expression in escherichia coli of three different soybean late embryogenesis abundant (lea) genes to...

Received 2 Aug. 2004 Accepted 15 Oct. 2004Supported by the National Special Program for Research and Industrialization of Transgenic Plants (JY03A18), the National NaturalScience Foundation of China (30470107), and Foundation for Key Teachers in Universities (200065).* Author for correspondence. E-mail: <[email protected]>.

Journal of Integrative Plant BiologyFormerly Acta Botanica Sinica 2005, 47 (5): 613−621

Expression in Escherichia coli of Three Different Soybean Late EmbryogenesisAbundant (LEA) Genes to Investigate Enhanced Stress Tolerance

Ying LAN1, 3, Dan CAI2 and Yi-Zhi ZHENG2*

(1. Institute of Genetics and Cytology, School of Life Sciences, Northeast Normal University, Changchun 130021, China;2. College of Life Sciences, Key Laboratory of Microorganism and Genetic Engineering of Shenzhen City,

Shenzhen University, Shenzhen 518060, China;3. Medical College of Beihua University, Jilin 132021, China)

Abstract: In order to identify the function of late embryogenesis abundant (LEA) genes, in vitro func-tional analyses were performed using an Escherichia coli heterologous expression system. Three soybeanlate embryogenesis abundant (LEA) genes, PM11 (GenBank accession No. AF004805; group 1), PM30(AF117884; group 3), and ZLDE-2 (AY351918; group 2), were cloned and expressed in a pET-28a system.The gene products were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis andidentified by mass spectrometry. E. coli cells containing the recombinant plasmids or empty vector ascontrols were treated by salt and low temperature stress. Compared with control cells, the E. coli cellsexpressing either PM11 or PM30 showed a shorter lag period and improved growth when transferred to LB(Luria-Bertani) liquid media containing 800 mmol/L NaCl or 700 mmol/L KCl or after 4 °C treatment. E. colicells expressing ZLDE-2 did not show obvious growth improvement both in either high KCl medium or after4 °C treatment. The results indicate that the E. coli expression system is a simple, useful method to identifythe functions of some stress-tolerant genes from plants.Key words: Escherichia coli; gene expression; LEA gene; osmotic stress; salt stress; soybean.

Drought, salinity, and low temperature are abioticstresses that are the main limiting factors for plantgrowth. A number of water deficit-induced genes havebeen isolated and characterized. Late embryogenesisabundant (LEA) proteins are a subset of a group ofevolutionarily conserved hydrophilic proteins termed“hydrophilins” involved in various responses to osmoticconditions (Garay-Arroyo et al. 2000). After their iden-tification first in cotton, LEA or LEA-like genes wereisolated from many plant species, some bacteria, andfungi (Dure et al. 1981; Stacy and Aalen 1998; Dure2001; Makarova et al. 2001). More recently, thesegenes have even been found in a nematode (Browne etal. 2002).

The LEA proteins are extremely hydrophilic and

soluble upon boiling. The proteins are classified into atleast five groups based on amino acid sequence ho-mology and specific motifs (Bray et al. 2002). Group1 LEA proteins contain a conserved 20 amino acid se-quence w i th a h igh hyd roph i l i c mo t i f o fGGETRKEQLGEEGYREMGRK. The majority of thepolypeptide favors the adoption of a PII structure,which indicates a possible function for the group 1LEA proteins as water-binding proteins that may pre-serve water in desiccated cells (Soulages et al. 2002).

Group 2 LEA proteins, also referred to as dehydrins,are characterized by the highly conserved lys-rich 15amino acid consensus EKKGIMDKIKEKLPG, whichis referred to as the K segment. It has been hypoth-esized (Close 1996) that the role of the K segment may

http://www.blackwell-synergy.comhttp://www.chineseplantscience.com

Journal of Integrative Plant Biology (Formerly Acta Botanica Sinica) Vol. 47 No. 5 2005614

be hydrophobic interaction with partially denatured pro-teins or membranes. Many dehydrins also contain atract of Ser residues (the S segment). It has been dem-onstrated (Close 1996) that the Ser residues in the seg-ment can be phosphorylated and that phosphorylationis related to the binding of nuclear localization signalpeptides to nuclear transport. Another consensus aminoacid sequence is (V/T)DEYGNP (the Y segment). Thismay exist near the amino terminus in the majority ofdehydrins. A “YSK” shorthand is based on these con-sensus sequences and facilitates further classificationof dehydrins (Close 1996).

