equine embryos produced in vitro how much · pdf filereported equine pregnancy produced by...
TRANSCRIPT
![Page 1: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/1.jpg)
EQUINE EMBRYOS PRODUCED IN VITRO: HOW MUCH DO THEY MISS A MARE?
Katrien Smits
Thesis submitted in fulfillment of the requirements for the degree of Doctor in Veterinary
Sciences (PhD), Faculty of Veterinary Medicine, Ghent University, 2010
Promotor: Prof. Dr. A. Van Soom
Co-Promotor: Prof. Dr. L. Peelman
Faculty of Veterinary Medicine
Department of Reproduction, Obstetrics and Herd Health
![Page 2: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/2.jpg)
Cover photo and design: Maarten Hoogewijs
ISBN: 978-90-5864-235-6
![Page 3: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/3.jpg)
Live as if you were to die tomorrow.
Learn as if you were to live forever.
Mahatma Gandhi
![Page 4: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/4.jpg)
![Page 5: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/5.jpg)
TABLE OF CONTENTS LIST OF ABBREVIATIONS ............................................................................................................................... 1
CHAPTER 1 GENERAL INTRODUCTION ..................................................................................................... 5
CHAPTER 2 AIMS OF THE THESIS ........................................................................................................... 33
CHAPTER 3 THE IN VITRO PRODUCTION OF EQUINE EMBRYOS ............................................................ 37
3.1 A DIFFERENT APPROACH TO THE IN VITRO PRODUCTION OF HORSE EMBRYOS: A PILOT STUDY
OF LASER-ASSISTED VERSUS PIEZO DRILL ICSI ............................................................................ 39
3.2 BIRTH OF THE FIRST ICSI-FOAL IN THE BENELUX ........................................................................ 49
CHAPTER 4 DETERMINATION OF A SET OF RELIABLE REFERENCE GENES FOR RT-QPCR IN IN VIVO
DERIVED AND IN VITRO PRODUCED EQUINE BLASTOCYSTS ............................................... 59
CHAPTER 5 IN VIVO DERIVED HORSE BLASTOCYSTS SHOW TRANSCRIPTIONAL UPREGULATION OF
DEVELOPMENTALLY IMPORTANT GENES COMPARED TO IN VITRO PRODUCED HORSE
BLASTOCYSTS ...................................................................................................................... 77
CHAPTER 6 INFLUENCE OF THE UTERINE ENVIRONMENT ON THE DEVELOPMENT OF IN VITRO
PRODUCED EQUINE EMBRYOS.......................................................................................... 107
CHAPTER 7 GENERAL DISCUSSION ....................................................................................................... 135
SUMMARY ................................................................................................................................................. 157
SAMENVATTING ........................................................................................................................................ 163
DANKWOORD/ACKNOWLEDGEMENTS ..................................................................................................... 169
CURRICULUM VITAE .................................................................................................................................. 173
BIBLIOGRAPHY .......................................................................................................................................... 175
ADDENDUM 1 PROTOCOL IN VITRO PRODUCTION EQUINE EMBRYOS ............................................ 179
ADDENDUM 2 SUPPRESSION SUBTRACTIVE HYBRIDIZATION .......................................................... 185
ADDENDUM 3 REVERSE TRANSCRIPTION QUANTITATIVE POLYMERASE CHAIN REACTION . .......... 187
![Page 6: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/6.jpg)
![Page 7: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/7.jpg)
1
LIST OF ABBREVIATIONS ACTB
AI
ART
BEX2
cDNA
COC
Cqvalue
CZB medium
DMEM-F12
DPBS
ET
FABP3
FAF-BSA
FCS
GAPDH
H2A/I
hCG
HEPES
HPRT
HSP90AA1
ICSI
IVC
IVF
IVM
IVP
KSOM
MII
MCM7
MEM
MOBKL3
beta actin
artificial insemination
artificial reproductive technologies
brain expressed X-linked 2
complementary deoxyribonucleic acid
cumulus oocyte complex
quantification cycle value
Chatot-Ziomek-Bavister medium
Dulbecco's modified Eagle medium: nutrient mixture F-12
Dulbecco's phosphate buffered saline
embryo transfer
fatty acid binding protein 3
fatty acid-free bovine serum albumin
fetal calf serum
glyceraldehyde-3-phosphate dehydrogenase
histone H2A type 1-C
human chorionic gonadotropin
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
hypoxanthine phosphoribosyltransferase 1
heat shock protein 90kDa alpha, class A member 1
intracytoplasmic sperm injection
in vitro culture
in vitro fertilization
in vitro maturation
in vitro production
simplex optimization medium with elevated K+ concentration
metaphase of the second meiotic division
minichromosome maintenance complex component 7
Eagle's minimal essential medium
mps one binder kinase activator-like 3
![Page 8: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/8.jpg)
2
ODC
OPU
PBS
PCR
pFSH
pLH
POU5F1
RNA
RPL32
RT
RT-qPCR
SDHA
SOF
SSH
SR
TALP
TCM199
TUBA4A
UBC
ornithine decarboxylase
ovum pick-up
phosphate buffered saline
polymerase chain reaction
porcine follicle-stimulating hormone
porcine luteinizing hormone
POU domain, class 5, transcription factor 1
ribonucleic acid
ribosomal protein L32
reverse transcription
reverse transcription quantitative real time polymerase chain reaction
succinate dehydrogenase complex, subunit A
synthetic oviduct fluid
suppression subtractive hybridization
serum replacement
Tyrode’s albumin-lactate-pyruvate
tissue culture medium 199
tubulin, alpha 4a
ubiquitin C
![Page 9: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/9.jpg)
![Page 10: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/10.jpg)
![Page 11: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/11.jpg)
CHAPTER 1
GENERAL INTRODUCTION
![Page 12: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/12.jpg)
![Page 13: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/13.jpg)
Chapter 1
7
1.1 ARTIFICIAL REPRODUCTIVE TECHNOLOGIES IN THE HORSE
Up to the end of the nineteenth century, the vast majority of horses were bred by natural
cover. The introduction of artificial reproductive technologies (ART) started with the first
reported equine pregnancy produced by artificial insemination (AI), which is the placement of
stallion sperm into a mare’s uterus (Heape, 1898). Nowadays, the majority of mares are
impregnated by AI using fresh, cooled or frozen-thawed sperm, thereby providing the
opportunity for genetically valuable stallions to produce more offspring. On the female side,
genetic selection can be accelerated by recovering an embryo from the uterus of a valuable
donor mare and subsequent embryo transfer (ET) to a recipient mare, which carries the foal to
term (for review see Stout, 2006). The first successful ET in horses was achieved in 1974 (Oguri
and Tsutsumi, 1974) and ET is now a routine procedure in practice (Scherzer et al., 2008). In
both of these techniques, early embryonic development occurs in the female reproductive
tract, i.e. in vivo. This is in contrast to in vitro production (IVP) of embryos, in which fertilization
and early development occur under laboratory conditions outside the mare. In vitro production
of equine embryos only evolved recently and is the subject of this thesis.
1.2 EARLY EQUINE EMBRYONIC DEVELOPMENT IN VIVO
As for all mammalian oocytes, the equine oocyte is arrested in the prophase of the first meiotic
division during foetal development, and only a few hundred selected oocytes ever reach the
second metaphase (MII) stage prior to ovulation (King et al., 1987; Pierson, 1992). Fertilization
of the mature oocyte occurs at the ampulla-isthmus junction of the oviduct, where the
developing embryo remains during its subsequent cleavage divisions (Betteridge et al., 1982;
McKinnon et al., 1992; Weber et al., 1996). After 5 days at the ampulla-isthmus junction,
transport through the oviductal isthmus occurs rapidly and the late morula or early blastocyst
enters the uterus through the utero-tubal junction 144-156 h after ovulation (Oguri and
Tsutsumi, 1972; Weber et al., 1996; Battut et al., 1997) (Figure 1). Unfertilized eggs on the
other hand are retained in the oviduct (Van Niekerk and Gerneke, 1966). This selective
oviductal transport is linked to the stage specific production of prostaglandin E2 by the equine
![Page 14: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/14.jpg)
Chapter 1
8
conceptus, an example of extremely early embryo-maternal communication or interaction
(Weber et al., 1991).
Figure 1 Equine embryonic development in vivo. Fertilization (1,2) and early cleavage (3,4,5)
occur at the ampulla-isthmic junction. After rapid transport through the istmus, the morula (6)
or early blastocyst (7) reaches the uterus. A glycoprotein capsule is formed between the
trophectoderm and the zona pellucida, which is subsequently shed from the rapidly expanding
blastocyst (8).
![Page 15: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/15.jpg)
Chapter 1
9
Another exceptional feature of the equine is the formation of an acellular glycoprotein capsule.
This structure was first described over a century ago (Bonnet, 1889; Krölling, 1937), but most of
the research has been performed in the past 40 years (Marrable and Flood, 1975; Betteridge et
al., 1982; Flood et al., 1982). Upon arrival of the embryo in the uterus, the capsule is formed
between the trophectoderm and the zona pellucida of the equine blastocyst and it surrounds
the conceptus until around day 21 of gestation (Betteridge et al., 1982; Enders and Liu, 1991)
(Figure 2). Embryonic tertiary coats are described in several species (Betteridge, 1989; Denker,
2000). The glycoprotein capsule as present in equids shows the most similarities with the
neozona in rabbits (Betteridge, 1989; Denker, 2000).
Figure 2 Equine embryonic capsule in vivo. This figure displays the capsule of two in vivo
derived blastocysts in a different stadium of the embryonic development. A: Slightly collapsed
hatched horse blastocyst surrounded by a loose, overlarge capsule; B: Tight capsule between the
trophectoderm and the zona pellucida of an expanding blastocyst.
Up to day 16, the spherical equine embryo is very mobile and migrates through the uterus. This
migration is necessary to obtain maternal recognition of the pregnancy. While migrating
through the uterus, the equine conceptus signals its presence and prevents cyclical luteolysis
(Allen, 2000). The strong, elastic capsule has been suggested to protect the preimplantation
embryo during this migratory phase (Betteridge et al., 1982). The capsule also appears to be
![Page 16: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/16.jpg)
Chapter 1
10
involved in subsequent fixation (day 16-17) and orientation of the embryo (Oriol, 1994).
Throughout embryonic development, the capsule is thought to function as a ‘mailbox’,
incorporating endometrial components and transporting these to the developing embryo
(Herrler and Beier, 2000). In this way, it can be involved in the early embryo-maternal
communication. Even though the precise role is not entirely clear, the capsule has been shown
to be essential for the continuance of pregnancy (McKinnon et al., 1989; Stout et al., 2005). The
equine trophoblast is the primary source of the capsular material (Albihn et al., 2003).
However, absence of normal capsule formation in vitro implies an essential role of the maternal
environment (Hinrichs et al., 1990a; Tremoleda et al., 2003). It remains to be determined which
aspects of the uterine surroundings and which mechanisms are involved in the formation of this
intriguing component of the equine embryo.
Endometrial secretions (‘histotrophe’) are particularly important in the horse, because of the
exceptionally long pre-implantation period, during which the developing embryo totally
depends on these secretions for its nutrition (Stewart et al., 2000). In this regard, uterocalin, a
component of the uterine secretions, might be involved in capsule formation. Uterocalin, a 19
kDa protein, was first isolated using SDS-PAGE of equine embryonic capsules (Stewart et al.,
1995). Structural analysis classifies uterocalin as a member of the lipocalin family and suggests
that the primary function of uterocalin is to act as a carrier of biologically important lipids and
as a source of essential amino acids for the developing conceptus (Suire et al., 2001; Kennedy,
2004). Substantial concentrations of uterocalin have been associated with the capsule, and
passage through the capsule to the developing conceptus has been evidenced by the presence
of uterocalin on the trophoblast cells (Crossett et al., 1996; Ellenberger et al., 2008).
Furthermore, uterocalin is positively charged. This facilitates its binding to the negatively
charged sialic acid residues of the capsule (Oriol et al., 1993; Crossett et al., 1998). Uterocalin is
secreted by the endometrial glands in a progesterone dependant way during both dioestrus
and early pregnancy (Stewart et al., 1995). Interestingly, the high concentrations of uterocalin
in the uterus, which are prevailing during early pregnancy (day 6-day 23), coincide exactly with
the period during which the equine embryo is surrounded by the capsule (Crossett et al., 1998).
In summary, structural, functional and temporal associations have been made between the
![Page 17: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/17.jpg)
Chapter 1
11
maternal uterocalin and the embryonic capsule in the horse, but whether uterocalin effectively
supports the capsule formation remains to be determined.
The examples mentioned above show the important interaction between the developing
embryo and the maternal genital tract. In vivo derived horse embryos have been exposed to the
maternal genital tract and are supposed to have developed normally. Such equine embryos
represent therefore interesting study material and can be used as a gold standard, to which in
vitro produced embryos that have been cultured in the absence of the maternal genital tract
can be compared. Unfortunately, in vivo derived horse embryos are relatively difficult to obtain.
From the zygote to the early morula stage, they remain for a relatively long stay in the oviduct
and can only be harvested surgically. After its arrival in the uterus, a horse blastocyst can be
recovered atraumatically by uterine flushing. But even then, generally only one embryo can be
obtained per mare, since the mare is mono-ovulatory and responds only moderately to
superovulatory treatments (for review see McCue, 1996; Stout, 2006). In the experiments
described in this thesis, equine in vivo embryos were flushed at day 7, at which time they have
reached the blastocyst stage. These in vivo derived blastocysts represented the gold standard
for comparison with the in vitro produced blastocysts. When equine embryos are produced and
cultured in vitro, the absence of these maternal interactions have morphological and
developmental consequences, which will be discussed in the next chapters of this thesis.
1.3 EARLY EQUINE EMBRYONIC DEVELOPMENT IN VITRO
The in vitro production (IVP) of equine embryos consists of several important steps.
First of all, oocytes need to be collected. In the living mare, the mature oocyte can be obtained
from a preovulatory follicle by aspiration using a long needle placed through the flank of the
sedated standing mare (Vogelsang et al., 1983; Palmer et al., 1986; Hinrichs et al., 1990b).
Alternatively, several follicles can be aspirated through ultrasound guided transvaginal ovum
pick up (OPU) (Brück et al., 1992; Cook et al., 1993; Bezard et al., 1995; Meintjes et al., 1995;
Goudet et al., 1997; Galli et al., 2001). Post mortem, immature oocytes can be collected from
ovaries through either aspiration (Desjardins et al., 1985; Shabpareh et al., 1993) or scraping of
![Page 18: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/18.jpg)
Chapter 1
12
the follicles (Del Campo et al., 1995; Dell’Aquila et al., 2001). Next, all immature oocytes must
undergo maturation in vitro (IVM). Finally, the mature oocytes must be fertilized. Conventional
in vitro fertilization (IVF), which implies the co-incubation of mature COCs with capacitated
sperm, is largely unsuccessful in horses. Therefore, intracytoplasmic sperm injection (ICSI), a
micromanipulation technique during which a single sperm cell is injected into the cytoplasm of
a mature oocyte, is the method of choice. These fertilized oocytes are then cultured in vitro
(IVC) up to the blastocyst stage, which can be transferred to the uterus of a recipient mare (ET).
Specific problems during these various steps of the IVP of equine embryos have hindered rapid
progress towards large scale equine IVP and will be covered in the subjoined paragraphs. The
general protocol that was followed throughout the thesis is described in Addendum 1.
1.3.1 Oocyte collection
Oocytes available for research are scarce, since the access to abattoir ovaries is limited. In some
countries, such as the USA, all horse abattoirs have been closed, and in these countries all
oocytes must be collected using the time consuming technique of in vivo collection through
OPU (McPartlin et al., 2007). Furthermore, the very tight connection between the equine
oocyte and the follicle wall requires scraping or vigorous flushing of the follicle to recover the
oocyte (Hawley et al., 1995).
Figure 3 Ex vivo collection of horse oocytes by means of aspiration. The follicular fluid is
aspirated (-100 mm Hg) (A), the follicles are scraped with the aspirating needle and
simultaneously flushed (B) with heparin (25IU/ml). After aspiration of the superficial follicles,
the ovary is cut to reach the follicles inside (C).
![Page 19: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/19.jpg)
Chapter 1
13
Oocytes can be recovered ex vivo either by incising the follicle and scraping the wall with a
bone curette or by aspiration of the follicular contents (Figure 3). An experiment conducted in
our laboratory comparing scraping with aspiration, indicated that the scraping technique is
associated with more cumulus cells surrounding the recovered oocytes, when compared to
aspiration (Table 1). Our observations are in agreement with Dell’Aquila et al. (2001), who
reported 53% of the aspirated oocytes to have only a partial cumulus, while this was only 15%
for the scraped oocytes. The presence of several layers of cumulus cells favors the classification
of the oocytes into expanded (Figure 4A) versus compact (Figure 4B) cumulus oocyte complexes
(COCs) (Hinrichs, 2010b). It is useful to be able to make an accurate distinction between the
expanded and the compact COCs, because the optimal maturation time is different for both
populations (Hinrichs et al., 1993). In other species, expanded COCs are discarded, as they
mostly originate from atretic follicles and are associated with a low developmental capacity. In
contrast, the equine expanded COCs have been shown to result in similar blastocyst rates,
when compared to compact COCs (Galli et al., 2007; Hinrichs, 2010a). When oocytes are
collected by aspiration, a significant proportion of oocytes is only surrounded by a few layers of
corona cells, which complicates an accurate classification. Despite the difficult classification of
oocytes collected by aspiration, the aspiration technique is the preferred technique for oocyte
recovery in our laboratory. This preference is largely based on the higher oocyte recovery rate
(73%) for aspiration compared to scraping (51%) in our laboratory, and by the fact that
aspiration is up to 4 times less time consuming (Using the aspiration methodology developed in
our laboratory, a trained technician can collect the same number of oocytes in one hour as two
technicians using scraping technique in two hours). It should however be pointed out that in
order to obtain as much oocytes as possible, the follicle wall is scraped repeatedly with the
point of the aspirating needle, and thus our aspiration technique is in fact a combination of the
scraping and the aspiration method. As a whole, oocyte recovery in the horse is far more time
consuming than it is in other species and for example over 10-fold more time consuming than
oocyte recovery in cattle (Galli et al., 2007). Galli et al. (2007) give the example of 4 technicians
needing 3-4 hours to collect 100 equine oocytes, while 2 technicians can collect the same
number of bovine oocytes in only 30-40 minutes.
![Page 20: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/20.jpg)
Chapter 1
14
Table 1 Oocyte collection technique. Oocytes were classified based on the expansion and
extensiveness of the surrounding cumulus cells. Oocytes were categorised as expanded COCs,
compact COCs and oocytes with only a few layers from the corona radiata. Recovery rates for
each category of oocytes were compared for two different collection techniques: scraping of the
follicle wall with a bone curette and follicular aspiration.
Total Expanded Compact Corona
Scraping 200 50 (25%) 105 (52.5%) 45 (22.5%)
Aspiration 430 68 (16%) 169 (39%) 193 (45%)
Figure 4 Immature equine cumulus oocyte complexes (magnification 100x). A: expanded COC;
B: compact COC
1.3.2 In vitro maturation
In equine, compared to bovine, a larger proportion of degenerate oocytes can be identified
after IVM of abattoir-derived oocytes (Galli et al., 2007). This post mortem degeneration affects
around 30% of the collected oocytes and substantially decreases the maturation rate.
Maturation of horse oocytes is judged after IVM and removal of the cumulus cells by assessing
the extrusion of the polar body (Figure 5), which indicates progression to metaphase II (MII).
![Page 21: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/21.jpg)
Chapter 1
15
Figure 5 Polar body (magnification 300x). The mature MII oocyte is characterized by an
extruded polar body (arrow).
However, nuclear maturation which is characterized by the extrusion of a polar body, does not
necessarily reflect the cytoplasmic maturation of the oocyte. During cytoplasmic maturation,
proteins, RNA, substrates and nutrients are accumulated, rendering the oocyte competent for
further development (Watson, 2007). This process is crucial for further embryonic development
and it is greatly influenced by the oocyte environment in vivo or in vitro. Therefore, the
maturation conditions can have a major influence on the blastocyst rate. Replacement of Tissue
Culture Medium199 (TCM199) by Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12
(DMEM-F12) for equine IVM has been shown to result in higher cleavage and blastocyst rates
without affecting the proportion of MII oocytes (Galli et al., 2007). For this reason, DMEM-F12-
based maturation medium is used in our laboratory.
1.3.3 Fertilization
Conventional in vitro fertilization (IVF), which implies the co-incubation of mature COCs with
capacitated sperm, is largely unsuccessful in horses, primarily because it is difficult to
adequately stimulate horse sperm to penetrate the zona pellucida in vitro (Alm et al., 2001;
Roasa et al., 2007). Only two foals produced by means of conventional IVF have been born to
date (Palmer et al., 1991). Even though acceptable in vitro fertilization rates were recently
![Page 22: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/22.jpg)
Chapter 1
16
reported following hyperactivation of stallion sperm with procaine (McPartlin et al., 2009), this
procedure has not yet been repeated in other laboratories.
To circumvent the problem of sperm activation in vitro, intracytoplasmic sperm injection (ICSI)
is now used for the IVP of equine embryos. This technique, using micromanipulation to inject a
single sperm cell into the cytoplasm of a mature oocyte (Figure 6), was initially developed in
Belgium for treatment of male factor infertility in humans (Palermo et al., 1992). The first ICSI
foal was produced by Squires et al. (1996), who injected in vitro matured oocytes and
transferred these oocytes to the oviduct of recipient mares.
Figure 6 Intracytoplasmic sperm injection in the horse (magnification 300x). The mature
oocyte is immobilized with the polar body at the 6 o’clock position (arrow) by aspiration with a
holding pipette at 9 o’clock. An immobilized sperm cell is injected using a fine injection pipette
at 3 o’clock.
After this initial success, several laboratories tried to implement the ICSI technique, with
variable results. In 2002, the piezo drill, a device that creates minute vibrations of the injection
pipette, was introduced for equine ICSI and, at the same time, increased cleavage rates and
more consistent results were reported (Choi et al., 2002, Galli et al., 2002). This has led to
general use of the piezo drill, even though a causal relationship with the improved results has
never been proven. Various aspects can explain the positive effect of piezo assisted ICSI. In
mice, the piezo drill was applied for ICSI and resulted in the first ICSI offspring (Kimura and
![Page 23: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/23.jpg)
Chapter 1
17
Yanagimachi, 1995). Advantages compared to conventional ICSI include a higher probability of
oolemma breakage and reduced damage to the oocyte. Moreover, the piezo might cause
increased permeabilization of the sperm membrane, which could facilitate oocyte activation
(Choi et al., 2002). The best results are obtained when a small amount of mercury is present in
the tip of the injection pipette (Ediz and Olgac, 2004). Mercury reduces the lateral oscillations
of the pipette, which reduces oocyte damage during the piercing (Ediz and Olgac, 2005). On the
other hand, mercury is a cumulative neurotoxin. Furthermore, piezo assisted
micromanipulation in mice has been associated with DNA damage (Yu et al., 2007). The possible
influence of the injection method on subsequent embryonic developmental competence,
including the advantages and disadvantages, needs to be investigated further. In this respect, it
might be interesting to consider other sperm injection technologies, like laser-assisted ICSI.
During laser-assisted ICSI, a hole is made in the zona pellucida prior to sperm injection. This
causes less oocyte disturbance than conventional ICSI. In human, the laser has been shown to
be advantageous for patients with fragile oolemmas or patients with high rates of oocyte
degeneration after conventional ICSI (Abdelmassih et al., 2002; Rienzi et al., 2004).
1.3.4 In vitro culture
As fertilized oocytes reside in the oviduct under physiological circumstances, initially sperm
injected horse oocytes were transferred to a recipient mare’s oviduct (Squires et al., 1996;
Cochran et al., 1998; McKinnon et al., 2000), with all the disadvantages associated with the
required surgery. Therefore, efforts were made to develop in vitro conditions to culture the
embryos up to the blastocyst stage, allowing transcervical transfer into the uterus. Firstly, co-
culture of embryos with different types of cells was performed. In vivo derived embryos were
cultured with oviduct cells (Battut et al., 1991) or uterine cells (Ball et al., 1993) and IVP
embryos with Vero cells (Guignot et al., 1998), cumulus cells (Li et al., 2001) or granulosa cells
(Rosati et al., 2002). Then, several defined media, like G1.2 (Choi et al., 2002) and CZB (Choi et
al., 2004) were evaluated, but blastocyst rates remained variable and below 20%. Eventually,
important progress was obtained by the finding that using DMEM-F12 as an equine embryo
culture medium yielded blastocyst development rates of up to 34% (Choi et al., 2006b).
![Page 24: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/24.jpg)
Chapter 1
18
Originally developed for cell culture, this medium contains a high glucose concentration when
compared to regular embryo culture media. Contrary to other species, equine embryos
apparently benefit from high glucose concentrations during early development (Herrera et al.,
2008). Despite these advances, the percentage of injected oocytes reaching the blastocyst stage
in clinical practice is only 10%, as recently published by one of the most experienced groups in
the field (Barbacini et al., 2010) and temporary culture in sheep oviducts still appears to yield
better results than total IVP (Lazzari et al., 2010), illustrating further the necessity for optimizing
IVC conditions for equine embryos.
1.3.5 Embryo transfer and foals
Several ICSI foals have been born to date (Squires et al., 1996; Cochran et al., 1998; McKinnon
et al., 2000; Li et al., 2001; Hinrichs et al., 2007; Galli et al., 2007). Pregnancy rates after transfer
of IVP embryos are comparable to those obtained after transfer of in vivo derived embryos
(Galli et al., 2007; Hinrichs, 2010b; Farin et al., 2010). In cattle, initial pregnancy rates are also
similar for in vivo and in vitro produced embryos, but subsequent survival is compromised by
considerable embryonic and fetal losses and the occurrence of the large offspring syndrome
(Willadsen et al., 1991; Walker et al., 1996; Niemann and Wrenzycki, 2000). The large offspring
syndrome, as observed in cattle after IVP and cloning, has not been reported in the horse. As
the application of ICSI in horses has only evolved recently and the number of foals born to date
is limited, data on possible long term influences are scarce. Initially, abnormal pregnancies
without an embryo proper were reported (Hinrichs et al., 2007). However, normal development
has been reported recently and this improved development has been contributed to more
consistent IVC conditions (Hinrichs, 2010b). An evaluation of 14 cloned foals revealed the need
for intensive support during the first week, but if the foals survived this critical period, further
development appeared to be normal (Johnson et al., 2010). As the number of IVP foals is still
limited, further research is necessary to evaluate long term consequences. Moreover, the
ability of IVP embryos to develop to normal foals remains the method of choice to evaluate the
quality of in vitro embryo production in horses: it is the ultimate proof that the equine embryos
which are produced after ICSI are not parthenogenetic or chromosomally abnormal blastocysts.
![Page 25: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/25.jpg)
Chapter 1
19
Despite an initially slow progress, IVP of equine embryos has evolved rapidly in the last decade.
Nowadays the combination of OPU, IVM, ICSI, IVC and ET is clinically available (Colleoni et al.,
2007). Since only a few normal sperm cells are required, ICSI can be applied for subfertile
stallions and even for semen which has been frozen-thawed, diluted and frozen again or for
sexed semen (Lazzari et al., 2002; Choi et al., 2006a; Squires et al., 2008). ICSI has also been
shown to be helpful in case of problems on the female side such as advanced age of the
breeding mare, degenerative endometrosis and cervical laceration (Colleoni et al., 2007).
Moreover, ICSI can be beneficial for creating offspring from valuable animals post mortem
(Hinrichs, 2005).
1.4 WHAT TO LOOK FOR WHEN EVALUATING EQUINE EMBRYOS: IN VITRO VERSUS IN VIVO
Even though the capability of establishing pregnancies is comparable for IVP and in vivo derived
equine embryos (Colleoni et al., 2007), differences between both types of embryos remain
present. Compared to their in vivo counterparts, equine IVP embryos display several
morphologic and developmental aberrations.
The kinetics of development differ, being slower in vitro than in vivo (Tremoleda et al., 2003;
Pomar et al., 2005; Rambags et al., 2005). Most equine in vivo embryos recovered 7 days after
ovulation have reached the blastocyst stage and are larger and contain more cells than their in
vitro counterparts 7 days after ICSI, which are predominantly still at the morula stage (Pomar et
al., 2005). In order to compare embryos at the same stage, Tremoleda et al. (2003) and
Rambags et al. (2005) used day 7 in vivo embryos and day 9-10 IVP embryos. Figure 7
represents an equine IVP blastocyst 9 days after ICSI and an in vivo derived blastocyst flushed 7
days after ovulation.
![Page 26: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/26.jpg)
Chapter 1
20
Figure 7 Equine blastocysts (magnification 200x). An in vitro produced blastocyst cultured for 9
days after ICSI (A) and an in vivo derived blastocyst recovered 7 days after ovulation (B).
Further morphological analysis using specific stains has revealed higher incidences of apoptotic
(Tremoleda et al., 2003; Pomar et al., 2005) and chromosomally abnormal cells (Rambags et al.,
2005) in IVP (compared to in vivo) equine embryos. Moreover IVP embryos exhibit a disturbed
microfilament distribution. A very intriguing abnormality is the failure of normal capsule
formation; even though capsular glycoproteins are formed in vitro, they fail to coalesce into the
distinct continuous capsule seen around in vivo embryos (Tremoleda et al., 2003). Two
hypotheses have been formulated to explain this phenomenon (Oriol et al., 1993; Tremoleda et
al., 2003). A first explanation is the simple dispersal of the glycoproteins in the culture medium,
impeding the critical concentration for assembling to be reached. Another possibility is the
failure of hydration and cross-linking of the capsular glycoproteins in the absence of a uterine
component. Recently, a positive effect of temporary transfer to the mare’s uterus for 2-3 days
on capsule formation of equine IVP blastocysts has been shown (Choi et al., 2009). Further
experiments are needed to reveal what is the mechanism behind this observation.
