APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Feb. 1994, p. 587-5930099-2240/94/$04.00+0Copyright ( 1994, American Society for Microbiology

Use of the Escherichia coli 13-Glucuronidase (gusA) Gene as a

Reporter Gene for Analyzing Promoters inLactic Acid Bacteria

CHRIST PLAITBEUW, GUUS SIMONS, AND WILLEM M. DE VOS*

Molecular Genetics Group, Department of Biophysical Chemistry, Netherlands Institutefor Dairy Research (NIZO), 6710 BA Ede, The Netherlands

Received 21 December 1992/Accepted 19 November 1993

A transcriptional fusion vector, designated pNZ272, based on the promoterless ,-glucuronidase gene (gus4)ofEscherichia coli as a reporter gene, has been constructed for lactic acid bacteria. The replicon of pNZ272 was

derived from the Lactococcus lactis plasmid pSH71, allowing replication in a wide range of gram-positivebacteria and E. coli. The applicability of pNZ272 and the expression of the gusA gene in L. lactis was

demonstrated in shotgun cloning experiments with lactococcal chromosomal and bacteriophage DNA. Inaddition, three defined lactococcal promoters were inserted in pNZ272: the plasmid-derived lacA promoter, thechromosomal usp45 promoter, and a promoter from bacteriophage 4SK11G. The three resulting plasmidsshowed 0-glucuronidase activity in a gusA-deficient E. coli strain and in four species of lactic acid bacteriabelonging to the genera Lactobacillus, Lactococcus, and Leuconostoc. The copy numbers of the gusA-expressingplasmids were similar within a single species of lactic acid bacteria. However, the specific B-glucuronidaseactivity and the gusA mRNA levels varied considerably both within a single species and among different speciesof lactic acid bacteria. The transcriptional start site of all three promoters was determined and found to beidentical in the different species. The results of this comparative promoter analysis indicate that therequirements for efficient transcription initiation differ among the lactic acid bacteria studied.

Lactic acid bacteria (LAB) form a large group of gram-positive organisms that are widely used in the production offermented foods. In recent years, a great deal of attention hasbeen focused on the development of gene-cloning techniquesand the first construction of expression systems, mainly inLactococcus lactis (12, 45). Detailed studies of the sequencesinvolved in transcription and translation initiation are essentialin understanding gene expression in LAB and engineering newstrains with improved properties.

Promoter-probe vectors are suitable tools for isolation ofpromoters and comparison of their efficiency. Promoters inLAB have been studied mainly by using transcriptional fusionsto promoterless reporter genes. These include the chloram-phenicol acetyltransferase genes such as cat-86 gene fromBacillus pumilis in the plasmids pGKV210 (46), pNZ220 (12),and pBV5030 (3) and the cat-194 gene from Staphylococcusaureus in pMU1328 (1). These vectors have the disadvantagethat only strong promoters can be isolated, because selectionrequires high expression of the cat gene while determination ofchloramphenicol acetyltransferase activity is laborious. In ad-dition, a promoter-screening vector based on the promoterlesslacG gene from Lactococcus lactis encoding phospho-p-galac-tosidase has been constructed (40). Finally, the application ofthe well-known Escherichia coli lacZ gene for transcriptionaland translational fusion in Lactococcus lactis has been demon-strated (13, 35). The reporter genes lacZ and lacG have limitedapplications because of the presence of those lactose hydro-lases in most LAB (7, 15, 21, 28). As a consequence, there is aneed for developing a promoter-probe vector that allows directscreening of promoters in a variety ofLAB and that is based on

* Corresponding author. Mailing address: Department of Biophys-ical Chemistry, NIZO, Kernhemseweg 2, 6718 ZB Ede, The Nether-lands. Phone: 31-8380-59558. Fax: 31-8380-50400. Electronic mailaddress: NIZO@CAOS.CAOS.KUN.

a reporter gene, whose expression should be easily detectableby using a chromogenic substrate.The promoterless P-glucuronidase gene (gusA), previously

described as uidA4 (23), is a well-studied and useful reportergene that has been used in a variety of plants (24, 27), animals(25), and microorganisms (18, 36, 39, 51). In addition, theexpression of the gusA gene can be easily determined with an

expanding range of chromogenic substrates (for reviews, seereferences 23, 27, and 52).

In this report, we describe the construction of a new versatilepromoter-probe vector, designated pNZ272, based on gusA asa reporter gene and a heterogramic replicon, allowing replica-tion in a great variety of LAB, other gram-positive bacteria,and E. coli. The applicability of pNZ272 has been demon-strated by shotgun cloning of random chromosomal and bac-teriophage fragments with promoter activity in Lactococcuslactis and by analyzing the functionality and efficiency of threelactococcal promoters in Lactococcus lactis, Leuconostoc lactis,Lactobacillus casei, and Lactobacillus plantarum.

MATERIALS AND METHODS

Bacterial strains and media. The bacterial strains used inthis study are listed in Table 1. E. coli was grown in Luria brothat 37°C (37). Lactobacillus spp. and Leuconostoc lactis strainswere grown in MRS broth (Difco Laboratories, Detroit, Mich.)(10). Lactococcus lactis was grown in M17 broth (DifcoLaboratories) (41) supplemented with 0.5% glucose (GM17).LAB were grown at 30°C (Lactococcus and Leuconostoc spp.)or 37°C (Lactobacillus spp.). Chloramphenicol was used at a

concentration of 10 ,Lg/ml for LAB and 25 ,ug/ml for E. coli.Histochemical screening for gusA-positive clones was per-formed with 5-bromo-4-chloro-3-indolyl-f-D-glucuronide (X-Gluc) (Research Organics Inc., Cleveland, Ohio) at a finalconcentration of 0.5 mM.

