expanding the genetic toolbox of leptospira generation of...
TRANSCRIPT
1
1
Expanding the genetic toolbox of Leptospira : 2
generation of fluorescent bacteria 3
4
5
6
7
8
9
Florence Aviat 1, Leyla Slamti 1, Gustavo M. Cerqueira 1, 2, Kristel Lourdault 1, 10
and Mathieu Picardeau 1* 11
12
13
14 1 Institut Pasteur, Unité de Biologie des Spirochètes, Paris, France 15 2 Centro de Biotecnologia, Instituto Butantan, São Paulo, SP, Brazil 16
17
18
19
running title: gfp-transformed Leptospira 20
21
22
23
24
25
26
27
28
29
30
* Corresponding author. 31
Mailing address: Mathieu Picardeau, Unité de Biologie des Spirochètes, Institut 32
Pasteur, 28 rue du docteur Roux, 75724 Paris Cedex 15, France. Tel: 33 (1) 45 68 33
83 68. Fax: 33 (1) 40 61 30 01. E-mail: [email protected] 34
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02199-10 AEM Accepts, published online ahead of print on 29 October 2010
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
2
ABSTRACT 1
2
In comparison to other bacterial species, our knowledge of the genetics and 3
molecular basis of the pathogenesis associated with Leptospira is very limited. An 4
improved understanding of pathogenic mechanisms requires reliable genetic tools for 5
functional genetic analysis. Here, we report the expression of gfp and mRFP1 genes 6
under the control of constitutive spirochetal promoters, in both saprophytic and 7
pathogenic Leptospira strains. We were able to reliably measure the fluorescence of 8
Leptospira by fluorescence microscopy and a fluorometric microplate reader-based 9
assay. We showed that the expression of the gfp gene had no significant effects on 10
growth in vivo and pathogenicity in L. interrogans. We constructed an expression 11
vector for L. biflexa that contains the lacI repressor, an inducible lac promoter and gfp 12
as the reporter, demonstrating that the lac system is functional in Leptospira. GFP 13
expression was induced by the addition of isopropyl-β-D-thiogalactopyranoside 14
(IPTG) in L. biflexa transformants harboring the expression vector. Finally, we 15
showed that GFP can be used as a reporter to assess promoter activity in different 16
environmental conditions. These results may facilitate further advances for studying 17
the genetics of Leptospira spp. 18
19
20
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
3
INTRODUCTION 1
The genus Leptospira belongs to the order Spirochaetales and includes both 2
saprophytic and pathogenic members, such as Leptospira biflexa and L. interrogans, 3
respectively. Leptospirosis is the most widespread zoonosis worldwide, with more 4
than one million severe cases annually (17, 21). This increasingly common disease 5
mostly occurs in rural environments and poor urban centers subject to frequent 6
flooding. Rodents are the main reservoir of the disease, excreting the bacteria in their 7
urine (17, 21). Humans are usually infected through contact with water contaminated 8
with the urine of infected animals. 9
Although our group has developed a number of tools for genetic manipulation of 10
Leptospira in recent years (6, 11, 25), fewer tools are available for genetic studies of 11
Leptospira than for various other bacteria. Further development and improvement of 12
genetic tools is therefore necessary to improve understanding of the pathogenic 13
mechanisms of Leptospira. 14
Green fluorescent protein (GFP) and its variants have become valuable tools in 15
molecular biology. One advantage of GFP is that its autofluorescence does not 16
require any cofactors for expression, enabling its detection in single cells and on agar 17
plates. GFP was originally obtained from the jellyfish Aequorea victoria and has an 18
excitation peak at 395 nm and a smaller peak at 475 nm. There are many derivatives 19
of this wild-type GFP, which have increased levels of fluorescence emission, and 20
shifted excitation or emission spectra. One of these GFP variants, GFPuv, appears to 21
have a higher fluorescence emission because it is more soluble than wild-type GFP 22
(10). Site-directed mutagenesis of wild-type GFP has also been used to create F64L 23
and S65T mutations to produce a series of GFPmut derivatives that have a red-24
shifted excitation spectrum (excitation maximum 488 nm) giving them characteristics 25
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
4
close to those of the fluorophore fluorescein isothiocyanate (FITC) (9). GFP mutants 1
with blue, cyan and yellowish-green emission spectra are also available (33). Another 2
fluorescent protein, DsRed, originally isolated from corals has an excitation maximum 3
around 560 nm and an emission maximum around 580 nm; these values are 4
significantly different from those for GFP fluorescence and therefore DsRed can be 5
used in conjunction with GFP. A disadvantage of wild-type DsRed is that it is 6
tetrameric and matures more slowly than GFP. However, more rapidly maturing 7
monomeric variants, for example monomeric red fluorescent protein (mRFP1), have 8
been developed (7). GFP and other fluorescent proteins have been used as 9
reporters for studies of gene expression, protein localization, and bacterial 10
localization and activities in infected animal/plant tissues. Many plasmids and 11
