Chemosphere 84 (2011) 727–730

Contents lists available at ScienceDirect

Chemosphere

journal homepage: www.elsevier .com/locate /chemosphere

Short Communication

Evaluation of ABC efflux transporters genes expression in kidney of rainbowtrout (Oncorhynchus mykiss) fed with melamine and cyanuric acid diets

Alessandro Benedetto a,⇑, Stefania Squadrone a, Marino Prearo b, Antonia Concetta Elia c, Ilaria Giorgi b,Maria Cesarina Abete a

a C.Re.A.A. – National Reference Center for the Surveillance and Monitoring of Animal feed, Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle D’Aosta, 10154 Turin, Italyb Fish Diseases Laboratory, Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle D’Aosta, 10154 Turin, Italyc Ecotoxicology Laboratory, Department of Cellular and Environmental Biology, University of Perugia, 06123 Perugia, Italy

a r t i c l e i n f o

Article history:Received 20 December 2010Received in revised form 31 March 2011Accepted 7 April 2011Available online 5 May 2011

Keywords:MelamineCyanuric acidABC efflux transportersRainbow troutmRNA expressionDDCT method

0045-6535/$ - see front matter � 2011 Elsevier Ltd. Adoi:10.1016/j.chemosphere.2011.04.028

⇑ Corresponding author. Tel./fax: +39 011 2686228E-mail addresses: alessandro.benedetto@izsto.it, c

ittiopatologia@izsto.it (M. Prearo), elia@unipg.it (A.C.

a b s t r a c t

Gene expression experiments were targeted in order to monitor the ABC efflux transporters, which ispotentially involved in cellular detoxification/defense. Changes in expression levels of different ABCgenes in kidney of Oncorhynchus mykiss fed with melamine and melamine + cyanuric acid enriched dietswere recorded in both treated groups by mRNA DDCT relative quantification method. Expression profilesof eight different ABC genes basically showed low alterations in melamine group and more consistentchanges in melamine + cyanuric acid treated fish, compared with own control. In the last group ABCC2gene over expression was the more evident alteration. These results suggest that ABC efflux system couldbe involved in mobilization of hydrophilic molecules in the forcing condition of chronic exposure.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

European Food Safety Authority (EFSA) Scientific Opinion onMelamine in Food and Feed, has recently highlighted the effectsof melamine exposure in humans, pets, and several other species,including fish. Melamine is not metabolized in liver and is nor-mally rapidly eliminated in the urine. In particular, co-exposureto melamine and cyanuric acid of fish showed higher toxicity com-pared with melamine or cyanuric acid alone. These effects arecaused by crystal formation distributed throughout the renal tu-bules and collecting duct system (Reimschuessel et al., 2008; Chenet al., 2009). The toxic mechanism seems similar to acute uric acidnephropathy in humans (Reimschuessel et al., 2010).

The active efflux of organic compounds, such as melamine andcyanuric acid, could play a primary role in the cellular resistancemechanism. In particular, ABC transporters are described as beinginvolved in many xenobiotic effluxes and their roles in cellulardetoxification/defense are well known. The characterization ofABC efflux genes in rainbow trout (Oncorhynchus mykiss) was de-

ll rights reserved.

.reaa@izsto.it (A. Benedetto),Elia) .

scribed by Zaja et al. (2008) and recently quantified in trout tissuesby Loncar et al. (2010).

Since works are scanty on melamine and cyanuric acid toxicityin fish (EFSA, 2010), a relative RNA quantification approach on kid-ney of trout fed for ten weeks with melamine (ME, 1000 mg kg�1)and melamine and cyanuric acid (ME + CA, 1000 mg kg�1) enricheddiets, was chosen to detect possible changes in ABC efflux trans-porters expression.

The aim was to investigate if ABC active efflux system could beinvolved in the development of toxic effects of melamine and mel-amine associated to cyanuric acid. To verify this hypothesis a geneexpression experiment targeted to quantified alteration in mRNAlevels of different ABC transporters was performed on rainbowtrout fed with melamine and coadministration of 1:1 ratio of mel-amine and cyanuric acid diets.