587

Vol. 60, No. 2

on January 9, 2021 by guesthttp://aem

.asm.org/

Dow

nloaded from

588 PLATTEEUW ET AL.

TABLE 1. Strains used in this study

Strain Relevant features Refer-ence(s)

Escherichia coli MC1061 araD139 lacX74 galU galK 5hsr hsm+ strA

Escherichia coli KW1 metB strA purB A(add-uid- 51man) hsr hsm+

Lactococcus lactis MG1363 Plasmid-free derivative of 19NCDO 712, Lac

Lactobacillus plantarum LP80 29Lactobacillus casei ATCC Cured from pLZ15, Lac- 7

393(,B-gal-)Leuconostoc lactis NZ6009 8, 9Bacillus subtilis 1G33 trp 17

DNA isolation and manipulation. Plasmid DNA was iso-lated from E. coli by using the alkali lysis method (2). PlasmidDNA was isolated from protoplasts of Lactococcus lactis andLeuconostoc lactis as described previously (16). Lactobacillusplasmid DNA was isolated by the same method, with 25 ,ug oflysozyme per ml for 90 min during protoplast formation. TotalDNA of Lactococcus lactis was isolated as described previously(31). DNA fragments were isolated from agarose gels by usingthe GeneClean Kit (Bio 101 Inc., La Jolla, Calif.). All otherDNA manipulations were performed by established proce-dures (37). Restriction enzymes and T4 DNA ligase were

purchased from Bethesda Research Laboratories, Gaithers-burg, Md.; New England BioLabs Inc., Beverly, Mass.; or

Boehringer GmBH, Mannheim, Germany; they were used as

specified by the manufacturers. Oligonucleotides were synthe-sized on a Cyclone DNA synthesizer (Biosearch, San Rafael,Calif.).

Transformation of plasmid DNA. E. coli was transformed bystandard techniques (37). Plasmid transformation of Bacillussubtilis protoplasts was performed as described previously (6).Leuconostoc lactis and Lactobacillus casei were electroporatedas described by David et al. (8) with the following modifica-tions. Overnight cultures were diluted 1:20 in MRS brothcontaining 40 mM D,L-threonine. Exponentially growing cellswere harvested by centrifugation and washed once with ice-cold electroporation buffer (0.5 M sucrose, 10% glycerol).Subsequently, cells were resuspended in electroporation buffersupplemented with 0.05 M EDTA and incubated on ice for 15min. After centrifugation, the cells were washed with electro-poration buffer and resuspended in 1/100 culture volume ofelectroporation buffer. Cell suspensions (40 p.l) were mixedwith 1 pI of plasmid DNA dissolved in a 10 mM Tris-hydrochloride buffer (pH 7.5) containing 1 mM EDTA (TEbuffer). The mixture was incubated on ice for 10 min prior toelectroporation. High-voltage pulses were delivered with aGene Pulser apparatus (Bio-Rad Laboratories, Richmond,Calif.) with the following setting: 2-mm cuvette, 25 ,uF, 200 Ql,and 2.0 kV. The electroporated cells were kept on ice for 10min, diluted in 1 ml of MRS broth, and then incubated at 30°Cfor at least 90 min. Dilutions were spread on MRS agar platescontaining appropriate antibiotics and X-Gluc. Colonies ap-peared after 36 h of incubation at 30°C for Leuconostoc lactisand after 4 days of incubation at 37°C for Lactobacillus casei.Lactococcus lactis was electroporated as described previ-

ously (22) with the following modifications. An overnightculture growing at 30°C in SGGM17 (GM17 containing 0.5 Msucrose and 3% glycine) was diluted eightfold in the samemedium and grown to an optical density of 0.3 at 600 nm. Thecells were washed and electroporated as described above.

After electroporation, the cells were diluted 10-fold in GM17and kept at 30°C for 90 min. The diluted cells were mixed with3 ml of GM17 top agar (GM17 containing 0.7% agar andX-Gluc) and poured onto GM17 plates solidified with 1.5%agar containing chloramphenicol.

Lactobacillus plantarum was electroporated as described byJosson et al. (29) with the following modifications. An over-night culture was diluted 50-fold in MRS broth and grown at37°C to an optical density of 0.8 to 1 at 600 nm. Cells werewashed twice with sterile water at room temperature andresuspended in 30% polyethylene glycol 1000 to a final volume(in milliliters) of 10 times the pellet weight (in grams). DNA (1to 10 ,ul in TE buffer) was added to 100 pul of cell suspensionthat had been transferred to a 2-mm cuvette, and a singleelectric pulse of 1,700 kV was applied with an internal resis-tance set at 400 Q. After electroporation, the cells were kepton ice for at least 30 min. Incubation and plating of the cellsuspensions were performed as described above for Leucono-stoc lactis and Lactobacillus casei.

P-Glucuronidase assays. For the determination of 3-glucu-ronidase activity, exponentially growing cells (5 ml) wereharvested and resuspended in 1 ml of GUS buffer (50 mMNaHPO4 [pH 7.0], 10 mM P-mercaptoethanol, 1 mM EDTA,0.1% Triton X-100). The cells were disrupted with zirconiumglass beads in a Mini Bead Beater (Biospec Products, Bartles-ville, Okla.) by three 3-min treatments, with intervals of at least1 min, during which the cells were kept on ice. After centrif-ugation, the cell extracts were used immediately. For thedetermination of 3-glucuronidase activity, 50 [lI of the cellextracts was added to 0.5 ml of GUS buffer containing 1.25 puMpara-nitro-3-D-glucuronic acid (Clonetech Lab. Inc., Palo Alto,Calif.), and the mixture was incubated at 37°C. At appropriatetime intervals (usually 5 min), 100-,u aliquots were taken andthe reaction was stopped by addition of 0.8 ml of 2 mMNa2CO3. Subsequently, the optical density at 420 nm of thereaction mixture was determined. The protein content wasdetermined as described by Bradford (4), using the Bio-Radprotein assay with bovine serum albumin as the standard.