transposons expressing the gfp gene have been used to label a broad variety of 12
eukaryotic and prokaryotic cells. In this study, we generated replicative plasmid 13
constructs containing constitutive and inducible promoters fused to genes encoding 14
GFP and mRFP1. Plasmids were introduced into the saprophyte L. biflexa and 15
expression of fluorescent proteins in transformants was evaluated by epifluorescence 16
microscopy and fluorometric microplate reader-based assay. Using a Himar1 17
transposon delivery system, we have also labeled the chromosome of the pathogen 18
L. interrogans with gfp . These new genetic tools may help investigations of the 19
virulence, and more generally the biology, of Leptospira. 20
21
22
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
5
MATERIAL AND METHODS 1
2
Bacterial strains, culture conditions, and animal experiments. 3
Leptospira were cultivated in liquid Ellinghausen–McCullough–Johnson–Harris 4
(EMJH) medium (13, 14) or on 1% agar plates at 30 °C and counted in a Petroff–5
Hausser counting chamber (Fisher Scientific). The saprophyte Leptospira biflexa 6
serovar Patoc strain Patoc I and the pathogens L. interrogans serovar Copenhageni 7
strain Fiocruz L1-130 (16, 27) and L. interrogans serovar Lai strain Lai 56601 (30) 8
were used. E. coli was grown in Luria-Bertani (LB) medium. When appropriate, 9
spectinomycin or kanamycin was added to culture media at 50 µg ml-1. Leptospira 10
containing the inducible system were grown with 1 mM isopropyl-β-D-11
thiogalactopyranoside (IPTG). 12
For infection experiments, three-week-old hartley male guinea pigs (Charles River 13
Laboratories, http://www.criver.com) or hamsters were inoculated intraperitoneally 14
with 1 ml of various doses of L. interrogans as previously described (31). Protocols 15
for animal experiments were prepared according to the guidelines of the Animal Care 16
and Use Committees of the Institut Pasteur. 17
18
Plasmid construction 19
L. interrogans flgB and hsp10 promoters were amplified with FlgA/FlgC and 20
HspA/HspC primer pairs, respectively, and inserted into the PvuII restriction site of 21
the E. coli-L. biflexa shuttle vector pSLe94 (3) to generate plasmids pSLe94PF and 22
pSLe94PH, respectively. The gfpuv (10) and gfpmut (23) alleles were amplified with 23
flanking BglII and SmaI sites, using primers GfpC5 and GfpC3 (Table 1), from 24
plasmids pSRKgfp (15) and pTM61 (24), respectively. The amplified gfp alleles were 25
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
6
then digested with BglII and SmaI, purified, and inserted between the BamHI and 1
SmaI restriction sites of pSLe94PF and pSLe94PH to generate pFA1/pFA4 and 2
pFA2/pFA3, respectively. Similarly, the gene encoding the red fluorescent protein 3
mRFP1 was amplified with primers MC5 and MC3 (Table 1) from pRSETb-mRFP1 4
(7). The PCR products were purified, digested with BamHI and XhoI and inserted 5
between the corresponding sites in pSLe94PF and pSLe94PH to generate pFA5 and 6
pFA6 (Table 2). 7
To use a transposon delivery system, gfpuv and gfpmut were amplified from 8
plasmids pSRKgfp (15) and pTM61 (24), respectively, with primer pairs FA/GfpAsc 9
and FA/GABIS (Table 1). The PCR products were then purified, digested with AscI 10
and inserted into the AscI restriction site of the kanamycin-resistant transposon 11
carried by pMKL (31), to generate pFA7 and pFA8. 12
To construct an inducible system, the DNA fragment containing the B. burgdorferi 13
flaB promoter and the lacI repressor gene was amplified from pJSB104 (4) with 14
primers PFlaBF and LacIR and inserted into the PvuII restriction site of pSLe94. The 15
hsp10 promoter was amplified with primers HspA and HspB to introduce a lacO site 16
and a 6x His-tag, and inserted into pCR2.1 (Invitrogen) to generate pCR-Phsp/lacO. 17
The gfpmut sequence was then amplified by GfpC5 and GfpC3 and inserted into the 18
SmaI and BglII restriction sites of pCR-Phsp/lacO. The gfp allele under the control of 19
Phsp/lacO was then amplified, digested with SmaI, and ligated to SmaI-digested 20
pSLe94, thereby generating pGC1 (Table 2). Leptospira were electroporated with 21
plasmid constructs as previously described (32). 22
To test for the use of gfp as a reporter gene, the promoterless gfp was amplified from 23
plasmid pTM61 (24), using primers gfp1 and gfp2, digested with SmaI, then ligated 24
with AleI-digested pSW29TLe94Spc (29), resulting in the conjugative plasmid p-gfp. 25
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
7
The promoter regions of hsp20 (LEPBIa1849) and groES (LEPBIa2343) were 1
amplified from L. biflexa chromosomal DNA using primer pairs PLBa1849.1/ 2
PLBa1849.2b and PgroES1/ PgroES2b, respectively; then cloned between the AscI 3
and NheI sites of p-gfp. The plasmids were introduced in L. biflexa by conjugation as 4
previously described (29) resulting in strains Patoc HspG and Patoc GroG (Table 2). 5
6
Heat-shock assay. 7
Five ml cultures were grown under agitation at 30°C until early- to mid-exponential 8
phase (OD420 0.2-0.4). Half the culture was then transferred to 37°C under agitation 9
for 4 h. For fluorescence measurements, 1 ml of cells was harvested by 10