2. Materials and methods

Rainbow trout (mean weight 180 g and mean length 25 cm),were acclimatized for two weeks in 10 000 L tanks prior to treat-ment. The study was carried out on three groups (five fish for eachgroup) for ten weeks: one was fed with melamine diet(1000 mg kg�1), the other was fed with co-exposure of melamine(1000 mg kg�1) and cyanuric acid (1000 mg kg�1) diet and troutfed with uncontaminated feedstuff were used as control. Diets

Table 1Primer sequences, their optimal concentrations and amplicon lengths used in the gene expression quantification using qRT-PCR.

Target Sense (50–30) Antisense (50–30) Optimal conc. (nM) Amplicon length (bp)

GAPDH ATGACCACTCCATCTCCGTATTC ACGACGTAATCGGCACCG 250/300 78 bpEF 1A TCTGCCCCTCCAGGATGTC TGGTGACATTAGCGGGGG 200/200 123 bpB2M AAGAGTGTTGGATTCACACCAGC GCTCCAGATCCTTACATATCTGCC 200/250 110 bpHPRT GGCTACACACCAGACTTCATAGGA GAAGTACTCGTTGTAGTCTAGCGCATAT 250/250 61 bpATUB GAACCAACTGTTGTTGATGAGGTTC GTGCACTGGTCCGACAGCTT 200/200 178 bpG6PD CCCTATATGAAGGTGGCAGACTCT GGCGTACTTCCCACTGACATAAG 300/350 84 bpBACT CTCCTTCCTCGGTATGGAGTCTT ACAGCACCGTGTTGGCGT 300/300 106 bp

Fig. 1. Housekeeping genes standard curve experiment on tenfold serial dilution ofkidney cDNA samples: Ct values were plotted versus the DNA concentration,maintaining linearity (�3.468 < slope < �3.281) and good amplification efficiencyin the range of dilution samples.

728 A. Benedetto et al. / Chemosphere 84 (2011) 727–730

offered to trout was 1.5% body weight day�1. The experimentaldiets had the same composition: fish meal, barley and soybeansmeal corn gluten meal, cod liver oil vitamin supplement, mineralsupplement and binder.

After 10 weeks exposure all fish of either treated and controlgroups were caught and euthanized with a lethal overdose of MS222 (250 mg/L) (Sigma–Aldrich, St.Louis, MO, USA).

The experiments were conducted in accordance with the Euro-pean and national guidelines (European Commission, Directive 86/609//EC and Italian Directive 116/1992, respectively).

Total RNA was isolated from kidney samples of all groups previ-ously stored in RNA-Later solution (Ambion, Austin, TX, USA). RNAextraction was performed using Qiagen RNeasy Plus MiniKit (Qia-gen, Basel, Switzerland) according to the manufacturer’s protocol.Extracted RNA was treated with Turbo DNAse kit (Ambion) to avoidany traces of genomic DNA. Extracted RNA in all samples wasquantified by fluorimetric analyses using Q-bit HS-RNA assay(Invitrogen, Carlsbad, CA, USA). One lg of RNA from each samplewas transcribed to cDNA using High Capacity cDNA Reverse Tran-scription Kit with RNase Inhibitor (Applied Biosystems, Foster City,CA, USA).

For a proper relative quantification of target genes using DDCT

method (Livak and Schmittgen, 2001) it is recommended to takeinto consideration multiple reference genes when determiningexpression levels. A preliminary experiment based on a panel ofspecific housekeeping genes was performed to define the most sta-ble gene or the best combination of reference genes allowing a ro-bust normalization of ABC expression levels.

All primers were designed using Primer express 3.0 software(Applied Biosystems). Primer concentrations for housekeepinggenes were optimized for each assay analyzing fluorescence signalson positive and negative control samples with serial primer dilu-tions, choosing concentrations resulting in the highest fluorescencesignal at the lowest Ct number with the expected melting curveprofile. Primer sequences, optimal concentrations and ampliconlengths are reported in Table 1. Primer concentrations for ABC ef-flux genes were adopted according to Loncar et al. (2010).

Real time PCR amplification (qRT-PCR) was performed on anApplied Biosystems Step One Plus analyzer with Fast SYBR GreenPCR master mix (Applied Biosystems). The reaction mix was basedon 10 lL of SYBR Green 2X reaction mix, a final concentration ofeach ABC efflux targets primer as described by Loncar et al.(2010), or 200 nM of each primer for EF target, 2 lL of cDNA tem-plate and nuclease free water needed to reach 20 ll final reactionvolume.