The importance of the early embryo-maternal interaction is illustrated above. When equine
embryos are produced in vitro, and therefore in the absence of the maternal tract, they differ
markedly from their in vivo counterparts. In order to bridge this difference, the IVP process
![Page 27: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/27.jpg)
Chapter 1
21
needs to be optimized. This requires fundamental insight into the aberrations in vitro and
sensitive evaluation of the impact of environmental changes. A valuable approach to achieve
this, is the assessment of the impact of the embryonic environment on gene expression levels.
It is commonly accepted that the suboptimal in vitro culture environment of embryos exerts
negative short-term effects, such as aberrations in genes involved in development and
metabolism up to the blastocyst stage. Even long-term effect with implications for the resulting
offspring have been described (Khosla et al., 2001; Fleming et al., 2004). These genetic
aberrations have been related to the use of suboptimal culture media (Fleming et al., 2004).
Differential gene expression in IVP versus in vivo derived embryos has been described in several
species, including cattle (Mohan et al., 2004; Corcoran et al., 2006; Goossens et al., 2007), pigs
(Magnani and Cabot, 2008) and mice (Fernández-González et al., 2009). In these species, the
expression level of specific genes has also been used to evaluate the effect of different embryo
culture media. The expression level of developmentally important genes can also be used to
assess the effect of specific components, like serum or cytokines in the embryo culture medium
(McElroy et al. 2008; Chin et al. 2009; Purpera et al. 2009). Some recent studies examined the
expression of specific genes in horse embryos, including the pluripotency marker POU5F1 (Choi
et al., 2009) and the embryonic receptors for estrogen and progesterone (Rambags et al.,
2008). However, large studies, evaluating gene expression in horse embryos produced in vivo
and in vitro, have not yet been reported. The genetic techniques used in this thesis, namely SSH
and RT-qPCR, are illustrated in Addendum 2 and 3.
REFERENCES
1. Abdelmassih S., Cardoso J., Abdelmassih V., Dias J.A., Abdelmassih R., Nagy Z.P. 2002.
Laser-assisted ICSI: a novel approach to obtain higher oocyte survival and embryo
quality rates. Hum Reprod 17 2694-2699.
2. Albihn A., Waelchli R.O., Samper J., Oriol J.G., Croy B.A., Betteridge K.J. 2003. Production
of capsular material by equine trophoblast transplanted into immunodeficient mice.
Reproduction 125 855-863.
3. Allen W.R. 2000. The physiology of early pregnancy in the mare. Proc AAEP 46 338-352.
![Page 28: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/28.jpg)
Chapter 1
22
4. Alm H., Torner H., Blottner S., Nurnberg G., Kanitz W. 2001. Effect of sperm
cryopreservation and treatment with calcium ionophore or heparin on in vitro
fertilization of horse oocytes. Theriogenology 56 817-829.
5. Ball B.A., Brinsko S.P., Thomas P.G., Miller P.G., Ellington J.E. 1993. Development to
blastocysts of one- to two-cell equine embryos after coculture with uterine tubal
epithelial cells. Am J Vet Res 54 1139-1144.
6. Battut I., Colchen S., Fieni F., Tainturier D., Bruyas J.F. 1997. Success rates when
attempting to nonsurgically collect equine embryos at 144, 156 or 168 hours after
ovulation. Equine Vet J Suppl 25 60-62.
7. Battut I., Bézard J., Palmer E. 1991. Establishment of equine oviduct cell monolayers for
co-culture with early equine embryos. J Reprod Fertil Suppl 44 393-403.
8. Barbacini S., Colleoni S., Duchi R., Necchi D., Lazzari G., Galli C. 2010. An update of
results obtainable with ovum pick up (OPU) intracytoplasmatic sperm injection (ICSI)
and embryo culture (IVC) in equine reproduction. Proc 5. Leipziger Tierärztekongress
304-306.
9. Betteridge K.J., Eaglesome M.D., Mitchell D., Flood P.F., Beriault R. 1982. Development
of horse embryos up to twenty two days after ovulation: observations on fresh
specimens. J Anat 135 191-209.
10. Betteridge K.J. 1989. The structure and fuction of the equine capsule in relation to
embryo manipulation and transfer Equine Vet J Suppl 8 92-100.
11. Bezard J., Goudet G., Duchamp G., Palmer E. 1995. Preovulatory maturation of ovarian
follicles and oocytes in unstimulated and superovulatory mares. Biol Reprod Monogr 1
261-271.
12. Blanco I.D.P., Devito L.G., Ferreira H.N., Araujo G.H.M., Fernandes C.B., Alvarenga M.A.,
Landim-Alvarenga F.C. 2009. Aspiration of equine oocytes from immature follicles after
treatment with equine pituitary extract (EPE) alone or in combination with hCG. Anim
Reprod Sci 114 203-209.
13. Bonnet R. 1889. Die Eihäute des Pferdes. Verh Anat Ges 3 17-38.
![Page 29: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/29.jpg)
Chapter 1
23
14. Brück I., Raun K., Synnestvedt B., Greve T. 1992. Follicle aspiration in the mare using a
transvaginal ultrasound-guided technique. Equine Vet J 24 58-59.
15. Chin P.Y., Macpherson A.M., Thompson J.G., Lane M., Robertson S.A. 2009. Stress
response genes are suppressed in mouse preimplantation embryos by granulocyte-
macrophage colony-stimulating factor (GM-CSF). Hum Reprod 24 2997-3009.
16. Choi Y.H., Love C.C., Love L.B., Varner D.D., Brinsko S.P., Hinrichs K. 2002.
Developmental competence in vivo and in vitro of in vitro-matured equine oocytes
fertilized by intracytoplasmic sperm injection with fresh or frozen-thawed sperm.
Reproduction 123 455-465.
17. Choi Y.H., Love L.B., Varner D.D., Hinrichs K. 2004. Factors affecting developmental
competence of equine oocytes after intracytoplasmic sperm injection. Reproduction
127 189-194.
18. Choi Y.H., Love C.C., Varner D.D., Hinrichs K. 2006a. Equine blastocyst development after
intracytoplasmic injection of sperm subjected to two freeze-thaw cycles. Theriogenology
65 808-819.
19. Choi Y.H., Love L.B., Varner D.D., Hinrichs K. 2006b. Holding immature equine oocytes in
the absence of meiotic inhibitors: effect on germinal vesicle chromatin and blastocyst
development after intracytoplasmic sperm injection. Theriogenology 66 955-963.
20. Choi Y.H., Harding H.D., Hartman D.L., Obermiller A.D., Kurosaka S., McLaughlin K.J.,
Hinrichs K. 2009. The uterine environment modulates trophectodermal POU5F1 levels in
equine blastocysts. Reproduction 138 589-599.
21. Cochran R., Meintjes M., Reggio B., Hylan D., Carter J., Pinto C., Paccamonti D., Godke
R.A. 1998. Live foals produced from sperm-injected oocytes derived from pregnant
mares. J Equine Vet Sci 18 736-740.
22. Colleoni S., Barbacini S., Necchi D., Duchi R., Lazzari G., Galli C. 2007. Application of
ovum pick-up, intracytoplasmic sperm injection and embryo culture in equine practice.
Proc AAEP 53 554-559.
23. Cook N.L., Squires E.L., Ray B.S., Jasko D.J. 1993. Transvaginal ultrasound-guided
follicular aspiration of equine oocytes. Equine Vet J 15 71-74.
![Page 30: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/30.jpg)
Chapter 1
24
24. Corcoran D., Fair T., Park S., Rizos D., Patel O.V., Smith G.W., Coussens P.M., Ireland J.J.,
Boland M.P., Evans A.C., Lonergan, P. 2006. Suppressed expression of genes involved in
transcription and translation in in vitro compared with in vivo cultured bovine embryos.
Reproduction 131 651-660.
25. Crossett B., Allen W.R., Stewart F. 1996. A 19 kDa protein secreted by the endometrium
of the mare is a novel member of the lipocalin family. Biochem J 320 137-143.
26. Crossett C., Suire S., Herrler A., Allen W.R., Stewart F. Transfer of a uterine lipocalin from
the endometrium of the mare to the developing equine conceptus. Biol Reprod 59 483-
490.
27. Del Campo M.R., Donoso X., Parrish J.J., Ginther O.J. 1995. Selection of follicles,
preculture oocyte evaluation, and duration of culture for in vitro maturation of equine
oocytes. Theriogenology 43 1141-1153.
28. Dell’Aquila M.E., Masterson M., Maritato F., Hinrichs K. 2001. Influence of oocyte
collection technique on initial chromatin configuration, meiotic competence, and male
pronucleus formation after intracytoplasmic sperm injection (ICSI) of equine oocytes.
Mol Reprod Dev 60 79-88.
29. Denker H.W. 2000. Structural dynamics and function of early embryonic coats. Cells
Tissues Organs 166 180-207.
30. Desjardins M., King W.A., Bousquet D. 1985. In vitro maturation of horse oocytes.
Theriogenology 23 187.
31. Ediz K., Olgac N. 2004. Microdynamics of the piezo-driven pipettes in ICSI. IEEE Trans
Biomed Eng 51 1262-1268.
32. Ediz K., Olgac N. 2005 Effect of mercury column on the microdynamics of the piezo-
driven pipettes. J Biomech Eng 127 531-535.
33. Ellenberger C., Wilsher S., Allen W.R., Hoffmann C., Kölling M., Bazer F.W., Klug J.,
Schoon D., Schoon H.-A. 2008. Immunolocalisation of the uterine secretory proteins
uterocalin, uteroferrin and uteroglobin in the mare’s uterus and placenta throughout
pregnancy. Theriogenology 70 746-757.
![Page 31: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/31.jpg)
Chapter 1
25
34. Enders A.C., Liu I.K. 1991. Lodgement of the equine blastocyst in the uterus from fixation
through endometrial cup formation. J Reprod Fertil Suppl 44 427-438.
35. Fernàndez-Gonzàlez R., de Dios Hourcade J., López-Vidriero I., Benguría A., Rodríguez De
Fonseca F., Gutiérrez-Adán A. 2009. Analysis of gene transcription alterations at the
blastocyst stage related to the long-term consequences of in vitro culture in mice.
Reproduction 137 271-283.
36. Fleming T.P., Kwong W.Y., Porter R., Ursell E., Fesenko I., Wilkins A., Miller D.J., Watkins
A.J., Eckert J.J. 2004. The embryo and its future. Biol Reprod 71 1046-1054.
37. Flood P.F., Betteridge K.J., Diocee M.S. 1982. Transmission electron microscopy of horse
embryos 3-16 days after ovulation. J Reprod Fert Suppl 32 319-327.
38. Galli C., Crotti G., Notari C., Turini P., Lazzari G. 2001. Embryo production by ovum pick
up from live donors. Theriogenology 55 1341-1357.
39. Galli C., Crotti G., Turini R., Duchi G., Mari G., Zavaglia G., Duchamp G., Daels P., Lazzari
G. 2002. Frozen-thawed embryos produced by ovum pickup of immature oocytes and
ICSI are capable to establish pregnancies in the horse. Theriogenology 58 705-708.
40. Galli C., Colleoni S., Duchi R., Lagutina I., Lazzari G. 2007. Developmental competence of
equine oocytes and embryos obtained by in vitro procedures ranging from in vitro
maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear
transfer. Anim Reprod Sci 98 39-55.
41. Goossens K., Van Soom A., Van Poucke M., Vandaele L., Vandesompele J., Van Zeveren
A., Peelman L. 2007. Identification and expression analysis of genes associated with
bovine blastocyst formation. BMC Dev Biol 7 64.
42. Goudet G., Bezard J., Duchamp G., Gerard N., Palmer E. 1997. Equine oocyte
competence for nuclear and cytoplasmic in vitro maturation: effect of follicle size and
hormonal environment. Biol Reprod 57 232-245.
43. Guignot F., Ottogalli M., Yvon J.-M., Magistrini M. 1998. Preliminary observations in in
vitro development of equine embryo after ICSI. Reprod Nutr Dev 38 653-663.
44. Hawley L.R., Enders A.C., Hinrichs K. 1995. Comparison of equine and bovine oocyte-
cumulus morphology within the ovarian follicle. Biol Reprod Monogr 1 243-252.
![Page 32: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/32.jpg)
Chapter 1
26
45. Heape W. 1898. On the artificial insemination of mares. Veterinarian 71 202-212.
46. Herrera C., Revora M., Vivani L., Miragaya M.H., Losinno L., Quintans C., Pasqualini R.S.
2008. Effect of high glucose concentrations during in vitro culture of equine embryos.
Proc 7th international symposium on equine embryo transfer 52-53.
47. Herrler A., Beier H.M. 2000. Early embryonic coats: morphology, function, practical
applications. Cells Tissues Organs 166 233-246.
48. Hinrichs K., Schmidt A.L., Memon M.A., Selgrath J.P., Ebert K.M. 1990a. Culture of 5-day
horse embryos in microdroplets for 10 to 20 days. Theriogenology 34 643-653.
49. Hinrichs K., Kennedy D.F., Kenney R.M. 1990b. Aspiration of oocytes from mature and
immature preovulatory follicles in the mare. Theriogenology 34 107-112.
50. Hinrichs K., Schmidt A.L., Friedman P.P., Selgrath J.P., Martin M.G. 1993. In vitro
maturation of horse oocytes: characterization of chromatin configuration using
fluorescence microscopy. Biol Reprod 48 363-370.
51. Hinrichs K. 2005. Update on equine ICSI and cloning. Theriogenology 64 535-541.
52. Hinrichs K., Choi Y.H., Walckenaer B.E., Varner D.D., Hartman D.L. 2007. In vitro-
produced equine embryos: production of foals after transfer, assessment by differential
staining and effect of medium calcium concentrations during culture. Theriogenology 68
521-529.
53. Hinrichs K. 2010a. The equine oocyte: factors affecting meiotic and developmental
competence. Mol Reprod Dev 77 651-661.
54. Hinrichs K. 2010b. In vitro production of equine embryos: state of the art. Reprod
Domest Anim 45 (Suppl 2) 3-8.
55. Johnson A.K., Clark-Price S.C., Choi Y.H., Hartman D.L., Hinrichs K. 2010. Physical and
clinicopathologic findings in foals derived by use of somatic cell nuclear transfer: 14
cases (2004-2008). J Am Vet Med Assoc 236 983-990.
56. Kimura Y., Yanagimachi R. 1995. Intracytoplasmic sperm injection in the mouse. Biol
Reprod 52 709-720.
57. King W.A., Bezard J., Bousquet D., Palmer E., Betteridge K.J. 1987. The meiotic stage of
preovulatory oocytes in mares. Genome 29 679-682.
![Page 33: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/33.jpg)
Chapter 1
27
58. Khosla S., Dean W., Reik W., Feil R. 2001. Culture of preimplantation embryos and its
long-term effects on gene expression and phenotype. Hum Reprod Update 7 419-427.
59. Krölling O. 1937. Über eine Keimblase in Stadium der Gastrula beim Pferd. Zeitschrift für
mikroskopisch-anatomische Forschung 42 124-147.
60. Lazzari G., Crotti G., Turini P., Duchi R., Mari G., Zavaglia G., Barbacini S., Galli C. 2002.
Equine embryos at the compacted morula and blastocyst stage can be obtained by
intracytoplasmic sperm injection (ICSI) of in vitro matured oocytes with frozen-thawed
spermatozoa from semen of different fertilities. Theriogenology 58 709-712.
61. Lazzari G., Colleoni S., Lagutina I., Crotti G., Turini P., Tessaro I., Brunetti D., Duchi R.,
Galli C. 2010. Shortterm and long-term effects of embryo culture in the surrogate sheep
oviduct versus in vitro culture for different domestic species. Theriogenology 73 748-57.
62. Li X., Morris L.H., Allen W.R. 2001. Influence of co-culture during maturation on the
developmental potential of equine oocytes fertilized by intracytoplasmic sperm
injection (ICSI). Reproduction 121 925-932.
63. Magnani L., Cabot R.A. 2008. In vitro and in vivo derived porcine embryos possess
similar, but not identical, patterns of Oct4, Nanog, and Sox2 mRNA expression during
cleavage development. Mol Repred Dev 75 1726-1735.
64. Marrable A.W., Flood P.F. 1975. Embryological studies on the dartmoor pony during the
first third of gestation. J Reprod Fertil Suppl 23 499-502.
65. McElroy S.L., Kim J.H., Kim S., Jeong Y.W., Lee E.G., Park S.M., Hossein M.S., Koo O.J.,
Abul Hashem M.D., Jang G., Kang S.K., Lee B.C., Hwang W.S. 2008. Effects of culture
conditions and nuclear transfer protocols on blastocyst formation and mRNA expression
in pre-implantation porcine embryos. Theriogenology 69 416-425.
66. McKinnon A.O., Carnevale E.M., Squires E.L., Carney N.J., Seidel G.E. 1989. Bisection of
equine embryos. Equine Vet J Suppl 8 129-133.
67. McKinnon A.O., Voss J.L., Squires E.L., Carnevale E.M. 1992. Diagnostic ultrasonography.
In: Equine Reproduction, ed. McKinnon A.O., Voss J.L. 266.
68. McKinnon A.O., Lacham-Kaplan O., Trounson A.O. 2000. Pregnancies produced from
fertile and infertile stallions by intracytoplasmic sperm injection (ICSI) of single frozen-
![Page 34: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/34.jpg)
Chapter 1
28
thawed spermatozoa into in vivo matured mare oocytes. J Reprod Fertil Suppl 56 513-
517.
69. McPartlin L.A., Suarez S.S., Czaya C.A., Hinrichs K., Bedford-Guaus S.J. 2009.
Hyperactivation of stallion sperm is required for successful in vitro fertilization of equine
oocytes. Biol Reprod 81 199-206.
70. Meintjes M., Bellow M.S., Paul J.B., Broussard J.R., Li L.Y., Paccamonti D., Eilts B.E.,
Godke R.A. 1995. Transvaginal ultrasound-guided oocyte retrieval from cyclic and
pregnant horse and poney mares for in vitro fertilization. Biol Reprod Monogr 1 281-
292.
71. Mohan M., Hurst A., Malayer J.R. Global gene expression analysis comparing bovine
blastocysts flushed on day 7 or produced in vitro. Mol Reprod Dev 68 288-298.
72. Niemann H., Wrenzycki C. 2000. Alterations of expression of developmentally important
genes in preimplantation bovine embryos by in vitro culture conditions: implications for
subsequent development. Theriogenology 53 21-34.
73. Oguri N., Tsutsumi Y. 1974. Non-surgical egg transfer in mares. J Reprod Fert 41 313-320.
74. Oriol J.G., Sharom F.J., Betteridge K.J. 1993. Developmentally regulated changes in the
glycoproteins of the equine embryonic capsule. J Reprod Fertil 99 653-664.
75. Oriol J.G. 1994. The equine embryonic capsule: practical implications of recent research.
Equine Vet J 26 184-186.
76. Palermo G., Joris H., Devroey P., Van Steirteghem A.C. 1992. Pregnancies after
intracytoplasmic injection of single spermatozoon into an oocyte. The Lancet 340 17-18.
77. Palmer E., Duchamp G., Bézard J., Magistrini M., King A., Bousquet D., Betteridge K.
1986. Recovery of follicular fluid and oocytes of mares by non-surgical punctures of the
preovulatory follicle. Theriogenology 25 178.
78. Palmer E., Bézard J., Magistrini M., Duchamp G. 1991. In vitro fertilization in the horse. A
retrospective study. J Reprod Fertil Suppl 44 375-384.
79. Pierson R.A. 1992. Folliculogenesis and ovulation. In: Equine Reproduction, ed.
McKinnon A.O., Voss J.L. 161.
![Page 35: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/35.jpg)
Chapter 1
29
80. Pomar F.J., Teerds K.J., Kidson A., Colenbrander B., Tharasanit T., Aguilar B., Roelen B.A.
2005. Differences in the incidence of apoptosis between in vivo and in vitro produced
blastocysts of farm animal species: a comparative study. Theriogenology 63 2254-2268.
81. Purpera M.N., Giraldo A.M., Ballard C.B., Hylan D., Godke R.A., Bondioli K.R. 2009.
Effects of culture medium and protein supplementation on mRNA expression of in vitro
produced bovine embryos. Mol Reprod Dev 76 783-793.
82. Rambags B.P., Krijtenburg P.J., Drie H.F., Lazzari G., Galli C., Pearson P.L., Colenbrander
B., Stout T.A. 2005. Numerical chromosomal abnormalities in equine embryos produced
in vivo and in vitro. Mol Reprod Dev 72 77-87.
83. Rambags B.P.B., van Tol H.T.A., van den Eng M.M., Colenbrander B., Stout T.A.E. 2008.
Expression of progesterone and oestrogen receptors by early intrauterine equine
conceptuses. Theriogenology 69 366-375.
84. Rienzi L., Greco E., Ubaldi F., Iacobelli M., Martinez F., Tesarik J. 2001. Laser-assisted
intracytoplasmic sperm injection. Fertil Steril 76 1045-1047.
85. Roasa L.M., Choi Y.H., Love C.C., Romo S., Varner D.D., Hinrichs K. 2007. Ejaculate and
type of freezing extender affect rates of fertilization of horse oocytes in vitro.
Theriogenology 68 560-566.
86. Rosati I., Berlinguer F., Bogliolo L., Leoni G., Ledda S., Naitana S. 2002. The effect of co-
culture on the development of in vitro matured equine oocytes after intracytoplasmic
sperm injection. Equine Vet J 34 673-678.
87. Quinn B.A., Hayes M.A., Waelchli R.O., Kennedy M.W., Betteridge K.J. 2007. Changes in
major proteins in the embryonic capsule during immobilization (fixation) of the
conceptus in the third week of pregnancy in the mare. Reproduction 134 161-170.
88. Scherzer J., Fayrer-Hosken R.A., Ray L., Hurley D.J., Heusner G.L. 2008. Advancements in
large animal embryo transfer and related biotechnologies. Reprod Dom Anim 43 371-
376.
89. Shabpareh V., Squires E.L., Seidel G.E., Jasko D.J. 1993. Methods for collecting and
maturing equine oocytes in vitro. Theriogenology 40 1161-1175.
![Page 36: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/36.jpg)
Chapter 1
30
90. Squires E.L., Suh T.K., Graham J.K., Carnevale E.M. 2008. Use of sexed, refrozen
spermatozoa for ICSI. Proc 7th international symposium on equine embryo transfer 54.
91. Stewart F., Charleston B., Crossett B., Barker P., Allen W.R. 1995. A novel uterine protein
that associates with the embryonic capsule. J Reprod Fertil 105 65-70.
92. Stewart F., Kennedy M.W., Suire S. 2000. A novel uterine lipocalin supporting pregnancy
in equids. Cell mol Life Sci 57 1373-1378.
93. Stout T.A., Meadows S., Allen W.R. 2005. Stage-specific formation of the equine
blastocyst capsule is instrumental to hatching and to embryonic survival in vivo. Anim
Reprod Sci 87 269-281.
94. Stout T.A.E. 2006. Equine embryo transfer: review of developing potential. Equine Vet J
38 467-487.
95. Tremoleda J.L., Stout T.A., Lagutina I., Lazzari G., Bevers M.M., Colenbrander B., Galli C.
2003. Effects of in vitro production on horse embryo morphology, cytoskeletal
characteristics, and blastocyst capsule formation. Biol Reprod 69 1895-1906.
96. Van Niekerk C.H., Gerneke W.H. 1966. Persistence and parthenogenetic cleavage of
tubal ova in the mare. Onderstepoort J Vet Res 33 195-232.
97. Vogelsang M.M., Kreider J.L., Potter G.D. 1983. Recovery of pre-ovulatory equine
oocytes by follicular aspiration. 8th Equine Nutrition and Physiology Symposium.
Lexington, KY, 285-288.
98. Walker S.K., Hartwich K.M., Seamark R.F. 1996. The production of unusually large
offspring following embryo manipulation: concepts and challenges. Theriogenology 45
111-120.
99. Watson A.J. 2007. Oocyte cytoplasmic maturation: a key mediatior of oocyte and
embryo developmental competence. J Anim Sci 85 Suppl E1-E3.
100. Weber J.A., Douglas A.F., Vanderwall D.K., Woods G.L. 1991. Prostaglandin E2 hastens
oviductal transport of equine embryos. Biol Reprod 45 544-546.
101. Weber J.A., Woods G.L., Aguilar J.J. 1996. Location of equine oviductal embryos on day 5
post ovulation and oviductal transport time of day 5 embryos autotransferred to the
contralateral oviduct. Theriogenology 46 1477-1483.
![Page 37: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/37.jpg)
Chapter 1
31
102. Willadson S.M., Janzen R.E., McAlister R.J., Shea B.F., Hamilton G., McDermand D. 1991.
The viability of late morulae and blastocysts produced by nuclear transplantation in
cattle. Theriogenology 35 161-170.
103. Yu Y., Ding C., Wang E., Chen X., Li X., Zhao C., Fan Y., Wang L., Beaujean N., Zhou Q,
Jouneau A., Ji W. 2007. Piezo-assisted nuclear transfer affects cloning efficiency and may
cause apoptosis. Reproduction 133 947-954.
![Page 38: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/38.jpg)
![Page 39: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/39.jpg)
CHAPTER 2
AIMS OF THE THESIS
![Page 40: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/40.jpg)
![Page 41: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/41.jpg)
Chapter 2
35
The general aim of this research is to test the hypothesis that development is altered in in vitro
produced blastocysts as compared to in vivo derived equine blastocysts, with gene expression
and capsule formation as a parameter, and that this altered development can be influenced by
the mare’s uterine environment, more specifically by uterocalin.
In order to test this general hypothesis, in a first part of the thesis we needed to optimize the
procedure for in vitro embryo production in the horse. This was achieved by evaluating
different methods for ICSI (3.1) and by confirming the developmental competence of in vitro
produced equine blastocysts after embryo transfer (3.2) (CHAPTER 3).
Next, we continued by investigating the aforementioned general hypothesis, which was
subdivided in three specific aims, namely :
1. To develop a reliable method for evaluating gene expression in equine blastocysts
(CHAPTER 4).
2. To identify genes which are differentially expressed between in vivo derived and in vitro
produced equine blastocysts (CHAPTER 5).
3. To examine the influence of the maternal environment on embryonic development,and
more specifically, to determine the influence of uterocalin on equine embryonic capsule
development and gene expression (CHAPTER 6).
![Page 42: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/42.jpg)
![Page 43: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/43.jpg)
CHAPTER 3
THE IN VITRO PRODUCTION OF EQUINE EMBRYOS
3.1 A DIFFERENT APPROACH TO THE IN VITRO PRODUCTION OF HORSE EMBRYOS: A PILOT STUDY OF LASER-ASSISTED VERSUS PIEZO DRILL ICSI
Adapted from Smits K., Govaere J., Hoogewijs M., Piepers S., Van Soom A. Reproduction
in Domestic Animals submitted.
3.2 BIRTH OF THE FIRST ICSI-FOAL IN THE BENELUX
Adapted from Smits K., Govaere J., Hoogewijs M., De Schauwer C., Van Poucke M.,
Peelman L., Van Soom A. 2010. Vlaams Diergeneeskundig Tijdschrift 70 134-138.
![Page 44: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/44.jpg)
![Page 45: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/45.jpg)
Chapter 3
39
3.1 A DIFFERENT APPROACH TO THE IN VITRO PRODUCTION OF HORSE EMBRYOS: A PILOT STUDY OF LASER-ASSISTED VERSUS PIEZO DRILL ICSI
3.1.1 ABSTRACT
Intracytoplasmic sperm injection (ICSI) is the method of choice for the in vitro production of
equine embryos. Conventional ICSI has been associated with mechanical damage to the oocyte
due to deformation of the zona and exposure of the oolemma to negative pressure during
injection. The introduction of the less traumatic and more efficient piezo drill-assisted ICSI
yielded higher cleavage rates and more consistent results. This device is also associated with
disadvantages such as the use of mercury and its association with DNA damage in the mouse.
The in vitro production of equine embryos would profit from further optimization in order to be
efficiently applicable on large scale like in cattle. This has led us to explore an alternative
method avoiding oocyte trauma, namely laser-assisted ICSI, which involves creating a hole in
the zona pellucida prior to ICSI. In this pilot study both the piezo drill and the laser were
compared for ICSI in the horse. A higher cleavage rate was achieved in the laser group, but no
significant influences on subsequent blastocyst development were observed.
3.1.2 INTRODUCTION
Conventional in vitro fertilization (IVF) is of limited success in the horse, mainly because stallion
spermatozoa have difficulties in penetrating the zona pellucida in vitro (Roasa et al., 2007,
McPartlin et al., 2009). Therefore ICSI has been introduced as an alternative to circumvent this
problem and it is used routinely for the in vitro production of equine embryos. Conventional
ICSI is characterized by the crushing of a sperm tail on the bottom of the petri dish, thus causing
immobilization of the spermatozoon, followed by mechanical breakage of the zona pellucida
and the oolemma with a beveled injection pipette and subsequent injection of the immobilized
sperm into the cytoplasm of a mature oocyte. The first successful pregnancy after ICSI in horses
was announced in 1996 (Squires et al., 1996) and was followed by a period in which different
laboratories tried to implement the technique, but unfortunately with variable results. In 2002,
![Page 46: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/46.jpg)
Chapter 3
40
the piezo drill was introduced for ICSI in horses and at the same time, increased cleavage rates
were reported during in vitro production of equine embryos (Choi et al., 2002; Galli et al.,
2002). Whether the introduction of the piezo drill had a causal relationship with the increased
cleavage rates was not clear, since no comparative studies have been published on this topic.