centrifugation at room temperature for 5 min at 5000 g, washed in PBS and 11
resuspended in 200 µl of the same buffer. 100 µl of each sample were aliquoted in 12
duplicate in 96-wells microplates and fluorescence was read as described below. 13
OD420 was then measured on the aliquots and used to normalize the fluorescence. 14
For RNA isolation and real-time RT-PCR assay, 1 ml of cells were added to 3 ml of 15
Trizol LS (Invitrogen) and RNA was purified according to the manufacturer’s 16
guidelines. Contaminating DNA was removed from RNA preparations using DNaseI 17
from Roche, and RNA was subsequently cleaned up using the RNeasy kit (Qiagen). 18
cDNA were synthesized with the iScript kit (Bio-Rad) and 1/10 of the reaction was 19
used for real-time RT-PCR assays with the SsoFast EvaGreen Supermix (Bio-Rad). 20
The PCR reaction mixture contained 300 nM of each primer in a total volume of 20 21
µl. The PCR reactions were performed and analyzed with a CFX96 Real-Time PCR 22
detection system (Bio-Rad). Ultimately, the amount of cDNA of interest measured in 23
each PCR assay was normalized to the amount of rpoB cDNA. 24
25
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
8
Immunoblot analysis. 1
Leptospira carrying the GFP inducible expression system were cultivated in the 2
presence of spectinomycin until the cell density reached 107 bacteria ml-1. IPTG was 3
then added to a concentration of 1 mM and the culture was incubated for one week 4
at 30°C. Approximately 109 spirochetes (one ml) were collected and processed for 5
sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins 6
were then transferred to nitrocellulose membranes and probed with anti-6x histidine-7
tag antibody (mouse IgG, Clonetech, USA). Alkaline phosphatase-conjugated anti-8
mouse IgG and the BCIP/NBT solution substrate (Uptima, France) were used to 9
detect the bound primary antibodies. 10
11
Fluorometric microplate reader-based assay 12
Cells were washed in PBS and the optical densities of the suspensions at 600 nm 13
were adjusted to 0.3 before fluorescence measurements were taken. The 14
measurements were performed on a microplate reader Mithras LB940 (Berthold 15
Technologies, Bad Wildbad, Germany). The excitation and emission wavelengths 16
used were 485 nm and 535 nm. The intensity of fluorescence is expressed in relative 17
values (arbitrary units) obtained at emission maxima. Wild-type cells were used as 18
controls to determine background fluorescence. All spectrofluorometer experiments 19
were performed at least twice independently. 20
21
Fluorescence microscopy 22
The cultures were spun down and the resulting pellets were washed with 1x PBS to 23
remove the culture medium. The pellets were resuspended in 1x PBS at an 24
appropriate cell density. Aliquots of 10 µl of the bacterial suspensions were applied to 25
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
9
poly-L-Lysine slides. Images of Leptospira were acquired using an Axioplan 2 1
Imaging microscope (Carl Zeiss) equipped with a Plan-Apochromat x63 NA-1.4 oil 2
objective and the AxioVision software (version 4.6). The GFP and mRFP1 filter sets 3
used were FS 44 (excitation: 455-495 nm, Emission: 505-555 nm) / FS09 4
(Excitation:BP 450-490, Emission: 515 nm) from Zeiss and XF 43 (Excitation: 563-5
587nm, Emission: 615-645 nm) from Omega Optical. 6
7
8
9
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
10
RESULTS 1
2
Fluorescence in both saprophytic and pathogenic Leptospira species 3
We chose the E. coli-L. biflexa spectinomycin-resistant plasmid pSLe94 (5) as the 4
backbone for our system. The genes encoding GFPuv (10), a GFP variant optimised 5
for excitation by ultraviolet light, GFPmut (23), a GFP variant previously used in the 6
spirochete Borrelia burgdorferi (12, 24), and mRFP1 (7), a red fluorescent protein, 7
were amplified by PCR and inserted into plasmid constructs carrying the flgB 8
(flagellar basal body rod protein FlgB, LA0347) and hsp10 (GroES protein, LA2654) 9
promoters from L. interrogans. The result was a set of plasmid vectors containing 10
either gfp or mRFP1 under the control of the L. interrogans flgB and hsp10 promoters 11
(Figure 1). These plasmids were then introduced into the saprophyte L. biflexa and 12
expression of fluorescent proteins in transformants was evaluated by epifluorescence 13
microscopy (Figure 2). All plasmid constructs proved to be functional in L. biflexa, 14
such that it was possible to visualise transformants by fluorescence microscopy. In 15
contrast, no fluorescent cells could be seen under the fluorescence microscope in the 16
untransformed recipient wild-type L. biflexa, indicating that background fluorescence 17
is insignificant. The strongest GFP fluorescence was from the gfpmut gene 18
constructs. Transformants expressing the gfpuv allele presented weaker 19
fluorescence as assessed both with the appropriate filter (excitation: 450-490 nm/ 20
emission: 515 nm) and with the FITC filter (excitation: 455-495 nm, Emission: 505-21
555 nm). Subsurface colonies on solid medium of L. biflexa transformed with gfp 22
variants were not fluorescent under UV light, whereas E. coli colonies harboring the 23
same plasmids were highly fluorescent (data not shown). Finally, the fluorescence of 24
