

ADAM17 results in reduction in size due to decreased

epithelial cell proliferation during branching morphogen-

esis (Zhao et al. 2001). ADAM10 controls EGF signaling

and regulates proliferation of late developing neuronal

populations (Marcinkiewicz and Seidah 2000). Loss of

ADAM10 function results in major deficits in brain

development (Hartmann et al. 2002). Whether the ADAMs

studied here are also involved in the proliferation of lens

cells should be further investigated.

Expression of ADAMs in the lens epithelium and cells

migration

During both embryonic development and adulthood the

anterior epithelium provides a continuous source of

undifferentiated cells that migrate toward the equator

region of the lens, where the cells start differentiation into

fiber cells (Leong et al. 2000; Tholozan and Quinlan 2007).

In this study, ADAM9, ADAM10, ADAM12, ADAM13,

ADAM17, ADAM22 and ADAM23 are observed to be

expressed in the lens epithelium where most the cells are in

migration (Fig. 5, 6, 7, 8, 9). ADAMs have been reported

to play a role in cell migration. For example, ADAM13

induces migration of cranial neural crest cells by cleaving

cadherin11 and modifying cell–cell adhesion (Alfandari

et al. 2001; McCusker et al. 2009). ADAM10 promotes

glioblastoma cell migration by cleaving Ncad (Kohutek

et al. 2009). ADAM10-knockout in the mouse results in

abnormal location of neurons in the cerebral cortex (Jor-

issen et al. 2010). Furthermore, several members of cad-

herins have been shown to be expressed in the lens

epithelium during the embryonic development (Leong

et al. 2000; Xu et al. 2002; Pontoriero et al. 2009).

Therefore, the expression of the ADAMs in the lens epi-

thelium indicates a function for them in the migration of

the lens cells during the lens development, possibly via

modifying cell adhesion molecules.

Expression of ADAMs in the equatorial lens epithelium

and lens fiber cells

In the present study, the seven members of the ADAMs

family investigated are also spatiotemporally regulated in

the cells of the equatorial lens epithelium and lens fiber

cells during the lens development (Figs. 5, 6, 7, 8, 9). The

lens cells, facing the posterior chamber of the eye and

bathed in the vitreous humor, are dramatically elongated

into a fiber shape and show a boundary around the equa-

torial region of the lens (Tholozan and Quinlan 2007).

Neuner et al. (2009) demonstrated that ADAM23 can

regulate the differentiation of neural crest cells during

embryonic development. Jorissen et al. (2010) reported that

absence of ADAM10 in mouse induces a premature dif-

ferentiation of neural progenitor cells into postmitotic

neurons in the neocortex. Furthermore, the expression of

the ADAMs including ADAM9, ADAM10, ADAM17,

ADAM19, ADAM22 and ADAM23 are spatiotemporally

expressed in the differentiating sensory neurons of dorsal

root ganglia and acoustic ganglion cells of the cochlea (Lin

et al. 2010; Yan et al. 2010, 2011).

Furthermore, the Notch and Wnt signaling pathway

(Fokina and Frolova 2006; Rowan et al. 2008) are involved

in the differentiation of lens cells. Of interest, ADAM10

activates Notch signaling (Lieber et al. 2002) by shedding

the Notch receptor and its ligands (Bland et al. 2003; La-

Voie and Selkoe 2003). In ADAM10-knockout mice, the

processing of Notch-1 is affected leading to down-regula-

tion of several Notch target genes (Jorissen et al. 2010).