Acceptable results with the piezo led to a generalized use of the device for ICSI in horses.
Possible explanations for the positive effect of piezo-assisted over conventional ICSI include the
higher probability of oolemma breakage, the reduction of damage to the oocyte since
mechanical suction of the oolemma is replaced by a single pulse and the increased
permeabilization of the sperm membrane facilitating oocyte activation (Yanagida et al., 1998;
Choi et al., 2002). The piezo produces pulses on the injection pipette resulting in micro-
oscillations of the blunt pipette of ≥0.1 µm at ≤40 µm s -1, which allows efficient and precise
penetration of the zona pellucida and the oolemma (Ediz and Olgac, 2004; Yoshida et al., 2007).
However, research to reveal the exact reason has not been performed yet. Another aspect
which needs further investigation is the favorable effect of mercury during piezo-assisted ICSI
(Ediz and Olgac, 2005). It leads to significant improvement of the success rate, but its toxicity
implies an important drawback (Ediz and Olgac, 2004). Another possible disadvantage that
should be considered, is that piezo-assisted micromanipulation has been associated with DNA
damage in mice (Yu et al., 2007).
An alternative advanced approach could be offered by laser-assisted ICSI. Drilling a hole in the
zona pellucida by means of a diode laser prior to ICSI can avoid the mechanical compression
and oocyte distortion as it occurs in the initial phase of zona penetration during conventional
ICSI (Rienzi et al., 2001). This less traumatic approach has been described in human to be
beneficial in case of patients which suffered of high rates of oocyte degeneration or fragile
oolemmas after conventional ICSI (Abdelmassih et al., 2002; Rienzi et al., 2004), although a
subsequent study reported no advantage (Richter et al., 2006).
In horses the in vitro production of embryos happens on a small scale and in most laboratories
piezo-assisted ICSI is preferred. However, a direct comparison of different ICSI methods has not
been performed yet. The aim of this technical study was to introduce a new method for horse
![Page 47: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/47.jpg)
Chapter 3
41
ICSI and to evaluate some of the advantages and disadvantages of piezo- versus laser-assisted
ICSI in the horse.
3.1.3 MATERIALS AND METHODS
3.1.3.1 General procedure for the in vitro production of equine embryos
Horse embryos were produced in vitro as described in Addendum 1. Briefly, oocytes were
aspirated from ovaries that were recovered at the slaughterhouse. The oocytes were matured
in vitro during 28h in DMEM-F12 based medium, containing 10% serum replacement, 10 µg/ml
pFSH and 2 µg/ml pLH (Stimufol, ULg FMV PhR, Sart-Tilman, Belgium) in 5% CO2 in air (Galli et
al., 2007). In this experiment, only compact cumulus-oocyte-complexes (n=253) were used.
After denudation, oocytes with visible polar bodies were selected and fertilized by means of
piezo- (Prime Tech, Ibaraki, Japan) or laser- (XYClone, Hamilton Thorne, Beverly, USA) assisted
ICSI. Six replicates were performed, in half of them piezo-assisted ICSI preceded laser-assisted
ICSI and in the other half the sequence was reversed. Injected oocytes were cultured in vitro up
to the blastocyst stage in DMEM-F12 with 10% fetal calf serum at 38.5°C in 5% CO2, 5% O2 and
90% N2. On day 2.5, cleavage was evaluated, the embryos that did not cleave were removed
and half of the medium was changed. Part of the cleaved embryos resulting from the piezo-
assisted ICSI was used for another experiment (CHAPTER 6) (Table 1). On day 6, half of the
medium was refreshed again and on day 9 blastocyst formation was evaluated.
3.1.3.2 Piezo-assisted ICSI
Piezo-assisted ICSI was performed with a blunt injection pipette (piezo-6-25, Humagen,
Charlottesville, VA, USA). A small amount of mercury was put in the tip of the pipette. A
progressive motile sperm was immobilized by piezo pulses and subsequently the zona and the
oolemma were penetrated with a piezo intensity setting of 5 and 4 respectively and a speed of
4 and 3 respectively, after which the sperm was injected into the ooplasm.
![Page 48: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/48.jpg)
Chapter 3
42
3.1.3.3 Laser-assisted ICSI
A beveled injection pipette (MIC-50-35, Humagen, Charlottesville, VA, USA) was used and one
progressively motile sperm cell was immobilized by crushing its tail. A hole was drilled in the
zona pellucida using the laser. In all replicates maximal power was used. In a preliminary
experiment, 250 µs pulses were given, but this resulted in cytoplasm leakage. Therefore, this
was reduced to 200 µs in the first replicate. Because some cytoplasm leakage remained, this
was further reduced to 150 µs in the other replicates. Several adjacent small holes were made
until the zona was fully penetrated. The oolemma was penetrated mechanically in conformity
with conventional ICSI without the ‘squeezing’ of the oocyte.
3.1.3.4 Statistical analysis
The cleavage and blastocyst rates in both groups were compared by means of a Pearson Chi-
square test (SPSS 16.0, SPSS Inc., Headquarters, Chicago, Illinois, US). The mean injection times
were compared using a t-test. A p-value <0.05 was considered significant.
3.1.4 RESULTS
Of the 96 oocytes which were injected using laser, 74 cleaved (cleavage rate: 77%). The
cleavage rate of the piezo injected oocytes was a little lower (65%), a difference which was
significant (p=0.0421). In contrast, in the piezo drill-assisted group, 11.3 % of the cleaved
oocytes developed to blastocysts, and 6.8 % for the laser-assisted ICSI, but this was not
significant (p>0.05). The mean time for ICSI, including the handling of the oocytes before and
after the procedure, was longer for the laser-assisted ICSI (4.0 minutes/oocyte) than for the
piezo-assisted ICSI (2.9 minutes/oocyte). This difference was not significant. The details on
development are listed in Table 1 and summarized in Figure 1.
![Page 49: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/49.jpg)
Chapter 3
43
Figure 1 Developmental competence of equine embryos after piezo- versus laser-assisted ICSI.
For both groups the mean cleavage rate (cleaved per injected) and the blastocyst rate
(blastocyst per cleaved) are displayed as well as the corresponding standard errors. *significant
difference (p=0.0421).
Table 1 Development of equine embryos following piezo- versus laser-assisted ICSI. For the six
conducted replicates, cleavage and blastocyst development was recorded for the oocytes
fertilized by piezo (P) and laser (L). Half of the cleaved embryos resulting from piezo-assisted ICSI
was destined to another experiment. The number of cleaved embryos used in this experiment
are listed under ‘used P’.
ICSI P ICSI L
Cleaved P
(% of injected)
Cleaved L
(% of injected) Used P
Blastocyst P
(% of cleaved)
Blastocyst L
(% of cleaved)
1 53 18 31 (58%) 11 (61%) 13 1 (7%) 1 (9%)
2 20 23 16 (80%) 19 (83%) 7 1 (14%) 0 (0%)
3 20 22 10 (50%) 16 (72%) 5 1 (20%) 2 (12.5%)
4 35 16 26 (74%) 12 (75%) 15 0 (0%) 1 (8.3%)
5 23 12 14 (61%) 12 (100%) 8 2 (25%) 1 (8.3%)
6 6 5 5 (83%) 4 (80%) 5 1 (20%) 0 (0%)
Total 157 96 102 (65%) 74 (77%) 53 6 (11.3%) 5 (6.8%)
0%10%20%30%40%50%60%70%80%90%
100%
Cleavage rate Blastocyst rate
Piezo
Laser
*
![Page 50: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/50.jpg)
Chapter 3
44
Figure 2 Day 2.5 embryo resulting from laser-assisted ICSI. After laser-assisted ICSI the hole in
the zona pellucida (arrow) was still apparent at the cleavage stage. This resulted in blastomere
leakage in some embryos.
The hole in the zona after laser-assisted ICSI was persistent in later stages of development. This
resulted in what we describe as blastomere leakage at day 2.5 (Figure 2) and prominent
hatching at the blastocyst stage (Figure 3) when compared to the piezo group. However, this
became less frequent when the pulse duration was diminished.
Figure 3 Blastocyst resulting from laser-assisted ICSI (magnification 150x). A substantial part
of the blastocyst has hatched through the hole in the zona. This hatching was more prominent
when compared to the blastocysts resulting from piezo-assisted ICSI.
![Page 51: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/51.jpg)
Chapter 3
45
3.1.5 DISCUSSION
This study was performed to compare the piezo drill and the laser during ICSI in the horse. The
developmental competence of the embryos produced in both ways is comparable. A smaller
cleavage rate is observed in the group where the piezo was used. The obtained cleavage rate of
65% is nevertheless comparable to results of 62-79%, reported in literature (Galli et al., 2007). It
must be remarked that the 65% cleavage rate was lower than average results (75%) with the
piezo in concurrent experiments (unpublished data). This may be related to the fact that the
injection pipette had to be changed for both procedures, which resulted in small variations in
the angle of the injection pipette. For piezo-assisted injection this angle is critical, since the
holding pipette, the oolemma and the injection pipette need to be in the same plane. In one
replicate the angle appeared suboptimal during the piezo-assisted injection, resulting in a few
more piezo pulses required to penetrate the oocyte and subsequently a reduced cleavage rate
(50%). The precise alignment of both pipettes (holding and injection) in the 3 dimensional
aspect of this technique appears to be less critical when laser-assisted ICSI is performed. This
could be possibly explained by the fact that the laser acts in a vertical plane, acting on the full
height of the zona at a particular point. Subsequently, the injection in the horizontal plane
becomes less critical.
Generally, the laser is very easy to handle and allows precise working. However, the sperm
needs to be captured and the oolemma is penetrated in the same way like in conventional ICSI.
Combined with the fact that several adjacent holes need to be made to penetrate the zona
pellucida, the laser-assisted ICSI remains rather time consuming when compared to piezo-
assisted ICSI where the penetration of the zona is followed fluently by the penetration of the
oolemma. Concerning the oolemma breakage, this study represents a comparison between
piezo-assisted and conventional ICSI, since the laser does not interact at this level. The suction
of the oolemma and the ooplasm into the injection pipette during conventional ICSI is
considered to be more traumatic than the oolemma breakage through piezo drill. Whether this
or the other piezo associated advantages as previously described contributed to the tendency
of a higher blastocyst rate is not clear. Anyhow, no significant differences were obtained.
![Page 52: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/52.jpg)
Chapter 3
46
Another peculiarity is the apparent hole in the zona after laser-assisted ICSI. Although the
blastomere leakage and the early hatching were reduced by minimizing the laser settings, it
remained present in some embryos. This might be associated with an increased chance of
monozygotic twinning and it was suggested that the zona pellucida can be thinned instead of
fully penetrated by the laser prior to ICSI when applying it to human embryos (Moser et al.,
2004). Also, we did not attempt reducing the power of the laser, which might be worth
exploring as an option with the laser method.
While interpreting these results, it must be taken into account that the lab had no prior
experience with the laser, while piezo-assisted ICSI had been performed routinely for a year.
The ease of laser use permitted these preliminary results, indicating the laser as a valid
alternative for equine ICSI. This opens new avenues for research into the molecular effects and
events that result from these methods.
3.1.6 CONCLUSIONS
The in vitro production of equine embryos is based upon ICSI. To minimize oocyte damage
associated with conventional ICSI, piezo- or laser-assisted ICSI can be used. In this study both
techniques were compared and present specific advantages and disadvantages, but no major
differences in embryonic development were observed. Further exploration of these methods is
required to define their value for equine ICSI.
REFERENCES
1. Abdelmassih S., Cardoso J., Abdelmassih V., Dias J.A., Abdelmassih R., Nagy Z.P. 2002.
Laser-assisted ICSI: a novel approach to obtain higher oocyte survival and embryo
quality rates. Hum Reprod 17 2694-2699.
2. Choi Y.H., Love C.C., Love L.B., Varner D.D., Brinsko S.P., Hinrichs K. 2002.
Developmental competence in vivo and in vitro of in vitro-matured equine oocytes
fertilized by intracytoplasmic sperm injection with fresh or frozen-thawed sperm.
Reproduction 123 455-465.
![Page 53: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/53.jpg)
Chapter 3
47
3. Ediz K., Olgac N. 2004. Microdynamics of the piezo-driven pipettes in ICSI. IEEE Trans
Biomed Eng 51 1262-1268.
4. Ediz K., Olgac N. 2005 Effect of mercury column on the microdynamics of the piezo-
driven pipettes. J Biomech Eng 127 531-535.
5. Galli C., Crotti G., Turini R., Duchi G., Mari G., Zavaglia G., Duchamp G., Daels P., Lazzari
G. 2002. Frozen-thawed embryos produced by ovum pickup of immature oocytes and
ICSI are capable to establish pregnancies in the horse. Theriogenology 58 705-708
(abstract).
6. Galli C., Colleoni S., Duchi R., Lagutina I., Lazzari G. 2007. Developmental competence of
equine oocytes and embryos obtained by in vitro procedures ranging from in vitro
maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear
transfer. Anim Reprod Sci 98 39-55.
7. McPartlin L.A., Suarez S.S., Czaya C.A., Hinrichs K., Bedford-Guaus S.J. 2009.
Hyperactivation of stallion sperm is required for successful in vitro fertilization of equine
oocytes. Biol Reprod 81 199-206.
8. Moser M., Ebner T., Sommergruber M., Gaisswinkler U., Jesacher K., Puchner M.,
Wiesinger R., Tews G. 2004. Laser-assisted zona pellucida thinning prior to routine ICSI.
Hum Reprod 19 573-578.
9. Oguri N., Tsutsumi Y. 1972. Non-surgical recovery of equine eggs, and an attempt at
non-surgical transfer in horses. J Reprod Fertil 31 187-195.
10. Richter K.S., Davis A., Carter J., Greenhouse S.J., Mottla G.L., Tucker M.J. 2006. No
advantage of laser-assisted over conventional intracytoplasmic sperm injection: a
randomized controlled trial [NCT00114725]. J Exp Clin Assist Reprod 3 1-7.
11. Rienzi L., Greco E., Ubaldi F., Iacobelli M., Martinez F., Tesarik J. 2001. Laser-assisted
intracytoplasmic sperm injection. Fertil Steril 76 1045-1047.
12. Rienzi L., Ubaldi F., Martinez F., Minasi M.G., Lacobelli M., Ferrero S., Tesarik J., Greco E.
2004. Clinical application of laser-assisted ICSI: a pilot study. Eur J Obstet Gynecol
Reprod Biol 115 S77-S79.
![Page 54: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/54.jpg)
Chapter 3
48
13. Roasa L.M., Choi Y.H., Love C.C., Romo S., Varner D.D., Hinrichs K. 2007. Ejaculate and
type of freezing extender affect rates of fertilization of horse oocytes in vitro.
Theriogenology 68 560-566.
14. Smits K., Govaere J., Hoogewijs M., De Schauwer C., Vanhaesebrouck E., Van Poucke M.,
Peelman L.J., Van den Berg M., Vullers T., Van Soom A. 2010. Birth of the first ICSI foal in
the Benelux. Vlaams Diergeneeskundig Tijdschrift 79 134-138.
15. Squires E.L., Wilson J.M., Kato H., Blaszczyk A. 1996. A pregnancy after intracytoplasmic
sperm injection into equine oocytes matured in vitro. Theriogenology 45 306 (abstract).
16. Yanagida K., Katayose H., Yazawa H., Kimura Y., Konnai K., Sato A. 1998. The usefulness
of a piezo-micromanipulator in intracytoplasmic sperm injection in humans. Hum
Reprod 14 448-453.
17. Yoshida N., Perry A.C.F. 2007. Piezo-actuated mouse intracytoplasmic sperm injection
(ICSI). Nature Protocols 2 296-304.
18. Yu Y., Ding C., Wang E., Chen X., Li X., Zhao C., Fan Y., Wang L., Beaujean N., Zhou Q,
Jouneau A., Ji W. 2007. Piezo-assisted nuclear transfer affects cloning efficiency and may
cause apoptosis. Reproduction 133 947-954.
![Page 55: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/55.jpg)
Chapter 3
49
3.2 BIRTH OF THE FIRST ICSI-FOAL IN THE BENELUX
3.2.1 ABSTRACT
This manuscript describes the creation of a foal using conventional intracytoplasmic sperm
injection (ICSI) and embryo transfer. Oocytes were aspirated from ovaries from slaughtered
mares. After in vitro maturation, the oocytes were fertilized by ICSI and cultured in vitro for 9
days. Two embryos reached the blastocyst stage and they were transferred to the uterus of a
synchronized mare. Six days later a single embryonic vesicle was diagnosed by ultrasound. After
a normal pregnancy a healthy foal was born the 27th of October 2009. Parentage testing via
microsatellite genotyping confirmed that the foal originated from the transferred embryo.
3.2.2 INTRODUCTION
Conventional in vitro fertilization (IVF), which implies culture of matured oocytes with
capacitated sperm, is not efficient in horses. Only two IVF foals, produced from in vivo matured
oocytes, have been born up till now (Palmer et al., 1991). It is not yet completely clear why the
in vitro fertilization of horse oocytes is so difficult. One theory states that it may be due to a
defective capacitation of stallion sperm, which impairs the normal hyperactivation process of
the sperm (McPartlin et al., 2009). Hyperactivation is a typical motility pattern which is
exhibited by capacitated sperm and it is generally characterized by an increased lateral head
displacement and beat asymmetry. Hyperactivation is believed to be necessary for the sperm
cell to penetrate the equine zona pellucida (McPartlin et al., 2009). To circumvent this problem
of defective hyperactivation and fertilization in vitro, ICSI has been used for the in vitro
production (IVP) of equine embryos. This technique involves injecting a single sperm cell into
the cytoplasm of a mature oocyte using a fine glass needle. It was initially developed for
treatment of male factor infertility in humans and the first ICSI baby was born in Belgium in
1992 (Palermo et al., 1992).
The first ICSI foals resulted from in vitro matured equine oocytes, which were surgically
transferred to the oviduct after ICSI (Squires et al., 1996; Cochran et al., 1998; McKinnon et al.,
![Page 56: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/56.jpg)
Chapter 3
50
2000). Subsequently also embryos which were cultured in vitro up to the blastocyst stage and
transferred to the uterus resulted into healthy foals (Li et al., 2001; Hinrichs, 2005; Galli et al.,
2007). Although ICSI is now commercially available for infertility treatment of both mares and
stallions, only a few laboratories perform this practice. In this case report, the birth of the first
ICSI foal in the Benelux is described.
3.2.3 MATERIALS AND METHODS
Equine ovaries were collected in the abbatoir and all follicles larger than 5 mm were aspirated
with a vacuum pump (-100 mm Hg), scraped with the aspirating needle and flushed with
heparin in phosphate buffered saline (PBS) (25IU/ml). The oocytes were matured during 26
hours in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM-F12) based medium
in an atmosphere containing 5% CO2 (Galli et al., 2007). After removal of the surrounding
cumulus cells by means of gentle pipetting, the oocytes with an extruded polar body were
fertilized by conventional ICSI. Frozen sperm from a stallion of proven fertility was thawed,
centrifuged at 750 x g during 40 minutes over a 90%/45% Percoll® gradient, washed with
calcium free Tyrode’s Albumin-Lactate-Pyruvate (TALP) solution and centrifuged again at 400x
g for 10 minutes. The sperm pellet was resuspended in Synthetic Oviductal Fluid (SOF) medium
and stored at 38.5 °C in 5% CO2. During ICSI the oocytes were kept in 4-(2-hydroxyethyl)-1-
piperazineethanesulfonic acid (HEPES) buffered SOF medium and the sperm in 9%
polyvinylpyrrolidone in PBS. All manipulations were performed on a heated plate (38.5 °C) of an
inverted microscope. A progressively motile sperm cell was immobilized by crushing the tail on
the bottom of the scale and injected into the cytoplasm of a mature oocyte. The injected
oocytes were cultured in groups of 10-20 embryos in 20µl droplets of DMEM-F12 with 10% fetal
calf serum at 38.5°C in 5% CO2, 5% O2 and 90% N2. On day 2.5 after fertilization, the embryos
which were not cleaved were removed and half of the medium was changed. On day 6 again
half of the medium was changed and on day 9 the embryonic development was evaluated and
blastocysts were selected. Two blastocysts were washed in Emcare Holding Medium® and put
in a 2 ml tube filled with Emcare Holding Medium®. During the 3 hour transport to the embryo
transfer centre, this tube was kept in 50 ml preheated saline and surrounded by 15 l infusion
![Page 57: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/57.jpg)
Chapter 3
51
bags at 38.5 °C in an isothermal box. Upon arrival, the embryos were washed again in Emcare
Washing Medium® and they were both transferred to the uterus of a recipient mare at day 6
post ovulation. Due to recipient availability, both embryos were transferred to the same mare.
3.2.4 RESULTS
Of the 52 collected oocytes, 27 (52%) extruded the first polar body at 26 h of maturation and
were subsequently injected with a spermatozoon (Figure 1).
Figure 1 Intracytoplasmic sperm injection (ICSI).
This resulted in 23 cleaved embryos (Figure 2), of which 2 (8.7%) reached the blastocyst stage at
day 9 (Figure 3).
Figure 2 Cleaved equine embryo (day 2.5). Figure 3 Equine IVP blastocyst (day 9).
![Page 58: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/58.jpg)
Chapter 3
52
On December 18th 2008 the embryos were transferred to the uterus of a mare that had
ovulated 6 days before. Six days after transcervical transfer one single embryonic vesicle of 0.7
cm was diagnosed by rectal ultrasound. The 12th of January 2009 one embryonic heart beat was
detected and regular ultrasound examinations revealed a normal development of a singleton
conceptus. The recipient mare was transported at 10 months of pregnancy to the Veterinary
Faculty at Merelbeke, where she gave birth the 27th of October 2009. A chestnut mare foal of
44 kg was born without complications and was called SMICSI (Figure 4,5).
Figure 4 Birth of SMICSI.
Figure 5 SMICSI 3 days old.
![Page 59: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/59.jpg)
Chapter 3
53
A DNA profile, based on 12 microsatellite markers, was determined for the foal, the sperm
donor and the recepient mare. DNA profile comparison assigned the sperm donor as the father
and excluded the receptor mare as the biological mother of the foal. The filly is now over one
month old and is developing normally.
3.2.5 DISCUSSION
The IVP of equine embryos has lagged behind that of other large domestic animals. This can be
explained by the scarce availability of equine oocytes, the inefficiency of conventional IVF and
the suboptimal culture conditions and low blastocyst rates. However, after the introduction of
ICSI, the IVP of equine embryos developed into a reasonably efficient and repeatable technique
(Hinrichs, 2005). Especially the use of the piezo drill, a device which causes minute vibrations of
the injection pipette during ICSI, seemed to be less traumatic for the oocyte and resulted in a
rapid evolution in recent years (Choi et al., 2002; Galli et al., 2007).
Nowadays the combination of ovum pick up, in vitro maturation, ICSI, in vitro culture and
embryo transfer is not only used for research purposes, but also clinically. Since only a few
normal sperm cells are required, it can be applied for subfertile stallions, for semen which has
been frozen-thawed, diluted and frozen again and for sexed semen (Lazzari et al., 2002; Choi et
al., 2006; Squires et al., 2008). It has also been successful in case of problems on the female
side like advanced age, degenerative endometriosis and cervical laceration (Colleoni et al.,
2007). Moreover, ICSI can be beneficial in creating offspring of valuable animals post mortem.
These prosperous results are only achieved in a few laboratories in the world. In general the
technique is labour intensive, expensive and not yet optimally efficient. Problems concerning
superovulation in horses and a very tight connection between the equine oocyte and the follicle
wall imply only limited oocyte collection. Moreover the IVP process is still suboptimal in horses
when compared to other species. The application of IVP of equine embryos on a larger scale,
like it happens in cattle, has not been achieved yet in the horse (Blanco et al., 2009).
In this study a cleavage rate of 85% was obtained, which is comparable to the results in other
recent publications and which is rather good when it is considered that the ICSI procedure was
![Page 60: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/60.jpg)
Chapter 3
54
performed in the conventional way without the use of the piezo drill. However, only 2 out of 23
injected oocytes (8.7%) reached the blastocyst stage, a fairly low number when compared to
other reports of 15.2% (Colleoni et al., 2007) and 23% (Hinrichs et al., 2007). Possible
explanations might include differences in oocyte source and culture conditions as well as in the
ICSI technique and experience. Even though spectacular blastocyst rates up to 38% have been
obtained during in vitro culture of equine embryos in DMEM/F12 (Hinrichs et al., 2005), there
are still quantitative and qualitative differences when (temporary) in vivo culture is performed.
Recent studies illustrated a higher percentage of equine ICSI embryos developing to the
compact morula or blastocyst stage in sheep oviducts (56%) when compared to culture in vitro
(20%) (Lazzari et al., 2010). Another intriguing finding was that aberrant expression of a
pluripotency gene in IVP blastocysts when compared to in vivo derived embryos could be
normalized by 2-3 days culture in an equine uterus (Choi et al., 2009). Studying gene expression
can reveal fundamental differences between equine in vivo and in vitro embryos (Smits et al.,
2009). When compared to in vivo derived equine blastocysts, IVP horse embryos have been
shown to be retarded in the kinetics of development, with more apoptosis and higher levels of
chromosomal abnormalities (Tremoleda et al., 2003; Pomar et al., 2005; Rambags et al., 2005).
Despite these differences, pregnancy rates after intra-uterine transfer of IVP equine blastocysts
are comparable to those after transfer of their in vivo counterparts and the possibility of
freezing IVP embryos at rather early stages provides the opportunity of successful
cryopreservation (Galli et al., 2007).
3.2.6 CONCLUSION
Although the IVP of equine embryos has evolved only recently and is not yet optimally efficient
when compared to other species, it provides important possibilities for research and clinical
application. This first ICSI foal of the Benelux is an important step in the improvement of the IVP
processes, which opens possibilities for more research in the domain of equine embryonic
development and valuable applications of the technique.
![Page 61: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/61.jpg)
Chapter 3
55
REFERENCES
1. Blanco I.D.P., Devito L.G., Ferreira H.N., Araujo G.H.M., Fernandes C.B., Alvarenga M.A.,
Landim-Alvarenga F.C. 2009. Aspiration of equine oocytes from immature follicles after
treatment with equine pituitary extract (EPE) alone or in combination with hCG. Anim
Reprod Sci 114 203-209.
2. Choi Y.H., Harding H.D., Hartman D.L., Obermiller A.D., Kurosaka S., McLaughlin K.J.,
Hinrichs K. 2009. The uterine environment modulates trophectodermal POU5F1 levels in
equine blastocysts. Reproduction 138 589-99.
3. Choi Y.H., Love C.C., Love L.B., Varner D.D., Brinsko S.P., Hinrichs K. 2002.
Developmental competence in vivo and in vitro of in vitro-matured equine oocytes
fertilized by intracytoplasmic sperm injection with fresh or frozen-thawed sperm.
Reproduction 123 455-465.
4. Choi Y.H., Love C.C., Varner D.D., Hinrichs K. 2006. Equine blastocyst development after
intracytoplasmic injection of sperm subjected to two freeze-thaw cycles. Theriogenology
65 808-819.
5. Cochran R., Meintjes M., Reggio B., Hylan D., Carter J., Pinto C., Paccamonti D., Godke
R.A. 1998. Live foals produced from sperm-injected oocytes derived from pregnant
mares. J Equine Vet Sci 18 736-740.
6. Colleoni S., Barbacini S., Necchi D., Duchi R., Lazzari G., Galli C. 2007. Application of
ovum pick-up, intracytoplasmic sperm injection and embryo culture in equine practice.
Proc AAEP 53 554-559.
7. Galli C., Colleoni S., Duchi R., Lagutina I., Lazzari G. 2007. Developmental competence of
equine oocytes and embryos obtained by in vitro procedures ranging from in vitro
maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear
transfer. Anim Reprod Sci 98 39-55.
8. Hinrichs K. 2005. Update on equine ICSI and cloning. Theriogenology 64 535-541.
9. Hinrichs K., Choi Y.H., Love L.B., Varner D.D., Love C.C., Walckenaer B.E. 2005. Chromatin
configuration within the germinal vesicle of horse oocytes, changes post mortem and
relationship to meiotic and developmental competence. Biol Reprod 72 1142-1150.
![Page 62: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/62.jpg)
Chapter 3
56
10. Hinrichs K., Choi Y.H., Walckenaer B.E., Varner D.D., Hartman D.L. 2007. In vitro-
produced equine embryos: production of foals after transfer, assessment by differential
staining and effect of medium calcium concentrations during culture. Theriogenology 68
521-529.
11. Lazzari G., Crotti G., Turini P., Duchi R., Mari G., Zavaglia G., Barbacini S., Galli C. 2002.
Equine embryos at the compacted morula and blastocyst stage can be obtained by
intracytoplasmic sperm injection (ICSI) of in vitro matured oocytes with frozen-thawed
spermatozoa from semen of different fertilities. Theriogenology 58 709-712.