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
11
L. biflexa transformants expressing mRFP1 was detectable by epifluorescence 1
microscopy (data not shown). 2
As there is no replicative plasmid vector available for pathogenic Leptospira, 3
exogenous genes can only be introduced with a transposon delivery system. The two 4
gfp variants were amplified from the replicative plasmids and inserted into the Himar1 5
transposon carrying a kanamycin-resistance gene (Figure 1). The constructs were 6
transferred into L. biflexa: the transposition frequency in cells that received the 7
suicide delivery vector was satisfactory and the transformants were fluorescent (data 8
not shown). Next, we tested transformation of pathogenic L. interrogans strains with 9
the Himar1 constructs. From three transformation experiments, only eight pFA8 10
transformants (gfpuv+) were obtained with the Lai strain and one pFA7 transformant 11
(gfpmut+) with each of the Lai and Fiocruz L1-130 strains. The transposon insertion 12
site of each transformant was identified (Table 2). The gfpuv and gfpmut genes were 13
efficiently expressed in L. interrogans transformants as assessed both by 14
fluorescence microscopy and with a fluorometric plate reader (Figures 2 and 3). The 15
L. interrogans cells containing gfpmut, strain TKG1, were brightly fluorescent; the 16
fluorescence of Lai TKG1 was stronger than that in Fiocruz TKG1, and even than 17
that of Patoc TKG1 (Figure 3). We determined the fluorescence of tenfold serial 18
dilutions of a suspension of GFPmut-transformed L. interrogans. The fluorescence of 19
Lai TKG1 was 18123, 2221, and 815 AU at a cell density of 108, 107, and 106 20
Leptospira in a volume of 100 µl, respectively. However, the fluorescence was 506 21
AU at a cell density of 105 Leptospira /100 µl, which is not substantially higher than 22
the background fluorescence of untransformed L. interrogans (184 to 250 AU 23
irrespective of cell density; data not shown). 24
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
12
We tested whether the growth of GFP-expressing Leptospira was impaired by the 1
presence of the plasmid/transposon. We first assessed the growth of the transformed 2
and parental control strains of L. interrogans in EMJH liquid medium. Under the 3
experimental conditions used in this study, expression of the GFP gene had no 4
significant effect on the growth rate of the transformants in liquid media (data not 5
shown). We then compared the virulence of the GFP-transformed strains with that of 6
the wild-type strains in animals using the guinea pig model of leptospirosis. There 7
was no difference in 50% lethal dose (LD50) values between gfp-transformed and 8
parental strains: <102 Leptospira for the Fiocruz strain and 108 for the Lai strain (data 9
not shown). Similar disease symptoms developed in animals infected with the GFP-10
transformed and parental strains and immunohistochemistry detected similar high 11
numbers of bacteria in both liver and kidney (data not shown). However, direct 12
observation of frozen sections by fluorescence microscopy did not allow the 13
identification of fluorescent bacteria in tissues of infected animals. In conclusion, no 14
significant differences in growth or virulence were observed between the GFP-15
transformed and wild-type L. interrogans strains, suggesting that the expression of 16
the gfp gene had no significant effects on growth in vivo and pathogenicity. 17
18
Use of GFP as a reporter gene 19
We used lacI Bb to construct an inducible expression system for L. biflexa; lacI Bb is 20
codon optimised to enhance the production of LacI in the spirochete B. burgdorferi 21
(4). We amplified the sequence and inserted it into the E. coli-L. biflexa shuttle 22
vector. A LacI-binding site (operator or lacO) was also introduced into the hsp10 23
promoter that controls gfp expression, between the -35 -10 regions and the Shine-24
Dalgarno sequence (Figure 4). The resulting plasmid pGC1 was then introduced into 25
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
13
L. biflexa and the fluorescence was measured after various times of growth in the 1
presence of 0, 1, and 10 mM IPTG. Fluorescence was only detected in cultures to 2
which IPTG had been added. There was no significant difference in fluorescence 3
between cultures induced with 1 and 10 mM IPTG, and therefore 1 mM IPTG was 4
used for subsequent studies. We used western blotting to study GFP protein in IPTG-5
induced and non-induced cultures of transformed and untransformed L. biflexa 6
(Figure 4B). Aliquots of both induced and non-induced cultures were collected 0, 1, 7
3, 6, 9, 12 and 24 hours, and one week post-induction (p.i.). The maximum of 8
fluorescence in induced cultures was attained after one hour of induction, and did not 9
change during the following days, except one week post-induction where 10
fluorescence declined. Nevertheless, the fluorescence measured one week p.i. was 11
still more than 3-fold higher (average 22,579 AU) than that in non-induced samples 12
after one week (average 7,301 AU) (Figure 4C). Fluorescence in the non-induced 13
culture was higher than that in non-transformed culture, indicating leakage of the 14