Commonly, group 3 LEA proteins contain a repeatof an 11 mer amino acid motif with the consensus se-quence TAQAAKEKAGE. A possible amphiphilic helixstructure of the 11 mer repeating unit may allow dimer-ization of the polypeptides via binding of their hydro-phobic faces, and a right-handed coiled coil would beformed. This structure suggests a function for theseproteins in ion sequestration under conditions of dehy-dration (Dure 1993).

Hydrophilicity and heat stability are common char-acteristics of LEA proteins. It has been suggested thatLEA-type proteins act as water-binding molecules, inion sequestration, and in macromolecule and membranestabilization (Wang et al. 2003); however, their exactfunction remains unclear.

Functional analyses of LEA proteins have been per-formed both in vivo and in vitro. Xu et al. (1996) re-ported that the expression of a barley group 3 LEAprotein, Hordeum vulgare HVA1, in transgenic rice(Oryza sativa L.) improved tolerance to salinity anddrought stress. Expression of the HVA1 gene in yeast(Saccharomyces cerevisiae) cells improved their growthrate under ionic (NaCl and KCl) stress, as well as in-creasing their freezing tolerance (Zhang et al. 2000).Using an S. cerevisiae heterologous expression system,a tomato group 2 protein (Lycopersicon esculentum LE4) and a group 4 protein (L. esculentum LE 25) con-ferred improved growth rates for yeast cells at highKCl and NaCl concentrations and both proteins im-proved freezing tolerance (Imai et al. 1996; Zhang et

al. 2000). A group 1 LEA protein from wheat (Em)was expressed in yeast cells and enhanced growth wasobserved under conditions of high concentrations ofNaCl, KCl, and sorbitol (Swire-Clark and Marcotte1999). Moreover, based on functional expression ofthe algal genes in Escherichia coli cells, Miyasaka etal. (2000) successfully isolated several anti-stress genes.Gowrishankar (1985) used the technique of lac operonfusions in E. coli to identify and examine the regulationof osmoresponsive genes. The expression of the genesspecifically either increased or decreased with changesin the osmolarity of the growth medium. In addition,by using functional screening in E. coli, Yamada (2002)reported that the expression of the mangrove allene oxidecyclase (AOC) gene enhanced the salt tolerance of E.coli, yeast, and tobacco cells. Until now, to ourknowledge, experimental evidence regarding in vitrofunctional studies of LEA proteins in E. coli has notbeen reported. To investigate the osmotic tolerancefunctions of LEA proteins, a simple method based onthe bacterial expression system was examined in thepresent study.

1 Materials and Methods1.1 Materials

Soybean (Glycine max L. Merr. cv. Bainong 6) seedswere kindly provided by Baicheng Institute of Agricul-ture Science (Baicheng City, Jilin Province, China).

E. coli JM109, BL21 Star (DE3) and plasmidpET-28a were kept in the Key Laboratory of Micro-organism and Genetic Engineering (Shenzhen City,China).1.2 Total RNA isolation and cDNA synthesis

Total RNA was extracted from soybean seeds 40 dafter flowering using the standard protocol of theRNAgents Total RNA Isolation System (Promega,Madison, WI, USA). Single-strand cDNA was synthe-sized using 3'-Full Core Set (TaKaRa, Dalian City,China) according to the manufacturer’s instructions.1.3 Cloning and sequencing of soybean LEA genes

To amplify the open reading frame (ORF) of threesoybean LEA genes from different groups, three pairs

Ying LAN et al.: Expression in Escherichia coli of Three Different Soybean Late Embryogenesis Abundant (LEA) Genes toInvestigate Enhanced Stress Tolerance 615

Table 1 The sequences of the primers used for soybean late embryogenesis abundant (LEA) genes cloningPrimer number Reported gene’s name Sequences of the primers† (5'→3')P1 (forward) PM11 CTAGGGATCCATGGGCGCATCTCGTCAAAACAACAAGP2 (reverse) PM11 CTAGCTCGAGTTACTTATCCTGGTCTTCGTTCTGP3 (forward) PM30 CTAGGGATCCATGGGCGCATCCCATAGGCAAAGCTATP4 (reverse) PM30 CTAGCTCGAGTTAGTAATTTCTGCGGTTGTCTTGP5 (forward) MAT1 GCGCCATGGCAAGTTATCAGAAGCACP6 (reverse) MAT1 GCGGATCCTTACTTGTCACTGTGTCCTCC

†, Nco I, BamHI and XhoI sites are underlined and translation start codon or stop codon are in bold.

of primers with restriction enzyme sites were designedaccording to the cDNA sequences of PM11, PM30,and MAT1 (M93568). The sequences of the primersare given in Table 1.