Relative-copy-number determination. Equal amounts of to-tal DNA of the strains were denatured with NaOH (finalconcentration, 0.2 M) and filtered in duplicate on GeneScreenPlus membranes (Dupont, Boston, Mass.) that were subse-quently neutralized with 0.1 M Tris (pH 7.5). One membranewas hybridized with the 1.8-kb EcoRI-Hindlll fragment ofpNZ272 carrying the gusA gene that was labeled by nicktranslation with [U-32P]dATP (37). The other membrane washybridized with a [y-32P]ATP-end-labeled (37) universal 16SrRNA probe with the sequence 5'-GTATTACCGCGGCTGCT-3' (30). The membranes were washed under stringentconditions as described by the manufacturer. After autoradiog-raphy, the radioactivity was determined by using a liquidscintillation counter (LS7500; Beckman Instruments Inc., PaloAlto, Calif.). The ratio between the radioactivity obtained fromthe gus4 and the 16S rRNA hybridization was used to calculatethe relative copy numbers within a single species.

Isolation of a Lactococcus lactis phage 4SK11G promoter. ADNA fragment containing promoter activity of the lactococcalbacteriophage 4SK11G (16) was isolated in the following way.Bacteriophage DNA, prepared as described previously (14,34), was digested with Sau3A and cloned into plasmid pNZ22.The latter plasmid consists of pPL603 (50), in which themultiple-cloning site of M13mp8 (49) was inserted into theEcoRI-PstI site. The ligation mixture was introduced into B.subtilis 1G33, and transformants resistant to chloramphenicolwere isolated. A transformant was obtained that showedresistance to a high level of chloramphenicol (more than 50%

APPL. ENVIRON. MICROBIOL.

on January 9, 2021 by guesthttp://aem

.asm.org/

Dow

nloaded from

gusA GENE AS A REPORTER GENE IN LAB 589

GGATCCAACTTGAAAAGGAACTGACTTATAAACTGATTTCAACAAACCGC 50

AGACGAGTAGTTAAGGGTAATTTATATTATGAACGTATAATCGTAGATAA 100

CCAGCTATTTAAGTTTGCAACTTTGAAAGATTTAATTGACTTGTATCACG 150

-35 -10AAAATATTAATGGGCCTATTTTTAGACAGAATCAGCTTCTTGTTAAAATG 200

V.GGAGAGCAACCAATCGAGGGTGGAGATATTTACATAGCTAACCTTAACGC 250

. RBSAGTTGCTGTTAAAAACCTAAGTGACCTACAAGGCAGTAGAAAGGACGTAA 300

CAAGCACAGATGAAACTAATAACCAATAGTGCTGAAATTAAAGTAACTGA 350M K L I T N S A E I K V T E

AAATGAGGACGGTTCTAAGTCGTTCCAAGGAATTGGTTCAGAAGTTGGTG 400N E D G S K S F E G I G S K V G

TAGACAATCTTAACGGTATTGTCTTGACACCTAACTGCATTGAGTTTGCT 450V D N L N G I V L T P N C I E F A

AGAGAACGATATCCATTGCTATATGAACACGGAGCTGGATCC 492R E D Y P L L Y E H G A G S

FIG. 1. Nucleotide sequence of the 0.5-kb Sau3A fragment con-taining a promoter from bacteriophage 4SKIIG. Conserved featuresin the putative promoter are underlined and include the canonical-35 and - 10 sequences and the TG dinucleotide upstream of the- 10 sequence (12, 20). A consensus ribosome-binding site (RBS) (12)is indicated, showing high complementarity (calculated free energyAG' of -12.2 kcal/mol [-51.04 kJ/mol] [42]) to the 3' end of thelactococcal 16S rRNA (32). The transcription start is indicated by anarrowhead.

survival on plates containing 40 ,ug of chloramphenicol per ml)and harbored a plasmid, designated pNZ577-5, containing a0.5-kb Sau3A insert that strongly hybridized with a Sau3Afragment of equal size obtained from the DNA of (SKIIG.Subsequently, this 0.5-kb Sau3A fragment was cloned into theLactococcus lactis promoter-probe vector pNZ220 (12), gen-erating pNZ229. Lactococcus lactis MG1363 harboringpNZ229 showed resistance to 15 p.g of chloramphenicol perml. The nucleotide sequence of the promoter fragment wasdetermined by using the dideoxy-chain termination method(38), which allowed the location of putative promoter andribosome-binding sites (Fig. 1).

Construction of plasmids. Plasmid pNZ123 is a broad-host-range plasmid that contains the heterogramic replicon ofpSH71 (12, 14). To facilitate the insertion of the gusA gene intopNZ123 and to increase the versatility of the resulting plasmid,the polylinker of pNZ123 was enlarged by inserting the double-stranded oligonucleotide 5'-GATCTCAGCTGGATCCAGTACTCTGCAG/5'-AATTCTGCAGAGTACTGGATCCAGCTG into plasmid pNZ123 digested with Sau3A and EcoRI.The resulting plasmid, designated pNZ124, contains 10 uniquecloning sites (Fig. 2).