repression of protein production (Figure 4C). In the L. biflexa transformants, GFP 15
expression driven by the LacI repressor-based system was not strong enough for the 16
GFP to be visualized by epifluorescence microscopy (data not shown). 17
We then constructed reporters to explore the response of specific genes to a change 18
in the environment. The hsp20 and groES genes encode heat stress proteins that 19
have recently been shown to be at least 1.5-fold up-regulated after a temperature 20
upshift from 30°C to 37° in L. interrogans (19). We examined the response of hsp20-21
gfp and groES-gfp transcriptional fusions to an increase in temperature in the 22
saprophytic strain L. biflexa. GFP expression from the hsp20 and groES promoters 23
was induced 2.6- and 1.3-fold, respectively, in cells grown at 37°C compared to cells 24
grown at 30°C (Figure 5A). The higher expression levels at 37°C were correlated to 25
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
14
an increase in transcript levels corresponding to the gfp gene, as well as to the 1
specific hsp20 and groES genes, as measured by real-time RT-PCR assays (Figure 2
5B). 3
4
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
15
DISCUSSION 1
The lack of genetic tools has hampered molecular analyses of Leptospira spp. In a 2
recent study, the luxCDABE cassette from Photorhabdus luminescens was 3
transferred into Leptospira spp. to generate luminescent bacteria (26). In this work, 4
we constructed a set of plasmid vectors which contain either gfp or mRFP1 alleles. 5
These plasmids confer spectinomycin resistance and have the LE1 origin of 6
replication, so they can be stably maintained in L. biflexa (5). Moreover, the Himar1 7
transposon we used can deliver gfp to a large number of Leptospira strains, including 8
pathogenic strains. The inclusion of a gfp gene within the transposon generated 9
fluorescent Leptospira, and thereby provided an additional method for screening 10
mutants. More importantly, the fluorescence phenotype permits the in vitro, but not in 11
vivo, observation of live mutants that retain full virulence. 12
GFP fluorescence in Leptospira spp. transformed with our plasmid constructs was 13
lower than that in E. coli probably due to weaker expression of the gfp gene. This 14
could be because in E. coli the gfp gene is present on a multicopy vector, whereas in 15
our Leptospira strains it was present at only one copy per chromosome. In addition, 16
the alleles we used were optimized for E. coli. To improve the translation efficiency, 17
nucleotides could be altered to preferred codons for L. interrogans. Mutations in the 18
gfp open reading frame may also improve the folding and the stability in Leptospira. 19
The use of other strong promoters and/or multiple gfp genes may also allow stronger 20
fluorescence intensity. Finally, the use of microscopy methods other than 21
conventional epifluorescence may improve the visualization of fluorescent Leptospira 22
(28). 23
GFP production did not affect the growth of pathogenic Leptospira either in liquid 24
media or in animals. After passages in vivo, the strains retained the gfp gene and 25
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
16
continued to exhibit uniform green fluorescence (data not shown). However, GFP 1
expression in Leptospira was not sufficiently strong for the fluorescence to be visible 2
in animal tissues. However, the use of fluorescent bacteria may facilitate the study of 3
interactions between Leptospira and cell monolayers. Indeed, several studies have 4
shown that Leptospira express surface proteins that interact with the extracellular 5
matrix (1, 8, 22, 34) and L. interrogans is an invasive pathogen that can rapidly 6
translocate through the host cell (2). 7
We also showed that the lac system is functional in Leptospira and can be used to 8
control the expression of gfp in this bacterium. The LacI repressor-based system can 9
be simply regulated by the use of IPTG. This inducible expression system could 10
therefore be a very useful tool to construct conditional mutants and to elucidate in 11
more detail the role of essential genes in Leptospira spp. Finally, although the GFP 12
fluorescence signal intensity was too low for characterization of the infection and 13
colonization process in animal models, gfp can be used as a reporter for specific 14
gene expression in Leptospira spp. The construction of transcriptional fusions of 15
leptospiral promoters with gfp is a potentially powerful approach to the analysis of 16
gene expression patterns under various in vitro conditions. For example, temperature 17
and osmolarity are major environmental signals that can affect gene expression in 18
Leptospira (18, 20). We showed that hsp20 and groES transcription levels are 19
increased by a temperature shift from 30°C to 37°C. 20
Further development of genetic tools in Leptospira should provide major informations 21
about the roles of key components in the pathogenesis of leptospirosis. 22
23
ACKNOWLEDGEMENTS 24
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
17
We would like to thank Dr. George Chaconas for kindly providing the gfpmut 1