Amplified fragments were cloned into plasmidpGEM-T Easy (Promega, Madison, WI, USA) andtransformed into E. coli JM109. Positive clones werethen selected based on the color reaction using an Xgal-isopropyl thiogalactoside (IPTG) system and confirmedby PCR reaction. Then, the positive clones screenedwere sequenced with a DNA Sequencing System (modelABI 377; Applied Biosystems, Foster City, CA, USA).1.4 Expression of soybean LEA genes in E. coli1.4.1 Construction of vectors The plasmids con-taining the amplified product with primers P1 and P2were digested with BamHI and XhoI. The shorter frag-ment produced was inserted in the BamHI/XhoI sitesof pET-28a and, thus, the recombinant pET28-PM11was obtained.

The plasmids containing the amplified product withprimers P3 and P4 were digested with the enzymesBamHI and XhoI. The shorter fragment produced wasinserted in the BamHI/XhoI sites of pET-28a and, thus,the recombinant pET28-PM30 was obtained.

The plasmids containing the amplified product withprimers P5 and P6 were digested with the enzymesNcoI and BamHI. The shorter fragment produced wasinserted in the NcoI/BamHI sites of pET-28a and, thus,the recombinant pET28-ZLDE-2 was obtained.1.4.2 Expression of recombinant plasmids ofpET28-PM11, pET28-PM30, and pET28-ZLDE-2 inE. coli The constructs were introduced into E. colistrain BL21 star (DE3) according to the manufacturer’sinstructions (Novagen, brands of EMD Biosciences,

Inc, an Affiliate of Merck KGaA, Darmstadt, Germany).E. coli BL21 star (DE3) cells carrying pET28-PM11,

pET28-PM30, pET28-ZLDE-2, or pET-28a weregrown at 37 °C in LB (Luria-Bertani) media supple-mented with 50 g/mL kanamicin. Isopropylthio-β-ga-lactoside was added to cell cultures (OD600=0.6–0.8)to a final concentration of 1 mmol/L and grown at 34°C for 4 h. Overexpressed proteins were detected bysodium dodecyl sulfate-polyacrylamide gel electro-phoresis (SDS-PAGE) according to standard methods(Sambrook et al. 1992).

A 100 mL cell culture was kept in a hot bath at 100°C for 10 min, placed on ice for 15 min, and then cen-trifuged at 4 000g for 10 min at 4 °C .The supernatantwas lyophilized and dissolved with 100 µL deionizedwater and finally separated on 12% SDS-PAGE(Sambrook et al. 1992).1.4.3 Mass spectrometry Electrospray ionizationmass spectrometry (ESI-MS) analysis of proteins wasperformed on the Agilent 1 100 series LC/MSD trap(Agilent, USA) as follows. Samples were obtained fromthe SDS-PAGE gels and, after being decolored with50% acetonitrile-25 mmol/L NH4HCO3, the proteinswere reduced with 1.5 mg/mL dithiothreitol (DTT) at56 °C for 1 h, alkylated in the dark with 10 mg/mLiodoacetamide at 37 °C for 45 min, dried for overnight,and then digested with trypsin at 37 °C for 20 h. Sampleswere then lyophilized and dissolved in 0.2%trifluoroacetic acid. Finally, the digested peptides wereinjected into the electrospray system at a flow rate of 3µL/min.1.5 Cell growth under salt and low temperaturestress

The BL21 star cells harboring pET28-PM11, pET28-


PM30, pET28-ZLDE-2, or pET-28a were induced bythe addition of IPTG as described above. A 2 mL ali-quot of the induced cultures (OD600=0.8) was incu-bated in LB medium with either 800 mmol/L NaCl or700 mmol/L KCl and grown at 34 °C. At each timepoint, 2 mL of the cultures was harvested and mea-sured at OD600 with a spectrophotometer. Growth wasmeasured three times and essentially the same growthcurve was obtained each time.

For low temperature stress, 2 mL of the inducedcultures (OD600=0.8) was cooled at 4 °C for 24 h andthen incubated in LB medium at 34 °C.