12. Lazzari G., Colleoni S., Lagutina I., Crotti G., Turini P., Tessaro I., Brunetti D., Duchi R.,
Galli C. 2010. Short-term and long-term effects of embryo culture in the surrogate sheep
oviduct versus in vitro culture for different domestic species. Theriogenology 73 748-
757.
13. Li X., Morris L.H., Allen W.R. 2001. Influence of co-culture during maturation on the
developmental potential of equine oocytes fertilized by intracytoplasmic sperm
injection (ICSI). Reproduction 121 925-932.
14. McKinnon A.O., Lacham-Kaplan O., Trounson A.O. 2000. Pregnancies produced from
fertile and infertile stallions by intracytoplasmic sperm injection (ICSI) of single frozen-
thawed spermatozoa into in vivo matured mare oocytes. J Reprod Fertil Suppl 56 513-
517.
15. McPartlin L.A., Suarez S.S., Czaya C.A., Hinrichs K., Bedford-Guaus S.J. 2009.
Hyperactivation of stallion sperm is required for successful in vitro fertilization of equine
oocytes. Biol Reprod 81 199-206.
16. Palermo G., Joris H., Devroey P., Van Steirteghem A.C. 1992. Pregnancies after
intracytoplasmic injection of single spermatozoon into an oocyte. The Lancet 340 17-18.
17. Palmer E., Bézard J., Magistrini M., Duchamp G. 1991. In vitro fertilization in the horse. A
retrospective study. J Reprod Fertil Suppl 44 375-384.
18. Pomar F.J., Teerds K.J., Kidson A., Colenbrander B., Tharasanit T., Aguilar B., Roelen B.A.
2005. Differences in the incidence of apoptosis between in vivo and in vitro produced
blastocysts of farm animal species, a comparative study. Theriogenology 63 2254-2268.
![Page 63: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/63.jpg)
Chapter 3
57
19. Rambags B.P., Krijtenburg P.J., Drie H.F., Lazzari G., Galli C., Pearson P.L., Colenbrander
B., Stout T.A. 2005. Numerical chromosomal abnormalities in equine embryos produced
in vivo and in vitro. Mol Reprod Dev 72 77-87.
20. Smits K., Goossens K, Van Soom A., Govaere J., Hoogewijs M., Vanhaesebrouck E., Galli
C., Colleoni S., Vandesompele J., Peelman L. 2009. Selection of reference genes for
quantitative real-time PCR in equine in vivo and fresh and frozen-thawed in vitro
blastocysts. BMC Res Notes 2 246.
21. Squires E.L., Suh T.K., Graham J.K., Carnevale E.M. 2008. Use of sexed, refrozen
spermatozoa for ICSI. Proc 7th international symposium on equine embryo transfer 54.
22. Squires E.L., Wilson J.M., Kato H., Blaszczyk A. 1996. A pregnancy after intracytoplasmic
sperm injection into equine oocytes matured in vitro. Theriogenology 45 306.
23. Tremoleda J.L., Stout T.A., Lagutina I., Lazzari G., Bevers M.M., Colenbrander B., Galli C.
2003. Effects of in vitro production on horse embryo morphology, cytoskeletal
characteristics, and blastocyst capsule formation. Biol Reprod 69 1895-1906.
![Page 64: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/64.jpg)
![Page 65: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/65.jpg)
CHAPTER 4
DETERMINATION OF A SET OF RELIABLE REFERENCE GENES
FOR RT-QPCR IN IN VIVO DERIVED AND IN VITRO
PRODUCED EQUINE BLASTOCYSTS
Adapted from BMC Research Notes Smits K., Goossens K., Van Soom A., Govaere J., Hoogewijs
M., Vanhaesebrouck E., Galli C., Colleoni S., Vandesompele J., Peelman L. 2009. 2 246
![Page 66: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/66.jpg)
![Page 67: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/67.jpg)
Chapter 4
61
4.1 ABSTRACT
Background
Application of reverse transcription quantitative real-time polymerase chain reaction is very
well suited to reveal differences in gene expression between in vivo and in vitro produced
embryos. Ultimately, this may lead to optimized equine assisted reproductive techniques.
However, for a correct interpretation of the real-time PCR results, all data must be normalized,
which is most reliably achieved by calculating the geometric mean of the most stable reference
genes. In this study a set of reliable reference genes was identified for equine in vivo and fresh
and frozen-thawed in vitro embryos.
Findings
The expression stability of 8 candidate reference genes (ACTB, GAPDH, H2A/I, HPRT1, RPL32,
SDHA, TUBA4A, UBC) was determined in 3 populations of equine blastocysts (fresh in vivo, fresh
and frozen-thawed in vitro embryos). Application of geNorm indicated UBC, GAPDH, ACTB and
HPRT1 as the most stable genes in the in vivo embryos and UBC, RPL32, GAPDH and ACTB in
both in vitro populations. When in vivo and in vitro embryos were combined, UBC, ACTB, RPL32
and GAPDH were found to be the most stable. SDHA and H2A/I appeared to be highly
regulated.
Conclusions
Based on these results, the geometric mean of UBC, ACTB, RPL32 and GAPDH is to be
recommended for accurate normalization of quantitative real-time PCR data in equine in vivo
and in vitro produced blastocysts.
4.2 BACKGROUND
Conventional IVF has been rather unsuccessful in horses. To overcome this barrier ICSI has been
introduced and has resulted in transferable blastocysts that were used for research and
![Page 68: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/68.jpg)
Chapter 4
62
commercial purposes (Galli et al., 2007; Hinrichs et al., 2007; Stokes et al., 2009). The ability of
in vitro produced blastocysts to establish normal pregnancies is comparable to that of the in
vivo derived ones and, contrary to other species, in vitro produced equine blastocysts tolerate
freezing better than in vivo produced ones and they are able to establish pregnancies after
thawing (Galli et al., 2007). Despite these successes, there is a great variability in oocyte quality
and culture conditions resulting in a low percentage of blastocyst formation in vitro with great
variations amongst laboratories. Compared to their in vivo counterparts, in vitro blastocysts are
retarded in the kinetics of development, are smaller with fewer cells, show more apoptosis and
higher levels of chromosomal abnormalities (Tremoleda et al., 2003a; Rambags et al., 2005;
Pomar et al., 2005). Moreover intra-uterine transfer of in vitro produced embryos can give rise
to abnormal pregnancies with the development of a trophoblastic vesicle without an embryo
proper (Hinrichs et al., 2007). Understanding the fundamental difference between equine in
vivo versus in vitro embryos may prove beneficial in the development of equine assisted
reproductive techniques.
RT-qPCR is a highly specific and sensitive tool to compare mRNA expression levels of specific
genes (Bustin et al., 2005). Not only the RNA quality, the RT, the reagents and the protocol are
critical factors, the analytical method can also influence the results dramatically (Bustin et al.,
2004; Bustin et al., 2005). All data must be normalized for technical differences between
samples. The method of choice consists in normalization to internal reference genes, which
should be constitutively expressed without influence of the experimental treatment. Since
there is no universal reference gene with a constant expression in all tissues, optimal reference
genes need to be selected for each system (Kubista et al., 2006). The use of a single reference
gene or of multiple unstable reference genes may lead to erroneous normalization (Dheda et
al., 2005). Therefore, the geometric mean of carefully selected genes is recommended for
reliable normalization (Vandesompele et al., 2002).
Reference genes have been validated in preimplantation embryos of cattle (Goossens et al.,
2005), mice (Mamo et al., 2007), pigs (Kuijk et al., 2007) and rabbits (Mamo et al., 2008).
However, gene stability in mammalian embryos turned out to be species specific, which implies
![Page 69: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/69.jpg)
Chapter 4
63
the need of reference gene selection for the study of equine embryos. Gene expression studies
in equine species are relatively scarce. Real-time PCR has been conducted on equine
conceptuses to evaluate expression of progesterone and oestrogen receptors and on equine
blastocysts to identify POU5F1 expression, but in these studies only one reference gene, β-
actin, was used (Rambags et al., 2008; Choi et al., 2009). While sets of reference genes have
been identified for equine skin (Bogaert et al., 2006) and lymphocytes (Capelli et al., 2008), the
most reliable reference genes in equine embryos have not been studied before.
The aim of this study was to identify a set of stable reference genes for equine in vivo derived
embryos and fresh and frozen-thawed in vitro embryos.
4.3 METHODS
The in vivo blastocyst collection procedures used were approved by the ethics committee of the
faculty of veterinary medicine (reference number EC 2007/009). Cycling mares were followed
up by transrectal ultrasound. When the follicle size exceeded 35 mm in the presence of an
edematous uterus, 3000 IU hCG (Chorulon, Intervet, Belgium) was injected intravenously. The
next day the mare was inseminated with fresh semen. The time of ovulation was determined by
daily ultrasonography of the genital tract.. If the mare did not ovulate within 48 hours after AI,
insemination was repeated. The mares’ uterus was flushed 7 days after ovulation and
recovered embryos were washed in DPBS (14190, Gibco, Invitrogen, Belgium) and conserved
individually at -80 °C in lysis buffer (10 % RNasin Plus RNase inhibitor (Promega, The
Netherlands), 5 % dithiothreitol (Promega, The Netherlands), 0.8 % Igepal CA-630 (Sigma,
Belgium) in RNase free water) until further analysis.
For the production of fresh in vitro blastocysts, ovaries were recovered at the slaughterhouse
and follicles ≥ 5 mm were aspirated with a vacuum pump at a negative pressure of 100 mm Hg.
The follicle wall was scraped with the aspirating 16 gauge needle and flushed with 0.5 % (v/v)
heparin (H 1027, Sigma, Belgium) in DPBS (14190, Gibco, Invitrogen, Belgium). Oocytes were
matured for 28 h in DMEM-F12 based medium (Galli et al., 2007) at 38.5 °C in 5% CO2 in air. The
MII oocytes were fertilized by conventional ICSI as described by Tremoleda et al. (2003b).
![Page 70: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/70.jpg)
Chapter 4
64
Frozen-thawed sperm was used from the same fertile stallion that was used for production of in
vivo embryos of this experiment. In vitro culture was performed for 8.5 to 9.5 days in 20 µl
drops of DMEM-F12 (D 2906, Sigma, Belgium) with 10% FCS (F 9665, Sigma, Belgium) or 5% FCS
and 5% SR (10828-028, Gibco, Invitrogen, Belgium) at 38.5 °C in 5% CO2, 5% O2 and 90% N2.
Blastocysts were stored individually at -80 °C in lysis buffer until further analysis.
The frozen-thawed in vitro embryos were produced in Italy (Galli et al., 2007). Briefly, oocytes
were recovered from abbatoir ovaries by scraping and washing all the follicles between 5 and
30 mm. Oocytes were washed in HEPES buffered TCM199 and transferred for 24 h into DMEM-
F12 based maturation medium as previously described (Galli et al., 2007). After removal of all
cumulus cells, the oocytes with a polar body were fertilized by ICSI with frozen-thawed sperm
from stallions of proven fertility. Injected oocytes were cultured up to day 8 in 20 µl drops of
modified SOF (from day 6 half SOF: half DMEM-F12) at 38.5 °C in 5% CO2, 5% O2 and 90% N2.
Embryos that reached the blastocyst stage were loaded individually into 0.25 ml straws, frozen
with a slow cooling protocol (0.5 °C/min up to -32°C) in glycerol and stored in liquid N2. The
embryos were shipped to Belgium in dry ice and upon arrival they were immediately
transferred into lysis buffer with a minimum of medium and conserved at - 80 °C until further
analysis.
In all groups only blastocysts which were not hatched and had good morphological
characteristics were retained.
For each of the 3 groups, 8 embryos were analysed separately. Total RNA was extracted from
single embryos with the PicoPure RNA-isolation Kit (Arcturus, Mountain View, CA, USA), treated
with RQ1 DNAse (Promega, The Netherlands) and purified over a spin column (Microcon YM-
100, Millipore, Belgium). After minus RT control with primers for GAPDH to check for
contaminating genomic DNA, RNA was concentrated by precipitation with 3M sodium acetate
and ethanol. RNA amplification and conversion into cDNA was performed by means of the WT-
Ovation RNA Amplification System (NuGEN, USA) according to the manufacturers’ instructions
and the cDNA was purified again over a spin column. Amplified cDNA samples were diluted 10-
20 times, depending on the yield, in 10 mM Tris HCL pH 8.0 and stored at - 80 °C.
![Page 71: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/71.jpg)
Chapter 4
65
Eight reference genes were selected based on previous studies (Goossens et al., 2005; Bogaert
et al., 2006; Capelli et al., 2008). The selected genes (ACTB, GAPDH, H2A/I, HPRT, RPL32, SDHA,
TUBA4A and UBC) belong to different functional classes, which reduces the chance of co-
regulation.
Primers for ACTB, HPRT1, RPL32, TUBA4A and UBC were provided by Bogaert and colleagues
(2006). The other primers were designed by means of Primer3 software
(http://frodo.wi.mit.edu/primer3/), based on horse sequences found in the NCBI GenBank
(http://www.ncbi.nlm.nih.gov/). Primers were selected over intron-exon boundaries, tested
using a BLAST analysis against the NCBI database and verified using MFold
(http://frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/dna-form1.cgi). The optimal primer
annealing temperatures were determined on cDNA of equine mixed tissues. A melt curve
analysis followed by agarose gel electrophoresis was performed to test for primer-dimer
formation and specificity of the amplicons. All primers are listed in Table 1.
All reactions were executed in duplicate for 8 embryos in each of the three groups and a blank
was included in each run.
The diluted cDNA (2.5 µl), 0.33 µM of both forward and reverse primers and 4µl of RNAse free
water were added to 7.5 µl of KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems) to a final
volume of 15 µl. The reactions were performed on the iCycler iQ Real-Time PCR Detection
System (Bio-Rad, Belgium).
The PCR program started with an initial denaturation at 95°C for 3 minutes to activate the DNA
polymerase. Then 45 cycles were performed with a denaturation step at 95°C for 20 seconds
followed by an annealing/extension step at the primer specific annealing temperature for 40
seconds, during which fluorescence was measured. A dilution series with pooled cDNA from all
24 embryos was included for each gene to acquire PCR efficiencies based on a relative standard
curve. Calculation of the Cq values, PCR efficiencies, correlation coefficients and analysis of the
melting curves was performed by means of iCycler iQ Optical System Software Version 3.0a. The
standard errors of the PCR efficiencies were obtained by the qBasePlus software
(http://www.qbaseplus.com/).
![Page 72: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/72.jpg)
Chapter 4
66
Table 1 Primers. For each reference gene, the NCBI GenBank accession number, the sequence of
both forward and reverse primer, the size of the amplicon and the optimal primer annealing
temperature are listed. The RTPrimerDB ID (http://rtprimerdb.org/) is also reported, except for
the primers for which there is not yet an official reference sequence available in the database
(*).
Gene GenBank accession number
Sequence Amplicon size (bp)
Ta (°C)
RTprimerDB ID
Cq range
ACTB AF035774 CCAGCACGATGAAGATCAAG
GTGGACAATGAGGCCAGAAT
88 60 7848 16.3-23.8
GAPDH XM_001496020.1 CAGAACATCATCCCTGCTTC
ATGCCTGCTTCACCACCTTC
187 59 7849 14.2-24.5
H2A/I XM_001497311.2 ATATTCAGGCCGTGCTGCT
TTTGGGTTTCAAAGCGTTTC
105 60 * 23.5-37.3
HPRT1 AY372182 GGCAAAACAATGCAAACCTT
CAAGGGCATATCCTACGACAA
163 57 7850 17.6-25.8
RPL32 XM_001492042.2 AGCCATCTACTCGGCGTCA
TCCAATGCCTCTGGGTTTC
149 60 * 16.8-25.9
SDHA XM_001490889 TCCATCGCATAAGAGCAAAG
GGTGGAACTGAACGAACTCC
159 59 7851 20.7-33.3
TUBA4A XM_001491910.2 GCCCTACAACTCCATCCTGA
ATGGCTTCATTGTCCACCA
78 60 * 16.6-27.9
UBC AF506969 GCAAGACCATCACCCTGGA CTAACAGCCACCCCTGAGAC
206 60 7874 15.5-23.7
The expression stabilities were evaluated using the geNorm software for Microsoft Excel
(Vandesompele et al., 2002). This program ranks the genes based on the internal control gene
stability parameter M. Stepwise exclusion of the gene with the highest M value and
recalculation results in a ranking of the reference genes. Lower M values represent higher
![Page 73: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/73.jpg)
Chapter 4
67
expression stabilities. Furthermore the minimum number of genes required for the calculation
of a reliable normalization factor is determined.
4.4 RESULTS AND DISCUSSION
For the recovery of the in vivo embryos (n=8), 13 uterine flushes were performed in a
population of 8 mares (recovery rate: 61.5 %). To collect the fresh in vitro embryos (n=8), 123
ovaries were recovered in 5 experiments, which gave rise to a total number of 365 oocytes.
Maturation was completed and ICSI was performed in 209 oocytes (57 %) and 74 % of these
injected oocytes cleaved. Of the cleaved oocytes 5.8 % reached the blastocyst stage. The 8 in
vitro blastocysts which were used for genetic analysis were produced in 2 of those 5 batches
where the blastocyst percentage was 7.3 %.
Frozen embryos were produced in experiments for quality control purposes. They were frozen
on day 8 at the early blastocyst or blastocyst stage.
Prior to the start of the experiment, PCR was tested on one of the frozen-thawed embryos to
evaluate possible effects of remnants of the cryoprotectant. Both undiluted and 25x diluted
cDNA resulted in clear electrophoretic bands of expected size for UBC and ACTB. Only a minimal
amount of cryoprotectant accompanying the embryo was transferred to and diluted in the lysis
buffer. Importantly Cq-values of the fresh and frozen-thawed embryos remained in the same
range.
Because only a small quantity of RNA can be extracted from one embryo, an RNA pre-
amplification step was included in the protocol. Ribo-SPIA, the isothermal messenger RNA
amplification method used, has been shown to be accurate and reproducible (Dafforn et al.,
2004). High sensitivity permits quantification of low abundance transcripts and there is a good
correlation in differential gene expression between amplified and nonamplified cDNA (Dafforn
et al., 2004).
![Page 74: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/74.jpg)
Chapter 4
68
Dilution series of all candidate reference genes gave PCR-efficiencies between 97.1 % and 100
% and linear correlation coefficients that varied from 0.973 to 1.000. In table 2 the efficiencies
and their standard errors are listed.
One in vivo and one fresh in vitro embryo consistently resulted in Cq-values around 40. Probably
the amplification went wrong and both samples were deleted from further analysis.
The selection of appropriate reference genes can be achieved by evaluating RT-qPCR data with
statistical algorithms. The uniformity in gene ranking between geNorm (Vandesompele et al.,
2002), NormFinder (Andersen et al., 2004) and BestKeeper (Pfaffl et al., 2004) has been shown
to be high (Cappelli et al., 2008; Willems et al., 2006).
Table 2 PCR efficiency and the respectively standard error. Results of the reference gene
stability, as determined by geNorm, are shown in Figure 1, 2, 3 and 4. When all three groups of
embryos were included, the most stable genes were UBC, ACTB, RPL32 and GAPDH. The M
values of these genes range between 0.6 and 0.9, which indicates relatively good stability.
Gene Efficiency (%) Standard error ACTB 98.1 0.01 GAPDH 100 0.021 H2A/I 100 0.067 HPRT1 100 0.037 RPL32 100 0.071 SDHA 99.3 0.033 TUBA4A 100 0.017 UBC 97.1 0.017
![Page 75: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/75.jpg)
Chapter 4
69
Figure 1 Average expression stability values of equine in vivo and in vitro embryos. The average
stability values of the control genes were calculated with geNorm. When in vivo embryos and fresh and
frozen-thawed in vitro embryos were combined, UBC, ACTB, RPL32 and GAPDH were found to be the
most stable.
Figure 2 Average expression stability values of equine in vivo embryos. The average stability values of
the control genes were calculated with geNorm. In the population of the equine in vivo embryos UBC,
GAPDH, ACTB and HPRT1 were found to be the most stable.
0,6
0,8
1
1,2
1,4
1,6
1,8
2
2,2
2,4
SDHA H2A/I TUBA4A HPRT1 GAPDH RPL32 ACTBUBC
Aver
age
expr
essi
on s
tabi
lity
M
<::::: Least stable genes Most stable genes ::::>
0,3
0,8
1,3
1,8
2,3
2,8
H2A/I SDHA TUBA4A RPL32 HPRT1 ACTB UBCGAPDH
Aver
age
expr
essi
on s
tabi
lity
M
<::::: Least stable genes Most stable genes ::::>
![Page 76: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/76.jpg)
Chapter 4
70
Figure 3 Average expression stability values of fresh equine in vitro embryos. The average stability
values of the control genes were calculated with geNorm. In the population of the fresh equine in vivo
embryos UBC, RPL32, GAPDH and ACTB were found to be the most stable.
Figure 4 Average expression stability values of frozen-thawed equine in vitro embryos. The average
stability values of the control genes were calculated with geNorm. In the population of the fresh equine
in vivo embryos UBC, RPL32, GAPDH and ACTB were found to be the most stable.
0,2
0,4
0,6
0,8
1
1,2
1,4
1,6
1,8
2
SDHA HPRT1 H2A/I TUBA4A ACTB GAPDH UBCRPL32
Aver
age
expr
essi
on s
tabi
lity
M
<::::: Least stable genes Most stable genes ::::>
0,5
0,7
0,9
1,1
1,3
1,5
1,7
1,9
2,1
SDHA TUBA4A H2A/I HPRT1 ACTB GAPDH UBCRPL32
Aver
age
expr
essi
on s
tabi
lity
M
<::::: Least stable genes Most stable genes ::::>
![Page 77: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/77.jpg)
Chapter 4
71
The order of the 4 most stable genes, UBC, RPL32, GAPDH and ACTB, is identical in both in vitro
groups. This is an interesting finding as there was a difference in embryo culture conditions and
as the cryopreservation could have affected the results. Three of those 4 genes, UBC, GAPDH
and ACTB, represent the most stable genes in the in vivo embryos. In murine embryos the order
of stability of reference genes has also been found to be similar in both in vitro and in vivo
embryos (Mamo et al., 2007). In the latter study however, the stability measure values M were
described to be higher in the in vitro samples compared to the in vivo samples, which was not
the case in the equine embryos. SDHA and H2A/I generally turned out to be highly regulated.
These results differ from those in embryos from other species and from those in other equine
tissues. SDHA, which was highly regulated in equine embryos, appeared to be very stable in
bovine embryos (Goossens et al., 2005) and equine lymphocytes (Cappelli et al., 2008). This is
also the case for H2A/I, which was preferred as a reference gene in embryos of mice (Mamo et
al., 2007) and rabbits (Mamo et al., 2008). ACTB on the other hand appears fairly stable in
equine embryos, although it is highly regulated in bovine embryos (Goossens et al., 2005). This
again demonstrates the necessity to validate the genes according to the species and the tissue
type.
The use of the geometric mean of several internal control genes as a normalization factor (NF)
is more accurate than the use of a single reference gene. Inclusion of unstable genes on the
other hand negatively influences the NF and the number of reference genes used to calculate
this NF is a trade-off between practical considerations and accuracy. The optimal number of
genes was determined with geNorm by means of the pairwise variations (Vn/n+1) between the
sequential normalization factors (NFn and NFn+1) after successive inclusion of less stable
reference genes (Figure 5). The value of the pairwise variations reduces until 0.207 for V3/4. This
suggests that the inclusion of a fourth reference gene contributes to the stability. Therefore it is
recommended to use the 4 most stable genes, UBC, ACTB, RPL32 and GAPDH. The high values
of V6/7 and V7/8 represent the instability of H2A/I and SDHA, which is also clear in the steep rise
in Figure 1.
![Page 78: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/78.jpg)
Chapter 4
72
Figure 5 Determination of the optimal number of control genes for normalization. The optimal
number of control genes for normalization was calculated by geNorm. The value of the pairwise
variations reduces until 0.207 for V3/4, which indicates that the inclusion a fourth reference gene
contributes to the stability. Therefore the average of the 4 most stable genes is recommended to
determine a reliable NF.
In conclusion, the geometric mean of ACTB, UBC, RPL32 and GAPDH is recommended for
normalization of RT-qPCR data in experiments with equine in vivo and in vitro blastocysts.
REFERENCES
1. Andersen C.L., Jensen J.L., Ørntoft T.F. 2004. Normalization of real-time quantitative
reverse transcription-PCR data: a model-based variance estimation approach to identify
genes suited for normalization, applied to bladder and colon cancer data sets. Cancer
Res 164 5245-5250.
Pair
wis
e va
riat
ion
V
![Page 79: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/79.jpg)
Chapter 4
73
2. Bogaert L., Van Poucke M., De Baere C., Peelman L., Gasthuys F., Martens A. 2006.
Selection of a set of reliable reference genes for quantitative real-time PCR in normal
equine skin and in equine sarcoids. BMC Biotechnol 6 24.
3. Bustin S.A., Nolan T. 2004. Pitfalls of quantitative real-time reverse-transcription
polymerase chain reaction. J Biomol Tech 15 155-166.
4. Bustin S.A., Benes V., Nolan T., Pfaffl M.W. 2005. Quantitative real-time RT-PCR: a
perspective. J Mol Endocrinol 34 597-601.
5. Cappelli K., Felicetti M., Capomaccio S., Spinsanti G., Silvestrelli M., Supplizi A.V. 2008.
Exercise induced stress in horses: selection of the most stable reference genes for
quantitative RT-PCR normalization. BMC Mol Biol 9 49.
6. Choi Y.H., Harding H.D., Hartman D.L., Obermiller A.D., Kurosaka S., McLaughlin K.J.,
Hinrichs K. 2009. The uterine environment modulates trophectodermal POU5F1 levels in
equine blastocysts. Reproduction 138 589-599.
7. Dafforn A., Chen P., Deng G., Herrler M., Iglehart D., Koritala S., Lato S., Pillarisetty S.,
Purohit R., Wang M., Wang S., Kurn N. 2004. Linear mRNA amplification from as little as
5 ng total RNA for global gene expression analysis. Biotechniques 37 854-857.
8. Dheda K., Huggett J.F., Chang J.S., Kim L.U., Bustin S.A., Johnson M.A., Rook G.A., Zumla
A. 2005. The implications of using an inappropriate reference gene for real-time reverse
transcription PCR data normalization. Anal Biochem 344 141-143.
9. Galli C., Colleoni S., Duchi R., Lagutina I., Lazzari G. 2007 Developmental competence of
equine oocytes and embryos obtained by in vitro procedures ranging from in vitro
maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear
transfer. Anim Reprod Sci 98 39-55.
10. Goossens K., Van Poucke M., Van Soom A., Vandesompele J., Van Zeveren A. Peelman
L.J. 2005. Selection of reference genes for quantitative real-time PCR in bovine
preimplantation embryos. BMC Dev Biol 5 27.
11. Hinrichs K., Choi Y.H., Walckenaer B.E., Varner D.D., Hartman D.L. 2007. In vitro-
produced equine embryos: production of foals after transfer, assessement by
![Page 80: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/80.jpg)
Chapter 4
74
differential staining and effect of medium calcium concentrations during culture.
Theriogenology 68 521-529.
12. Kubista M., Andrade J.M., Bengtsson M., Forootan A., Jonák J., Lind K., Sindelka R.,
Sjöback R., Sjögreen B., Strömbom L., Ståhlberg A., Zoric N. 2006. The real-time
polymerase chain reaction. Mol Aspects Med 27 95-125.
13. Kuijk E.W., du Puy L., van Tol H.T., Haagsman H.P., Colenbrander B., Roelen B.A. 2007.
Validation of reference genes for quantitative RT-PCR studies in porcine oocytes and
preimplantation embryos. BMC Dev Biol 7 58.
14. Mamo S., Gal A.B., Bodo S., Dinnyes A. 2007. Quantitative evaluation and selection of
reference genes in mouse oocytes and embryos cultured in vivo and in vitro. BMC Dev
Biol 7 14.
15. Mamo S., Gal A.B., Polgar Z., Dinnyes A. 2008. Expression profiles of the pluripotency
marker gene POU5F1 and validation of reference genes in rabbit oocytes and
preimplantation stage embryos. BMC Mol Biol 9 67.
16. Pfaffl M.W., Tichopad A., Prgomet C., Neuvians T.P. 2004. Determination of stable
housekeeping genes, differentially regulated target genes and sample integrity:
BestKeeper--Excel-based tool using pair-wise correlations. Biotechnol Lett 26 509-515.
17. Pomar F.J., Teerds K.J., Kidson A., Colenbrander B., Tharasanit T., Aguilar B., Roelen B.A.
2005. Differences in the incidence of apoptosis between in vivo and in vitro produced
blastocysts of farm animal species: a comparative study. Theriogenology 63 2254-2268.
18. Rambags B.P., Krijtenburg P.J., Drie H.F., Lazzari G., Galli C., Pearson P.L., Colenbrander
B., Stout T.A. 2005. Numerical chromosomal abnormalities in equine embryos produced
in vivo and in vitro. Mol Reprod Dev 72 77-87.
19. Rambags B.P., van Tol H.T., van den Eng M.M., Colenbrander B., Stout T.A. 2008.
Expression of progesterone and oestrogen receptors by early intrauterine equine
conceptuses. Theriogenology 69 366-375.
20. Stokes J.E., Squires E.L., Suh T.K., Altermat J.L., Carnevale E.M. 2009. Effect of
developmental stage of ICSI-produced equine embryos on pregnancy rates (abstract).
Reprod Fertil Dev 21 164.