allele and Emmanuelle Perret (Plate-forme d’Imagerie Dynamique-Imagopole, Institut 2
Pasteur) and Angélique Levoye for fluorescence studies. Albert Ko’s group is 3
thanked for animal experiments. GMC was supported by CAPES foundation, 4
Brazilian ministry of education, Brazil. This work was supported by the Institut 5
Pasteur, Paris, France; the French Ministry of Research ANR-08-MIE-018 and the 6
Fiocruz-Pasteur Scientific Cooperation Agreement. 7
8
9
REFERENCES 10
11
12
1. Barbosa, A. S., P. A. Abreu, F. O. Neves, M. V. Atzingen, M. M. Watanabe, 13
M. L. Vieira, Z. M. Morais, S. A. Vasconcellos, and A. L. Nascimento. 14
2006. A newly identified leptospiral adhesin mediates attachment to laminin. 15
Infect. Immun. 74:6356-6364. 16
2. Barocchi, M. A., A. I. Ko, M. G. Reis, K. L. McDonald, and L. W. Riley. 17
2002. Rapid translocation of polarized MDCK cell monolayers by Leptospira 18
interrogans, an invasive but nonintracellular pathogen. Infect. Immun. 19
70:6926-6932. 20
3. Bauby, H., I. Saint Girons, and M. Picardeau. 2003. Construction and 21
complementation of the first auxotrophic mutant in the spirochaete Leptospira 22
meyeri. Microbiology 149:689-693. 23
4. Blevins, J. S., A. T. Revel, A. H. Smith, G. N. Bachlani, and M. V. Norgard. 24
2007. Adaptation of a luciferase gene reporter and lac expression system to 25
Borrelia burgdorferi. Appl. Environ. Microbiol. 73:1501-1513. 26
5. Bourhy, P., L. Frangeul, E. Couve, P. Glaser, I. Saint Girons, and M. 27
Picardeau. 2005. Complete nucleotide sequence of the LE1 prophage from 28
the spirochete Leptospira biflexa and characterization of its replication and 29
partition functions. J. Bacteriol. 187:3931-3940. 30
6. Bourhy, P., H. Louvel, I. Saint Girons, and M. Picardeau. 2005. Random 31
insertional mutagenesis of Leptospira interrogans, the agent of leptospirosis, 32
using a mariner transposon. J. Bacteriol. 187:3255-3258. 33
7. Campbell, R. E., O. Tour, A. E. Palmer, P. A. Steinbach, G. S. Baird, D. A. 34
Zacharias, and R. Y. Tsien. 2002. A monomeric red fluorescent protein. Proc. 35
Natl. Acad. Sci. USA 99:7877-7882. 36
8. Choy, H. A., M. M. Kelley, T. L. Chen, A. K. Møller, J. Matsunaga, and D. 37
A. Haake. 2007. Physiological osmotic induction of Leptospira interrogans 38
adhesion: LigA and LigB bind extracellular matrix proteins and fibrinogen. 39
Infect. Immun. 75:2441-2450. 40
9. Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996. FACS-optimized 41
mutants of the green fluorescent protein (GFP). Gene 173:33-38. 42
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
18
10. Crameri, A., E. A. Whitehorn, E. Tate, and W. P. Stemmer. 1996. Improved 1
green fluorescent protein by molecular evolution using DNA shuffling. Nat. 2
Biotechnol. 14:315-319. 3
11. Croda, J., C. P. Figueira, E. A. J. Wunder, C. S. Santos, M. G. Reis, A. I. 4
Ko, and M. Picardeau. 2008. Targeted mutagenesis in pathogenic 5
Leptospira: Disruption of the ligB gene does not affect virulence in animal 6
models of leptospirosis. Infect. Immun. 76:5826-5833. 7
12. Eggers, C. H., M. J. Caimano, M. L. Clawson, W. G. Miller, D. S. Samuels, 8
and J. D. Radolf. 2002. Identification of loci critical for replication and 9
compatibility of a Borrelia burgdorferi cp32-based shuttle vector for the 10
expression of fluorescent reporters in the Lyme disease spirochete. Mol. 11
Microbiol. 43:281–295. 12
13. Ellinghausen, H. C., and W. G. McCullough. 1965. Nutrition of Leptospira 13
pomona and growth of 13 other serotypes: fractionation of oleic albumin 14
complex and a medium of bovine albumin and polysorbate 80. Am. J. Vet. 15
Res. 26:45-51. 16
14. Johnson, R. C., and V. G. Harris. 1967. Differentiation of pathogenic and 17
saprophytic leptospires. J. Bacteriol. 94:27-31. 18
15. Knoppová, M., M. Phensaijai, M. Veselý, M. Zemanová, J. Nesvera, and M. 19
Pátek. 2007. Plasmid vectors for testing in vivo promoter activities in 20
Corynebacterium glutamicum and Rhodococcus erythropolis. Curr. Microbiol. 21
55:234-239. 22
16. Ko, A. I., M. Galvao Reis, C. M. Ribeiro Dourado, W. D. Johnson, Jr., and 23
L. W. Riley. 1999. Urban epidemic of severe leptospirosis in Brazil. Salvador 24
Leptospirosis Study Group. Lancet 354:820-825. 25
17. Levett, P. N. 2001. Leptospirosis. Clin. Microbiol. Rev. 14:296-326. 26
18. Lo, M., D. M. Bulach, D. R. Powell, D. A. Haake, J. Matsunaga, M. L. 27
Paustian, R. L. Zuerner, and B. Adler. 2006. Effects of temperature on gene 28
expression patterns in Leptospira interrogans serovar Lai as assessed by 29
whole-genome microarrays. Infect. Immun. 74:848-859. 30
19. Lo, M., S. J. Cordwell, D. M. Bulach, and B. Adler. 2009. Comparative 31
transcriptional and translational analysis of leptospiral outer membrane protein 32
expression in response to temperature. PLoS Negl. Trop. Dis. 3:e560. 33
20. Matsunaga, J., M. Lo, D. M. Bulach, R. L. Zuerner, B. Adler, and D. A. 34
Haake. 2007. Response of Leptospira interrogans to physiologic osmolarity: 35
relevance in signaling the environment-to-host transition. Infect. Immun. 36
75:2864-2874. 37
21. McBride, A. J., D. A. Athanazio, M. G. Reis, and A. I. Ko. 2005. 38
Leptospirosis. Curr. Opin. Infect. Dis. 18:376-386. 39
22. Merien, F., J. Truccolo, G. Baranton, and P. Perolat. 2000. Identification of 40