When the induced E. coli cultures in LB mediumreached an OD600 value of 0.8, cells were diluted1/100 and then a 50 µL aliquot was spread on LB agarplates with either 1 000 mmol/L NaCl or 800 mmol/LKCl. For low temperature stress, the induced cultures(OD600=0.8) were cooled at 4 °C for 24 h, diluted1/100 with deionized water, and a 50 µL aliquot of thesuspension was spread on LB agar plates. After incu-bation for 48 h, clones appearing on the plates werecounted.

2 Results2.1 cDNA cloning of PM11, PM30, and ZLDE-2

A 341 bp fragment was amplified using RT-PCR withprimers P1 and P2. The fragment had one base differ-ence from a soybean PM11 cDNA (AF004805) se-quence deposited in GenBank. The base C (+221) waschanged to base G, resulting in an amino acid changefrom Asp to Glu, but their charge polarity was the same(data not shown). The cDNA, named PM11, containeda 317 bp ORF encoding a predicted polypeptide of 105amino acids. The predicted protein contains a conserved20 amino acid motif of an LEA group 1 protein.

Another fragment (446 bp) was cloned using thesame approach but with primers P3 and P4. BLASTanalysis of GenBank revealed that this fragment shared100% identity with the soybean PM30 cDNA(AF117884) sequence in GenBank. Sequence analysisshowed that the cDNA contained a 423 bp ORF en-coding a predicted polypeptide of 140 amino acids (data

not shown). The predicted protein contains a conserved11 mer motif of an LEA group 3 protein.

Using primers P5 and P6, a 742 bp fragment wasamplified. This fragment shared 96% identity with soy-bean MAT1 cDNA (M93568). The cDNA cloneobtained, named ZLDE-2, contained a 729 bp ORFencoding a predicted polypeptide of 243 amino acids(data not shown). This fragment was supposed to be anew member of the soybean LEA gene family and thegene and the deduced protein were registered inGenBank as AY351918 and AAQ02338, respectively.The deduced amino acid sequence of ZLDE-2 had aconsensus sequence of the K domain, which referredto the motif of the LEA group 2 proteins.2.2 Production of PM11, PM30, and ZLDE-2 pro-teins in E. coli

To express LEA genes in E. coli at high levels, cDNAfragments of PM11, PM30, and ZLDE-2 were ligatedinto plasmid pET28a. The positive clones were selectedand confirmed by digestion with BamHI/XhoI or NcoI/BamHI. The bands on agar gels gave approximately350 bp of PM11, 500 bp of PM30, and 750 bp ofZLDE-2 at their respective molecular weights (data notshown).

After induction with IPTG for 4 h, the clones withrecombinant plasmids of pET28-PM11, pET28-PM30,and pET28-ZLDE-2 were harvested. Total proteinextracts, soluble cell extracts, and cell pellets were ana-lyzed by 12% SDS-PAGE. Cell cultures boiled for 10min were also analyzed by 12% SDS-PAGE.Overexpression of PM11, PM30, and ZLDE-2 genesin E. coli produced protein bands of approximately 18,20, and 32 kDa on the gels, respectively. The size ofthe proteins deduced from the cDNA sequences was15.6, 19.3, and 27.0 kDa, respectively (Fig. 1). Themismatch between the predicted and measured mo-lecular weights on the SDS-PAGE gel was supposedlydue to the biased amino acid compositions, as for someother LEA proteins (Imai et al. 1996; Zhang et al. 2000).After boiling for 10 min, the expressed PM11, PM30,and ZLDE-2 proteins still existed in the soluble part ofthe cultures, suggesting that the three proteins are all


Fig. 1. Expression of soybean group late embryogenesisabundant (LEA1) genes in Escherichia coli. Expressionof recombinant plasmids of pET28-PM11 (a), pET28-PM30(b) and pET28-ZLDE-2 (c) is shown. Lanes 1 and 2, totalprotein extracts from E. coli with pET28a without/withXgalisopropyl thiogalactoside (IPTG) inducing; lanes 3and 4, total protein extracts from E. coli with recombinantplasmids without/with IPTG inducing; lanes 5 and 6, solubleand pellet part of E. coli with recombinant plasmids withIPTG inducing; lane 7, boiling treated protein of E. coli withrecombinant plasmids; lane 8, molecular weight standards.