The run method was set with a starting holding stage at 95 �Cfor 20 s, 40 cycles of amplification carried out with denaturationat 95 �C for 3 s, annealing and elongation at 60 �C for 30 s, followedby a melting curve analysis.

A relative standard curve experiment on seven differenthousekeeping genes (five serial tenfold dilutions of kidney cDNA)was performed to estimate PCR efficiency (Fig. 1). The reactionspecificity on different housekeeping genes was verified by meltingcurve profile analysis (Fig. 2).

3. Results and discussion

Analysis with different VBA applets like GeNorm (Vandesompeleet al., 2002) and BestKeeper (Pfaffl et al., 2004) on treated (melamineand melamine + cyanuric acid samples) and control samples definedthe EF target as the most stable endogenous control in our samplesdata set (data not shown). As previously reported in other salmonidrelated species (Olsvik et al., 2005), EF-1A and EF-1B were ranked asthe most stable housekeeping genes.

In order to contain confounding variance, caused by both intersubject variance (different responses to treatment, different base-line expressions of genetic targets) and the processing variancecaused by sampling procedures, RT step and qPCR amplification,we adopted a larger number of biological and technical replicatesfor both treated and untreated groups as suggested by Tichopadet al. (2009).

Fig. 2. Housekeeping genes melt curves: the melting profile and temperature foreach assay showed assays specificity.

Fig. 3. Relative ABC transporters expression profiles on melamine group(1000 mg kg�1), melamine plus cyanuric acid (ME + CA, 1000 mg kg�1 each) groupand control. Expression level for each target in untreated group was arbitrarily setto value 1 and then compared with both treated groups.

A. Benedetto et al. / Chemosphere 84 (2011) 727–730 729

Ct values from amplification plots and relative quantificationresults with the application of DDCT method were obtained withStep One Software 2.1 (Applied Biosystems).

Expression profiles of eight different ABC genes (Fig. 3) basicallyshowed low alterations in ME group and more consistent changesin ME + CA group, compared with own control.

As shown in Fig. 3 the major upregulation event was the alter-ation of the ABCC2 gene confirmed in both treated groups, withhigher expression levels in the ME + CA (more than double RQ val-ues). ABCG2 and ABCC4 showed lower upregulation in the treatedME and ME + CA groups. ABCC5 was slightly down expressed in theME and ME + CA groups. Other ABC targets such as ABCC1 showeda down-regulation in the ME group in contrast with a lower in-crease of expression in the ME + CA group.

ABCB11 expression, which is known to be a characteristic livertransporter, related to the efflux of bile salts from hepatocytes intobile (Loncar et al., 2010), was detected at very low expression in kid-ney of all three experimental groups. However, among all ABC trans-porters analyzed, ABCB11 expression evidenced the higheststandard deviation values of all treated and untreated groups (Fig. 3).

The detoxification mechanism mediated by ABC efflux trans-porters is usually activated in order to reduce the compounds accu-mulation and their toxic effects in cytosol of exposed cell.Therefore, this mechanism could also happen for melamine andcombination of melamine and cyanuric acid. On the other hand,the active efflux could contribute to the accumulation of mela-mine–cyanuric acid complexes in tubular ducts.

The alteration in ABC efflux genes tested (the most evident isthe ABCC2 upregulation) also suggests that the active efflux sys-tems could be involved in detoxification of melamine and cyanuric

acid complexes. This process could eventually lead to crystalprecipitation/accumulation in tubular ducts. Intratubular mela-mine-cyanurate crystal spherulite formation causes obstructionand subsequent acute renal failure, through a mechanism similarto the uric acid nephropathy (Reimschuessel et al., 2010).

The evaluation of intratubular melamine-cyanurate crystalformation, causing obstruction and subsequent nephropathy, wasperformed by ‘‘wet-mount’’ microscopy analysis on kidney sam-ples according to Reimschuessel et al. (2008). Melamine-cyanuratecrystals were observed only in kidney of trout fed with mela-mine + cyanuric acid (ME + CA) diet (data not shown). Most likely,melamine + cyanuric acid co-exposure tends to form complexes inkidney, less soluble than melamine or cyanuric acid alone.Therefore, the observed disturbance on efflux system, such asABC transporters, in fish treated with coadministration of mela-mine and cyanuric acid, could play an important role in the devel-opment of toxic effects, thus leading to selective accumulation ofcrystal complexes in renal ducts, together with an expected pas-sive/gradient efflux of more soluble separated compounds.