ADAM17 may be also involved in ectodomain shedding of

Delta-Notch ligand (LaVoie and Selkoe 2003). It is also

clear that the ADAMs, especially ADAM10 and ADAM17,

Fig. 4 Thionine staining and Ncad in situ hybridization in transverse

sections of the developing chicken lens at different embryonic

incubation days (E). a–i Thionine staining of sections at E5 (a–c), E9

(d–f) and E14 (g–i) with the magnification of the CE (b, e, h), the LE

and the eLE (c, f, i). j–l In situ hybridization of Ncad in the same

regions of the lens at E9 as a positive control for all in situ

hybridizations. m–o Sense ADAM9 cRNA probe is used as negative

control for in situ hybridization in the lens at E9. CE central

epithelium, Cep corneal epithelium, eLE equatorial lens epithelium,

LE lens epithelium, LFc cortical lens fiber cells, LFn nuclear lens

fiber cells, LFp primary lens fiber cells, PI presumptive iris

epithelium, PM periocular mesenchyme. The white asterisks (*) in

d, g and j mark the pigmented retinal epithelium, which has a light or

dark brown color due to natural pigmentation. Scale bars 20 lm in

e for h, k and n; 50 lm in a and b; 100 lm in f for i, l and o; 200 lm

in a and in d for g, j and m

b

J Mol Hist (2012) 43:121–135 127

123

Fig. 5 Expression patterns of

chicken ADAM9 (a–c),

ADAM10 (d–f), ADAM12 (g–

i), ADAM13 (j–l), ADAM17

(m–o), ADAM22 (p–r) and

ADAM23 (s–u) by in situ

hybridization in the lens at

embryonic day 5. A ADAM, CEcentral epithelium, Cep corneal

epithelium, eLE equatorial lens

epithelium, LE lens epithelium,

LFp primary lens fiber cells, PIpresumptive iris epithelium, PMperiocular mesenchyme. Scalebars 50 lm in b for e, h, k, n,

q and t, and in c for f, i, l, o,

r and u; 100 lm in a for d, g, j,m, p and s

128 J Mol Hist (2012) 43:121–135

123



ADAM10 (d–f), ADAM12

(g–i), ADAM13 (j–l), ADAM17




embryonic day 7. A ADAM,

CE central epithelium, eLEequatorial lens epithelium,

LE lens epithelium, LFc cortical

lens fiber cells, LFn nuclear lens

fiber cells. The white asterisks(*) in d, j and m mark the

retinal pigmented epithelium,

which has a light or dark browncolor due to natural

pigmentation. Scale bars 50 lm

in b for e, h, k, n, q and t, and in

c for f, i, l, o, r and u; 100 lm in

a for d, g, j, m, p and s

J Mol Hist (2012) 43:121–135 129

123








embryonic day 9. A ADAM, CEcentral epithelium, Cep corneal

epithelium, eLE equatorial lens

epithelium, LE lens epithelium,

PI presumptive iris epithelium,

PM periocular mesenchyme.

The white asterisks (*) in a, d,

g, j, m, p and s mark the retinal

pigmented epithelium, which

has a light or dark brown colordue to natural pigmentation.

Scale bars 20 lm in b for e, h,

k, n, q and t; 100 lm in c for f,i, l, o, r and u; 200 lm in a for

d, g, j, m, p and s

130 J Mol Hist (2012) 43:121–135

123








embryonic day 14. A ADAM,

CE central epithelium, Cepcorneal epithelium, eLEequatorial lens epithelium, LElens epithelium, PM periocular

mesenchyme. The whiteasterisks (*) in a, d, g, j, m,

p and s mark the retinal

pigmented epithelium, which

has a light or dark brown colordue to natural pigmentation.

Scale bars 20 lm in b for e, h,

k, n, q and t; 100 lm in c for f,i, l, o, r and u; 300 lm in in

a for d, g, j, m, p and s

J Mol Hist (2012) 43:121–135 131

123

participate in proteolytic cleavage of Notch and its ligands,

thereby playing an essential role for controlling cell dif-

ferentiation (Yang et al. 2006; Edwards et al. 2008). Fur-

thermore, in Xenopus, ADAM13 has been reported to

cleave class B ephrins and promote canonical Wnt sig-

naling (Wei et al. 2010). Take together, it is of interest to

investigate whether the ADAMs, especially ADAM10 and

ADAM17, are involved in the cell differentiation of the

lens during the morphogenesis of the chicken embryonic

lens.

Fig. 9 Expression patterns of chicken ADAM9 (a–d), ADAM10 (e–

h), ADAM17 (i–l), ADAM22 (m–p) and ADAM23 (q–t) by in situ

hybridization in the lens at embryonic day 16. A ADAM, CE central

epithelium, eLE equatorial lens epithelium, LE lens epithelium. The

white asterisks (*) in a, c, e, g, i, k, m, q and s mark the retinal

pigmented epithelium, which has a light or dark brown color due to

natural pigmentation. Scale bars 20 lm in b for f, j, n and r; 100 lm

in c for g, k, o and s, and in d for h, l, p and t; 200 lm in a for e, i,m and q

132 J Mol Hist (2012) 43:121–135

123

Table 2 Summary of the expression of ADAMs in different cell types of the embryonic lens

E2 E3 E5 E7 E9 E14 E16

ADAM9

Lp ??