Fig. 2. The probability based on Mascot score of peptides.a. Expression product of pET28-PM11. b. Expression productof pET28-PM30. c. Expression product of pET28-ZLDE-2.

heat stable.2.3 Mass spectrometry analysis

The peptide map data of MS and MS/MS spectrawere saved into one data file. After a subsequent data-base search (http://www.matrixscience.com), threemain proteins, namely PM11, PM30, and ZLDE-2, wereidentified. The probability base of the Mascot scorefor these three proteins is shown in Fig. 2a–c. Detailedresults are given in Table 2.2.4 Growth performance of transformed E. colistrains under the stresses of salt and low tempera-ture

We tested the growth performance of the E. coli

cells transformed with pET28-PM11, pET28-PM30,and pET28-ZLDE-2 under stress conditions of salt andlow temperature. The growth performance of thesecells was compared with that of the strain transformedwith pET-28a as a control.

The control strain and the three transformants weregrown in LB media and showed almost the same growthrate (data not shown), indicating that overproductionof LEA proteins is not deleterious for the growth of thestrains in medium under normal condition.2.4.1 Growth performance of the three recombi-nant strains in liquid medium under stress condi-tions

The control strain with the pET28 plasmid wasgrown in LB liquid medium containing 800 mmol/LNaCl. The growth of the control strain was initiallyarrested and exponential growth resumed after a lagphase of 48 h (Fig. 3). The three recombinant strainsdisplayed improved growth compared with the control


Table 2 The research results on Mascot for peptides digested from late embryogenesis abundant (LEA) proteinIdentified protein Matched to Nominal mass (kDa) Score Sequence coverage (%)Embryonic abundant protein in soybean (a) T07087 11 485 65 11Seed maturation protein PM30 in Glycine max (b) gi|4838147 15 088 176 67LEA protein in G. max (c) gi|33303618 25 354 123 35

Fig. 3. Growth of Escherichia coli cells expressing PM11,PM30, ZLDE-2 proteins and the control cell in the mediacontaining 800 mmol/L NaCl.

Fig. 4. Growth of Escherichia coli cells expressing PM11,PM30, ZLDE-2 proteins and the control cell in the mediacontaining 700 mmol/L KCl.

Fig. 5. Growth of Escherichia coli cells expressing PM11,PM30, ZLDE-2 proteins and the control cell in the normalmedia after 4 °C treatment.

strain (Fig. 3). After the transformants had been trans-ferred to a medium with 800 mmol/L NaCl, the lagphase of strains transfected with pET28-PM11, pET28-PM30, and pET28-ZLDE-2 was approximately 32, 35,and 42 h, respectively (Fig. 3). Similar experimentswere performed to investigate the effect of high KClconcentrations on the growth characteristics of thetransformants. In LB medium containing 700 mmol/LKCl, the lag phase of the control strain was approxi-mately 35 h, whereas that of strains expressing PM11and PM30 proteins was only 17 and 21 h, respectively(Fig. 4). The PM30-expressing strain also displayed agreater growth rate than the PM11-expressing strainduring the exponential phase. In contrast, when thestrain expressing ZLDE-2 was grown in the samemedium, no improvement in growth characteristics wasobserved (Fig. 4). In fact, the growth of E. coli withpET28-ZLDE-2 was reduced and these cells displayeda longer lag period (approximately 5 h) than even thatof the control strain (Fig. 4).

To determine whether expression of LEA altered the

cooling tolerance of E. coli, the cells grown in LB me-dium to the exponential phase were stored at 4 °C for24 h and the growth performance of the control andrecombinant strains was then observed. Bothtransformants with pET28-PM11 and pET28-PM30displayed a shorter lag period (3–4 h) than the control


Fig. 6. Growth performance of the several recombinant strains under solid LB plates containing 800 mmol KCl medium.a. pET28 strain as control. b, c, and d. The transformants with plasmid of pET28-PM11, pET28-PM30, and pET28-ZLDE-2,respectively.

