evolution of body size in bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · evolution...
TRANSCRIPT
![Page 1: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/1.jpg)
Evolution of Body Size in Bears
How to Build and Use a Phylogeny
![Page 2: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/2.jpg)
Lesson I
Building a Phylogeny
![Page 3: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/3.jpg)
Objectives for Lesson I: 1.Overview of concepts 1.Observe TA complete a simple walk through for creating a phylogeny. 1.Complete a handout giving specific instructions on how to create a phylogeny. **Students will use the following example: • Reconstrucing phylogenetic position of the extinct dodo and solitaire, based
on Shapiro et al. (2002) Science
![Page 4: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/4.jpg)
What is a phylogenetic tree?
• A history of evolution • Often uses characteristics of modern taxa to reconstruct
evolutionary history • Depicts the evolutionary relationships between organisms.
![Page 5: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/5.jpg)
How do we make them?
Morphology: •Winged/wingless •Number of limbs •Type of lung
Genetic: •Mitochondrial:
Evolves rapidly Matrilinear inheritance No recombination
•Nuclear: Evolves more slowly Sexual reproduction Recombination
•RNA •Neutral vs. coding
Phylogenies are built using characters. Commonly used characters include:
![Page 6: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/6.jpg)
How do we make them?
More about characters: • A character that has evolved to a different state is an
apomorphy • An apomorphy found in multiple taxa is a
synapomorphy •may be homologous – inherited from a common ancestor •or may be analogous – evolved twice or more by convergent evolution
• Taxa are grouped by synapomorphic characters
![Page 7: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/7.jpg)
One method...
Parsimony: the relationship requiring the fewest evolutionary changes is most likely to be correct
![Page 8: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/8.jpg)
Construct data matrix of apomorphies:
Shark Lizard Dog Whale
Dorsal fin 1 0 0 1
Pectoral girdle 0 1 1 1
Lungs 0 1 1 1
Milk 0 0 1 1
![Page 9: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/9.jpg)
Shark Lizard Dog Whale
Shark - 0 0 1
Lizard - - 2 2
Dog - - - 3
Whale - - - -
Count synapomorphies between each taxon:
![Page 10: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/10.jpg)
Shark
Lizard
Dog
Whale
Find the tree requiring the fewest evolutionary changes:
Dorsal fin
Lungs
Milk
Pectoral girdle
Dorsal fin
![Page 11: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/11.jpg)
Other methods...
When we have a lot of taxa and characters, the number
of potential trees soon reaches millions.
Statistical methods are useful in these cases:
Maximum likelihood: uses an algorithm to evaluate all possible trees and find the one that best explains the observed relationships
Incorporates models of how DNA evolves
![Page 12: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/12.jpg)
Other methods...
Other statistical methods include: •Distance: calculate the amount of evolutionary change between each pair of taxa and then find the tree that best predicts that pattern. •Bayesian inference: uses probability theory: how probable is each possible tree, considering:
•Observed data •Models of evolutionary process •Prior beliefs
![Page 13: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/13.jpg)
Terms:
• Species B and C are sister taxa
• Species E is an outgroup to ABCD
• Node Y is the ancestor to A, B & C
Node Y
![Page 14: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/14.jpg)
Copyright 2008 Nature Education
Reading a Phylogenetic Tree
![Page 15: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/15.jpg)
Reference for relationships of all organisms can be found at Tree of Life Web Project.