CE (lv) ??? ??? ??? ?? ?? ??

LE ??? ??? ??? ?? ??

eLE ??? ??? ??? ?? ??

LFn (p) ?? - - - -

LFc ? - - -

ADAM 10

Lp ??

CE (lv) ??? ??? ??? ?? ?? ?

LE ??? ??? ??? ?? ??

eLE ??? ??? ??? ?? ??

LFn (p) ?? - - - -

LFc ? - - -

ADAM 12

Lp ??

CE (lv) ?? ??? ?? ? - -

LE ??? ? ? - -

eLE ??? ? ? - -

LFn (p) ? - - - -

LFc - - - -

ADAM 13

Lp ?

CE (lv) ? ? ? ? - -

LE ?? ? - - -

eLE ?? ? - - -

LFn (p) ?? - - - -

LFc - - - -

ADAM 17

Lp ??

CE (lv) ??? ??? ?? ? ? ??

LE ??? ?? ? ?? ??

eLE ??? ?? ? ? ??

LFn (p) ?? - - - -

LFc - - - -

ADAM 22

Lp -

CE (lv) - ? ? - - -

LE ? ? ? ? -

eLE ? ? ? ? -

LFn (p) ? - - - -

LFc - - - -

ADAM 23

Lp ?

CE (lv) ??? ? ? ? ? -

LE ?? ? ? ? ?

eLE ?? ? ? ? -

LFn (p) ?? - - - -

J Mol Hist (2012) 43:121–135 133

123

Acknowledgments We thank Dr. E. Mix from Department of

Neurology, University of Rostock for critical reading of this manu-

script. This work was supported by a grant from the German Research

Foundation (DFG; LU1455/1-1) and by a fund from the National

Natural Science Foundation of China (31000475).