Defined promoter fragments were cloned in the promoter-probe vector pNZ272 in the following way (Fig. 2). TheLactococcus lactis lacA promoter region including the lacoperators and the divergently transcribed lacR gene was iso-lated as a 1.5-kb EcoRI-PstI fragment from plasmid pNZ3005(48). The EcoRI site was made blunt with Klenow polymerase,and the resulting fragment was cloned in pNZ272 digested withPvuII and PstI, generating plasmid pNZ276. The promoter ofthe usp45 gene (44), containing 153 bp upstream of thetranscription start, was isolated as a 260-bp BamHI-PstI frag-ment from plasmid pNZ10cx11 (43) and cloned into BammHI-PstI-digested pNZ272, resulting in plasmid pNZ275. Thephage 4SK1 1G promoter was isolated from plasmid pNZ577-5as a BamHI fragment and cloned in BamHI-linearized

pNZ275

pNZ276IE

lacR

B

S (0.26 kb)

usp4S (20)

I P (1.5 kb)

kcA (8)

IBpNZ278 (0.46 kb)

~(od+ (61)

GUCPEXTHO

N

cat

pNZ124 on2831 bp repC/S~~~~~~~~~~~~~f

FIG. 2. Physical and genetic maps of plasmids pNZ124 andpNZ272, and the promoter-containing fragments cloned in pNZ272.The hatched bars indicate coding regions. Abbreviations: A, SnaBI; B,BamHI; C, Scal; E, EcoRI; F, FokI; G, BglII; H, HindIII; N, NcoI; 0,XhoI; P, PstI; S, Sall; T, SstI; U, PvuII; V, AvaIl; X, XbaI.

pNZ272, resulting in plasmid pNZ278. All manipulationsleading to the constructions of pNZ272 derivatives were per-formed in E. coli KW1 selecting for resistance to chloramphen-icol and formation of blue colonies on plates containingX-Gluc.RNA analysis and primer extension mapping. Exponentially

growing cells (25 ml) were pelleted and resuspended in 0.5 mlof TE buffer. Subsequently, 0.8 g of Zirkonium glass beads,0.18 g of 4% Macaloid clay suspension (37) (KRONOS N.V.,Rotterdam, The Netherlands), 0.5 ml of phenol, and 50 p.l of10% sodium dodecyl sulfate were added, and the cells weredisrupted by high-speed vortexing (2 min per cycle for threecycles). Total RNA was separated from DNA, protein, and celldebris by centrifugation. The supernatant contains the RNA,and the pellet, consisting of glass beads, phenol, Macaloid, andcell debris, contains DNA and protein. Finally the supernatantwas treated with phenol-chloroform, and the RNA was precip-itated with ethanol. RNA was denatured with glyoxal (37),adjusted to a final volume of 250 pL. with sterile water, anddotted on a GeneScreen Plus membrane (New England Nu-clear) by using a dot blot apparatus. The membrane washybridized with a [y-32P]ATP-end-labeled (37) antisense probe(primer GUS-AS) specific for the gusA gene with the sequence5'-GGGTTGGGGTlTlCTACAGGACGTA, ranging frompositions 325 to 298 (numbering according to reference 23).Following autoradiography, dots were cut out and total radio-activity was determined by using a liquid scintillation counter.

Primer extension was performed by annealing 20 ng ofoligonucleotide GUS-AS to 15 p.g of RNA in 70 mM Trishydrochloride (pH 8.3)-14 mM MgCl2-14 mM dithiothrei-tol-33 U of RNasin (Promega Corp., Madison, Wis.) in a totalvolume of 15 p.1 for 5 min at 65°C. The mixture was allowed tocool to room temperature, adjusted to 20 p. by adding dCTP,

m

I ~~~~~~

VOL. 60, 1994

1-

on January 9, 2021 by guesthttp://aem

.asm.org/

Dow

nloaded from

590 PLATTEEUW ET AL.

dGTP, and dYTP (final concentration, 100 FM each); 15 pLCiof [a-32P]dATP; and 20 U of Moloney murine leukemia virusreverse transcriptase, and incubated for 30 min at 42°C.Samples were precipitated with ethanol, and the pellets were

dissolved in 5 [L ofTE buffer and 5 [LI loading buffer, boiled for3 min, and subsequently electrophoresed on a sequencing gelin parallel with a sequencing reaction obtained with the same

oligonucleotide primer.Nucleotide sequence accession number. The Lactococcus

lactis phage (SKllG promoter fragment sequence has beensubmitted to GenBank and assigned accession no. L08810.

RESULTS

Construction of a gusA promoter probe vector. A 1.8-kbEcoRI-HindIII fragment of pRAJ294 (26), which contains theE. coli gusA gene including its translation initiation signals, wascloned into plasmid pNZ124, a versatile, polylinker-containingvector containing the broad-host-range replicon of pSH71(14). The resulting plasmid, designated pNZ270, contains twoBamHI sites, one in the polylinker and the other in the gusAgene. The BamHI site in the gusA gene was removed byexchanging the SnaBI-FokI fragment of pNZ270 with that ofpRAJ260 (23), which contains no BamHI, allowing cloninginto the BamHI site of the polylinker. The resulting plasmid,pNZ272 (Fig. 2), was used to generate transcriptional fusionswith the gusA gene and to analyze 3-glucuronidase productionin LAB. An improved derivative of pNZ272 was constructed byinserting the double-stranded oligonucleotide 5'-AA1TGGCGGCCGCTAGCTAGCTAG/5 '-GTCCTAGCTAGCTAGCGGCCGCG (stop codons are underlined) into pNZ272digested with EcoRI and AvaIl. The resulting plasmid,pNZ273, contains translational stops in all reading frames andan unique Notl site.