Tolweb.org
![Page 16: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/16.jpg)
Building a bear phylogeny:
![Page 17: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/17.jpg)
http://www.ncbi.nlm.nih.gov/genbank/
http://www.ebi.ac.uk/ena/
Genetic Databases:
![Page 18: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/18.jpg)
Ailuropoda melanoleuca (Giant Panda) complete cytochrome b sequence FM177761.1 TGATCAACATCCGAAAAACTCATCCATTAGTTAAAATTATCAACAACTCATTCATTGACCTTCCAACACCATCAAACATTTCAACATGATGGAACTTTGGGTCCCTGTTAGGAGTGTGTCTGATCTTGCAAATCTTAACAGGCTTATTTCTAGCCATACACTATACATCAGATACAGCTACAGCCTTTTCATCAGTCGCACACATTTGTCGAGACGTCAACTATGGTTGATTTATCCGATATATACATGCCAATGGGGCCTCTATATTTTTTATCTGCCTATTTATACACGTAGGGCGAGGCTTATACTATGGATCATACCTATTTCCAGAGACATGGAATATCGGAATTATTCTCCTACTTACAGTTATAGCCACAGCATTCATAGGATATGTACTACCTTGAGGACAAATATCCTTCTGAGGAGCAACCGTCATTACTAACCTACTATCAGCAATTCCTTACATTGGCACTAATCTAGTGGAGTGAATCTGAGGGGGTTTCTCCGTAGATAAAGCAACACTAACCCGATTTTTTGCTTTTCACTTTATCCTTCCATTTATCATCTCAGCACTAGCAATAGTCCATCTATTATTCCTTCACGAAACAGGATCTAATAACCCCTCCGGAATTCCATCTGACCCAGACAAAATCCCATTTTACCCCTATCATACAATTAAAGACATCCTAGGCGTCCTATTTCTTGTCCTCGCCTTAATAACCCTGGCTTTATTCTCACCAGACCTGTTAGGAGACCCTGATAACTATACCCCTGCAAATCCACTAAGTACCCCGCCACATATTAAGCCTGAATGGTACTTTCTATTTGCCTACGCTATCCTGCGATCTATCCCTAATAAACTAGGAGGGGTGCTAGCTCTAATCTTCTCTATTCTAATTCTAACTATTATTCCACTATTACATACATCCAAACAACGAAGCATGATATTCCGACCTCTAAGTCAATGCTTATTCTGACTCCTAGTAGCAGACCTACTCACACTAACATGAATTGGAGGACAGCCAGTAGAACACCCCTTCATTATTATTGGGCAATTGGCCTCTATTCTCTACTTTACAATTCTTCTAGTACTTATACCTATCACTAGCATTATTGAGAATAGCCTCTCAAAATGAAGA
Mitochondrial DNA and
cytochrome b gene:
![Page 19: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/19.jpg)
Web search www.phylogeny.fr.
In the pull down “Phylogeny Analysis” pick “One Click”
![Page 20: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/20.jpg)
Page should be seen after “one click”
http://www.phylogeny.fr/version2_cgi/one_task.cgi?task_type=phyml
![Page 21: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/21.jpg)
Copy and paste gene sequences into phyml. Once inserted click submit.
![Page 22: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/22.jpg)
Loading screen should appear as sequences are analysed.
![Page 23: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/23.jpg)
A tree will generate in the program, click on “Tree in Newick Format”
under input. Copy the code that generates.
![Page 24: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/24.jpg)
Edit the tips using the “Change leaf name” tool.
![Page 25: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/25.jpg)
* Extinct species
![Page 26: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/26.jpg)
Node values
* Extinct species
![Page 27: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/27.jpg)
* Extinct species
![Page 28: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/28.jpg)
Sister taxa
* Extinct species
![Page 29: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/29.jpg)
• Node Y is ancestor to grizzly bear, polar bear and cave bear
![Page 30: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/30.jpg)
Node Y
• Node Y is ________ to grizzly bear, polar bear and cave bear
![Page 31: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/31.jpg)
* Extinct species
![Page 32: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/32.jpg)
* Extinct species
![Page 33: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/33.jpg)
Tree root
* Extinct species
![Page 34: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/34.jpg)
Tree root
* Extinct species
![Page 35: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/35.jpg)
Tree root
Scale Bar * Extinct species
![Page 36: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/36.jpg)
Tree root
Scale Bar * Extinct species
![Page 37: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/37.jpg)
Tree root
Scale Bar
Outgroup
* Extinct species
![Page 38: Evolution of Body Size in Bearsaimup.unm.edu/documents/2-bears-phylogeny-lesson1.pdf · Evolution of Body Size in Bears How to Build and Use a Phylogeny . Lesson I Building a Phylogeny](https://reader034.vdocuments.us/reader034/viewer/2022050109/5f4715930fd1867762555899/html5/thumbnails/38.jpg)
Knowing how to create and read a phylogeny, now you will create a
tree using mitochondrial DNA sequences of bird taxa including the
dodo bird.