![Page 81: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/81.jpg)
Chapter 4
75
21. Tremoleda J.L., Stout T.A. Lagutina I., Lazzari G., Bevers M.M., Colenbrander B., Galli C.
2003a. Effects of in vitro production on horse embryo morphology, cytoskeletal
characteristics, and blastocyst capsule formation. Biol Reprod 69 1895-1906.
22. Tremoleda J.L., Van Haeften T., Stout T.A., Colenbrander B., Bevers M.M. 2003b.
Cytoskeleton and chromatin reorganization in horse oocytes following intracytoplasmic
sperm injection: patterns associated with normal and defective fertilization. Biol Reprod
69 186-194.
23. Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A., Speleman
F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome Biol 3 0034.1-0034.11.
24. Willems E., Mateizel I., Kemp C., Cauffman G, Sermon K., Leyns L. 2006. Selection of
reference genes in mouse embryos and in differentiating human and mouse ES cells. Int
J Dev Biol 50 627-635.
![Page 82: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/82.jpg)
![Page 83: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/83.jpg)
CHAPTER 5
IN VIVO DERIVED HORSE BLASTOCYSTS SHOW
TRANSCRIPTIONAL UPREGULATION OF DEVELOPMENTALLY
IMPORTANT GENES COMPARED TO IN VITRO PRODUCED
HORSE BLASTOCYSTS
Adapted from Smits K., Goossens K., Van Soom A., Govaere J., Hoogewijs M., Peelman L. 2010.
Reproduction Fertility and Development in press.
![Page 84: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/84.jpg)
![Page 85: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/85.jpg)
Chapter 5
79
5.1 ABSTRACT
In vitro produced (IVP) equine blastocysts can give rise to successful pregnancies, but their
morphology and developmental rate differ from that of in vivo derived equine blastocysts. The
aim of this study was to evaluate this difference at the genetic level. Therefore suppression
subtractive hybridization (SSH) was used to construct a cDNA library enriched for transcripts
preferentially expressed in in vivo derived equine blastocysts compared to in vitro produced
ones. Of the 62 different genes identified in this way, 6 genes involved in embryonic
development (BEX2, FABP3, HSP90AA1, MOBKL3, MCM7 and ODC) were selected for the
confirmation of this differential expression by means of reverse transcription quantitative real-
time PCR (RT-qPCR). For 5 of these genes the higher expression in vivo was proven by RT-qPCR
to be significant (FABP3 and HSP90AA1) or highly significant (ODC, MOBKL3 and BEX2),
confirming the results of the SSH. For MCM7 the difference was not significant. In conclusion 5
genes which are transcriptionally upregulated in in vivo derived equine blastocysts as compared
to IVP blastocysts have been identified. Because of their possible importance in embryonic
development, the expression of these genes can be used as a marker to evaluate in vitro
embryo production systems in the horse.
5.2 INTRODUCTION
Compared to other species the in vitro production (IVP) of equine embryos has been hampered
by the scarce availability of oocytes and by the inefficiency of conventional in vitro fertilization
(IVF). The introduction of intracytoplasmic sperm injection (ICSI) induced a rapid progress over
the last decade and transferable equine in vitro blastocysts have been successfully produced for
research as well as for commercial purposes (Galli et al., 2007; Hinrichs et al., 2007; Smits et al.,
2010). The IVP of equine embryos is a very valuable technique to study early stages of embryo
development, which used to be quite inaccessible because of their location in the oviduct.
Moreover in vitro embryos can be used to optimize the different steps of the IVP process itself.
Further research is required to obtain large scale clinical applications like in cattle (Blanco et al.,
2009), but promising results illustrating the great value of IVP in the horse have been published
![Page 86: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/86.jpg)
Chapter 5
80
recently (Colleoni et al., 2007). The combination of OPU and IVP represents in some cases the
only opportunity to obtain foals from valuable subfertile mares and stallions. It can be used for
mares with reproductive disorders or for aged mares and since the requirements for sperm
which is selected for ICSI are minimal, it is also applicable for stallions with poor sperm (Colleoni
et al., 2007). In this way IVP provides the production of offspring from genetically valuable
horses, which is of considerable benefit to the horse breeding industry.
Even though the capability of establishing pregnancies is comparable for IVP and in vivo derived
equine embryos (Colleoni et al., 2007), differences between both types of embryos remain
present. Compared to their in vivo counterparts equine IVP embryos have fewer cells with more
apoptosis and chromosomal abnormalities (Tremoleda et al., 2003; Pomar et al., 2005;
Rambags et al., 2005). In in vivo derived equine blastocysts a distinct glycoprotein capsule is
formed between the trophectoderm and the zona pellucida. In vitro produced blastocysts have
a deficient capsule formation and show only scattered patches of glycoproteins (Tremoleda et
al., 2003). Suboptimal culture conditions are a possible cause of this aberrant differentiation
since even temporary exposure of IVP embryos to an in vivo environment can have a major
influence on embryonic development. Lazzari et al. (2010) reported that 56 % of cleaved equine
in vitro embryos were developing to compact morulae and blastocysts after temporary culture
in sheep oviducts, which differed significantly from the 20 % which was achieved after total in
vitro culture. Another example was the finding that impaired differentiation of the equine
trophectoderm in vitro, which was determined by aberrant expression of the pluripotency
marker POU5F1 when compared to equine in vivo blastocysts, could be normalized by culturing
the IVP blastocysts in vivo for 2-3 days in an equine uterus (Choi et al., 2009).
In vivo derived horse embryos are relatively difficult to obtain, because the mare does not
respond adequately to superovulatory treatments and because the horse embryo arrives only
in the uterus at day 6.5, which limits the time period during which equine embryos can be
obtained by non-surgical flushing (Scherzer et al., 2008). As such, horse embryos are mostly
flushed during a natural cycle at day 7, at which time they have developed to the blastocyst or
expanded blastocyst stage. Such horse blastocysts represent the gold standard for early equine
![Page 87: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/87.jpg)
Chapter 5
81
embryonic development. Comparing IVP and in vivo derived horse blastocysts at the genetic
level can reveal fundamental differences responsible for the observed morphological and
developmental changes. In other mammalian species the expression level of specific genes has
been used to evaluate the effect of different embryo culture media as well as the effect of
adding specific components like serum or cytokines to these media on embryonic
differentiation (McElroy et al., 2008; Chin et al., 2009; Purpera et al., 2009). In the horse, the
expression of genes involved in cumulus expansion has been used to assess different oocyte
maturation conditions (Dell’Aquila et al., 2004). Evaluation of horse embryos by means of RT-
qPCR may provide the basis for improving the culture conditions for horse embryos.
Little is known about gene expression in equine embryos. At the start of this project, no
commercial horse microarray was available and annotation of the horse genome was poor.
Microarray is very useful if one wants to investigate a known panel of genes but it is not able to
detect novel or unknown genes. Therefore we decided to use suppression subtractive
hybridization (SSH), a powerful method for the detection of differentially expressed genes
when prior knowledge is limited (Diatchenko et al., 1996). This technique provides a selective
amplification of target cDNA fragments which are specifically expressed in one of the two cDNA
populations and in this way can be applicable for the comparison of the gene expression in in
vivo versus in vitro embryos. Results of this SSH however need to be confirmed by reverse
transcription quantitative real-time polymerase chain reaction (RT-qPCR), a highly sensitive and
specific tool, which can evaluate and quantify the difference in expression of the genes of
interest selected from the SSH.
The aim of this study was to evaluate gene expression in equine blastocysts at the
transcriptional level. SSH was used to identify genes which were expressed at a higher level in in
vivo derived equine blastocysts when compared to IVP equine blastocysts. Six of these genes
were selected for the confirmation and quantification of this difference in expression by RT-
qPCR. The choice of these genes was based upon their involvement in embryonic development
in other species.
![Page 88: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/88.jpg)
Chapter 5
82
5.3 MATERIALS AND METHODS
5.3.1 Collection of embryos
The procedures performed on the mares were approved by the Ethics Committee of the Faculty
of Veterinary Medicine (EC 2007/009). The in vivo embryos were collected by uterine flushing
of inseminated mares 7 days after detection of ovulation as described previously (Smits et al.,
2009). The in vitro embryos were produced following the protocol as previously described by
Smits et al. (2010). Briefly slaughterhouse oocytes were matured in vitro during 26h in DMEM-
F12 based medium in an atmosphere containing 5% CO2 (Galli et al., 2007). MII oocytes were
fertilized by conventional ICSI and cultured in vitro during 9-9.5 days in DMEM-F12 with 10%
fetal calf serum at 38.5°C in 5% CO2, 5% O2 and 90% N2.
In order to compare similar developmental stages, rather than embryos of equal chronological
age, the in vitro blastocysts were collected later than the in vivo derived blastocysts. This choice
was based upon previous research on equine in vivo and in vitro produced embryos. Tremoleda
et al. (2003) and Rambags et al. (2005) described day 7 IVP embryos to be smaller, to contain
fewer cells and to be retarded in the kinetics of development when compared to their in vivo
derived counterparts of the same age (day 7). In a subsequent study by Pomar et al. (2005) in
vivo embryos were collected 7 days after ovulation and in vitro embryos 9 days after ICSI and in
a recent publication by Choi et al. (2009) similarities in cell count and embryonic diameter were
found between IVP blastocysts on day 10 and the smallest in vivo derived blastocysts (day 7). In
both populations in our study the blastocyst stage was characterized by a blastocoele cavity
surrounded by a layer of trophoblast cells. Early expansion was displayed by a thinned zona
pellucida. However, considering rapid expansion in vivo, blastocysts in the in vivo group were
collected rather early and variation was minimized through regular ultrasound to detect
ovulation (1-2 times daily). For the SSH 10 in vivo embryos and 12 in vitro embryos were
collected. The number of in vitro embryos exceeded the number of in vivo embryos to provide
sufficient cDNA in the driver group, i. e. the in vitro embryos, in order to achieve hybridization
of common strands with the in vivo embryos. The RT-qPCR was performed with 8 in vivo and 8
in vitro embryos.
![Page 89: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/89.jpg)
Chapter 5
83
5.3.2 SSH
To identify the genes that were preferentially expressed in the in vivo embryos, 10 in vivo
embryos were pooled and composed the tester population. The driver population consisted of
12 pooled in vitro embryos. In both groups total RNA was extracted with the Pico Pure RNA
Isolation Kit (Arcturus, Mountain View, CA, USA), treated with RQ1 DNAse (Promega, The
Netherlands) and purified over a spin column (Microcon YM-100, Millipore, Belgium). After
concentration by precipitation with ammonium acetate and 95 % ethanol, conversion to and
amplification of cDNA was performed with the SMART PCR cDNA Synthesis Kit (Takara Bio Inc.,
France).
The SSH was accomplished with the PCR-Select cDNA Subtraction Kit (Takara Bio Inc., France)
following the manufacturer’s instructions. Briefly, Rsa I digestion of the cDNA and adaptor
ligation to the tester population was followed by 2 hybridizations and 2 PCR amplifications. This
resulted in enrichment of the differentially expressed high- and low-abundance tester
sequences. These were cloned into a T/A cloning vector (Invitrogen, Belgium) and transformed
into competent DH5α E. coli cells (Invitrogen, Belgium). The DNA-inserts were sequenced with
the BigDye Terminator v.3.1 cycle sequencing kit (Applied Biosystems, Belgium) on the Applied
Biosystems 3710xI DNA Analyzer and identified by BLAST analysis against the NCBI gene
database (Altschul et al., 1990) (http://www.ncbi.nlm.nih.gov/). Functional and pathway
analysis of the identified genes was performed by means of Ingenuity software
(http://www.ingenuity.com/products/pathways_analysis.html).
5.3.3 RT-qPCR
In both the in vivo and the in vitro group 8 embryos were analysed individually. The RNA
extraction, purification, concentration, amplification and conversion into cDNA were performed
as described previously (Smits et al., 2009).
The primers (Integrated DNA Technologies, Belgium) were designed by means of Primer3
software (Rozen and Skaletsky 2000), based on horse RNA and DNA sequences found in the
NCBI GenBank. To distinguish genomic DNA amplification, to provide specificity and to avoid
![Page 90: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/90.jpg)
Chapter 5
84
secondary structures in the primer region, primers were respectively selected over intron-exon
boundaries, tested using a BLAST analysis against the NCBI database and characterized with
MFold (Zuker, 2003). Primers were tested and optimal annealing temperature was determined
on cDNA of equine mixed tissues. The amplicons were run on a 2% agarose gel and confirmed
by nucleotide sequencing. All primers are listed in Table 1.
All RT-qPCR reactions were performed in duplicate with the KAPA SYBR FAST qPCR Master Mix
(Kapa Biosystems, USA) as previously described in Smits et al. (2009).
A blank, a melting curve and a 5- or 10-fold serial dilution series of pooled amplified embryonic
cDNA were included for each gene to check for contamination and specificity and to acquire
PCR efficiencies (Table 1) based on a relative standard curve. All Cq values were converted into
raw data using these PCR efficiencies and normalized by dividing them by their respective
normalization factor. This normalization factor was determined per embryo by calculating the
geometric mean of the validated reference genes ACTB, UBC, RPL32 and GAPDH (Smits et al.,
2009). For each gene the difference in expression level between the in vivo derived embryos
and the in vitro produced ones was analyzed by means of a Mann Whitney test and p-values
smaller than 0.05 were considered statistically significant.
Table 1 Primers RT-qPCR (Equus caballus). For each gene the GenBank accession number, the
primer sequences, the size of the amplicon, the primer annealing temperature and the qPCR
efficiency with its respective standard error are listed.
Gene Accession number
Sequence 5’→3’ Amplicon size (bp)
Ta (°C)
Efficiency (%)
Standard error
BEX2 XM_001503074.1 AAGCTGGTGAATGCTGTGTG AACTGCCCGCAAACTATGAC
209 63 99.5 0.064
FABP3 NM_001163885.1 CTGCTCTCTTGGCTCTTCTTTG CGATGATTGTGGTAGGCTTG
173 60 94.5 0.036
HSP90AA1 NM_001163955.1 GGATCTGGTCATCCTGCTCTAC ACGTGTCGTCATCTCCTTCA
197 63 96.1 0.112
MCM7 XM_001505047.1 GAGGATGATGAGGCTGGTG TCAGGCAGATGTTGATGTTG
211 63 93.1 0.040
MOBKL3 XM_001917847.1 GGCCGAAACTGTAACCAAAG CCAACCTTCACGCTAACTGG
138 60 94.8 0.012
ODC XM_001502323.2 CATGGGCGCTTATACTGTTG GAAGTCGTGGTTCTGGATTTG
121 63 97.2 0.018
![Page 91: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/91.jpg)
Chapter 5
85
5.4 RESULTS
5.4.1 Collection of equine blastocysts
For the recovery of the 10 in vivo blastocysts for the SSH 20 uterine flushes were performed
(recovery rate: 50 %), the 8 blastocysts for RT-qPCR were recovered in 13 flushes (recovery
rate: 61.5 %). These were the same blastocysts as those, used in CHAPTER 4.
To produce the 12 in vitro blastocysts needed for the SSH 466 mature oocytes were injected
and 44 % cleaved. Of the cleaved oocytes 5.8 % reached the blastocyst stage. To produce the 8
in vitro blastocysts necessary for RT-qPCR 123 ovaries were recovered in the course of 5
replicates, which gave rise to a total of 365 oocytes. ICSI was performed in 209 mature oocytes
(57 %) and 74 % of these injected oocytes cleaved. Of the cleaved oocytes 5.8 % reached the
blastocyst stage. The 8 in vitro blastocysts used for genetic analysis were derived from 2 out of
5 replicates, with a mean blastocyst percentage of 7.3 %. Parallel experiments revealed mean
cell counts of around 500 and the developmental compentence of the in vitro blastocysts was
shown by embryo transfer of 2 in vitro blastocysts resulting in a foal (Smits et al., 2010).
5.4.2 SSH
A total of 84 clones was sequenced, but some genes were represented by more than one clone.
This lead to the identification of 62 different genes preferentially expressed in the in vivo
blastocysts when compared to the in vitro produced blastocysts. Table 2 represents the
accession numbers of the SSH sequences and the respective genes which were identified
through BLAST.
Analysis of these genes by means of Ingenuity Pathway Analysis revealed the most important
functions in which these genes were involved (Figure 1). A majority of genes identified play a
role in protein synthesis, including many ribosomal genes, and in energy production, including
many mitochondrial genes. Furthermore several of the genes with higher expression in in vivo
embryos could be mutually linked in a functional network. The networks are added in Figure 2.
![Page 92: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/92.jpg)
Chapter 5
86
Table 2 Genes upregulated in in vivo derived blastocyst when compared to in vitro produced
blastocysts as determined by SSH (Equus caballus). This table describes the 62 genes that were
expressed at a higher level in the in vivo equine blastocysts than in the in vitro equine
blastocysts as determined by SSH. For each gene the NCBI accession number (AN) of the
sequence resulting from the SSH is listed. This sequence was identified through BLAST analysis
and the details on the homologous gene which was found in the NCBI database are also
included in the table. Finally the query coverage and the % of homology between both
sequences are described. * Predicted sequence, Ecab: Equus caballus, sim: similar to
AN SSH AN reference Gene GeneID
Query coverage (%)
Max identity (%)
GW820038 XM_001492988.2 *: Ecab sim tyrosine 3/tryptophan 5 -monooxygenase activation protein, zeta polypeptide (LOC100056060), mRNA YWHAZ 18 100
GW820037 XM_001505047.1 *: Ecab sim Minichromosome maintenance complex component 7 (LOC100068673), mRNA MCM7 39 100
GW820039 XM_001505158.2 *: Ecab sim HNRPC protein, transcript variant HNRPC 85 97
GW820040 XM_001494978.2 *: Ecab sim ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 (LOC100059401), mRNA ATP5J2 37 99
GW820041 NM_001163880.1 Ecab ribosomal protein L35a (RPL35A), mRNA RPL35A 36 99
GW820042 XR_044465.1 *: Ecab misc_RNA (LOC100054512), miscRNA / 40 89
GW820043 XM_001503074.1 *: Ecab sim brain expressed X-linked 2 (LOC100059298), mRNA BEX2 31 89
GW820044 NM_001163950.1 Ecab ribosomal protein S4 (RPS4), mRNA RPS4 72 99
GW820045 XM_001494060.2 *: Ecab sim mCG7602, transcript variant 1 (LOC100051535), mRNA mCG7602 77 98
GW820046 XM_001490466.2 *: Ecab sim Saccharopine dehydrogenase SCCPDH 56 100
GW820047 NM_001163890.1 Ecab ribosomal protein S26 (RPS26), mRNA RPS26 79 99
GW820048 XM_001917666.1 *: Ecab mitochondrial ATP synthase, H+ transporting F1 complex beta subunit (ATP5B), mRNA ATP5B 40 100
GW820029 XM_001918118.1 *: Ecab sim tat-associated protein (LOC100072802 / 56 99
GW820030 XM_001488883.2 *: Ecab actin, gamma 1 (ACTG1), mRNA ACTG1 43 99
GW820031 XM_001504949.1 *: Ecab sim ribosomal protein S13 (LOC100056386), mRNA RPS13 57 99
GW820032 XM_001500201.2 *: Ecab sim 60S ribosomal protein L12 (LOC100070538), mRNA RPL35A 31 98
GW820033 XM_001495020.2 *: Ecab sim ferritin heavy chain (LOC100062546 FTH1 73 98
GW820034 XM_001504725.2 *: Ecab sim transmembrane protein 93 ( TMEM93 57 99
GW820035 NM_001081781.1
Ecab eukaryotic translation elongation factor 1 alpha 1 (EEF1A1), mRNA >dbj|AB292108.1| Ecab EEF1A1 mRNA for eukaryotic translation elongation factor 1 alpha 1, complete cds EEF1A1 28 99
GW820036 XM_001494582.2 *: Ecab actin related protein 2/3 complex, subunit 1A, 41kDa (ARPC1A), mRNA ARPC1A 37 98
GW820049 XM_001493016.1 *: Ecab sim myosin regulatory light chain MYL12B 74 98
GW820050 XM_001492042.2 *: Ecab sim ribosomal protein L32 (LOC100056766 RPL32 79 100
GW820051 XM_001918320.1 *: Ecab sim proteasome (prosome, macropain PSMD11 47 98
GW820052 XM_001499248.2 *: Ecab sim ribosomal protein L23a (LOC100055584), mRNA RPL23A 47 98
GW820053 XM_001498955.2 *: Ecab sim ribosomal protein L37 (LOC100066211), mRNA RPL37 68 100
GW820054 XM_001503344.2 *: Ecab serine carboxypeptidase 1 (SCPEP1), mRNA SCPEP1 35 82
![Page 93: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/93.jpg)
Chapter 5
87
GW820055 XM_001493543.1 *: Ecab sim heat shock 105kDa/110kDa HSPH1 30 99
GW820056 XM_001916408.1 *: Ecab sim rCG50488 (LOC100067336), mRNA YBX1 88 99
GW820057 XM_001496510.2 *: Ecab sim rab11 (LOC100066116), mRNA RAB11A 58 99
GW820058 XM_001917617.1 *: Ecab sim HLA-B associated transcript 1 (LOC100146384), mRNA BAT1 66 100
GW820059 XM_001499910.2 *: Ecab Tax1 (human T-cell leukemia virus type I) binding protein 1 (TAX1BP1), mRNA TAX1BP1 42 99
GW820060 XM_001494880.2 *: Ecab G-beta-like protein (LOC100057771), mRNA GNB2L1 76 99
GW820061 XM_001916244.1 *: Ecab sim ATP synthase subunit alpha, mitochondrial (LOC100053178), mRNA ATP5A1 68 99
GW820062 XM_001496761.2 *: Ecab sim ribosomal protein S8 (LOC100065845 RPS8 61 99
GW820063 XM_001499070.2 *: Ecab sim caspase 12 (LOC100069290), mRNA CASP12 21 91
GW820064 XM_001502980.2 *: Ecab DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), mRNA DNMT3A 63 100
GW820065 XM_001500732.2 *: Ecab sim aldose reductase (LOC100065145 AKR1B1 87 99
GW820066 XM_001493571.2
*: Ecab sim 60S ribosomal protein L6 (TAX-responsive enhancer element-binding protein 107) (TAXREB107) (Neoplasm-related protein C140) (LOC100051509), mRNA RPL6 92 99
GW820067 XM_001493775.2 *: Ecab sim endoplasmic reticulum protein 29 (LOC100057258), mRNA ERP29 78 99
GW820068 XM_001502323.2 *: Ecab sim Ornithine decarboxylase (ODC) (LOC100072405), mRNA ODC1 83 99
GW820069 XM_001504903.2 *: Ecab sim ribosomal protein L27a-like (LOC100071004), mRNA RPL27A 62 100
GW820070 NM_001163885.1 Ecab fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) (FABP3), mRNA FABP3 50 99
GW820071 XM_001502665.2
*: Ecab sim 60 kDa heat shock protein, mitochondrial precursor (Heat shock protein 60) (HSP-60) (Hsp60) (60 kDa chaperonin) (Chaperonin 60) (CPN60) (Mitochondrial matrix protein P1) (P60 lymphocyte protein) (HuCHA60) (LOC100055147), mRNA HSPD1 52 98
GW820072 XM_001500153.2 *: Ecab septin 7 (SEPT7), mRNA SEPT7 43 98
GW820073 XM_001490339.1 *: Ecab sim zinc ribbon domain containing 1 (LOC100056703), mRNA ZNRD1 6 97
GW820074 XM_001503115.2 *: Ecab sim ribosomal protein S24 (LOC100073005 RPS24 77 100
GW820075 XM_001491121.2 *: Ecab sim Isoleucyl-tRNA synthetase, cytoplasmic (Isoleucine--tRNA ligase) (IleRS) (IRS) (LOC100054721), mRNA IARS 74 99
GW820076 XM_001503108.2 *: Ecab sim 14-3-3 protein beta/alpha (Protein kinase C inhibitor protein 1) (KCIP-1) (Protein 1054) (LOC100056084), mRNA YWHAB 88 99
GW820077 XM_001492385.2 *: Ecab sim COX6B protein (LOC100051249), mRNA COX6B 42 99
GW820078 XM_001499935.1
*: Ecab sim ATP synthase lipid-binding protein, mitochondrial precursor (ATP synthase proteolipid P3) (ATPase protein 9) (ATPase subunit c) (LOC100053347), mRNA ATP5G3 89 99
GW820079 XM_001501901.2 *: Ecab sim Fructose-bisphosphate aldolase A (Muscle-type aldolase) (Lung cancer antigen NY-LU-1) (LOC100066121), mRNA ALDOA 84 100
GW820080 NM_001163955.1 Ecab heat shock protein 90kDa alpha (cytosolic), class A member 1 (HSP90AA1), mRNA HSP90AA1 38 99
GW820081 XM_001915319.1 *: Ecab laminin, beta 1 (LAMB1), mRNA LAMB1 29 100
GW820082 XM_001491034.2 *: Ecab sim proteasome (prosome, macropain) subunit, alpha type 7 (LOC100057828), mRNA PSMA7 40 98
GW820083 XM_001494265.1 *: Ecab sim Malate dehydrogenase, cytoplasmic (Cytosolic malate dehydrogenase) (LOC100051612), mRNA MDH1 61 99
GW820084 XM_001493077.2 *: Ecab sim Protein tweety homolog 2 (hTTY2) (LOC100060986), mRNA TTYH2 68 100
GW820085 XM_001496363.2 *: Ecab sim ribosomal protein S6 (LOC100052368), mRNA RPS6 59 99
GW820086 XM_001498163.2 *: Ecab sim ribosomal protein L9 (LOC100055158 RPL9 83 99
GW820087 XM_001917847.1 *: Ecab sim Mps One Binder kinase activator MOBKL3 51 100
GW820088 XM_001498694.1 *: Ecab sim FGF-binding protein (LOC100068876), mRNA FGFBP1 64 89
GW820089 XM_001504562.1 *: Ecab heterogeneous nuclear ribonucleoprotein HNRNPA1 84 98
GW820090 XM_001501228.1 *: Ecab hypothetical LOC100066131 (LOC100066131 65 99
![Page 94: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/94.jpg)
Chapter 5
88
Figure 1 Functions genes SSH.The genes upregulated in in vivo equine blastocysts resulting from
SSH analysis were divided into functional classes by means of Ingenuity Pathway Analysis
software. The 13 most significant functions (p<0.003) are listed in this figure. The legend of the
X axis is –log (p-value). This p-value is calculated through Ingenuity Pathway analysis by means
of a right tailed Fisher’s Exact test and determines the probability that the association between
the genes in the dataset and the function is explained by chance alone.
![Page 95: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/95.jpg)
Chapter 5
89
A
B
![Page 96: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/96.jpg)
Chapter 5
90
C
D
![Page 97: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/97.jpg)
Chapter 5
91
Figure 2 Network classification according to Ingenuity Pathway Analysis.The genes resulting
from the SSH were mutually linked in several networks as determined by Ingenuity Pathway
Analysis (http://www.ingenuity.com/products/pathways_analysis.html), namely A: energy
production, nucleic acid metabolism, small molecule biochemistry B: organ development, gene
expression, cancer C: cardiovascular system development and function, hair and skin
development and function, organ development and D: organismal development, cell death,
nervous system development and function. The genes resulting from the SSH are colored grey,
the other genes involved in the networks are white. The genes selected for RT-qPCR are
indicated with a red circle. Solid lines imply direct relationships between proteins; dotted lines
imply indirect interactions.
5.4.3 RT-qPCR
Of the 62 genes identified, 6 which were previously shown to be involved in embryo
development in other species were selected for further evaluation by RT-qPCR. For 5 (brain
expressed X-linked 2 (BEX2), fatty acid binding protein 3 (FABP3), heat shock protein 90kDa
alpha, class A member 1 (HSP90AA1), mps one binder kinase activator-like 3 (MOBKL3), and
ornithine decarboxylase (ODC)) of the 6 genes that were selected from the SSH, the higher
expression in the in vivo derived embryos could be confirmed with RT-qPCR. Both FABP3 and
HSP90AA1 were significantly more expressed in the in vivo derived embryos compared to the in
vitro produced embryos (p<0.05). For ODC, MOBKL3 and BEX2 this difference was highly
significant (p<0.005). For the sixth gene (minichromosome maintenance complex component 7
(MCM7) the mean expression was higher in the in vivo population than in the in vitro group, but
this was not statistically significant. The results are summarized in Figure 3.
![Page 98: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/98.jpg)
Chapter 5
92
Figure 3 Differential gene expression in vivo versus in vitro as determined by RT-qPCR.This
figure presents the mean expression of 6 genes as determined by RT-qPCR in in vivo derived and
in vitro produced equine blastocysts. The standard errors are indicated by bars. For BEX2,
FABP3, HSP90AA1, MOBKL3 and ODC the mean expression was significantly higher in the in vivo
derived embryos. *significant (p<0.05) **higly significant (p<0.005)
5.5 DISCUSSION
Until recently the equine zygote and cleaving embryo were relatively inaccessible as a research
specimen without using surgery or slaughter (Betteridge, 2007), but since the establishment of
ICSI in the horse, it is possible to produce horse embryos outside the genital tract. As such, IVP
of equine embryos represents a valuable tool for research as well as for clinical purposes.
However, IVP embryos show marked differences when compared to embryos derived in vivo.