Introduction of pNZ272 into LAB and analysis of ,-glucu-ronidase production. Plasmid pNZ272 was introduced intofour strains belonging to three different species of LAB (Table1) with high efficiency (104 to 106 chloramphenicol-resistanttransformants per jLg of DNA); it was maintained in thesestrains without any detectable structural instability. None ofthe transformants nor the untransformed host strains showedblue colonies on plates containing X-Gluc. In addition, cellextracts of the untransformed LAB and the transformantsharboring pNZ272 did not contain any detectable 3-glucuroni-dase activity, even after extended incubation for more than 18h at 37°C (results not shown). These results show that the LABstrains used lack endogenous 3-glucuronidase activity and thatthe promoterless gusA gene of pNZ272 is not expressed inthese strains.Random cloning of promoter fragments in pNZ272. To

show the applicability of plasmid pNZ272 as a promoter-probevector, chromosomal DNA of Lactococcus lactis MG1363 wasdigested with Sau3A, ligated to BamHI-linearized pNZ272,and transformed into strain MG1363. Of the approximately1,000 chloramphenicol-resistant transformants, 12 (1%)showed blue colonies on X-Gluc-containing plates. In a similarshotgun experiment, Sau3A-digested DNA of lactococcal bac-teriophage 4US3 (34) was used as donor DNA and yielded 8(2%) blue colonies from 400 chloramphenicol-resistant trans-formants of strain MG1363. Plasmid DNA was isolated fromthe blue colonies, and in all cases inserts with various sizeswere found (data not shown). These results show that the gus/I

gene of pNZ272 can be activated in Lactococcus lactis, illus-trating the potential of pNZ272 as a promoter-probe vector.

Analysis of defined promoters in LAB. Derivatives ofpNZ272 that contained three defined promoter inserts as

TABLE 2. Expression in LAB of the gusA gene fused to variousLactococcus lactis promoters

,B-Glucuronidase activity (mean ± SD)a for:Bacterium

pNZ275 pNZ276 pNZ278

Leuconostoc lactis Sla ± 8.5 (1.1) NDb 17 ± 0.8 (1)Lactococcus lactis 241 ± 34 (2.3) 55 ± 1.5 (2.6) 3.3 ± 0.3 (1)Lactobacillus plantarum 12 ± 0.8 (1.3) 162 ± 25 (3.9) 14 ± 0.3 (1)Lactobacillus casei 5.7 ± 0.18 (1.3) 301 ± 18 (1.7) 63 ± 5.3 (1)

a The 3-glucuronidase activity is expressed in nanomoles per minute permilligram of protein. Each value is the mean and standard deviation of at leastthree determinations. The number in parentheses indicates the relative copynumber, as calculated by determining the radioactivity obtained by hybridizationof total DNA with probes for the gusA gene and the 16S rRNA genes (seeMaterials and Methods).

b ND, not determined owing to the structural instability of the plasmid in thishost.

shown in Fig. 2 were constructed. All resulting plasmidsexpressed the gusA gene in E. coli KW1. The plasmids weretransformed into the four different LAB used in this study(Table 1), and chloramphenicol-resistant colonies were ana-lyzed for 3-glucuronidase activity. Plasmid DNA was isolatedfrom transformants from all LAB strains, and its integrity wasverified by restriction enzyme digestions. All plasmids weremaintained without apparent changes except for Leuconostoclactis harboring plasmid pNZ276 that showed structural insta-bility. This instability was obvious from the high frequency(99%) of white colonies on plates containing X-Gluc. Whenthe few blue colonies were spread on plates containing X-Gluc,white colonies appeared again with a high frequency (approx-imately 99%). The loss of P-glucuronidase activity appeared tobe due to a deletion in the gus/I gene (data not shown). Colonyformation in all strains was accompanied by the developmentof a blue color on plates containing X-Gluc, except forLactococcus lactis harboring pNZ278 and Lactobacillus caseiharboring pNZ275. Colonies of these two strains, which con-tained lower activities of ,-glucuronidase (see below), turnedblue on plates containing X-Gluc only after storage at 4°C for24 h.

Expression of the gusA gene in LAB. Cell extracts of theLAB harboring the gusA-expressing plasmids containing thedefined promoters were prepared, and 3-glucuronidase activitywas assayed. In addition, the total DNA of the strains wasisolated and the relative copy number of the gus/I-expressingplasmids was determined (Table 2). Within a single species thecopy number was relatively constant, but considerable differ-ences in 3-glucuronidase activity were observed among thevarious promoter configurations. To determine whether thesedifferences in 3-glucuronidase activity indeed reflected differ-ences in transcriptional activity, we analyzed the gusA/-specificmRNA by using the GUS-AS primer, which is complementaryto the gus/I coding region. Dot blot analysis (results not shown)and quantitative primer extension (see below) experimentsshowed a good correlation between the 3-glucuronidase activ-ity and gus/I expression. The highest level of gus/I mRNA andspecific 3-glucuronidase activity was found in Lactobacilluscasei harboring pNZ276 with the lacA promoter, which is lessefficient in its original host, Lactococcus lactis. The usp45promoter of pNZ275 showed the highest activity in Lactococ-cus lactis (see below), whereas the bacteriophage 4SK11Gpromoter in pNZ278 showed a more than 25-fold-lower gus/Iexpression in this host. A similar phenomenon was found inLeuconostoc lactis, although the difference was less pro-nounced. In contrast, pNZ276 containing the lacA promoter

APPL. ENVIRON. MICROBIOL.

on January 9, 2021 by guesthttp://aem

.asm.org/

Dow

nloaded from

gusA GENE AS A REPORTER GENE IN LAB 591

A G C T 1 2 3 4A

A

T

A

T

G

T

T

T

*A

T

T

C

A

A

C

C

G

FIG. 3. Primer extension products obtained with RNA from LABharboring pNZ275 containing the usp45 promoter. The relevantnucleotide sequences are indicated, and the determined transcrip-tional start site is marked by an asterisk. Lanes: A, G, C, T, sequence

reactions; 1, Lactococcus lactis; 2, Lactobacillus plantarum; 3, Leu-conostoc lactis; 4, Lactobacillus casei.

showed highest levels of gusA mRNA and 3-glucuronidaseactivity in the lactobacilli, whereas in these hosts pNZ275containing the usp45 promoter showed the lowest P-glucuroni-dase activity. The bacteriophage XSK11G promoter appearedto be the least efficient promoter in Lactococcus lactis andLeuconostoc lactis but not in the tested lactobacilli.