In conclusion, unreported novel changes in mRNA transcriptionof ABC transporters related to melamine and melamine + cyanuricacid exposure have been demonstrated, mainly for ABCC2 gene.Significative upregulation of ABCC2 expression was recently foundin kidney of zebrafish exposed to sodium arsenate, cadmium, mer-cury, lead and different hydrophilic compounds, thus evidencingthe importance of ABCC2 expression also in heavy metal detoxifi-cation process (Long et al., 2011).

Therefore the results of the present study indicate that ABC effluxsystem could be involved in mobilization of hydrophilic molecules inthe forcing condition of chronic exposure. Among the observed alter-ations in mRNA transcription of different ABC transporters, ABCC2upregulation could be considered as valid tool in kidney of rainbowtrout for melamine and cyanuric acid chronic exposure studies.

References

Chen, K.C., Liao, C.W., Cheng, F.P., Chou, C.C., Chang, S.C., Wu, J.H., Zen, J.M., Chen,Y.T., Liao, J.W., 2009. Evaluation of subchronic toxicity of pet food contaminatedwith melamine and cyanuric acid in rats. Toxicol. Pathol. 37, 959–968.

730 A. Benedetto et al. / Chemosphere 84 (2011) 727–730

EFSA, 2010. Scientific Opinion on Melamine in Food and Feed. EFSA Journal 2010 8(4):1573 8, 145.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25,402–408.

Loncar, J., Popovic, M., Zaja, R., Smital, T., 2010. Gene expression analysis of the ABCefflux transporters in rainbow trout (Oncorhynchus mykiss). Comp. Biochem.Physiol. C 151, 209–215.

Long, Y., Li, Q., Zhong, S., Wang, Y., Cui, Z., 2011. Molecular characterization andfunctions of zebrafish ABCC2 in cellular efflux of heavy metals. Comp. Biochem.Physiol. C: 153, 381–391.

Olsvik, P.A., Lie, K.K., Jordal, A.E., Nilsen, T.O., Hordvik, I., 2005. Evaluation ofpotential reference genes in real-time RT-PCR studies of Atlantic salmon. BMCMol. Biol. 6, 21.

Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stablehousekeeping genes, differentially regulated target genes and sample integrity:BestKeeper – excel-based tool using pair-wise correlations. Biotechnol. Lett. 26,509–515.

Reimschuessel, R., Gieseker, C.M., Miller, R.A., Ward, J., Boehmer, J., Rummel, N.,Heller, D.N., Nochetto, C., de Alwis, G.K., Bataller, N., Andersen, W.C., Turnipseed,

S.B., Karbiwnyk, C.M., Satzger, R.D., Crowe, J.B., Wilber, N.R., Reinhard, M.K.,Roberts, J.F., Witkowski, M.R., 2008. Evaluation of the renal effects ofexperimental feeding of melamine and cyanuric acid to fish and pigs. Am. J.Vet. Res. 69, 1217–1228.

Reimschuessel, R., Evans, E., Andersen, W.C., Turnipseed, S.B., Karbiwnyk, C.M.,Mayer, T.D., Nochetto, C., Rummel, N.G., Gieseker, C.M., 2010. Residue depletionof melamine and cyanuric acid in catfish and rainbow trout following oraladministration. J. Vet. Pharmacol. Ther. 33, 172–182.

Tichopad, A., Kitchen, R., Riedmaier, I., Becker, C., Stahlberg, A., Kubista, M., 2009.Design and optimization of reverse-transcription quantitative PCR experiments.Clin. Chem. 55, 1816–1823.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A.,Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCRdata by geometric averaging of multiple internal control genes. Genome Biol 3,7, research 0034.1-0034.12.

Zaja, R., Munic, V., Klobucar, R.S., Ambriovic-Ristov, A., Smital, T., 2008. Cloning andmolecular characterization of apical efflux transporters (ABCB1, ABCB11 andABCC2) in rainbow trout (Oncorhynchus mykiss) hepatocytes. Aquat. Toxicol. 90,322–332.