References

Alfandari D, Cousin H, Gaultier A, Smith K, White JM, Darribere T,

Desimone DW (2001) Xenopus ADAM 13 is a metalloprotease

required for cranial neural crest-cell migration. Curr Biol

11:918–930

Alfandari D, McCusker C, Cousin H (2009) ADAM function in

embryogenesis. Semin Cell Dev Biol 20:153–163

Ashery-Padan R, Marquardt T, Zhou X, Gruss P (2000) Pax6 activity

in the lens primordium is required for lens formation and for

correct placement of a single retina in the eye. Genes Dev

14:2701–2711

Belecky-Adams TL, Adler R, Beebe DC (2002) Bone morphogenetic

protein signaling and the initiation of lens fiber cell differenti-

ation. Development 129:3795–3802

Bland CE, Kimberly P, Rand MD (2003) Notch-induced proteolysis

and nuclear localization of the Delta ligand. J Biol Chem

278:13607–13610

Blobel CP (2005) ADAMs: key components in EGFR signalling and

development. Natl Rev Mol Cell Biol 6:32–43

Canau M, Certel K, Schatzberg D, Wagner DD, Hynes RO (2010) The

lack of ADAM17 activity during embryonic development causes

hemorrhage and impairs vessel formation. PLoS One 5:e13433

Chen YY, Hehr CL, Atkinson-Leadbeater K, Hocking JC, McFarlane

S (2007) Targeting of retinal axons requires the metalloprotein-

ase ADAM10. J Neurosci 27:8448–8456

Chow RL, Roux GD, Roghani M, Palmer MA, Rifkin DB, Moscatelli

DA, Lang RA (1995) FGF suppresses apoptosis and induces

differentiation of fibre cells in the mouse lens. Development

121:4383–4393

de Iongh R, McAvoy JW (1993) Spatio-temporal distribution of

acidic and basic FGF indicates a role for FGF in rat lens

morphogenesis. Dev Dyn 198:190–202

Donner AL, Lachke SA, Maas RL (2006) Lens induction in

vertebrates: variations on a conserved theme of signalling

events. Semin Cell Dev Biol 17:676–685

Edwards DR, Handsley MM, Pennington CJ (2008) The ADAM

metalloproteinases. Mol Aspects Med 29:258–289

Fokina VM, Frolova EI (2006) Expression patterns of Wnt genes

during development of an anterior part of the chicken eye. Dev

Dyn 235:496–505

Furuta Y, Hogan BL (1998) BMP4 is essential for lens induction in

the mouse embryo. Genes Dev 12:3764–3775

Goldsmith AP, Gossage SJ, ffrench-Constant C (2004) ADAM23 is a

cell-surface glycoprotein expressed by central nervous system

neurons. J Neurosci Res 78:647–658

Gschwind A, Hart S, Fischer OM, Ullrich A (2003) TACE cleavage

of proamphiregulin regulates GPCR-induced proliferation and

motility of cancer cells. EMBO J 22:2411–2421

Hall RJ, Erickson CA (2003) ADAM 10: an active metalloprotease

expressed during avian epithelial morphogenesis. Dev Biol

256:146–159

Hamburger V, Hamilton HL (1951) A series of normal stages in the

development of the chick embryo. J Morphol 88:49–92

Hartmann D, de Strooper B, Serneels L, Craessaerts K, Herreman A,

Annaert W, Umans L, Lubke T, Lena Illert A, von Figura K,

Saftig P (2002) The disintegrin/metalloprotease ADAM 10 is

essential for Notch signalling but not for alpha-secretase activity

in fibroblasts. Hum Mol Genet 11:2615–2624

Itoh Y, Joh T, Tanida S, Sasaki M, Kataoka H, Itoh K, Oshima T,

Ogasawara N, Togawa S, Wada T, Kubota H, Mori Y, Ohara H,

Nomura T, Higashiyama S, Itoh M (2005) IL-8 promotes cell

proliferation and migration through metalloproteinase-cleavage

proHB-EGF in human colon carcinoma cells. Cytokine 29:

275–282

Jorissen E, Prox J, Bernreuther C, Weber S, Schwanbeck R, Serneels

L, Snellinx A, Craessaerts K, Thathiah A, Tesseur I, Bartsch U,

Weskamp G, Blobel CP, Glatzel M, De Strooper B, Saftig P

(2010) The disintegrin/metalloproteinase ADAM10 is essential

for the establishment of the brain cortex. J Neurosci 30:

4833–4844

Kohutek ZA, diPierro CG, Redpath GT, Hussaini IM (2009) ADAM-

10-mediated N-cadherin cleavage is protein kinase C-alpha

dependent and promotes glioblastoma cell migration. J Neurosci

29:4605–4615

Kondoh H (1999) Transcription factors for lens development assessed

in vivo. Curr Opin Genet Dev 9:301–308

LaVoie MJ, Selkoe DJ (2003) The Notch ligands, Jagged and Delta,

are sequentially processed by alpha-secretase and presenilin/

gamma-secretase and release signaling fragments. J Biol Chem

278:34427–34437

Le AC, Musil LS (2001) FGF signaling in chick lens development.

Dev Biol 233:394–411

Leong L, Menko AS, Grunwald GB (2000) Differential expression of

N- and B-cadherin during lens development. Invest Ophthalmol

Vis Sci 41:3503–3510

Lewis SL, Farlie PG, Newgreen DF (2004) Isolation and embryonic

expression of avian ADAM 12 and ADAM 19. Gene Expr

Patterns 5:75–79

Li HS, Yang JM, Jacobson RD, Pasko D, Sundin O (1994) Pax-6 is

first expressed in a region of ectoderm anterior to the early neural

plate: implications of stepwise determination of the lens. Dev

Biol 162:181–194

Lieber T, Kidd S, Young MW (2002) Kuzbanian-mediated cleavage

of Drosophila Notch. Genes Dev 16:209–221

Lin J, Redies C, Luo J (2007) Regionalized expression of ADAM13

during chicken embryonic development. Dev Dyn 236:862–870

Lin J, Luo J, Redies C (2008) Differential expression of five members

of ADAM family in the developing chicken brain. Neuroscience

157:360–375

Table 2 continued

E2 E3 E5 E7 E9 E14 E16

LFc - - - -

Expression levels were determined from E2 to E16 and designated as follows: -, absent; ?, weak; ??, moderate; ???, strong. CE central lens

epithelium, eLE equatorial lens epithelium, LE lens epithelium, LFc cortical lens fiber cells, LFn nuclear lens fiber cells, LFp primary lens fiber

cells (only at E5), lv lens vesicle (only at E3), Lp lens placode (only at E2)

134 J Mol Hist (2012) 43:121–135

123

Lin J, Yan X, Markus A, Redies C, Rolfs A, Luo J (2010) Expression

of seven members of the ADAM family in developing chicken

spinal cord. Dev Dyn 239:1246–1254

Lovicu FJ, McAvoy JW (2005) Growth factor regulation of lens

development. Dev Biol 280:1–14

Luo J, Treubert-Zimmermann U, Redies C (2004) Cadherins guide

migrating Purkinje cells to specific parasagittal domains during

cerebellar development. Mol Cell Neurosci 25:138–152

Marcinkiewicz M, Seidah NG (2000) Coordinated expression of beta-

amyloid precursor protein and the putative beta-secretase BACE

and alpha-secretase ADAM10 in mouse and human brain.