Primer extension mapping. The transcriptional start sites ofthe three promoters in the different LAB strains were deter-mined by primer extension experiments. In Lactococcus lactisand the two Lactobacillus species harboring pNZ276, primerextension products of identical size were found. The transcrip-tional initiation site of the lacA promoter was identical to thatdetermined previously in Lactococcus lactis (48). Transcriptioninitiation at the bacteriophage 4SK11G promoter (Fig. 1) alsoappeared identical in all four LAB harboring pNZ278. Finally,the transcriptional start site of the usp45 promoter was alsofound to be identical in the four different LAB harboringpNZ275 (Fig. 3) and corresponds to that previously deter-mined (44). An additional, smaller primer extension productwas obtained with RNA from Leuconostoc lactis (lane 3).Although this may be due to limited RNA degradation, we

cannot rule out the possibility that transcription initiation alsooccurs at position +5 in this host.

Since the primer extension experiments were carried out

with excess primer, the band intensities of the cDNA productsreflect the amount of template mRNA in the extracts andhence the promoter strength (48). This is illustrated by theband intensities of the cDNA products obtained in the primerextension experiments with RNA from LAB harboringpNZ275 containing the usp45 promoter (Fig. 3). A goodcorrelation was observed between the amount of labeledprimer extension product and the ,-glucuronidase activities(Table 2). The RNA isolated from Lactococcus lactis harboringpNZ275 resulted in the band with the highest labeling inten-sity, whereas that from Lactobacillus casei harboring pNZ275gave the weakest signal. The primer extension products ob-tained with RNA from Leuconostoc lactis and Lactobacillusplantarum harboring pNZ275 showed intermediate labelingintensities.

DISCUSSIONIn this paper we have described the construction and use in

LAB of pNZ272, a promoter-probe vector based on the E. coligusA gene and the heterogramic replicon of the lactococcalplasmid pSH71 (14). This vector allows application of the

well-established advantages of the gusA gene and its product,-glucuronidase (25) in LAB and other bacteria that sustainthe promiscuous replication of the vector. Following its con-struction in E. coli, plasmid pNZ272 could be readily intro-duced and maintained without apparent structural changes infour different LAB strains belonging to the species Lactococ-cus lactis, Lactobacillus casei, Lactobacillus plantarum, andLeuconostoc lactis. All untransformed LAB lacked detectable13-glucuronidase activity, and the gusA gene of pNZ272 was notexpressed in these LAB. Endogenous P-glucuronidase activityhas been found in gram-positive bacteria belonging to thegenera Staphylococcus and Streptococcus (52). In addition,3-glucuronidase has been found in two Bifidobacterium breve

strains (10). However, to the best of our knowledge thepresence of P-glucuronidase has not been reported in LAB.This and our present data showing the absence of endogenousactivity in three species of LAB suggest that pNZ272 also canbe used in other LAB.The applicability of pNZ272 in isolating DNA fragments

with promoter activity was shown in shotgun cloning experi-ments with chromosomal and bacteriophage DNA in Lacto-coccus lactis. Although no efforts were made to preventself-ligation of pNZ272 and the donor DNA was digested tocompleteness, up to 2% of the transformants showed P-glucu-ronidase activity.The promiscuous replication properties of pNZ272 allowed

investigation and comparison of the efficiency of characterizedpromoters in LAB. For this purpose, we cloned in pNZ272three Lactococcus lactis promoters derived from plasmid(lacA), chromosomal (usp45), and bacteriophage (4SK11G)DNA. The promoter-containing fragments showed readilydetectable levels of 3-glucuronidase activity in E. coli and thetested LAB. The copy number of the plasmids was relativelyconstant within a single species, which facilitated the interpre-tation of the transcriptional fusion experiments. All plasmidswere maintained without detectable loss of integrity in theLAB hosts, except for pNZ276, a pNZ272 derivative contain-ing the lacA promoter, which showed structural instability inLeuconostoc lactis. Further studies showed that this was due toa deletion in the gusA gene. Similar instability was observedwhen lacR promoter fragments were cloned upstream of gusAin pNZ272 in Lactococcus lactis (47). Since pNZ272 and itsother derivatives could be stably maintained in LAB, weconclude that the instability of pNZ276 in Leuconostoc lactiscan be attributed to the nature of its promoter-containinginsert rather than the vector part or the gusA gene.The efficiencies of the three cloned promoters appeared to

differ considerably among the different LAB, whereas the copynumbers of the various plasmids were similar within a strain(Table 2). Substantial differences in promoter efficiency weredetected within a single species, notably in Lactobacillus caseiand in Lactococcus lactis, even when corrected for the smalldifferences in copy number. None of the promoters showed anoverall high 3-glucuronidase activity in any of the tested LAB.pNZ275 containing the usp45 promoter showed the highest,-glucuronidase activity in the mesophilic cocci, whereaspNZ276 with the lacA promoter showed the highest gusAexpression in the lactobacilli.

Dot-blot analysis and quantitative primer extension experi-ments (Fig. 3) showed a good correlation between the ,-glu-curonidase activities and the gusA mRNA levels, demonstrat-ing that gusA is a suitable reporter gene for promoter analysisin LAB. Recent experiments have shown that the gusA re-porter gene has been valuable in analyzing the regulation ofthe prtP and prtM promoters in Lactococcus lactis, which arecontrolled by the composition of the growth medium (33).

VOL. 60, 1994

on January 9, 2021 by guesthttp://aem

.asm.org/

Dow

nloaded from

592 PLATTEEUW ET AL.

The primer extension experiments showed that transcriptionfrom the three studied promoters is initiated at the same startsite in the four LAB strains, albeit with different efficiencies.These results indicate that efficient transcription initiation inLAB is dependent on host-specific interactions with the pro-moter region. This implies that dedicated promoters should beselected for efficient expression in LAB. The described pro-moter-screening vector pNZ272 and its derivative pNZ273have all the properties that allow for a simple selection andcharacterization of such promoters.