a 36-kDa fibronectin-binding protein expressed by a virulent variant of 41
Leptospira interrogans serovar icterohaemorrhagiae. FEMS Microbiol. Lett. 42
185:17-22. 43
23. Miller, W. G., and S. E. Lindow. 1997. An improved GFP cloning cassette 44
designed for prokaryotic transcriptional fusions. Gene 191:149-153. 45
24. Moriarty, T. J., M. U. Norman, P. Colarusso, T. Bankhead, P. Kubes, and 46
G. Chaconas. 2008. Real- time high resolution 3D imaging of the Lyme 47
disease spirochete adhering to and escaping from the vasculature of a living 48
host. PLoS Pathog. 4: e1000090 49
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
19
25. Murray, G. L., K. M. Ellis, M. Lo, and B. Adler. 2008. Leptospira interrogans 1
requires a functional heme oxygenase to scavenge iron from hemoglobin. 2
Microbes Infect. 10:791-797. 3
26. Murray, G. L., A. M. King, A. Srikram, R. W. Sermswan, and B. Adler. 4
2010. Use of luminescent Leptospira interrogans for enumeration in biological 5
assays. J. Clin. Microbiol. 48:2037-2042. 6
27. Nascimento, A. L., A. I. Ko, E. A. Martins, C. B. Monteiro-Vitorello, P. L. 7
Ho, D. A. Haake, S. Verjovski-Almeida, R. A. Hartskeerl, M. V. Marques, 8
M. C. Oliveira, C. F. Menck, L. C. Leite, H. Carrer, L. L. Coutinho, W. M. 9
Degrave, O. A. Dellagostin, H. El-Dorry, E. S. Ferro, M. I. Ferro, L. R. 10
Furlan, M. Gamberini, E. A. Giglioti, A. Goes-Neto, G. H. Goldman, M. H. 11
Goldman, R. Harakava, S. M. Jeronimo, I. L. Junqueira-de-Azevedo, E. T. 12
Kimura, E. E. Kuramae, E. G. Lemos, M. V. Lemos, C. L. Marino, L. R. 13
Nunes, R. C. de Oliveira, G. G. Pereira, M. S. Reis, A. Schriefer, W. J. 14
Siqueira, P. Sommer, S. M. Tsai, A. J. Simpson, J. A. Ferro, L. E. 15
Camargo, J. P. Kitajima, J. C. Setubal, and M. A. Van Sluys. 2004. 16
Comparative genomics of two Leptospira interrogans serovars reveals novel 17
insights into physiology and pathogenesis. J. Bacteriol. 186:2164-2172. 18
28. Norman, M. U., T. J. Moriarty, A. R. Dresser, B. Millen, P. Kubes, and G. 19
Chaconas. 2008. Molecular mechanisms involved in vascular interactions of 20
the Lyme disease pathogen in a living host. PLoS Pathog. 4:e1000169. 21
29. Picardeau, M. 2008. Conjugative transfer between Escherichia coli and 22
Leptospira spp. as a new genetic tool. Appl. Environ. Microbiol. 74:319-322. 23
30. Ren, S., G. Fu, X. Jiang, R. Zeng, H. Xiong, G. Lu, H. Q. Jiang, Y. Miao, H. 24
Xu, Y. Zhang, X. Guo, Y. Shen, B. Q. Qiang, X. Q., A. Danchin, I. Saint 25
Girons, R. L. Somerville, Y. M. Weng, M. Shi, Z. Chen, J. G. Xu, and G. P. 26
Zhao. 2003. Unique and physiological and pathogenic features of Leptospira 27
interrogans revealed by whole genome sequencing. Nature 422:888-893. 28
31. Ristow, P., P. Bourhy, F. W. da Cruz McBride, C. P. Figueira, M. Huerre, 29
P. Ave, I. S. Girons, A. I. Ko, and M. Picardeau. 2007. The OmpA-like 30
protein Loa22 is essential for leptospiral virulence. PLoS Pathog. 3:e97. 31
32. Saint Girons, I., P. Bourhy, C. Ottone, M. Picardeau, D. Yelton, R. W. 32
Hendrix, P. Glaser, and N. Charon. 2000. The LE1 bacteriophage replicates 33
as a plasmid within Leptospira biflexa: construction of an L. biflexa-34
Escherichia coli shuttle vector. J. Bacteriol. 182:5700-5705. 35
33. Shaner, N. C., P. A. Steinbach, and R. Y. Tsien. 2005. A guide to choosing 36
fluorescent proteins. Nat .Methods. 2:905-909. 37
34. Stevenson, B., H. A. Choy, M. Pinne, M. L. Rotondi, M. C. Miller, E. 38
Demoll, P. Kraiczy, A. E. Cooley, T. P. Creamer, M. A. Suchard, C. A. 39
Brissette, A. Verma, and D. A. Haake. 2007. Leptospira interrogans 40
endostatin-like outer membrane proteins bind host fibronectin, laminin and 41
regulators of complement. PLoS ONE 2:e1188. 42
43
44
45
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
20
Table 1: Primers used in the study. 1
2
primers Sequence 5’-3’ a comments
HspA GAATTCTCTAAAAGTATGAATTCCTAC L. interrogans hsp10 promoter
HspC CTCGAGCCCGGGGGATCCGTGATGGTGATGGTGATGAATCGATGCCATAG
L. interrogans hsp10 promoter
HspB CTCGAGCGCGGATCCGTGATGGTGATGGTGATGTGCCATAGACTGACTCCTTAA
L. interrogans hsp10 promoter + lacO
FlgA GTAATCTTTTAAATTTAGCACTTC L. interrogans flgB promoter FlgC CTCGAGCCCGGGGGATCCGTGATGGTGATGGTGATGTTTCTC
AAACATTA L. interrogans flgB promoter
FA TTGGCGCGCCTGACTAATTGTACAGC L. interrogans flgB promoter GAbis TTGGCGCGCCTTATTATTTGTAGAGCTC gfpuv MC5 GCGGGATCCGTCATCAAGGAGTTCATG mRFP1 MC3 CCGCCTCGAGATTGCTCAGCGGTGGC mRFP1 BG5 GGAAGATCTAAAGGAGAAGAACTTTTCAC gfpuv BG3 TCCCCCGGGTTATTATTTGTAGAGCTCATCC gfpuv GFPasc TTTGGCGCGCCCTAGGATCTATTTGTATAGTTC gfpmut GfpC5 GTCGACGAGCTCGAGATGGATCCAAAAGGAGAAGAACTTTTCA
C gfpmut
GfpC3 GTACCTCAGATCTATTTGTATAG gfpmut gfp1 TCCCCCGGGGGCGCGCCTACGTAGCTAGCGCATGCAGTAAAG
GAGAAGAACTTTTCACTGG
gfpmut
gfp2 GAGGATCCCCGGGTACCTCAG gfpmut PFlaBF GGGCAGCTGAAGCTTGAAGATAGAG B. burgdorferi flaB promoter LacIR GGGCAGCTGTCCCCCGGGTTACTGGCCGCTTTC Bb lacI PLBa1849.1 AGGCGCGCCTGTTTTACGAAGTTTTCCTC L. biflexa hsp20 promoter PLBa1849.2b CTAGCTAGCCATGCAAAATCTCCTTTTGGCAC L. biflexa hsp20 promoter PgroES1 AGGCGCGCCAAAAACCCCCTCGCCAG L. biflexa groES promoter PgroES2b CTAGCTAGCCATGAGTGACTCCTTGTATGCATTC L. biflexa groES promoter a restriction sites incorporated in the primers are underlined 3
4
5
Table 2: Leptospira strains used in this study 6
