evolution of body size in bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · evolution...

38
Evolution of Body Size in Bears How to Build and Use a Phylogeny

Upload: others

Post on 14-Jul-2020

2 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Evolution of Body Size in Bears

How to Build and Use a Phylogeny

Page 2: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Lesson I

Building a Phylogeny

Page 3: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Objectives for Lesson I: 1.Overview of concepts 1.Observe TA complete a simple walk through for creating a phylogeny. 1.Complete a handout giving specific instructions on how to create a phylogeny. **Students will use the following example: • Reconstrucing phylogenetic position of the extinct dodo and solitaire, based

on Shapiro et al. (2002) Science

Page 4: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

What is a phylogenetic tree?

• A history of evolution • Often uses characteristics of modern taxa to reconstruct

evolutionary history • Depicts the evolutionary relationships between organisms.

Page 5: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

How do we make them?

Morphology: •Winged/wingless •Number of limbs •Type of lung

Genetic: •Mitochondrial:

Evolves rapidly Matrilinear inheritance No recombination

•Nuclear: Evolves more slowly Sexual reproduction Recombination

•RNA •Neutral vs. coding

Phylogenies are built using characters. Commonly used characters include:

Page 6: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

How do we make them?

More about characters: • A character that has evolved to a different state is an

apomorphy • An apomorphy found in multiple taxa is a

synapomorphy •may be homologous – inherited from a common ancestor •or may be analogous – evolved twice or more by convergent evolution

• Taxa are grouped by synapomorphic characters

Page 7: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

One method...

Parsimony: the relationship requiring the fewest evolutionary changes is most likely to be correct

Page 8: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Construct data matrix of apomorphies:

Shark Lizard Dog Whale

Dorsal fin 1 0 0 1

Pectoral girdle 0 1 1 1

Lungs 0 1 1 1

Milk 0 0 1 1

Page 9: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Shark Lizard Dog Whale

Shark - 0 0 1

Lizard - - 2 2

Dog - - - 3

Whale - - - -

Count synapomorphies between each taxon:

Page 10: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Shark

Lizard

Dog

Whale

Find the tree requiring the fewest evolutionary changes:

Dorsal fin

Lungs

Milk

Pectoral girdle

Dorsal fin

Page 11: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Other methods...

When we have a lot of taxa and characters, the number

of potential trees soon reaches millions.

Statistical methods are useful in these cases:

Maximum likelihood: uses an algorithm to evaluate all possible trees and find the one that best explains the observed relationships

Incorporates models of how DNA evolves

Page 12: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Other methods...

Other statistical methods include: •Distance: calculate the amount of evolutionary change between each pair of taxa and then find the tree that best predicts that pattern. •Bayesian inference: uses probability theory: how probable is each possible tree, considering:

•Observed data •Models of evolutionary process •Prior beliefs

Page 13: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Terms:

• Species B and C are sister taxa

• Species E is an outgroup to ABCD

• Node Y is the ancestor to A, B & C

Node Y

Page 14: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Copyright 2008 Nature Education

Reading a Phylogenetic Tree

Page 15: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Reference for relationships of all organisms can be found at Tree of Life Web Project.

Tolweb.org

Page 16: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Building a bear phylogeny:

Page 17: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

http://www.ncbi.nlm.nih.gov/genbank/

http://www.ebi.ac.uk/ena/

Genetic Databases:

Page 18: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Ailuropoda melanoleuca (Giant Panda) complete cytochrome b sequence FM177761.1 TGATCAACATCCGAAAAACTCATCCATTAGTTAAAATTATCAACAACTCATTCATTGACCTTCCAACACCATCAAACATTTCAACATGATGGAACTTTGGGTCCCTGTTAGGAGTGTGTCTGATCTTGCAAATCTTAACAGGCTTATTTCTAGCCATACACTATACATCAGATACAGCTACAGCCTTTTCATCAGTCGCACACATTTGTCGAGACGTCAACTATGGTTGATTTATCCGATATATACATGCCAATGGGGCCTCTATATTTTTTATCTGCCTATTTATACACGTAGGGCGAGGCTTATACTATGGATCATACCTATTTCCAGAGACATGGAATATCGGAATTATTCTCCTACTTACAGTTATAGCCACAGCATTCATAGGATATGTACTACCTTGAGGACAAATATCCTTCTGAGGAGCAACCGTCATTACTAACCTACTATCAGCAATTCCTTACATTGGCACTAATCTAGTGGAGTGAATCTGAGGGGGTTTCTCCGTAGATAAAGCAACACTAACCCGATTTTTTGCTTTTCACTTTATCCTTCCATTTATCATCTCAGCACTAGCAATAGTCCATCTATTATTCCTTCACGAAACAGGATCTAATAACCCCTCCGGAATTCCATCTGACCCAGACAAAATCCCATTTTACCCCTATCATACAATTAAAGACATCCTAGGCGTCCTATTTCTTGTCCTCGCCTTAATAACCCTGGCTTTATTCTCACCAGACCTGTTAGGAGACCCTGATAACTATACCCCTGCAAATCCACTAAGTACCCCGCCACATATTAAGCCTGAATGGTACTTTCTATTTGCCTACGCTATCCTGCGATCTATCCCTAATAAACTAGGAGGGGTGCTAGCTCTAATCTTCTCTATTCTAATTCTAACTATTATTCCACTATTACATACATCCAAACAACGAAGCATGATATTCCGACCTCTAAGTCAATGCTTATTCTGACTCCTAGTAGCAGACCTACTCACACTAACATGAATTGGAGGACAGCCAGTAGAACACCCCTTCATTATTATTGGGCAATTGGCCTCTATTCTCTACTTTACAATTCTTCTAGTACTTATACCTATCACTAGCATTATTGAGAATAGCCTCTCAAAATGAAGA

Mitochondrial DNA and

cytochrome b gene:

Page 19: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Web search www.phylogeny.fr.

In the pull down “Phylogeny Analysis” pick “One Click”

Page 20: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Page should be seen after “one click”

http://www.phylogeny.fr/version2_cgi/one_task.cgi?task_type=phyml

Page 21: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Copy and paste gene sequences into phyml. Once inserted click submit.

Page 22: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Loading screen should appear as sequences are analysed.

Page 23: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

A tree will generate in the program, click on “Tree in Newick Format”

under input. Copy the code that generates.

Page 24: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Edit the tips using the “Change leaf name” tool.

Page 25: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

* Extinct species

Page 26: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Node values

* Extinct species

Page 27: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

* Extinct species

Page 28: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Sister taxa

* Extinct species

Page 29: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

• Node Y is ancestor to grizzly bear, polar bear and cave bear

Page 30: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Node Y

• Node Y is ________ to grizzly bear, polar bear and cave bear

Page 31: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

* Extinct species

Page 32: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

* Extinct species

Page 33: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Tree root

* Extinct species

Page 34: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Tree root

* Extinct species

Page 35: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Tree root

Scale Bar * Extinct species

Page 36: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Tree root

Scale Bar * Extinct species

Page 37: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Tree root

Scale Bar

Outgroup

* Extinct species

Page 38: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny

Knowing how to create and read a phylogeny, now you will create a

tree using mitochondrial DNA sequences of bird taxa including the

dodo bird.