Research in other species revealed the influence of different steps in the IVP process on the
embryonic expression of developmentally important genes. Not only the fertilization through
IVF (Giritharan et al., 2007) or ICSI (Fernández-González et al., 2008), but also the IVC conditions
(Niemann and Wrenzycki, 2000; Rizos et al., 2002, Goossens et al., 2007) affect gene expression
levels. Even simple modifications of the embryo culture media, like the presence or absence of
**
**
**
**
0
0,5
1
1,5
2
2,5
BEX2 FABP3 HSP90AA1 MCM7 MOBKL3 ODC
Mean in vivo
Mean in vitro
![Page 99: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/99.jpg)
Chapter 5
93
serum, can profoundly influence the gene expression, which is reflected in the developmental
competence and the quality of the IVP embryos and even in long-term consequences (McElroy
et al., 2008; Fernández-González et al., 2009). Therefore the expression of specific genes has
been monitored to evaluate how different fertilization techniques and culture media can
influence embryonic differentiation.
In horses very little is known about gene expression in early embryos, with just a few recent
papers focusing on this topic (Rambags et al., 2008; Choi et al., 2009; Smits et al., 2009).
Comparative analysis of embryonic gene expression in the presence or absence of the maternal
genital tract is however a very valuable technique to get more insight into embryo-maternal
interaction in the horse and as such it can provide the basis for the optimisation of culture
conditions for horse embryos. Since the expression of specific genes can be stage specific, care
was taken to use similar developmental stages in the in vivo and the in vitro group. For the
reasons stated earlier, suppression subtractive hybridization (SSH) was used for the detection
of differentially expressed genes. In this study the genes expressed at a higher level in in vivo
derived equine blastocysts (tester) when compared to IVP equine blastocysts (driver) were
selectively amplified. This comparison, which has been shown to be valuable in other species,
has not yet been performed in the horse.
Ingenuity Pathway Analysis revealed the networks and functional categories in which these 62
differentially expressed genes are involved (Figure 1, Figure 2). Remarkable and on the other
hand logical is their implication in embryonic development, which shows clearly from the
different networks. Furthermore both the networks and the function categories illustrate the
involvement of these genes in energy production, nucleic acid metabolism and small molecule
biochemistry. The most important functional role appeared to be protein synthesis. This is in
agreement with the upregulation of protein synthesis genes in bovine in vivo blastocysts when
compared to in vitro blastocysts as determined by SSH (Mohan et al., 2004). In another
comparison of bovine in vivo versus in vitro blastocysts using microarrays the authors suggested
that phenotypic differences between both types of embryos might be associated with
inefficient transcription and translation in IVP embryos when compared to in vivo derived
![Page 100: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/100.jpg)
Chapter 5
94
embryos (Corcoran et al., 2006). The differentially expressed genes involved in protein
synthesis contained several ribosomal proteins. Knockdown studies in zebrafish and allelic
inactivation in mice illustrated the importance of ribosomal proteins in embryonic development
(Panić et al., 2006; Chakraborty et al., 2009).
The occurrence of false positive results in SSH analysis, as in microarray analysis, requires
confirmation of the differential expression by a very sensitive and specific method, RT-qPCR. Six
genes were selected from the SSH results based upon evidence of their involvement in
embryonic development in other species. For 5 of these genes the higher expression in in vivo
derived equine blastocysts when compared to IVP equine blastocysts was proven by RT-qPCR to
be significant (FABP3 and HSP90AA1) or highly significant (ODC, MOBKL3 and BEX2), confirming
the results of the SSH. Subsequently the biological relevance of the RT-qPCR results will be
discussed for ODC, HSP90AA1, BEX2, MOBKL3, FABP3 and MCM7.
Ornithine decarboxylase (ODC) is an enzyme which decarboxylates L-ornithine to putrescine,
the first step in the biosynthetic pathway of polyamines, which are regulators of cell growth
and differentiation. Polyamines stimulate DNA repair and they prevent DNA damage by
stabilizing the chromatin structure and by acting as antioxidant as they scavenge reactive
oxygen species (ROS) (Pendeville et al., 2001). Several studies illustrate the importance of
polyamines, proline, a major substrate for the polyamine synthesis, and ODC, the key
regulatory enzyme in this synthesis, throughout embryonic and fetal development in different
species (Wu et al., 2008; Gao et al., 2009; Lopez-Garcia et al., 2009). The essential role of ODC
in embryonic development has been demonstrated by the lethality of Odc-deficient murine
embryos, caused by a deficient expansion of the inner cell mass (ICM) of these embryos, which
was found to be mediated through increased apoptosis in the ICM (Pendeville et al., 2001). The
lower expression of ODC in equine in vitro blastocysts could be a possible factor influencing the
indistinct separation between the ICM and the trophectoderm as observed in in vitro produced
horse blastocysts. A possible way to improve embryonic expression of ODC was investigated in
a study of pig parthenotes: by means of addition of exogenous polyamines to the embryo
culture medium, the mRNA expression of ODC could be enhanced and this improved porcine
![Page 101: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/101.jpg)
Chapter 5
95
embryonic development to the blastocyst stage, with increased cell counts and decreased
apoptosis (Cui and Kim 2005). Although the exact molecular mechanisms are not clear, the
authors state that the induced transcription of ODC through the exogenous polyamines might
regulate cell cycle and/or apoptosis related gene expression in the embryos, resulting in
enhanced embryo viability. This anti-apoptotic effect of ODC was also found during oocyte
maturation and appeared to be mediated through the suppression of ROS since an increase of
ROS was demonstrated in ODC-deficient oocytes (Zhou et al., 2009).
Another group of proteins exhibiting an anti-apoptotic role during embryonic development are
the heat shock proteins (HSP) (Esfandiari et al., 2007). Under physiological circumstances these
molecular chaperones exhibit several of the functions indicated in Figure 1, like protein folding.
Increased synthesis is induced in response to stressful conditions, including rapid cell growth
and differentiation, toxicity and inflammation. Their important role in embryonic development
starts at the early onset of zygotic genome activity (Bensaude et al., 1983; Christians et al.,
1995). The supplementation of mouse in vitro culture media with mononoclonal antibodies to
HSP60, HSP70 or HSP90 has been shown to result in impaired embryonic development with
reduced blastocyst formation and higher rates of apoptosis (Neuer et al., 1998; Esfandiari et al.,
2007). This anti-apoptotic effect of HSPs is valuable for in vitro embryo production systems
since suboptimal culture conditions can induce a higher degree of apoptosis when compared to
conditions prevailing in the maternal genital tract. Therefore Esfandiari et al., (2007) suggest
that overexpression of HSP might be beneficial for embryonic development. A similar
conclusion was drawn in cattle in vivo embryos in which a positive correlation was found
between HSP70 expression and embryo quality (Pretheeban et al., 2009), which is in agreement
with our results. In the SSH several HSPs, namely HSP60, HSP90AA1 and HSPH1, were expressed
at a higher level in the in vivo derived equine blastocysts when compared to the IVP blastocysts.
For HSP90AA1 this difference was further evaluated by RT-qPCR and confirmed as significant.
However, it must be noted that some authors interpret a higher HSP expression as a negative
sign illustrating increased stress for the embryo (Chin et al., 2009).
![Page 102: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/102.jpg)
Chapter 5
96
One more group of genes which is intriguing with regard to embryonic development is the BEX
family. It consists of 4 to 7 genes, according to the species, with BEX1 and BEX2 highly diverged
from the others (Zhang, 2008). BEX1, BEX2 and BEX3 have been discovered in mice in an
experiment where parthenogenetic and normal blastocysts were compared to identify new
imprinted genes. The expression of BEX1 appeared to be upregulated in parthenogenetic
blastocysts (Brown and Kay, 1999). However, Williams et al., (2002) found indications that this
elevated expression did not result from genomic imprinting of the BEX1 gene since no
difference in expression was observed between androgenotes (two paternal genomes),
gynogenotes (two maternal genomes) and control embryos. On the other hand the BEX1
expression seemed to be dependent on the developmental stage and the cell type with an
increased expression at the expanding blastocysts stage, which was moreover trophectoderm
specific. Therefore a more likely explanation for the higher expression in the parthenogenotes
as observed by Brown and Kay (1999) could be the combination of the effects of the
trophectoderm specific expression of BEX1 and the differences in timing of trophectoderm
differentiation between the different classes of embryos. In our study the expression of BEX2
was found to be higher in equine in vivo blastocysts than in IVP blastocysts. Possibly this might
be explainable in a similar way since the differentiation of the equine trophectoderm, as
indicated by loss of expression of the pluripotency marker POU5F1, has been shown to be
impaired in IVP equine blastocysts (Choi et al., 2009). Recent studies however do support X-
linked imprinting, as they describe a predominant expression in female embryos of BEX1 in
mice (Kobayashi et al., 2010) and BEX1 and BEX2 in cattle (Bermejo-Alvarez et al., 2010).
Bermejo-Alvarez et al. (2010) found a higher expression of BEX1 and BEX2 in female bovine
blastocysts produced in vitro when compared to their male and parthenogenetic counterparts,
suggesting preferential expression of the paternal allele. Even though little is known about X-
chromosome inactivation during early embryonic development, several studies illustrate the
importance of genes involved in imprinting for the long term phenotype as well as a substantial
influence of the in vivo or in vitro environmental conditions on the expression of these genes
(Young et al., 2001; Fernàndez-Gonzàlez et al., 2009). Further research is needed to elucidate
the role and the mode of action of the BEX genes in horse embryos.
![Page 103: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/103.jpg)
Chapter 5
97
Another gene expressed at a significantly higher level in the in vivo derived equine blastocysts is
FABP3. The role of fatty acids in embryonic development is controversial. Compared to mice
and human, oocytes and embryos of domestic animals contain high amounts of lipids. A
hypothesis to explain this is that the lipids function as endogenous energy reserve during the
time that the embryos remain unattached in the uterus, which is relatively long when
compared to the early attachment in human and mice, which occurs immediately after hatching
(Sturmey et al., 2009). Previous research indicates the ability of oocytes and early embryos to
use fatty acids as energy substrates (Sturmey et al., 2009). Several studies illustrate the
essential role of FABP during embryonic development (Gentili et al., 2004; Arai et al., 2005).
However, abundance of fatty acids in the embryonic environment negatively influences the
development. Supplementation of hyperlipidaemic sera to bovine embryo culture medium
resulted in a reduction of blastocyst development (Leroy et al., 2010).
Mps One Binder kinase activator-like 3 (MOBKL3, MOB1) is also known as preimplantation
protein 3 because of its expression during oocyte maturation and preimplantation embryo
development following embryonic genome activation. Research in mice revealed a relatively
high expression through the one cell stage, a decline at the two cell stage and a subsequent rise
at either the eight cell or blastocyst stage, indicating a role in preimplantation embryogenesis
(Temeles et al., 1994). In pigs the polymorphism of this gene was associated with litter size
traits and suggested to be useful for marker assisted selection (Niu et al., 2006). In this study
this preimplantation protein was expressed at a higher level in the in vivo derived equine
blastocysts when compared to the IVP blastocysts. Information about this gene in horses is
absent, but an important role in the coordination of mitotic exit and cytokinesis has been found
in yeast and mammalian homologues appear to play similar roles (Hergovich et al., 2008;
Wilmeth et al., 2010).
Another gene involved in the guidance of the accurate execution of cell division is MCM7. For
normal embryonic development it is important that complete duplication of the genome occurs
exactly once per cell cycle (Blow and Laskey, 1988). This crucial event is ensured through DNA
licensing by the assembly of a prereplication complex to the replication origins (Donaldson and
![Page 104: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/104.jpg)
Chapter 5
98
Blow, 1999). As a part of this complex the minichromosome maintenance (MCM) 2-7 helicase
plays a central role in DNA replication initiation and elongation (Labib et al., 2000). The
expression of MCM genes can serve as a sensitive marker for proliferation zones during
embryogenesis (Ryu and Driever, 2006). A member of this MCM family, MCM7, which is
involved in the oogenesis and the first embryonic cell cycle in mice (Sweich et al., 2007), was
indicated by the SSH to be preferentially expressed in in vivo equine embryos when compared
to their in vitro counterparts. However, evaluation of this differential expression by RT-qPCR
revealed it to be not significant.
In conclusion 62 genes which were expressed at a higher level in in vivo derived equine
blastocysts when compared to in vitro produced equine blastocysts were identified by means of
SSH. Ingenuity Pathway analysis revealed the functional categories and networks in which these
genes are involved and indicated an important role in protein synthesis. For 5 of these SSH
sequences, namely ODC, HSP90AA1, BEX2, MOBKL3 and FABP3, the higher expression in vivo
was confirmed by RT-qPCR. The evaluation of embryos at the genetic level has appeared to be
valuable in other species. This study contains the first step of a similar approach in the horse,
which may enable progress in the field of assisted reproductive techniques. Further research
will be focused on environmental influences on the embryonic gene expression, finally aiming
to improve knowledge and valuable clinical applications for the subfertile horse.
REFERENCES
1. Arai Y., Funatsu N., Numayama-Tsuruta K., Nomura T., Nakamura S., Osumi N. 2005.
Role of Fabp7, a downstream gene of Pax6, in the maintenance of neuroepithelial cells
during early embryonic development of the rat cortex. J Neurosci 25 9752-9761.
2. Bensaude O., Babinet C., Morange M., Jacob F. 1983. Heat shock proteins, first major
products of zygotic gene activity in mouse embryo. Nature 305 331-333.
3. Bermejo-Alvarez P., Rizos D., Rath D., Lonergan P., Gurierrez-Adan A. 2010. Sex
determines the expression level of one third of the actively expressed genes in bovine
blastocysts. Proc Natl Acad Sci U S A. 107 3394-3399.
![Page 105: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/105.jpg)
Chapter 5
99
4. Betteridge K. 2007. Equine embryology: an inventory of unanswered questions.
Theriogenology 68 suppl 1 S9-21.
5. Blanco I.D.P., Devito L.G., Ferreira H.N., Araujo G.H.M., Fernandes C.B., Alvarenga M.A.,
Landim-Alvarenga F.C. 2009. Aspiration of equine oocytes from immature follicles after
treatment with equine pituitary extract (EPE) alone or in combination with hCG. Anim
Reprod Sci 114 203-209.
6. Blow J.J., Laskey R.A. 1988. A role for the nuclear envelope in controlling DNA replication
winthin the cell cycle. Nature 332 546-548.
7. Brown A.L., Kay G.F. 1999. Bex1, a gene with increased expression in parthenogenetic
embryos, is a member of a novel gene family on the mouse X chromosome Hum Mol
Genet 8 611-619.
8. Chakraborty A., Uechi T., Higa S., Torihara H., Kenmochi N. 2009. Loss of ribosomal
protein L11 affects zebrafish embryonic development through a p53-dependent
apoptotic response. PLoS One 4 e4152.
9. Chin P.Y., Macpherson A.M., Thompson J.G., Lane M., Robertson S.A. 2009. Stress
response genes are suppressed in mouse preimplantation embryos by granulocyte-
macrophage colony-stimulating factor (GM-CSF). Hum Reprod 24 2997-3009.
10. Choi Y.H., Harding H.D., Hartman D.L., Obermiller A.D., Kurosaka S., McLaughlin K. J.,
Hinrichs K. 2009. The uterine environment modulates trophectodermal POU5F1 levels in
equine blastocysts. Reproduction 138 589-599.
11. Christians E., Campion E., Thompson E.M., Renard J. 1995. Expression of the HSP 70.1
gene, a landmark of early zygotic activity in the mouse embryo, is restricted to the first
burst of transcription. Development 121 113-122.
12. Colleoni S., Barbacini S., Necchi D., Duchi R., Lazzari G., Galli, C. 2007. Application of
ovum pick-up, intracytoplasmic sperm injection and embryo culture in equine practice.
Proc AAEP 554-559.
13. Corcoran D., Fair T., Park S., Rizos D., Patel O.V., Smith G.W., Coussens P.M., Ireland J. J.,
Boland M.P., Evans A.C., Lonergan P. 2006. Suppressed expression of genes involved in
![Page 106: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/106.jpg)
Chapter 5
100
transcription and translation in in vitro compared with in vivo cultured bovine embryos.
Reproduction 131 651-660.
14. Cui X.S., Kim N.H. 2005. Polyamines inhibit apoptosis in porcine parthenotes developing
in vitro. Mol Reprod Dev 70 471-477.
15. Dell’Aquila M.E., Caillaud M., Maritato F., Martoriati A., Gérard N., Aiudi G., Minoia P.,
Goudet G. 2004. Cumulus expansion, nuclear maturation and connexin 43,
cyclooxygenase-2 and FSH receptor mRNA expression in equine cumulus-oocyte
complexes cultured in vitro in the presence of FSH and precursors for hyaluronic acid
synthesis. Reprod Biol Endocrinol 2 44.
16. Diatchenko L., Lau Y.F., Campbell A.P., Chenchik A., Moqadam F., Huang B., Lukyanov S.,
Lukyanov K., Gurskaya N., Sverdlov E.D., Siebert P.D. 1996. Suppression subtractive
hybridization: a method for generating differentially regulated or tissue-specific cDNA
probes and libraries. Proc National Academy of Sciences of the USA 93 6025-6030.
17. Donaldson A.D., Blow J.J. 1999. The regulation of replication origin activation. Curr opin
Genet Dev 9 62-68.
18. Esfandiari N., Falcone T., Goldberg J.M., Agarwal A., Sharma K.R. 2007. Heat-shock
proteins modulate the incidence of apoptosis and oxidative stress in preimplantation
mouse embryos. Fertil Steril 87 1214-1217.
19. Fernández-González R., Moreira P. N., Pérez-Crespo M., Sánchez-Martín M., Ramirez M.
A., Pericuesta E., Bilbao A., Bermejo-Alvarez P., de Dios Hourcade J., de Fonseca F. R.,
Gutiérrez-Adán A. 2008. Long-term effects of mouse intracytoplasmic sperm injection
with DNA-fragmented sperm on health and behavior of adult offspring. Biol Reprod 78
761-772.
20. Fernàndez-Gonzàlez R., de Dios Hourcade J., López-Vidriero I., Benguría A., Rodríguez De
Fonseca F., Gutiérrez-Adán A. 2009. Analysis of gene transcription alterations at the
blastocyst stage related to the long-term consequences of in vitro culture in mice.
Reproduction 137 271-283.
21. Galli C., Colleoni S., Duchi R., Lagutina I., Lazzari G. 2007. Developmental competence of
equine oocytes and embryos obtained by in vitro procedures ranging from in vitro
![Page 107: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/107.jpg)
Chapter 5
101
maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear
transfer. Anim Reprod Sci 98 39-55.
22. Gao H., Wu G., Spencer T.E., Johnson G.A., Bazer F.W. 2009. Select nutrients in the ovine
uterine lumen. V. Nitric oxide synthase, GTP cyclohydrolase, and ornithine
decarboxylase in ovine uteri and peri-implantation conceptuses. Biol Reprod 81 67-76.
23. Gentili C., Tutolo G., Zerega B., Di Marco E., Cancedda R., Cancedda F.D. 2004. Acute
phase lipocalin Ex-FABP is involved in heart development and cell survival. J Cell Physiol
202 683-689.
24. Giritharan G., Talbi S., Donjacour A., Di Sebastiano F., Dobson A. T., Finaudo P. F. 2007.
Effect of in vitro fertilization on gene expression and development of mouse
preimplantation embryos. Reproduction 134 63-72.
25. Goossens K., Van Soom A., Van Poucke M., Vandaele L., Vandesompele J., Van Zeveren
A., Peelman L. 2007. Identification and expression analysis of genes associated with
bovine blastocyst formation. BMC Dev Biol. 7 64.
26. Hayes M.A. Quinn, B.A., Keirstead N.D., Katavolos P., Waelchli R.O., Betteridge K.J. 2008.
Proteins Associated With the Early Intrauterine Equine Conceptus. Reprod Domest Anim
(Suppl 2) 43 232–237.
27. Hegovich A., Cornils H., Hemmings B.A. 2008. Mammalian NDR Protein kinases: From
regulation to a role in centrosome duplication. Biochim Biophys Acta 1784 3-15.
28. Hinrichs K., Choi Y.H., Walckenaer B.E., Varner D.D., Hartman D.L. 2007. In vitro-
produced equine embryos: production of foals after transfer, assessement by
differential staining and effect of medium calcium concentrations during culture.
Theriogenology 68 521-529.
29. Kobayashi S., Fujihara Y., Mise N., Kaseda K., Abe K., Ishino F., Okabe M. 2010. The X-
linked imprinted gene family FTH17 shows predominantly female expression following
the two-cell stage in mouse embryos. Nucleic Acids Res 38 3672-3681.
30. Lazzari G., Colleoni S., Lagutina I., Crotti G., Turini P., Tessaro I., Brunetti D., Duchi R.,
Galli C. 2010. Short-term and long-term effects of embryo culture in the surrogate sheep
![Page 108: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/108.jpg)
Chapter 5
102
oviduct versus in vitro culture for different domestic species. Theriogenology 73 748-
757.
31. Labib K., Tercero J.A., Diffley J.F. 2000. Uninterrupted MCM2-7 function required for
DNA replication fork progression. Science 294 867-870.
32. Leroy J.L.M.R., Van Hoeck V., Clemente M., Rizos D., Gutierrez-Adan A., Van Soom A.,
Uytterhoeven M., Bols P. 2010. The effect of nutritionally induced hyperlipidaemia on in
vitro bovine embryo quality. Hum Reprod 25 768-778.
33. Lopez-Garcia C., Lopez-Contreras A.J., Cremades A., Castells M.T., Peñafiel R. 2009.
Transcriptomic analysis of polyamine-related genes and polyamine levels in placenta,
yolk sac and fetus during the second half of mouse pregnancy. Placenta 30 241-249.
34. McCue P.M. 1996. Superovulation. Vet Clin North Am Equine Pract 12 1-11.
35. McCurley A.T., Callard G.V. 2008. Characterization of housekeeping genes in zebrafish:
male-female differences and effects of tissue type, developmental stage and chemical
treatment. BMC Mol Biol 12, 102.
36. McElroy S.L., Kim J.H., Kim S., Jeong Y.W., Lee E.G., Park S.M., Hossein M.S., Koo O.J.,
Abul Hashem M.D., Jang G., Kang S.K., Lee B.C., Hwang W.S. 2008. Effects of culture
conditions and nuclear transfer protocols on blastocyst formation and mRNA expression
in pre-implantation porcine embryos. Theriogenology 69 416-425.
37. Mohan M., Hurst A.G., Malayer J.R. 2004. Global gene expression analysis comparing
bovine blastocysts fluched on day 7 or produced in vitro. Mol Reprod Dev 68 288-298.
38. Neuer A., Mele C., Liu H.C., Rosenwaks Z., Witkin S.S. 1998. Monoclonal antibodies to
mammalian heat shock proteins impair mouse embryo development in vitro. Hum
Reprod 13 987–990.
39. Niemann H., Wrenzycki C. 2000. Alterations of expression of developmentally important
genes in preimplantation bovine embryos by in vitro culture conditions: implications for
subsequent development. Theriogenology 53 21-34.
40. Niu B.Y., Xiong, Y.Z., Li F.E., Deng C.Y., Jiang C.W., Ye L.Z., Wang J., Ding S.H., Guo W.H.
2006. Polymorphism of the pig pre-implantation protein 3 (prei3) gene and its
association with litter size traits. South African Journal of Animal Science 36 209-214.
![Page 109: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/109.jpg)
Chapter 5
103
41. Panić L., Tamarut S., Sticker-Jantscheff M., Barkić M., Solter D., Uzelac M., Grabušić K.,
Volarević S. 2006. Ribosomal protein S6 gene haploinsufficiency is associated with
activation of a p53-dependent checkpoint during gastrulation. Mol Cell Biol 26 8880-
8891.
42. Pendeville H., Carpino N., Marine J.C., Takahashi Y., Muller M., Martial J.A., Cleveland
J.L. 2001. The ornithine decarboxylase gene is essential for cell survival during early
murine development. Mol Cell Biol 21 6549-6558.
43. Pomar F.J., Teerds K.J., Kidson A., Colenbrander B., Tharasanit T., Aguilar B., Roelen B.A.
2005. Differences in the incidence of apoptosis between in vivo and in vitro produced
blastocysts of farm animal species: a comparative study. Theriogenology 63 2254-2268.
44. Pretheeban T., Gordon M., Singh R., Perera R., Rajamhendran R. 2009. Differential
mRNA expression in in vivo produced pre-implantation embryos of dairy heifers and
mature cows. Mol Reprod Dev 76 1165-1172.
45. Purpera M.N., Giraldo A.M., Ballard C.B., Hylan D., Godke R.A., Bondioli K.R. 2009.
Effects of culture medium and protein supplementation on mRNA expression of in vitro
produced bovine embryos. Mol Reprod Dev 76 783-793.
46. Rambags B.P., Krijtenburg P.J., Drie H.F., Lazzari G., Galli C., Pearson P.L., Colenbrander
B., Stout T.A. 2005. Numerical chromosomal abnormalities in equine embryos produced
in vivo and in vitro. Mol Reprod Dev 72 77-87.
47. Rambags B.P., van Tol H.T., Van den Eng M.M., Colenbrander, B., Stout T.A. 2008.
Expression of progesterone and oestrogen receptors by early intrauterine equine
conceptuses. Theriogenology 69 366-375.
48. Rizos D., Lonergan P., Boland M.P., Arroyo-García R., Pintado B., de la Fuente J.,
Gutiérrez-Adàn A. 2002. Analysis of differential messenger RNA expression between
bovine blastocysts produced in different culture systems: implications for blastocyst
quality. Biol Reprod 66 589-595.
49. Rozen S., Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist
programmers. Methods Mol Biol 132 365-386.
![Page 110: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/110.jpg)
Chapter 5
104
50. Ryu S., Driever W. 2006. Minichromosome maintenance proteins as markers for
proliferation zones during embryogenesis. Cell Cycle 5 1140-1142.
51. Scherzer J., Fayrer-Hosken R.A., Ray L., Hurley D.J., Heusner G.L. 2008. Advancements in
large animal embryo transfer and related biotechnologies. Reprod Dom Anim 43 371-
376.
52. Smits K., Goossens K., Van Soom A., Govaere J., Hoogewijs M., Vanhaesebrouck E., Galli
C., Colleoni S., Vandesompele J., Peelman L. 2009. Selection of reference genes for
quantitative real-time PCR in equine in vivo and fresh and frozen-thawed in vitro
blastocysts. BMC Res Notes 2 246.
53. Smits K., Govaere J., Hoogewijs M., De Schauwer C., Vanhaesebrouck E., Van Poucke M.,
Peelman L.J., Van den Berg M., Vullers T., Van Soom A. 2010. Birth of the first ICSI foal in
the Benelux. Vlaams Diergeneeskundig Tijdschrift 79 134-138.
54. Sturmey R.G., Reis A., Leese H.J., McEvoy T.G. 2009. Role of fatty acids in energy
provision during oocyte maturation and early embryo development. Reprod Domest
Anim 44 (Suppl 3) 50-58.
55. Swiech L., Kisiel K., Czolowska R., Zientarski M., Borsuk E. 2007. Accumulation and
dynamics of proteins of the MCM family during Mouse oogenesis and the First
embryonic cell cycle. Int J Dev Biol 51 283-295.
56. Temeles G.L., Ram P.T., Rothstein J.L., Schultz R.M. 1994. Expression patterns of novel
genes during mouse preimplantation embryogenesis. Mol Reprod Dev 37 121-129.
57. Tremoleda J.L., Stout T.A., Lagutina I., Lazzari G., Bevers M.M., Colenbrander B., Galli C.
2003. Effects of in vitro production on horse embryo morphology, cytoskeletal
characteristics, and blastocyst capsule formation. Biol Reprod 69 1895-1906.
58. Williams J.W., Hawes S.M., Patel B., Latham K.E. 2002. Trophectoderm-specific
expression of the X-linked Bex1/Rex3 gene in preimplantation stage mouse embryos.
Mol Reprod Dev 61 281-287.
59. Wilmeth L.J., Shrestha S., Montaño G., Rashe J., Bradley C.S. 2010. Mutual Dependence
of Mob1 and the Chromosomal Passenger Complex for Localization During Mitosis. Mol
Biol Cell 21 380-392.
![Page 111: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/111.jpg)
Chapter 5
105
60. Wu G., Bazer F.W., Datta S., Johnson G.A., Li P., Satterfield M.C., Spencer T.E. 2008.
Proline metabolism in the conceptus: implications for fetal growth and development.
Amino Acids 35 691-702.
61. Young L.E., Fernandes K., McEvoy T.G., Butterwith S.C., Gutierrez C.G., Carolan C.,
Broadbent P.J., Robinson J.J., Wilmut I., Sinclair K.D. 2001. Epigenetic change in IGF2R is
associated with fetal overgrowth after sheep embryo culture. Nat Genet. 27 153-154.
62. Zhang L. 2008. Adaptive evolution and frequent gene conversion in the brain expressed
X-linked gene family in mammals. Biochem Genet 46 293-311.
63. Zhou Y., Ma C., Karmouch J., Katbi HA., Liu X.J. 2009. Antiapoptotic role for ornithine
decarboxylase during oocyte maturation. Mol Cell Biol 29 1786-1795.
64. Zuker M. 2003. Mfold web server for nucleic acid folding and hybridization prediction.
Nucleic Acids Res 31 3406-3415.
![Page 112: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/112.jpg)
![Page 113: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/113.jpg)
CHAPTER 6
INFLUENCE OF THE UTERINE ENVIRONMENT ON THE
DEVELOPMENT OF IN VITRO PRODUCED EQUINE EMBRYOS
Smits K., Govaere J., Peelman L.J., Goossens K., de Graaf D.C., Vercauteren D., Vandaele L.,
Hoogewijs M., Stout T., Van Soom A. Adapted from Reproduction submitted.