7
strains Description/ genotype L. biflexa strains:
serovar Patoc strain Patoc1 wild-type strain (wt) Patoc SFGu wt transformed with pFA1; Spc
R, PflgBgfpuv
Patoc SHGu wt transformed with pFA2; SpcR, Phsp10gfpuv
Patoc SFG wt transformed with pFA3; SpcR, Phsp10gfpmut
Patoc SHG wt transformed with pFA4; SpcR, PflgBgfpmut
Patoc SFR wt transformed with pFA5; SpcR, PflgBmRFP1
Patoc SHR wt transformed with pFA6; SpcR, Phsp10mRFP1
Patoc TKG1 wt transformed with pFA7; KmR, PflgBgfpmut (Tn insertion at
position 3437784, between LEPBIa3326 and LEPBIa3327, of the large chromosome)
Patoc SLHGlacI wt transformed with pGC1; SpcR, PBbflaBBblacI, Phsp10/lacOgfpmut
Patoc HspG wt transformed with pLS1; SpcR , Phsp20-gfpmut
Patoc GroG wt transformed with pLS2; SpcR , PgroES-gfpmut
L. interrogans strains: serovar Copenhageni strain Fiocruz L1-130 wt Fiocruz TKG1 wt transformed with pFA7; Km
R, PflgBgfpmut (Tn insertion at
position 3406309, between LIC12799 and LIC12800, of the large chromosome)
serovar Lai strain Lai 56601 wt Lai TKG1 wt transformed with pFA7; Km
R, PflgBgfpmut (Tn insertion at
position 70520, into LA0064, of the large chromosome ) Lai TKGu3 wt transformed with pFA8; Km
R, PflgBgfpuv (Tn insertion at
position 3226542, into LA3258, of the large chromosome)
8
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
21
FIGURE LEGENDS 1
2
Figure 1: Schematic diagram of plasmid constructs used to express constitutively 3
GFP and mRFP1. The determinants for replication in L. biflexa (parAB and rep), as 4
well as a spectinomycin (SpcR)- and kanamycin (KmR) resistance cassettes are 5
indicated 6
7
Figure 2: Micrographs of GFP-expressing Leptospira strains visualized on slides by 8
fluorescence microscopy. A: GFPmut-expressing L. biflexa, B : GFPmut-expressing 9
L. interrogans strain Lai, C : GFPmut-expressing L. interrogans strain Fiocruz. 10
11
Figure 3: Spectrofluorometric analysis of fluorescence from Leptospira 12
transformants. 13
Data are the means of two independent experiments with bars indicating the range. 14
The fluorescence intensity (y-axis) was quantified in 100-µl aliquots of cell 15
suspension containing 5x108 bacteria. 16
17
Figure 4: Induction of fluorescence in a lac-inducible expression system. 18
Cultures of Patoc SLHGlacI were untreated (0 mM IPTG) or induced with 1 mM 19
IPTG. Samples were collected at the times indicated (h), and fluorescence assays 20
were performed. GFP fluorescence (OD) from triplicate samples of each culture was 21
standardized according to a cell density of 5 x 108 spirochaetes; results are 22
presented as the mean OD/ 1 x 108 bacteria ± standard deviation. 23
A: Schematic representation of the relevant regions and restriction sites of the L. 24
biflexa shuttle plasmid used in this study. B: Western blot analysis of GFP using anti-25
6x His monoclonal antibodies. Cultures of L. biflexa and Patoc SLHGlacI were 26
untreated or induced with 1 mM IPTG. Cells were collected one week postinduction. 27
Total protein extracted from 1 x 108 spirochaetes was loaded in each gel lane. 28
Molecular masses (kDa) are indicated on the left. C: Kinetics of green fluorescence 29
production from the lac repressor/operator expression construct. 30
31
Figure 5 : Heat-shock stimulates transcription of hsp20 and groES in L. biflexa. 32
Cells were grown at 30°C and half the culture was transferred at 37°C for 4h, before 33
harvesting the cells for fluorescence measurement and RNA isolation. The results 34
are from one representative experiment and are the means of technical duplicates. 35
The error bars represent the standard deviations. 36
A. Measured fluorescence relative to the OD420 of the culture, in arbitrary 37
fluorescence units (AU), at 30°C and 37°C. The white bars represent the 38
fluorescence at 30°C, whereas the black bars represent the fluorescence at 37°C. 39
Phsp20-gfp, Patoc HspG; PgroES-gfp, Patoc GroG. B. Levels of induction of the hsp20 40
and groES promoters after heat-shock, in strain Patoc HspG (light grey bars) and 41
Patoc GroG (dark grey bars), respectively. The target transcript for real-time RT-PCR 42
is indicated below each bar. The transcripts levels were normalized to the amount of 43
rpoB transcripts in the cells. The dashed line indicates a ratio of one. 44
45
46
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
Figure 1
SmaI
BamHI/BglIIBamHI/BglII
SmaI
PfglB
gfpuv
rep
parB
parA
SpcRpSLFgfpuv
6660 bp
pFA1
SmaI
BamH1/BglIIBamH1/BglII
SmaI
Phsp10
gfpuv
rep
parB
parA
SpcR pSLHgfpuv
6560 bp
pFA2
SmaI
BamH1/BglIIBamH1/BglII
SmaI
Phsp10
gfpb
rep
parB
parA
SpcR pSLHgfp
6561 bp
pFA3
SmaI
BamHI/BglIIBamHI/BglII
SmaI
PfglB
gfpb
rep
parB
parA
SpcRpSLFgfp
6661 bp
pFA4
XhoI
BamH1BamH1
XhoI
PflgB
mRFP1
rep
parB
parA
SpcRpSLFmRFP1
6667 bp
pFA5
XhoI
BamH1BamH1
XhoI
Phsp10
mRFP1
rep
parB
parA
SpcRpSLHmRFP1
6507 bp
pFA6
AscI
AscI
C9
SpcRPflgB
gfpuv
KmR
pSTKFgfpuv
8571 bp
pFA8
AscI
AscI
C9
SpcRPflgB
gfpb
KmR
pSTKFgfp
8575 bp
pFA7
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
A
B
… gcttgacgctttcttagctattttttttaatgaaaAactatataagcactc
tcacgaataaattgtgagcgctcacaattttaaggagtcagtctATG …
-35 -10
lacO SD
C
Arb
itra
ry U
nit
Figure 4
on May 14, 2019 by guest
http://aem.asm
.org/D
ownloaded from