ACKNOWLEDGMENTS

We thank Kate Wilson for the generous gift of plasmids and strainsand for communicating results prior to publication and Nicolette Klijn,Martien van Asseldonk, and Rutger van Rooijen for providing probesand promoters. We are grateful to Mieke Lexmond for technicalassistance in an early phase of this work.

Part of this work was financially supported by the BRIDGE Pro-gramme of the Commission of European Communities (contractBIOT-CT91-0263).

REFERENCES1. Achen, M. G., B. E. Davidson, and A. J. Hillier. 1986. Construction

of plasmid vectors for the detection of streptococcal promoters.Gene 45:45-49.

2. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extractionprocedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1517.

3. Bojovic, B., G. Djordjevic, and L. Topisirovic. 1991. Improvedvector for promoter screening in lactococci. AppI. Environ. Mi-crobiol. 57:358-388.

4. Bradford, M. M. 1976. A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 12:248-254.

5. Casadaban, M. J., and S. N. Cohen. 1980. Analysis of gene controlsignals by DNA fusion and cloning in Escherichia coli. J. Mol. Biol.138:179-207.

6. Chang, S., and S. N. Cohen. 1979. High frequency transformationof B. subtilis protoplasts by plasmid DNA. Mol. Gen. Genet.168:111-115.

7. Chassy, B. M., and L. Flickinger. 1987. Transformation of Lacto-bacillus casei by electroporation. FEMS Microbiol. Lett. 44:173-177.

8. David, S., G. Simons, and W. M. de Vos. 1989. Plasmid transfor-mation by electroporation of Leuconostoc paramesenteroides andits use in molecular cloning. Appl. Environ. Microbiol. 55:1483-1489.

9. David, S., H. Stevens, M. van Riel, G. Simons, and W. M. de Vos.1992. Leuconostoc lactis 3-galactosidase is encoded by two over-lapping genes. J. Bacteriol. 174:4475-4481.

10. DeMan, J. C., M. Rogosa, and M. E. Sharpe. 1960. A medium forthe cultivation of lactobacilli. J. Bacteriol. 170:2796-2801.

11. Desjardins, M.-L., D. Roy, and J. Goulet. 1990. Growth ofbifidobacteria and their enzyme profiles. J. Dairy Sci. 73:299-307.

12. de Vos, W. M. 1987. Gene cloning and expression in lacticstreptococci. FEMS Microbiol. Rev. 46:281-295.

13. de Vos, W. M., and M. J. Gasson. 1989. Structure and expressionof the Lactococcus lactis gene for phospho-I-galactosidase (lacG)in Escherichia coli and L. lactis. J. Gen. Microbiol. 135:1833-1846.

14. de Vos, W. M., and G. Simons. 1987. Methods for preparingproteins using transformed lactic acid bacteria. European PatentSpecification 0 228 726 Al.

15. de Vos, W. M., and G. Simons. 1988. Molecular cloning of lactosegenes in dairy lactic streptococci: the phospho-3-galactosidase and3-galactosidase genes and their expression products. Biochimie70:461-473.

16. de Vos, W. M., H. M. Underwood, and F. L. Davies. 1984. Plasmidencoded bacteriophage resistance in Streptococcus cremoris SK11.FEMS Microbiol. Lett. 23:175-178.

17. de Vos, W. M., G. Venema, U. Canosi, and T. A. Trautner. 1981.Plasmid transformation in Bacillus subtilis: fate of plasmid DNA.

Mol. Gen. Genet. 181:424-433.18. Feldhaus, M. J., V. Hwa, Q. Cheng, and A. A. Salyers. 1991. Use

of an Escherichia coli 3-glucuronidase gene as a reporter gene forinvestigation of Bacteroides promoters. J. Bacteriol. 173:4540-4543.

19. Gasson, M. J. 1983. Plasmid complements of Streptococcus lactisNCDO 712 and other lactic streptococci after protoplast-inducedcuring. J. Bacteriol. 154:1-9.

20. Graves, M. C., and J. C. Rabinowitz. 1986. In vivo and in vitrotranscription of the Clostridium pasteurianum ferredoxine gene.Evidence for "extended" promoter elements in Gram-positiveorganisms. J. Biol. Chem. 261:11409-11415.

21. Hickey, M. W., A. J. Hillier, and R. Jago. 1986. Transport andmetabolism of lactose, glucose, and galactose in homofermenta-tive lactococci. Appl. Environ. Microbiol. 51:825-831.

22. Holo, H., and I. F. Nes. 1989. High-frequency transformation byelectroporation of Lactococcus lactis subsp. cremoris grown withglycine in osmotically stabilized media. Appl. Environ. Microbiol.55:3119-3123.

23. Jefferson, R. A., S. M. Burgess, and D. Hirsh. 1986. 3-Glucuroni-dase from Escherichia coli as a gene-fusion marker. Proc. Natl.Acad. Sci. USA 83:8447-8451.

24. Jefferson, R. A., T. A. Kavanagh, and M. W. Bevan. 1987. GUSfusions: 3-glucuronidase as a sensitive and versatile gene fusionmarker in higher plants. EMBO J. 6:3901-3907.

25. Jefferson, R. A., M. Klass, N. Wolf, and D. Hirsh. 1987. Expressionof chimeric genes in Caenorhabditis elegans. J. Mol. Biol. 193:41-46.

26. Jefferson, R. A., and K. J. Wilson. Personal communication.27. Jefferson, R. A., and K. J. Wilson. 1991. The GUS gene fusion

system, p. 1-33. In S. Gelvin, R. Schilperoort, and D. P. Verma(ed.), Plant molecular biology manual. Kluwer Academic Publish-ers, Dordrecht, The Netherlands.