Table 3 Growth performance of the several recombinantstrains under stress conditions of solid medium mediumStrains 1 000 mmol 800 mmol 4 °C treatment

NaCl KClpET28 − − ++++pET28-PM11 ++ ++++ ++++pET28-PM30 ++ +++ ++++pET28-ZLDE-2 − − ++++“−” indicates none or <100 colones; “+” indicates about 250colones.

strain (Fig. 5). Transformants with pET28-ZLDE-2exhibited almost the same lag period as the control strain(Fig. 5).2.4.2 Growth performance of the three recombi-nant strains under stress conditions of a solid me-dium E. coli cells were grown in LB medium to theexponential phase, then the control and recombinantstrains were properly diluted and spread on solid LBplates containing 1 000 mmol/L NaCl or 800 mmol/LKCl. After culture at 37 °C for approximately 48 h, the

control strain was not able to survive at a high concen-tration of either NaCl or KCl. The cells expressing thePM11 and PM30 proteins had 500 or 1 000 colonesappeared on the plates, as shown in Table 3 and Fig. 6(other data not shown). In contrast, cells expressingthe ZLDE-2 protein had fewer than 50 colones, similarto the number that grew under liquid stress conditions.E. coli cells with the three LEA proteins showed nodifference in growth on solid LB medium after treat-ment with low temperature (Table 3).

The results described above reveal that PM11, PM30,and ZLDE-2 proteins may have different protectivefunctions in transformed E. coli cells.

3 DiscussionThe LEA proteins are a subset of stress-induced

proteins that can be divided into several groups basedon their amino acid sequence. Because different LEAgroups display conservation of unique primary


structures, it is reasonable to predict that at least partof the putative protective function is the result of indi-vidual contributions by each LEA protein group andthat those contributions can be demonstrated and ana-lyzed independently (Swire-Clark and Marcotte 1999).

A heterologous E. coli expression system was usedto show that the soybean LEA protein can function asan osmoprotective molecule and provide cellular pro-tection from external osmotic challenge. The strategywas based on the result that the E. coli cells express-ing LEA genes were capable of tolerating high salt stressor low temperature, which was different from the con-trol cultures. E. coli, like many other non-halophilicbacteria, is able to tolerate and grow in media with anosmolarity of 0.7 mol/L NaCl (Gowrishankar 1985).In the present study, three different groups of soybeanLEA proteins were produced in transformed E. coli.The proteins expressed were confirmed by tandemESI-MS/MS. So, we can consider that the improvedgrowth performance was directly due to the functionof the LEA protein. The ability of cells harboring soy-bean LEA genes to grow in the presence of high levelsof various osmotica was used as a functional assay toexamine the putative function of the LEA proteins.Growth measurements in high NaCl and KCl mediarevealed that PM11 and PM30 proteins both have pro-tective functions in E. coli. This is evidenced by theshortened osmoadaptive lag period (6–18 h) for recom-binant strains compared with the control strain (Figs.3,4). This may be due to the more rapid recovery ofLEA-expressing cells compared with non-expressingcells and strongly suggests that PM11 or PM30 ex-pression is responsible for the improvement in growth.Moreover, PM30-expressing cells display the highestenhanced growth in high KCl medium, suggesting thata larger number of recombinant cells could survive andthat PM30 has an effect specific to K+ ions. This sup-ports the hypothesis of a putative function of group 3LEA proteins in ion sequestration.

Previous studies with members of the LEA groupshave also suggested that at least some of these pro-teins are osmoprotective. Heterologous expression in

S. cerevisiae can be used to address the function ofspecific genes. Swire-Clark and Marcotte (1999) ex-pressed a group 1 wheat Em protein in yeast usingexperiments similar to those presented here. A group 3LEA protein, namely HVA1, reportedly displayed in-creased tolerance to salt stress and water deficit in bothan S. cerevisiae expression system and transgenic riceplants (Xu et al. 1996; Zhang et al. 2000). The resultsof the present study, obtained using the E. coli expres-sion system, also demonstrate a positive effect of LEAproteins on growth in liquid and solid media containinghigh salt and low temperature stress but the K1-typegroup 2 protein ZLDE-2 did not enable the E. coli tosurvive in a high-KCl medium or after cooling treatment.Previous in vitro functional studies of a Y2K-type group2 LEA protein from tomato (LE4) showed an effect ofionic (KCl) or freezing stress in yeast cells (Zhang etal. 2000). These discrepancies between studies maybe due to differences in the structure of ZLDE-2 andLE4 or for other reasons that require furtherinvestigation.

In the present study, we have demonstrated that theoverproduction of LEA proteins is not deleterious togrowth in medium under normal conditions. The PM11and PM30 proteins may have protective functions forsurvival under stress conditions. The method describedoffers the opportunity to analyze the functions of othercandidate proteins, like LEA proteins, under stress con-ditions that are related to tolerance. Moreover, this ap-proach has the possibility for further research onhydrophilins.