![Page 114: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/114.jpg)
![Page 115: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/115.jpg)
Chapter 6
109
6.1 ABSTRACT
After an unusually long stay in the oviduct, the equine embryo passes through the utero-tubal
papilla on day 6 after ovulation. Soon after its arrival in the uterus, the embryo becomes
enveloped by a glycoprotein tertiary coat (the ‘capsule’); during the first 5 weeks of intrauterine
development the conceptus is entirely dependent on endometrial secretions for its nutrition.
The necessity for early interaction between the embryo and the oviductal and/or uterine
environment in the horse is reflected by several striking differences between equine embryos
that develop in vivo and those produced in vitro. Better understanding of the salient
interactions may help to improve the efficiency of in vitro equine embryo production. In an
initial experiment, cleavage-stage in vitro produced (IVP) equine embryos were transferred into
the uterus of recently ovulated recipient mares to determine whether premature placement in
this in vivo environment would improve subsequent development. In a second experiment, an
important element of the uterine environment was mimicked by adding uterocalin, a major
component of the endometrial secretions during early pregnancy, to the culture medium. Intra-
uterine transfer of cleavage-stage equine IVP embryos yielded neither ultrasonographically
detectable pregnancies nor day 7 blastocysts, indicating that the uterus is not a suitable
environment for per-compact morula stage horse embryos. By contrast, exposure to uterocalin
during IVP improved capsule formation, although it did not measurably affect development or
expression of a panel of genes known to differ between in vivo and in vitro embryos.
Nevertheless, the positive effect of uterocalin on capsule formation in IVP horse blastocysts
illustrates that adding a specific endometrial protein to embryo culture medium can help
embryos develop more physiologically; further studies are required to evaluate whether
uterocalin serves purely as a carrier protein or more directly promotes improved capsule
development.
6.2 INTRODUCTION
Early embryonic development in the horse is characterized by a number of peculiarities
(Betteridge, 2007). Firstly, the equine embryo doesn’t enter the uterus via the prominent utero-
![Page 116: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/116.jpg)
Chapter 6
110
tubal papilla until as late as 144-156 h after ovulation (Battut et al., 1997). Moreover,
unfertilized eggs are not capable of stimulating passage through the ampullary-isthmic junction
and are instead retained in the oviduct. This selective oviductal transport has been shown to be
a stage specific function of the production of prostaglandin E2 by day 4-5 equine conceptuses
(Weber et al., 1991), and is a clear example of very early embryo-maternal interaction in the
horse.
Another enigmatic feature exemplifying early embryo-maternal interaction in the horse is the
formation of an acellular glycoprotein tertiary embryo coat (‘capsule’: Flood et al., 1982) very
soon after the arrival of the horse embryo in the uterus; the capsule completely envelopes the
equine conceptus until around day 21 of gestation (Betteridge, 1982). Although the precise
functions of the capsule are not clear, it has been proposed to function as a ‘mailbox’,
incorporating endometrial components such as signalling molecules and nutrients and
transporting them to the embryo (Herrler & Beier, 2000), and to physically protect the mobile
embryo and maintain its spherical shape while migrates around the uterus to signal its presence
to its dam and prevent luteolysis (Ginther, 1985; Allen and Stewart, 2001; Stout and Allen,
2001). In addition, structural changes in the capsule are thought to be instrumental to the
process of fixation and orientation of the conceptus within the mares’ uterus (Oriol, 1994).
Since a functional chorioallantoic placenta is not formed until as late as days 40-45 of gestation,
equids have the longest pre-implantation period of all mammals studied to date (Allen and
Stewart, 2001); moreover, during this prolonged pre-implantation period the embryo is entirely
dependent on endometrial secretions (‘histotrophe’) for its nutrition. An undoubtedly
important component of this histotrophe is the 19 kDa progesterone-dependent protein,
uterocalin, that is secreted by the endometrial glands during both dioestrus and early
pregnancy (Crossett et al., 1996). The marked drop in uterocalin production that coincides with
the disappearance of the capsule at around day 21, and the fact that uterocalin is one of the
most abundant proteins in the capsule (Quinn et al., 2007), suggests that there may be a
functional correlation between uterocalin production and the presence of the capsule (Crossett
et al., 1996). Moreover, detection of uterocalin in the trophoblast and yolk-sac fluid of equine
![Page 117: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/117.jpg)
Chapter 6
111
conceptuses implies passage through the capsule and absorption by the conceptus proper. On
the basis of its structure, uterocalin has been classified as a member of the lipocalin family,
which contains several transport proteins that bind small hydrophobic molecules (Crosset et al.,
1996). Moreover, in depth structural analysis of uterocalin, suggests a putative function as a
carrier of essential lipids and amino acids for the developing conceptus (Kennedy, 2004).
All of the above illustrate the importance of embryo-maternal interaction during early
embryonic development in the horse. Furthermore, when equine embryos are produced in
vitro, and therefore in the absence of the maternal tract, they differ markedly from their in vivo
counterparts in terms of the kinetics of development, incidence of apoptotic cells, inner cell
mass morphology and gene expression patterns (McKinnon, 1989; Hinrichs, 1990; Tremoleda et
al., 2003; Pomar et al., 2005; Smits et al., 2010a). One of the more striking irregularities of IVP
horse embryos is the failure of normal capsule formation (Tremoleda et al., 2003); even though
capsular mucin-like glycoproteins are produced in vitro, they fail to coalesce into the distinct
continuous capsule observed around in vivo equine embryos from the early blastocyst stage.
The reason(s) for the failure of capsular glycoprotein coalescence in vitro are not known but
may involve simple dispersion of the glycoproteins into the culture medium, preventing
attainment of the critical concentration required for capsule assembly, or failure of hydration
and cross-linking of the capsular glycoproteins in the absence of a specific uterine
component(s) (McKinnon, 1989; Hinrichs, 1990; Tremoleda et al., 2003). In either case, the
presence of the mare’s uterus appears to be essential to the process of capsule formation; to
confirm that the uterine environment and/or specific uterine components are central to
capsule formation, we exposed IVP embryos to either the complete uterine environment or to
the endometrial protein, uterocalin, which is known to contribute substantially to the
substance of the capsule of day 10-18 blastocysts. A recent study demonstrated that temporary
transfer of IVP horse blastocysts to the mare’s uterus for 2-3 days had a positive effect on
capsule formation, as assessed by light microscopy (Choi et al., 2009). In this study, we wanted
to further determine whether ‘premature’ transfer of day 2-3 embryos to the uterus could not
only enhance capsule formation but also improve equine blastocyst development rates and
quality, as compared to culture in vitro. In this latter respect, while it is common practice to
![Page 118: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/118.jpg)
Chapter 6
112
culture embryos to the blastocyst stage prior to intra-uterine transfer in most domestic species,
in human medicine premature intra-uterine transfer of day 2 and 3 embryos is a routine
procedure that yields good results (Younis et al., 2009) and circumvents the potential
downsides of prolonged in vitro culture, or the difficulty of transferring early embryos to the
oviduct. If transfer of cleavage stage IVP embryos to the uterus of the mare was successful, it
would considerably simplify the IVP process even if it didn’t have additional beneficial effects
on embryonic development and capsule formation. To more specifically investigate the putative
role of uterocalin in capsule formation and early development of equine embryos, recombinant
uterocalin was added to culture medium for 5-10 days, and the effect on subsequent
development was examined in terms of capsule formation and expression of a panel of genes
known to be differentially expressed by in vivo versus IVP horse embryos.
6.3 MATERIALS AND METHODS
6.3.1 Experiment 1: Intra-uterine transfer of cleavage stage equine in vitro embryos
All animal procedures were approved by the ethics committee of the Faculty of Veterinary
Medicine at Ghent University. In vitro embryos were produced as previously described by Smits
et al. (2010b). Briefly, slaughterhouse oocytes were matured in vitro for 24h in a DMEM-F12
based medium in an atmosphere containing 5% CO2 (Galli et al., 2007). MII oocytes were
fertilized by conventional ICSI and cultured in vitro in DMEM-F12 with 10% fetal calf serum at
38.5°C in 5% CO2, 5% O2 and 90% N2. On day 2-3 after ICSI, cleaved embryos were transferred
by means of a transcervical pipet (IMV Technologies, France) to the uterus of a recipient mare
that had ovulated 2-3 days previously. A total of 99 cleaved embryos were transferred to the
uterus of 12 synchronized mares (average of 8.25 embryos per mare). On the day of transfer,
the recipient mare was injected intravenously with 1.1 mg/kg of the non-steroidal anti-
inflammatory agent, flunixine meglumine (Emdofluxin, Emdoka, Belgium) and daily per os
treatment with 0.044mg/kg of the synthetic progestagen, altrenogest (Regumate, Intervet,
The Netherlands) was initiated and continued until evaluation for embryo development. Half of
the mares were examined by per rectum uterine ultrasound 14 days after ICSI, and half were
![Page 119: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/119.jpg)
Chapter 6
113
subjected to embryo recovery by transcervical uterine lavage on day 7 after ICSI. Briefly,
flushing was performed with 6 liters of Lactated Ringer’s solution using a Bivona-catheter
(Minitüb, Germany) and the recovered fluid was passed through an EZ filter (Bioniche, Ireland).
Any embryos recovered were stained with Hoechst 33342 (Molecular Probes, The Netherlands)
to assess cell viability and number.
6.3.2 Experiment 2: IVP in the presence of recombinant uterocalin
Production of recombinant uterocalin
A recombinant uterocalin clone and an anti-uterocalin-antibody were kindly provided by
Professor MW Kennedy (University of Glasgow, UK). The recombinant uterocalin was purified
mainly as described by Suire et al. (2001) using the ProfinityTM IMAC Ni-Charged Resin (Bio-
Rad), to produce a working concentration of 7.88 mg/ml.
Estimation of the physiological concentration of uterocalin
Since no absolute concentrations of uterocalin in the uterine environment are reported in the
literature, the physiological concentration of uterocalin was estimated using a uterine secretion
sample recovered from a day 7 pregnant mare. Sampling of uterine secretions was performed
by means of aspiration through a pipette for deep intra-uterine insemination as described by
Velazquez et al. (2010), while subsequent uterine lavage resulted in the recovery of an embryo,
thereby confirming that the mare was pregnant. A dot blot technique was used to compare a
dilution series of recombinant uterocalin with the recovered uterine secretion and indicated
that the concentration of uterocalin in the uterine secretions was approximately 4 mg/ml.
In vitro production of equine blastocysts
In vitro embryos were produced as described for experiment 1, except that only oocytes with a
compact cumulus complex were used, the maturation time was 28h and ICSI was performed
using a Piezo Drill (Prime Tech Ltd., Ibaraki, Japan). The embryos were cultured in groups of 10-
20 in 20 µl droplets of DMEM-F12 with 10% fetal calf serum at 38.5°C in 5% CO2, 5% O2 and 90%
N2. On day 2.5, half of the medium was refreshed and the embryos that had not cleaved were
![Page 120: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/120.jpg)
Chapter 6
114
removed. On day 6, half of the medium was refreshed again and, in half of the culture droplets,
2.54 µl of the medium was replaced by the recombinant uterocalin solution, resulting in a final
concentration of 1 mg/ml recombinant uterocalin. On day 9-9.5, the embryos that had reached
the blastocyst stage were recovered for further analysis.
Immunofluorescent staining of the capsule
Immunofluorescent staining of the equine capsule was performed as described by Tremoleda et
al. (2003) using the monoclonal anti-capsule antibody OC-1 (Oriol et al., 1993), which was kindly
provided by Professor KJ Betteridge (University of Guelph, Canada). Day 9.5 blastocysts were
fixed in 4% paraformaldehyde (P6118, Sigma-Aldrich, Bornem, Belgium) and stored at 4°C until
analysis. Twelve blastocysts that had been cultured with uterocalin and 14 blastocysts from the
control group were stained simultaneously. After permeabilisation by exposure to 0.5% (v/v)
Triton X-100 for 30 minutes at room temperature, the blastocysts were washed 3 times in PBS
containing 1 mg/ml PVP. Non-specific staining was blocked by incubation in 10% (v/v) goat
serum (16210-064, Invitrogen, Merelbeke, Belgium) for 30 minutes at 37°C. The blastocysts
were then washed again and incubated with the primary antibody (mouse monoclonal anti-
capsule OC-1: 1/200 dilution) for 1.5h at 37°C. In both groups, a negative control blastocyst was
incubated in 10% goat serum without primary antibody. After a washing step, incubation with
the secondary antibody (goat-anti-mouse FITC: Molecular Probes, Leiden, The Netherlands),
1/100 dilution) was performed for 1h at 37°C, followed by another washing step. Nuclei were
then stained by incubation with 2% propidium iodide (Molecular Probes, Leiden, The
Netherlands) for 30 minutes at room temperature, after which the embryos were fixed in
Dabco (Acros, Ghent, Belgium) on siliconized glass and enclosed under a cover slip supported by
small vaseline bridges to prevent crushing of the embryos. All embryos were evaluated in one
session using a Nikon C1 confocal laser scanning module attached to a motorized Nikon
TE2000-E inverted microscope (Nikon Benelux, Brussels, Belgium) and identical settings.
Subsequent fluorescence measurements were performed using Nikon EC-V1 FreeViewer
software. Since some blastocysts were a little squeezed by the cover slip, intact capsules of 6
uterocalin blastocysts and 8 control blastocysts in similar condition were evaluated. For each
![Page 121: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/121.jpg)
Chapter 6
115
embryo, the total fluorescence of 3 areas in different, randomly selected, spots of the capsule
were measured and the mean of these 3 measurements was recorded (Figure 1).
Figure 1 Measurement of the capsule fluorescence (Equus caballus). For each blastocyst
capsular fluorescence was measured in 3 areas of at least 10 µm2 as represented in the figure.
Random places on different sides of the blastocyst showing an intact capsule were assessed. For
each embryo the mean of these 3 measurements was calculated.
RT-qPCR
For both the uterocalin and the control group, 11 blastocysts were selected on day 9. After
washing in DPBS, individual blastocysts were transferred to cryotubes with 2 µl lysis buffer,
frozen in liquid nitrogen for 3 minutes and stored at -80°C. RNA-extraction was performed using
the RNeasy Micro Kit (Qiagen, Venlo, The Netherlands) and, after RT minus control, the RNA
was converted into cDNA using the iScriptTMcDNA synthesis Kit (Bio-Rad, Nazareth Eke,
Belgium). The expression of the 5 development ‘marker’ genes (BEX2, FABP3, HSP90AA1,
MOBKL3 and ODC) was quantified by RT-qPCR as described by Smits et al. (2010a).
Normalization of data was performed using UBC, ACTB, RPL32 and GAPDH as reference genes
(Smits et al., 2009).
![Page 122: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/122.jpg)
Chapter 6
116
Statistical analysis
The blastocyst development rates for the uterocalin and control groups were compared using a
Pearson Chi-square test (SPSS 16.0, SPSS Inc., Headquarters, Chicago, Illinois, US). Cell number
and capsular fluorescence were compared between the groups using t-tests, while gene
expression between the uterocalin and control groups was compared with a Mann-Whitney
test using GraphPadInStat3. A p-value <0.05 was considered statistically significant.
6.4 RESULTS
6.4.1 Experiment 1: Intra-uterine transfer of cleavage stage IVP embryos
A total of 99 cleaved (2-8 cell stage) embryos were transferred to the uterus of 12 synchronized
(day 2-3 after ovulation) mares (average of 8.25 embryos / mare). Six of these mares were
subsequently examined for pregnancy by transrectal ultrasound on day 14 after ovulation, but
no conceptus vesicles were detected. The uterus of the remaining six mares was flushed on day
7 after ovulation. Disappointingly, embryos were recovered from only 3 of the 6 mares and no
mare yielded more than a single embryo (overall recovery rate 6%). Moreover, none of the 3
recovered embryos had developed to the blastocyst stage; instead all 3 were clearly degenerate
(Figure 2).
![Page 123: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/123.jpg)
Chapter 6
117
Figure 2 Intra-uterine transfer of cleavage stage embryos (Equus caballus). After intra-uterine
transfer of day 2-3 equine cleavage stage embryos and subsequent flushing on day 7 only
degenerated embryos were recovered. The embryos were stained with Hoechst 33342.
6.4.2 Experiment 2: Addition of recombinant uterocalin to embryo culture medium
No significant differences in overall development were observed between embryos that had or
had not been exposed to uterocalin during IVP (Table 1). In total, 60% of recovered oocytes
reached the MII stage and 76% of sperm injected oocytes had cleaved 48h after ICSI. In the
control group, 25 of 198 cleaved embryos developed to the blastocyst stage (12.6%); in the
group cultured with uterocalin, 22 of 165 cleaved embryos (13.3%) reached the blastocyst stage
(Figure 3 A, B). Mean cell counts and embryo diameters (± S.E.M.) were respectively 579 (± 40)
and 247 (±15) µm for the blastocysts cultured with uterocalin (n=11) and 551 (± 47) and 270
(±12) µm for the control group (n=11) (p>0.05).
![Page 124: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/124.jpg)
Chapter 6
118
Table 1: Influence of uterocalin on development and capsule formation in equine in vitro
produced blastocysts (Equus caballus). Addition of uterocalin during IVC did not affect
blastocyst rate, cell count and embryonic diameter. Immunofluorescence of the embryonic
capsule was significantly increased in the presence of uterocalin. Mean values and their
respective standard errors are displayed.
Control Uterocalin p-value
Blastocyst percentage (%) 12.6 (±2.5) 13.3 (±3.5) 0.842
Mean cell count D9.5 551 (±47) 579 (±40) 0.660
Mean diameter (µm) 270 (±12) 247 (±15) 0.251
Fluorescence capsule 2123 (±117) 2745 (±208) 0.0312
By contrast, total fluorescence after immunofluorescent labeling of the embryos with the
capsule specific antibody OC-1 (Oriol et al., 1993) was significantly higher in blastocysts that had
been cultured in the presence of uterocalin (2745 ±208; n=6), than in those cultured in control
medium (2123 ±117; n=8) (p=0.0312) (Table 1). Penetration of capsular glycoproteins into the
transzonal channels was observed in both groups, and was more obvious in smaller blastocysts
(Figure 3 C, D). In the larger blastocysts, the capsular material appeared to form a more or less
continuous layer (Figure 3 E, F), although this did not extend over the part of the embryo that
had herniated through the hole in the zona created during ICSI; instead the glycoprotein over
the protruding trophectoderm was visible in patches in both groups (Figure 4). Interestingly, in
the uterocalin group, an apparently continuous area of capsule associated with the
trophectoderm was observed in an area where the zona had become loosened locally around
one blastocyst and in a zona-free area of another blastocyst (Figure 5); similar findings were not
observed in control embryos.
![Page 125: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/125.jpg)
Chapter 6
119
Figure 3 Day 9.5 blastocysts produced in vitro and cultured in the absence (A,C,E) or presence
(B,D,F) of uterocalin (Equus caballus). A,B: Equine blastocysts before fixation. Small blastocysts
display a thin capsular line (OC1-staining) and penetration of capsular material in the transzonal
channels in both the embryos cultured in the absence (C) or presence (D) of uterocalin. Larger
blastocysts present a more developed and continuous capsule in both the control (E) and the
uterocalin (F) group, but still show penetration of the glycoproteins in the thinned zona. White
scale bar = 10 µm.
![Page 126: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/126.jpg)
Chapter 6
120
Figure 4 Hatching blastocyst produced in vitro (Equus caballus).This immunofluorescent
staining of the capsular OC-1 illustrates the capsular glycoproteins in the hatched part of an in
vitro produced blastocyst of the control group (A) and the uterocalin group (B). No confluent
capsule is apparent.
![Page 127: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/127.jpg)
Chapter 6
121
Figure 5 Confluent capsule adjacent to trophectoderm (Equus caballus). This day 9.5 horse
blastocyst was cultured in the presence of uterocalin and capsule formation was assessed by
immunofluorescent OC1-staining. Interruption in the zona pellucida reveals a confluent capsule
which is attached to the trophectodermal surface. White scale bar = 10 µm.
Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a highly
specific and sensitive tool for comparing expression of mRNA for specific genes between
experimental groups. The 5 genes analysed, BEX2, FABP3, HSP90AA1, MOBKL3 and ODC were
chosen as markers for developmental quality, because a previous study indicated
downregulation of these genes in in vitro produced compared to in vivo derived equine
blastocysts (Smits et al., 2010a). It was hypothesized that adding the endometrial protein,
uterocalin, might induce an expression pattern in the in vitro embryos more closely resembling
![Page 128: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/128.jpg)
Chapter 6
122
that of in vivo embryos. In fact, no differences in expression levels were found between the
blastocysts which were cultured with uterocalin (n=11) and the blastocysts from the control
group (n=11) (Figure 6). In this experiment, qPCR efficiencies of ≥ 99% and correlation efficients
≥ 0.992 were obtained, indicating that the results were reliable.
Figure 6 Expression of BEX2, FABP3, HSP90AA1, MOBKL3 and ODC in blastocysts cultured with
uterocalin and control blastocysts as determined by RT-qPCR (Equus caballus). The expression
of these 5 genes was previously found to be downregulated in in vitro produced equine
blastocysts when compared to in vivo derived equine blastocysts. However, this figure shows
that the addition of uterocalin, an important protein in the uterine secretions during early
pregnancy, to the in vitro culture medium from day 6 up to day 9 did not influence the
expression levels of these genes. The error bars represent the S.E.M.
6.5 DISCUSSION
The ability to efficiently produce equine embryos in vitro is of interest for both research
purposes and the clinical treatment of (equine) infertility. Presently, acceptable rates of embryo
production and levels of embryo quality can be obtained using intracytoplasmic sperm injection
of in vitro matured oocytes followed by culture in DMEM/F12 supplemented with serum;
however, there is still room for further optimisation of the in vitro culture process to improve
0
0,2
0,4
0,6
0,8
1
1,2
1,4
1,6
1,8
BEX2 HSP90AA1 ODC FABP3 MOBKL3
RT-qPCR
control
uterocalin
![Page 129: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/129.jpg)
Chapter 6
123
the overall efficiency of the procedure (Galli et al., 2007; Hinrichs et al., 2007; Blanco et al.,
2009). Understanding the influence of the equine oviductal and uterine environments, and
specific components thereof, on early embryonic development could lead to targeted
adaptations of the in vitro environment to mimic aspects of the maternal environment
identified as beneficial.
In this study, intra-uterine transfer of cleavage stage IVP equine embryos did not yield any
pregnancies and, since no healthy blastocysts were recovered on day 7 (i.e. 4-5 days after
transfer), it appears that the transferred cleavage stage embryos do not develop in the uterine
environment. There are several possible explanations for this failure of development. Firstly, it
is possible that closure of the cervix 2-3 days after ovulation was suboptimal when compared to
the day 4-9 period during which commercial embryo transfers are usually performed. This could
result in loss of embryos through the cervix soon after transfer. On the other hand, pregnancy
after transfer of day 10 embryos to recipient mares on days 1 or 3 after ovulation has been
described by Wilsher et al. (2010) and, although none of these embryo’s subsequently
developed into normal pregnancies (none developed an embryo proper), it does illustrate that
the uterus should be capable of mechanically retaining embryos introduced soon after
ovulation. A second possible explanation is simple absence of intrinsic developmental potential
of the transferred in vitro embryos. However, using identical preliminary steps, standard in vitro
production yielded 5-10 % blastocysts in our hands, and transfer of one of these blastocysts has
resulted in pregnancy and the birth of a live foal (Smits et al., 2010b); in short, at least some (5-
10) of the cleaved embryos should have been capable of further development.
The remaining possible interpretation is that the mare’s uterus does not provide an adequate
or appropriate environment for these early cleavage stage embryos. A similar failure to
establish pregnancy following premature intrauterine transfer was reported for 292 day 2
mouse embryos (Goto et al., 1993), and for previous small studies that described the intra-
uterine transfer of early in vivo derived horse embryos. For example, Weber et al. (1993)
achieved no pregnancies following intra-uterine transfer of 7 day 2 horse embryos and while
Allen and Rowson (1975) did describe a single pregnancy after transfer of 5 day 3 equine
![Page 130: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/130.jpg)
Chapter 6
124
embryos, the age of the embryo was estimated from daily examination for ovulation by
transrectal palpation; the embryo that resulted in pregnancy could thus easily have been closer
to 4 days. Indeed, day 4 equine embryos have been reported to be sufficiently mature to
survive in the mare’s uterus (Peyrot et al., 1987).
In human medicine, cleavage stage embryos are routinely transferred to the uterus and, while
the procedure is considered to entail both specific advantages and disadvantages when
compared to blastocyst transfer, overall favourable pregnancy rates of 30-40% are common
(Bromer & Seli, 2008; Papanikolaou et al., 2008). The reason for the marked differences in the
success of intrauterine transfer of day 2-3 embryos in women and some primates compared
with other domestic species might be due to marked anatomical differences. In the mare,
there is a distinct, tightly closed uterotubal papilla, which presumably helps to maintain the
marked differences in fluid composition observed in different parts of the oviduct and uterus in
both horses and other domestic and laboratory species. This is in marked contrast to the lack of
an anatomically distinct utero-tubal junction in women, in which the oviductal and uterine
fluids appear to mix freely (Hunter, 1998).
During the initial intrauterine period, the equine embryo migrates continually, surrounded by a
protective glycoprotein capsule and bathed in nourishing endometrial secretions, which contain
several progesterone dependent proteins (Ellenberger et al., 2008). The addition of one of the
major progesterone dominated proteins, uterocalin, to embryo culture medium had a positive
effect on capsule formation around IVP blastocysts. Blastocysts cultured in the presence of
uterocalin showed more intense fluorescence following labelling with a capsule specific
antibody (OC-1) than control embryos. Furthermore, where the zona pellucida was locally
absent around blastocysts cultured in the presence of uterocalin, a distinct and confluent
capsule was found associated with the trophectoderm (Figure 5); such zona-independent areas
of continuous capsule were not seen on control embryos, and have not been described
previously for IVP equine embryos. Indeed, when Tremoleda et al. (2003) separated the zona
pellucida from a day 10 in vitro produced embryo, they found the capsular material to be stuck
to the zona instead of forming a separate layer between zona and trophectoderm. This
![Page 131: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/131.jpg)
Chapter 6
125
apparent effect on capsular glycoprotein coalescence may reflect an additional function of
uterocalin and, together with previous studies illustrating that uterocalin makes a considerable
contribution to the total mass of the capsule, it suggests that uterocalin may be a maternally-
derived structural component of the capsule rather than just a transiently associated transport
molecule. Previous studies, have demonstrated that OC-1 reactive capsular glycoproteins are
secreted by trophectoderm cells (Albihn et al., 2003), while the failure of normal capsule
formation in vitro suggests the need for an additional maternal component (Tremoleda et al.,
2003). In this respect, the 19kDa endometrial protein uterocalin was first isolated as one of the
dominant proteins detected by SDS-PAGE of equine embryonic capsules (Stewart et al., 1995).
Subsequent studies confirmed the presence of uterocalin in the capsule in a temporal pattern
that suggested a functional correlation between the two (Crossett et al., 1996; Herrler & Beier,
2000; Quinn et al., 2007). Subsequently, and as a result of its molecular structure, uterocalin
has been proposed to function primarily as a carrier of biologically important lipids and a source
of essential amino acids for the developing conceptus (Suire et al., 2001, Kennedy, 2004),
where the positive charge of uterocalin (Crossett et al., 1996) is thought to facilitate its binding
to the negatively charged sialic acid residues of the capsule (Oriol et al., 1993). Since uterocalin
has also been found in trophoblast cells (Crossett et al., 1996; Ellenberger et al., 2008), some of
the molecule clearly passes through the capsule and presumably fulfils a role as a carrier
protein. In addition, it seems likely that uterocalin contributes to the structure of the capsule,
and plays a role in the initial aggregation and cross-linking of trophectoderm-produced OC-1
reactive glycoproteins. In summary, uterocalin appears to be instrumental in initial capsular
glycoprotein coalescence, contributes significantly to the substance and structure of the
capsule and plays an important role in transporting essential nutrients and or signalling
molecules to the developing conceptus during the initial intra-uterine period.
The dynamics of embryonic covering formation and loss and, in particular, the addition of tubal
and uterine secreted materials during development has been described in several species (for
Review see Denker, 2000). In this respect, the equine embryonic capsule has been proposed to
be most analogous to the neozona of the rabbit (Betteridge, 1989; Herrler & Beier, 2000). For
example, while trophoectodermal secretions are important for neozona formation, maternal
![Page 132: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/132.jpg)
Chapter 6
126
components also appear to be critical (Fisher et al., 1991; Denker, 2000). Indeed, in vitro culture
of rabbit embryos is associated with the deposition of granular material on the inside of the
mucoprotein layer, but failure of normal neozona formation, aberrant herniation of embryonic
cells through the zona, and incomplete or failed dissolution of the zona pellucida (Fisher et al.,
1991). These features are reminiscent of the aberrations of capsule formation and hatching
observed in IVP equine embryos (Tremoleda et al., 2003; Stout et al., 2005). However, in both
species, these deviations are not necessarily irreversible and most can be corrected by
exposure to uterine components. In this respect, addition of uterine flushings to rabbit embryo
culture medium, or intra-uterine transfer of in vitro cultured embryos, has been shown to allow
reactivation and completion of zona dissolution, although uterine flushings alone did not induce
neozona formation in vitro (Fisher et al., 1991). In the horse, intra-uterine transfer of in vitro
produced blastocysts results in successful pregnancies (Galli et al., 2007; Hinrichs et al., 2007;
Smits et al., 2010b) with an apparently normal capsule (Choi et al., 2009), illustrating that the
degree of initial aberration in capsule formation during IVP is not so severe as to preclude
normal establishment of pregnancy, at least as long as exposure to the uterine environment is
sufficiently early to remedy the aberrations; by contrast, total removal of the blastocyst capsule
from day 6.5 embryos has been reported to be incompatible with embryonic survival after
transfer (Stout et al., 2005); clearly the disruption to capsule formation suffered during IVP is
not equivalent to removal.