28. Jimeno, J., M. Casey, and F. Hofer. 1984. The occurrence of3-galactosidase and I-phosphogalactosidase in Lactobacillus casei

strains. FEMS Microbiol. Lett. 25:275-278.29. Josson, K., T. Scheirlinck, F. Michiels, C. Platteeuw, P. Stansens,

H. Joos, P. Dhaese, M. Zabeau, and J. Mahillon. 1989. Charac-terization of a Gram-positive broad-host-range plasmid isolatedfrom Lactobacillus hilgardii. Plasmid 21:9-20.

30. Klijn, N., C. Bovie, J. Dommes, J. D. Hoolwerf, C. B. van derWaals, A. H. Weerkamp, and F. F. J. Nieuwenhof. Submitted forpublication.

31. Leenhouts, K. J., J. Kok, and G. Venema. 1989. Campbell-likeintegration of heterologous plasmid DNA into the chromosome ofLactococcus lactis subsp. lactis. Appl. Environ. Microbiol. 55:394-400.

32. Ludwig, W., E. Seewaldt, R. Klipper-Balz, K. H. Schleifer, L.Magrum, C. R. Fox, and E. Stackebrandt. 1985. The phylogeneticposition of Streptococcus and Enterococcus. J. Gen. Microbiol.131:543-551.

33. Marugg, J., P. G. Bruinenberg, and W. M. de Vos. Unpublisheddata.

34. Platteeuw, C., and W. M. de Vos. 1992. Location, characterizationand expression of lytic enzyme encoding gene, lytA, of Lactococcuslactis bacteriophage 4US3. Gene 118:115-120.

35. Renault, P., C. Gaillardin, and H. Heslot. 1989. Product of theLactococcus lactis gene required for malolactic fermentation ishomologous to a family of positive regulators. J. Bacteriol. 171:3108-3114.

36. Roberts, I. N., R. P. Oliver, P. J. Punt, and C. A. M. J. J. van denHondel. 1989. Expression of the Escherichia coli ,-glucuronidasegene in industrial and phytopathogenic filamentous fungi. Curr.Genet. 12:231-233.

37. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labo-ratory, Cold Spring Harbor, N.Y.

38. Sanger, F., A. R. Coulson, B. G. Barell, A. J. H. Smith, and B. A.Roe. 1980. Cloning in single-stranded bacteriophages as an aid torapid DNA sequencing. J. Mol. Biol. 143:161-178.

39. Sharma, S. B., and E. R. Singer. 1990. Temporal and spatialregulation of the symbiotic genes of Rhizobium meliloti in plantsrevealed by transposon TnS-gusA. Genes Dev. 4:344-356.

APPL. ENVIRON. MICROBIOL.

on January 9, 2021 by guesthttp://aem

.asm.org/

Dow

nloaded from

gusA GENE AS A REPORTER GENE IN LAB 593

40. Simons, G., H. Buys, R. Hoger, E. Koenhen, and W. M. De Vos.1990. Construction of a promoter-probe vector for lactic acidbacteria using the lacG gene of Lactococcus lactis. J. Ind. Micro-biol. 31:31-39.

41. Terzaghi, P. E., and W. E. Sandine. 1975. Improved medium forlactic streptococci and their bacteriophage. Appl. Environ. Micro-biol. 29:807-813.

42. Tinoco, I., P. N. Borer, B. Denger, M. D. Levine, 0. C. Uhlenbeck,D. M. Crothers, and J. Gralla. 1973. Improved estimation onsecondary structure in ribonucleic acids. Nature (London) NewBiol. 246:40-41.

43. van Asseldonk, M. Unpublished results.44. van Asseldonk, M., G. Rutten, M. Oteman, R. J. Siezen, W. M. de

Vos, and G. Simons. 1990. Cloning of usp45, a gene encoding asecreted protein from Lactococcus lactis subsp. lactis MG1363.Gene 95:155-160.

45. van de Guchte, M., J. Kok, and G. Venema. 1992. Gene expressionin Lactococcus lactis. FEMS Microbiol. Rev. 88:73-92.

46. van der Vossen, J. M. B., J. Kok, and G. Venema. 1985. Construc-tion of cloning, promoter-screening, and terminator-screeningshuttle vectors for Bacillus subtilis and Streptococcus lactis. Appl.Environ. Microbiol. 50:2452-2457.

47. van Rooien, R. J. Personal communication.48. van Rooijen, R. J., M. J. Gasson, and W. M. de Vos. 1992.

Characterization of the Lactococcus lactis lactose operon pro-moter: contribution of flanking sequences and LacR repressor topromoter activity. J. Bacteriol. 174:2273-2280.

49. Vieira, J., and J. Messing. 1982. The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing withsynthetic universal primers. Gene 19:259-268.

50. Williams, D. M., E. J. Duvall, and P. S. Lovett. 1981. Cloningrestriction fragments that promote expression of a gene in Bacillussubtilis. J. Bacteriol. 146:1162-1165.

51. Wilson, K. J., K. E. Giller, and R. A. Jefferson. 1991. P-Glucuroni-dase (GUS) operon fusions as a tool for studying plant-microbeinteractions, p. 226-229. In H. Hennecke and D. P. S. Verma (ed.),Advances in molecular genetics of plant-microbe interactions, vol.1. Kluwer Academic Publishers, Dordrecht, The Netherlands.

52. Wilson, K. J., S. G. Hughes, and R A. Jeferson. 1992. TheEscherichia coli gus operon: introduction and expression of the gusoperon in E. coli and the occurrence and use of GUS in otherbacteria, p. 7-22. In S. R. Gallagher (ed.), GUS protocols: usingthe GUS gene as a reporter of gene expression. Academic Press,Inc., New York.

VOL. 60, 1994

on January 9, 2021 by guesthttp://aem

.asm.org/

Dow

nloaded from