References

Browne J, Tunnacliffe A, Burnell A (2002). Plant desiccation

gene found in a nematode. Nature 416, 38.

Bray EA, Bailey-Serres J, Weretilnyk E (2002). Responses to

abiotic stresses. In: Buchanan B, Gruissem W, Jones RL,

eds. Biochemistry and Molecular Biology of Plants. Am Soc

Plant Biol, Rockville, MD. pp.1158–1173.

Close TJ (1996). Dehydrins: Emergence of a biochemical role of

a family of plant dehydration proteins. Physiol Plant 97,

795–803.


(Managing editor: Li-Hui ZHAO)

Dure L III (1993). A repeat 11-mer amino acid motif and plant

desiccation. Plant J 3, 363–369.

Dure L III (2001). Occurence of a repeating 11-mer amino acid

sequence motif in diverse organisms. Protein Peptide Lett 8,

115–122.

Dure L III, Greenway SC, Galau GA (1981). Developmental

biochemistry of cottonseed embryogenesis and germination.

XIV. Changing mRNA populations as shown by in vitro and

protein synthesis. J Biochem 20, 4162–4168.

Garay-Arroyo A, Colmenero-Flores JM, Garciarrubio A,

Covarrubias AA (2000). Highly hydrophilic proteins in

prokaryotes and eukaryotes are common during conditions

of water deficit. J Biol Chem 275, 5668–5674.

Gowrishankar J (1985). Identification of osmoresponsive genes

in Escherichia coli: Evidence for participation of potassium

and praline transport systems in osmoregulation. J Biochem

164, 434–445.

Imai R, Zhang L, Ohta A, Bray EA, Takagi M (1996). A lea-class

gene of tomato confers salt and freezing tolerance when ex-

pressed in Saccharomyces cerevisiae. Gene 170, 243–248.

Makarova KS, Aravind L, Wolf YI (2001). Genome of the ex-

tremely radiation-resistant bacterium Deinococcus

radiodurans viewed from the perspective of comparative

genomics. Microbiol Miol Rev 65, 44–79.

Miyasaka H, Kanaboshi H, Ikeda K (2000). Isolation of several

anti-stress genes from the alotolerant green alga Chlamy-

domonas by simple functional expression screening with

Escherichia coli. World J Microbiol Biotechnol 16, 23–29.

Nagele E, Vollmer M, Horth P (2004). Improved 2D nano-LC/

MS for proteomics applications: A comparative analysis using

yeast proteome. J Biotech 15, 134–143.Sambrook J, Russell

DW (2001). Molecular Cloning: A Laboratory Manual, 3rd

edn. Cold Spring Harbor Laboratory Press, Cold Spring

Harbor, NY.

Soulages JL, Kim K, Walters C, Cushman JC (2002). Tempera-

ture-induced extended helix/random coil transition in a group

1 late embrogenesis-abundant protein from soybean. Plant

Physiol 128, 822–832.

Stacy RAP, Aalen RB (1998). Identification of sequence homol-

ogy between the internal hydrophilic repeated motifs of

Group 1 late-embryogenesis-abundant proteins in plants and

hydrophilic repeats of the general stress protein GsiB of

Bacillus subtilis. Planta 206, 476–478.

Swire-Clark GA, Marcotte WR (1999). The wheat LEA protein

Em functions as an osmoprotect ive molecule in

Saccahromyces cerevisiae. Plant Mol Biol 39, 117–128.

Wang WX, Vinocur B, Altman A (2003). Plant responses to

drought, salinity and extreme temperatures: Towards genetic

engineering for stress tolerance. Planta 218, 1–14.

Xu DP, Duan XL, Wang BY (1996). Expression of a late em-

bryogenesis abundant protein gene HVA1, from barley con-

fers tolerance to water deficit and salt stress in transgenic

rice. Plant Physiol 110, 249–257.

Yamada A (2002). Expression of mangrove allene oxide cyclase

enhances salt tolerance in Escherichia coli, yeast, and to-

bacco cells. Plant Cell Physiol 43, 903–910.

Zhang L, Ohta A, Takagi M, Imai R (2000). Expression of plant

group 2 and group 3 lea genes in Saccharomyces cerevisiae

revealed functional divergence among LEA proteins. J Biochem

127, 611–616.

expression in escherichia coli of three different soybean late embryogenesis abundant (lea) genes to...

Documents