J Neurochem 75:2133–2143

Maretzky T, Reiss K, Ludwig A, Buchholz J, Scholz F, Proksch E, de

Strooper B, Hartmann D, Saftig P (2005) ADAM10 mediates

E-cadherin shedding and regulates epithelial cell–cell adhesion,

migration, and beta-catenin translocation. Proc Natl Acad Sci

USA 102:9182–9187

McCusker C, Cousin H, Neuner R, Alfandari D (2009) Extracellular

cleavage of cadherin-11 by ADAM metalloproteases is essential

for Xenopus cranial neural crest cell migration. Mol Biol Cell

20:78–89

Neuner R, Cousin H, McCusker C, Coyne M, Alfandari D (2009)

Xenopus ADAM19 is involved in neural, neural crest and

muscle development. Mech Dev 126:240–255

Pontoriero GF, Smith AN, Miller LA, Radice GL, West-Mays JA,

Lang RA (2009) Co-operative roles for E-cadherin and N-cad-

herin during lens vesicle separation and lens epithelial cell

survival. Dev Biol 326:403–417

Rowan S, Conley KW, Le TT, Donner AL, Maas RL, Brown NL

(2008) Notch signaling regulates growth and differentiation in

the mammalian lens. Dev Biol 321:111–122

Schafer B, Marg B, Gschwind A, Ullrich A (2004) Distinct ADAM

metalloproteinases regulate G protein-coupled receptor-induced

cell proliferation and survival. J Biol Chem 279:47929–47938

Shi W, Chen H, Sun J, Buckley S, Zhao J, Anderson KD, Williams

RG, Warburton D (2003) TACE is required for fetal murine

cardiac development and modeling. Dev Biol 261:371–380

Smith AN, Miller LA, Song N, Taketo MM, Lang RA (2005) The

duality of beta-catenin function: a requirement in lens morpho-

genesis and signalling suppression of lens fate in periocular

ectoderm. Dev Biol 285:477–489

Tholozan FM, Quinlan RA (2007) Lens cells: more than meets the

eye. Int J Biochem Cell Biol 39:1754–1759

Watabe-Uchida M, Masuda A, Shimada N, Endo M, Shimamura K,

Yasuda K, Sehara-Fujisawa A (2004) Novel metalloprotease-

disintegrin, meltrin epsilon (ADAM35), expressed in epithelial

tissues during chick embryogenesis. Dev Dyn 230:557–568

Wei S, Xu G, Bridges LC, Williams P, White JM, DeSimone DW

(2010) ADAM13 induces cranial neural crest by cleaving class B

Ephrins and regulating Wnt signaling. Dev Cell 19:345–352

Xu L, Overbeek PA, Reneker LW (2002) Systematic analysis of E-,

N- and P-cadherin expression in mouse eye development. Exp

Eye Res 74:753–760

Yagami-Hiromasa T, Sato T, Kurisaki T, Kamijo K, Nabeshima Y,

Fujisawa-Sehara A (1995) A metalloprotease-disintegrin partic-

ipating in myoblast fusion. Nature 377:652–656

Yan X, Lin J, Wang H, Markus A, Wree A, Rolfs A, Luo J (2010)

Regional expression of the ADAMs in developing chicken

cochlea. Dev Dyn 239:2256–2265

Yan X, Lin J, Markus A, Rolfs A, Luo J (2011) Regional expression

of ADAM19 during chicken embryonic development. Dev

Growth Differ 53:333–346

Yang P, Baker KA, Hagg T (2006) The ADAMs family: coordinators

of nervous system development, plasticity and repair. Prog

Neurobiol 79:73–94

Zhao J, Chen H, Wang YL, Warburton D (2001) Abrogation of tumor

necrosis factor-alpha converting enzyme inhibits embryonic lung

morphogenesis in culture. Int J Dev Biol 45:623–631

J Mol Hist (2012) 43:121–135 135

123

expression patterns of adams in the developing chicken lens

Documents