In the current study, some aspects of aberrant equine embryonic capsule formation in vitro
appeared to be ameliorated by the presence of uterocalin. However, it is not known how the
uterocalin had this effect, and neither was uterocalin alone sufficient to completely normalize
capsule formation; e.g. the ‘hatched’ areas of trophectoderm still exhibited dispersed patches
of OC-1 reactive glycoproteins that did not coalesce into a confluent layer (Figure 4). In
addition, capsular material still penetrated into the transzonal channels as previously reported
for IVP embryos (Tremoleda et al., 2003) but not seen in in vivo embryos; the transzonal
penetration of capsular glycoproteins in this study was particularly evident for smaller embryos
(Figure 3). While it is possible that there was insufficient uterocalin provided in the current
study to completely normalize capsule production, it is more likely that this partial correction
![Page 133: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/133.jpg)
Chapter 6
127
reflects the continued absence of other components of the complex intra-uterine environment
that are required for capsule formation.
Surprisingly, no clear influence of uterocalin on the development of equine IVP blastocysts was
observed, as illustrated by equal blatocyst rates, embryo diameters and cell counts between
control and uterocalin groups (Table 1). Moreover, exposure to uterocalin did not alter
expression of 5 genes (BEX2, FABP3, HSP90AA1, MOBKL3 and ODC: Figure 6), previously found
to be down-regulated in IVP embryos as compared to in vivo derived embryos (Smits et al.,
2010a). A similar failure of endometrial proteins to influence early equine embryonic
development was reported by Bøgh et al. (2002) who exposed day 8 in vivo derived embryos to
a p19 (i.e. uterocalin) homologue during a 3h incubation, and found no obvious influence on
subsequent embryonic growth and metabolism. The absence of effects on embryonic growth,
metabolism (Bøgh et al., 2002), gene expression or quality (this study) might be an artefact due
to measurement of factors not influenced by uterocalin. However, it is also possible that a
crucial ligand(s) necessary for uterocalin to influence gene expression or metabolism was
absent in the in vitro culture medium; this would seem logical if uterocalin is primarily a carrier
protein, as suggested by its ability to bind several essential small lipids (Suire et al., 2001),
rather than a stimulator of embryonic growth or development per se.
6.6 CONCLUSION
Several unusual features of early embryonic development in the horse illustrate the importance
of embryo-maternal interaction. To optimize equine IVP it may well be necessary to further
clarify, and develop methods to mimic, particular aspects of this interaction. In the current
study, an essential role of the oviductal environment was illustrated by the failure of premature
intrauterine transfer to yield any viable embryos. In addition, the need for the uterine
environment of slightly older embryos was illustrated by the positive effect on capsule
development of exposing IVP embryos to the maternal endometrial protein, uterocalin.
However, since capsule formation in the presence of uterocalin was not completely normal,
while embryo development and gene expression still differed markedly from in vivo embryos, it
![Page 134: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/134.jpg)
Chapter 6
128
is clear that many aspects of the maternal environment necessary to support optimal early
embryonic development still need to be identified.
REFERENCES
1. Albihn A., Waelchli R.O., Samper J., Oriol J.G., Croy B.A., Betteridge K.J. 2003. Production
of capsular material by equine trophoblast transplanted into immunodeficient mice.
Reproduction 125 855-863.
2. Allen W.R., Rowson L.E.A. 1975. Surgical and non-surgical egg transfer in horses J Reprod
Fert Suppl 23 525-530.
3. Allen W.R., Stewart F. 2001. Equine placentation. Reprod Fertil Dev 13 623-634.
4. Battut I., Colchen S., Fieni F., Tainturier D., Bruyas J.F. 1997. Success rates when
attempting to nonsurgically collect equine embryos at 144, 156 or 168 hours after
ovulation. Equine Vet J Suppl 25 60-62.
5. Betteridge K.J., Eaglesome M.D., Mitchell D., Flood P.F., Beriault R. 1982. Development
of horse embryos up to twenty two days after ovulation: observations on fresh
specimens. J Anat 135 191-209.
6. Betteridge K.J. 1989. The structure and fuction of the equine capsule in relation to
embryo manipulation and transfer Equine Vet J Suppl 8 92-100.
7. Betteridge K.J. 2007. Equine embryology: an inventory of unanswered questions.
Theriogenology 68S S9-S2.
8. Blanco I.D.P., Devito L.G., Ferreira H.N., Araujo G.H.M., Fernandes C.B., Alvarenga M.A.,
Landim-Alvarenga F.C. 2009. Aspiration of equine oocytes from immature follicles after
treatment with equine pituitary extract (EPE) alone or in combination with hCG. Anim
Reprod Sci 114 203-209.
9. Bøgh I.B., Steeves T., Cartwright G., Gurevich V., Greve T., Hyland J. 2002. Effects of a
progesterone-induced protein with a molecular weight of 20 kDa (PIP-20) on
carbohydrate metabolism and growth of day 8 equine embryos in culture.
Theriogenology 58 751-754.
![Page 135: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/135.jpg)
Chapter 6
129
10. Bromer JG, Seli E. 2008. Assessment of embryo viability in assisted reproductive
technology: shortcomings of current approaches and the emerging role of
metabolomics. Curr Opin Obstet Gynecol 20 234-241.
11. Choi Y.H., Love C.C., Varner D.D., Hinrichs K. 2006. Equine blastocyst development after
intracytoplasmic injection of sperm subjected to two freeze-thaw cycles. Theriogenology
65 808-819.
12. Choi Y.H., Harding H.D., Hartman D.L., Obermiller A.D., Kurosaka S., McLaughlin K.J.,
Hinrichs K. 2009. The uterine environment modulates trophectodermal POU5F1 levels in
equine blastocysts. Reproduction 138 589-599.
13. Cochran R., Meintjes M., Reggio B., Hylan D., Carter J., Pinto C., Paccamonti D., Godke
R.A. 1998. Live foals produced from sperm-injected oocytes derived from pregnant
mares. JEquine Vet Sci 18 736-740.
14. Crossett B., Allen W.R., Stewart F. 1996. A 19 kDa protein secreted by the endometrium
ot the mare is a novel member of the lipocalin family. Biochem J 320 137-143.
15. Denker H.W. 2000. Structural dynamics and function of early embryonic coats. Cells
Tissues Organs 166 180-207.
16. Ellenberger C., Wilsher S., Allen W.R., Hoffmann C., Kölling M., Bazer F.W., Klug J.,
Schoon D., Schoon H.-A. 2008. Immunolocalisation of the uterine secretory proteins
uterocalin, uteroferrin and uteroglobin in the mare’s uterus and placenta throughout
pregnancy. Theriogenology 70 746-757.
17. Fischer B., Mootz U., Denker H.W., Lambertz M., Beier H.M. 1991. The dynamic
structure of rabbit blastocyst coverings Anat Embryol 183 17-27.
18. Flood P.F., Betteridge K.J., Diocee M.S. 1982. Transmission electron microscopy of horse
embryos 3-16 days after ovulation. J Reprod Fert Suppl 32 319-327.
19. Galli C., Colleoni S., Duchi R., Lagutina I., Lazzari G. 2007. Developmental competence of
equine oocytes and embryos obtained by in vitro procedures ranging from in vitro
maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear
transfer. Anim Reprod Sci 98 39-55.
![Page 136: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/136.jpg)
Chapter 6
130
20. Ginther O.J. 1985. Dynamic physical interactions between the equine embryo and
uterus. Eq Vet J 3 41-47.
21. Goto Y., Noda Y., Masahide S., Kishi J., Nonogaki T., Mori T. 1993. The fate of embryos
transferred into the uterus. J Assist Reprod Genet 10 197-201
22. Herrler A., Beier H.M. 2000. Early embryonic coats: morphology, function, practical
applications. Cells Tissues Organs 166 233-246.
23. Hinrichs K., Schmidt A.L., Memon M.A., Selgrath J.P., Ebert K.M. 1990. Culture of 5-day
horse embryos in microdroplets for 10 to 20 days. Theriogenology 34 643-653.
24. Hinrichs K., Choi Y.H., Walckenaer B.E., Varner D.D., Hartman D.L. 2007. In vitro-
produced equine embryos: production of foals after transfer, assessement by
differential staining and effect of medium calcium concentrations during culture.
Theriogenology 68 521-529.
25. Hunter R.H.F. 1998. Have the fallopian tubes a vital role in promoting fertility? Acta
Obstet Gynecol Scand 77 475-486.
26. Kennedy M.W. 2004. Uterocalin – provider of essential lipids and amino acids to the
pre-placentation equine conceptus. Havemeyer Foundation Monograph Series 16 53-56.
27. Lazzari G., Colleoni S., Lagutina I., Crotti G., Turini P., Tessaro I., Brunetti D., Duchi R.,
Galli C. 2010. Short-term and long-term effects of embryo culture in the surrogate sheep
oviduct versus in vitro culture for different domestic species. Theriogenology 73 748-
757.
28. McKinnon A.O., Carnevale E.M., Squires E.L., Carney N.J., Seidel G.E. 1989. Bisection of
equine embryos. Equine Vet J Suppl 8 129-133.
29. McKinnon A.O., Lacham-Kaplan O., Trounson A.O. 2000. Pregnancies produced from
fertile and infertile stallions by intracytoplasmic sperm injection (ICSI) of single frozen-
thawed spermatozoa into in vivo matured mare oocytes. J Reprod Fertil Suppl 56 513-
517.
30. McKinnon A.O., Squires E.L. 2009. Embryo transfer and related technologies. Proc AAEP
27-57.
![Page 137: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/137.jpg)
Chapter 6
131
31. Oriol J.G., Sharom F.J., Betteridge K.J. 1993. Developmentally regulated changes in the
glycoproteins of the equine embryonic capsule. J Reprod Fertil 99 653-664.
32. Oriol J.G. 1994. The equine embryonic capsule: practical implications of recent research.
Equine Vet J 26 184-186.
33. Papanikolaou E.G., Kolibianakis E.M., Tournaye H., Venetis C.A., Faterni H., Tarlatzis B.,
Devroey P. 2008. Live birth rates after transfer of equal number of blastocysts or
cleavage-stage embryos in IVF. A systematic review and meta-analysis. Hum Reprod 23
91-99.
34. Peyrot L.M., Little T.V., Lowe J.E., Weber J.A., Woods G.L. 1987. Autotransfer of day 4
embryos from oviduct to oviduct versus oviduct to uterus in the mare. Theriogenology
28 699-708.
35. Pomar F.J., Teerds K.J., Kidson A., Colenbrander B., Tharasanit T., Aguilar B., Roelen B.A.
2005. Differences in the incidence of apoptosis between in vivo and in vitro produced
blastocysts of farm animal species: a comparative study. Theriogenology 63 2254-2268.
36. Quinn B.A., Hayes M.A., Waelchli R.O., Kennedy M.W., Betteridge K.J. 2007. Changes in
major proteins in the embryonic capsule during immobilization (fixation) of the
conceptus in the third week of pregnancy in the mare. Reproduction 134 161-170.
37. Smits K., Goossens K., Van Soom A., Govaere J., Hoogewijs M., Vanhaesebrouck E., Galli
C., Colleoni S., Vandesompele J., Peelman L. 2009. Selection of reference genes for
quantitative real-time PCR in equine in vivo and fresh and frozen-thawed in vitro
blastocysts. BMC Res Notes 2 246.
38. Smits K., Govaere J., Hoogewijs M., De Schauwer C., Vanhaesebrouck E., Van Poucke M.,
Peelman L.J., Van den Berg M., Vullers T., Van Soom A. 2010a. Birth of the first ICSI foal
in the Benelux. Vlaams Diergeneeskundig Tijdschrift 79 134-138.
39. Smits K., Goossens K., Van Soom A., Govaere J., Hoogewijs M., Peelman L. 2010b. In vivo
derived horse blastocysts show upregulation of developmentally important genes
compared to in vitro produced horse blastocysts. RFD, in press.
40. Squires E.L., Wilson J.M., Kato H., Blaszczyk A. 1996. A pregnancy after intracytoplasmic
sperm injection into equine oocytes matured in vitro. Theriogenology 45 306.
![Page 138: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/138.jpg)
Chapter 6
132
41. Stewart F., Charleston B., Crossett B., Barker P., Allen W.R. 1995. A novel uterine protein
that associates with the embryonic capsule. J Reprod Fertil 105 65-70.
42. Stewart F., Kennedy M.W., Suire S. 2000. A novel uterine lipocalin supporting pregnancy
in equids. Cell Mol Life Sci 57 1373-1378.
43. Stout T.A., Allen W.R. 2001. Role of prostaglandins in intrauterine migration of the
equine conceptus. Reproduction 121 771-775.
44. Stout T.A., Meadows S., Allen W.R. 2005. Stage-specific formation of the equine
blastocyst capsule is instrumental to hatching and to embryonic survival in vivo. Anim
Reprod Sci 87 269-281.
45. Suire S., Stewart F., Beauchamp J., Kennedy M.W. 2001. Uterocalin, a lipocalin
provisioning the preattachment equine conceptus: fatty acid and retinol binding
properties, and structural characterization. Biochem J 356 369-376.
46. Tremoleda J.L., Stout T.A.E., Lagutina I., Lazzari G., Bevers M.M., Colenbrander B., Galli
C. 2003. Effects of in vitro production on horse embryo morphology, cytoskeletal
characteristics, and blastocyst capsule formation. Biol Reprod 69 1895-1906.
47. Velazquez M.A., Parrilla I., Van Soom A., Verberckmoes S., Kues W., Niemann H. 2010.
Sampling techniques for oviductal and uterine luminal fluid in cattle. Theriogenology
73 756-767.
48. Weber J.A., Douglas A.F., Vanderwall D.K., Woods G.L. 1991. Prostaglandin E2 hastens
oviductal transport of equine embryos. Biol Reprod 45 544-546.
49. Wilsher S., Clutton-Brock A., Allen W.R. 2010. Successful transfer of day 10 horse
embryos: influence of donor-recipient asynchrony on embryo development.
Reproduction 139 575-585.
50. Younis J.S., Radin O., Izhaki I., Ben-Ami M. 2009. Does first polar body morphology
predict oocyte performance during ICSI treatment? J Assist Reprod Genet 26 561-567.
![Page 139: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/139.jpg)
![Page 140: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/140.jpg)
![Page 141: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/141.jpg)
CHAPTER 7
GENERAL DISCUSSION
![Page 142: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/142.jpg)
![Page 143: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/143.jpg)
Chapter 7
137
7.1 PRODUCTION OF EQUINE BLASTOCYSTS IN VIVO AND IN VITRO
This research focused on the equine blastocyst, a clinically relevant developmental phase
because it is the physiological stage associated with presence in the uterus. Compared to
oviductal stages, blastocysts can be obtained easily by flushing of the uterine cavity and can
also be transferred by means of a non-invasive transcervical technique into the uterus. Equine
embryonic development in vitro is retarded compared to in vivo development (Pomar et al.,
2005). In this study, the in vivo derived blastocysts were recovered 7 days after ovulation
whereas the in vitro produced blastocysts were harvested 9-9.5 days after ICSI in order to
obtain comparable developmental stages rather than embryos of similar chronological age.
However, considerable individual variation in the kinetics of development in vitro was
observed, as illustrated in Figure 1.
Figure 1 Equine IVP blastocysts 9.5 days after ICSI (magnification 60x). Even though the 4
blastocysts have exactly the same age, there are differences in grade of expansion and hatching.
The lower two blastocysts are more expanded than the upper two. The right blastocyst starts
hatching.
![Page 144: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/144.jpg)
Chapter 7
138
Historically, research on equine blastocyts has been hampered by the difficulty of obtaining
sufficient samples. Recovery of large numbers of in vivo embryos is hindered by the fact that
the horse is a seasonal breeder with little or no ovarian activity during the winter months and,
moreover, the mare is mono-ovulatory and does not react favourably to superovulatory
treatments. In our studies, embryo recovery rates ranged around 50-60% (CHAPTER 4,5), which
is in agreement with published figures (Squires et al., 2003).
Neither is IVP of equine blastocysts widespread nor efficient. Maturation (50%) and cleavage
rates (70-80%) in our study were comparable to results published elsewhere (Galli et al., 2007).
However, our blastocyst production rate was low and variable and improved from less than 2%
in initial experiments up to more than 20% in later experiments. Even though media were
constant throughout the period, there are some possible explanations for this improvement.
First of all, the original maturation time of 24h (Galli et al., 2007) was increased to 28h, which
has been reported to improve cleavage rates for compact COCs (Choi et al., 2004). In this
regard, it must be noted that the expanded COCs, for which a shorter maturation time might be
preferential, matured to a high degree (up to 70%), which is in agreement with Galli et al.
(2007) and Hinrichs and Schmidt (2000). However, the development of oocytes from expanded
COCs up to the blastocyst stage was generally very poor when compared to that of compact
COCs. This is in contrast to the results of Galli et al. (2007), who found a similar developmental
competence for oocytes from both compact and expanded COCs. It should however be noted
that these authors collected the oocytes by scraping the follicle wall, while in our laboratory
aspiration of the follicles was performed. The latter is associated with the collection of a
significant proportion of oocytes surrounded by only a few layers of cumulus cells, and they
were classified as compact COCs, leaving the expanded COCs as a minority of the collected
COCs (CHAPTER 1, Table 1). This difference in classification might have influenced the results
observed.
A second factor that might have had a positive influence on the blastocyst production rate was
the introduction of the piezo drill in December 2008. The introduction of the piezo drill for ICSI
in the horse has been associated with better cleavage rates and more consistent results (Choi et
![Page 145: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/145.jpg)
Chapter 7
139
al., 2002). Possible explanations for the positive effect of piezo-assisted over conventional ICSI
include the higher probability of oolemma breakage, reduced damage to the oocyte because
mechanical suction of the oolemma is replaced by a single pulse and better permeabilization of
the sperm membrane, which facilitates oocyte activation (Yanagida et al., 1998, Choi et al.,
2002). Considering the possible influence of the injection technique on subsequent embryonic
development, the laser was introduced as an alternative for the piezo drill. The pilot study
presented here, determined the laser as a valuable option for ICSI in the horse.
A final consideration is the acquisition of experience over the years, coinciding with faster
manipulation of the oocytes and reduced damage during subsequent IVP procedures.
The low blastocyst rate could be considered suboptimal. It could be criticized that IVP
blastocysts, cultured in suboptimal conditions, will have more aberrations in gene expression.
However, the focus of the research was on the identification of genes that were more highly
expressed in the golden standard, which were in vivo derived equine blastocysts. Moreover,
several stains (Figure 2) and the successful transfer of two IVP blastocysts leading to the birth of
a foal (CHAPTER 3.2) proved the developmental competence and vitality of the produced
blastocysts.
Figure 2 Equine IVP blastocysts (day 9) (magnification 400x). Fluorescent staining with Hoechst
33342 (A) and propidium iodide (B) illustrate the vital nuclei of horse blastocysts produced in
vitro.
![Page 146: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/146.jpg)
Chapter 7
140
Despite the relatively low blastocyst rate, the foal rate is comparable to the results of an established
laboratory in this field (Barbacini et al., 2009). The Italian group obtained 103 blastocysts out of 1553
collected oocytes. Considering the 3 ongoing pregnancies delivered a foal, 17 foals were produced out of
84 transferred blastocysts (20%). In summary, an average of 0.013 foals per collected oocyte can be
calculated. In our study, one foal resulted from 52 collected oocytes (0.019). This is a good result, even
though it only concerns a single experiment.
7.2 EMBRYO-MATERNAL INTERACTION
The early post-fertilization stages of embryonic development in the horse are supported by
very specific micro-environments, offered by the oviduct and the uterus. Several aspects of this
embryo-maternal interaction have been highlighted during the thesis and are summarized in
Table 1.
Table 1 Embryo-maternal interaction in the horse. Several unusual aspects, both maternal and
embryonic, contribute to specific interactions between the oviduct and the early embryo on the
one hand and between the uterus and the later embryo on the other hand.
Maternal environment Embryo
Oviduct – Cleavage/morula Separated from the uterus by a
distinct uterotubal papilla
Specific transport of embryos, while
oocytes are retained
Long stay (~6 days)
Stage specific production of
prostaglandin E2 inducing relaxation of
the oviduct
Uterus - Blastocyst Nourishing histotrophe
Progesterone dependent proteins,
including uterocalin
Long pre-implantation period
Capsule
Mobile, signaling its presence to
prevent luteolysis
![Page 147: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/147.jpg)
Chapter 7
141
Absence of the physiological maternal environment results in major or minor effects on the
embryos. The oviductal environment supporting the early cleavage stage equine embryo is
distinct to uterine effects, as illustrated by the failure of development after premature intra-
uterine transfer of cleavage stage embryos (CHAPTER 6). On the other hand, the uterine
environment is essential to attainment of specific features of a normal blastocyst. Blastocysts
produced in vitro differ from their in vivo counterparts with regard to the kinetics of
development, morphology and gene expression (Tremoleda et al., 2003; Pomar et al., 2005;
CHAPTER 5). The addition of a specific component of the in vivo environment, for example
uterocalin, to the in vitro culture medium appeared to partially restore one aspect, namely
capsule formation, although other morphological and developmental features and expression
of specific genes remained unaffected (CHAPTER 6). The absence of effects on embryonic
growth, gene expression or quality might be an artefact due to measurement of factors not
influenced by uterocalin. However, it is also possible that a crucial ligand(s) necessary for
uterocalin to influence gene expression or metabolism was absent in the in vitro culture
medium. More research is needed to better define the pieces of this complex embryo-maternal
interaction.
7.3 GENE EXPRESSION
7.3.1 Gene expression in mammalian embryos
Several reciprocal interactions exist between embryonic development, embryonic gene
expression and embryo culture conditions (Figure 3). The embryonic environment affects
embryonic development, which is in turn reflected by the genes expressed by the embryo. On
the other hand, environmental conditions can induce changes in gene expression, which can in
their turn interfere with embryonic developmental competence. Altered embryo quality can
then induce secondary changes in gene expression.
![Page 148: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/148.jpg)
Chapter 7
142
Figure 3 Reciprocal interactions between embryonic development, gene expression and
environmental circumstances.
Marked morphological and developmental differences between in vivo derived and IVP
embryos have been shown in several species, and they have been associated to culture
environment induced changes in mRNA abundance (Corcoran et al., 2006). This differential
gene expression is evident at several levels. Firstly, IVP embryos exhibit a different gene
expression pattern when compared to their in vivo derived counterparts, as shown in various
mammals, including cattle (Mohan et al., 2004; Corcoran et al., 2006; Goossens et al., 2007),
pigs (Magnani and Cabot, 2008) and mice (Fernández-González et al., 2009). Furthermore the
gene expression level is influenced by IVF per se (Giritharan et al., 2007), by the type of embryo
culture medium (Rinaudo and Schultz., 2004) and by embryo density (Hoelker et al., 2009).
Therefore the expression of specific developmentally important genes has been used to
evaluate the effects of different culture media and of the addition of particular components to
the embryo culture medium (McElroy et al., 2008; Chin et al., 2009). For example, the presence
of FCS during IVC has been associated with the upregulation of the pro-apoptotic Bax-gene in
bovine (Rizos et al., 2003) and porcine (Cui et al., 2004) embryos. Moreover FCS in murine IVC
medium modifies the expression of genes related to epigenetic mechanisms (Fernández-
González et al., 2009). Since early epigenetic modifications affect the later phenotype, aberrant
expression of the related genes might provide the link between suboptimal embryonic culture
conditions and long-term phenotype perturbation (Fernández-González et al., 2009). Epigenetic
changes due to suboptimal culture conditions have also been associated with the ‘large
offspring syndrome’ in sheep (Young et al., 2001). This illustrates the importance of gene
expression analysis as a tool to understand the link between the early embryonic environment
![Page 149: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/149.jpg)
Chapter 7
143
and the long-term phenotype on the one hand, and to evaluate IVC conditions in order to
optimize the IVP of embryos on the other.
7.3.2 Gene expression in equine embryos
As gene expression reflects embryo quality and the effects of embryo culture conditions, we
aimed to identify genes that are expressed at a higher level in golden standard in vivo derived
equine blastocysts than in IVP equine blastocysts, with the ultimate purpose of inducing similar
expression patterns in vitro by optimization of embryo culture conditions. The most suitable
technique at that moment to attain this purpose was SSH. The SSH method as developed and
described in detail by Diatchenko et al. (1996) uses cDNA of a tester (in vivo blastocysts) and a
driver (in vitro blastocysts) and combines several hybridizations and amplifications resulting in
suppression of non-target DNA amplification and the selective amplification of the tester
specific sequences (Addendum 2). Suppression subtractive hybridization has proven extremely
useful for studying early embryonic development in other mammals including cattle (Mohan et
al., 2004; Goossens et al., 2007), mice (Wen and Guang-xiu, 2007) and monkeys (Sun et al.,
2004) because of a number of particular advantages (Bui et al., 2005; Pfeffer et al., 2007).
1. No prior knowledge about the genes of interest is required. At the start of this project in
2007, little was known about gene expression in equine embryos and the equine
genome was poorly annotated. Therefore SSH was preferred over micro-array, which
requires specific probes.
2. The genetic material can be pre-amplified without biasing the outcome of the SSH. This
is very valuable considering the difficulty of obtaining blastocysts in the horse and the
very low amount of RNA in each embryo.
3. It enriches lowly abundant tester-specific transcripts, while common sequences are
blocked, leading to the identification of tester-specific genes of interest in very small
amounts of initial cDNA.
Even though initial identification of the amplified target sequences via BLAST analysis against
the NCBI database (www.ncbi.nlm.nih.gov) was hindered by the poor annotation of the horse
![Page 150: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/150.jpg)
Chapter 7
144
genome and frequent changes through updates, final identification of 62 genes with a higher
expression in in vivo derived equine blastocysts was achieved. Functional analysis revealed
particular involvement of these genes in protein synthesis and energy metabolism. This is in
agreement with reports in other species about impaired mitochondrial function (Mtango et al.,
2008) and transcription/translation (Corcoran et al., 2006) in vitro, when compared to the
situation in vivo.
As for other large scale screening techniques such as microarray, SSH is at risk of false positive
results. Therefore, differentially expressed genes require confirmation by means of a very
sensitive and specific method, as offered by RT-qPCR (Addendum 3). RT-qPCR permits accurate
quantification of the difference in expression between in vivo derived and IVP equine
blastocysts, but in order to ensure reliability of the results, the RT-qPCR assays must be
carefully conducted. Most importantly, accurate normalization is obligatory for correct
interpretation (Vandesompele et al., 2002; Bustin and Nolan, 2004; Bustin et al., 2005). Since
no RT-qPCR normalisation studies had been reported for horse embryos, a preliminary trial was
conducted to optimize the RT-qPCR standard operating procedure for equine embryos (Smits et
al., 2008) and reference genes for comparing in vivo and in vitro produced equine blastocysts
were evaluated (CHAPTER 4). Similarities in reference gene stability between the 3 different
types of equine blastocysts and differences to reference genes reported for other species
supported respectively the reliability and the need for the experiment. Meanwhile, RT-qPCR
has been used in equine embryos to examine expression of progesterone and oestrogen
receptors (Rambags et al., 2008), POU5F1 (Choi et al., 2009) and HSPA1A (Mortensen et al.,
2010). However, in these studies, only one reference gene was used, namely ACTB (Rambags et
al., 2008; Choi et al., 2009) or 18S rRNA (Mortensen et al., 2010). Even though ACTB appeared
stable in our study, the use of a single reference gene can lead to erroneous normalization
(Dheda et al., 2005).
Of the six genes selected from the SSH, five (ODC, HSP90AA1, BEX2, MOBKL3 and FABP3) were
confirmed to be expressed more highly in the in vivo derived horse blastocysts by means of RT-
qPCR (83%). This is a good result, as it is lower than the reported incidence of false positive
![Page 151: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/151.jpg)
Chapter 7
145
sequences in SSH, being of the order of 30% (Mohan et al., 2004) and 25% (Goossens et al.,
2007).
Even though statistical significance was shown, biological relevance remains hard to interpret.
Although several transcriptomic analyses have been performed in different species, data on the
function of many identified genes are much scarcer. To obtain this functional information,
several methods can be applied, including:
1. Knocking out specific genes (Guan et al., 2010). Through knocking out a specific gene
and subsequent observation of the phenotype, the function of this gene can be
deduced. For practical and ethical reasons this method is mainly restricted to mice.
2. RNA interference (Schellander et al., 2007; Perrimon et al., 2010). Posttranscriptional
gene silencing includes the introduction of siRNA, dsRNA or shRNA, leading to
degradation of the target mRNA. This technique has proven valuable in functional
genomics not only in murine, but also in bovine and porcine oocytes and embryos in
vivo and in vitro.
3. Systems biology (Romero et al., 2006). The central dogma describes the transcription of
genes to mRNA and further translation to the protein, which actually exerts the
biological function. Accordingly, combining genomics, transcriptomics, proteomics and
metabolomics is essential to understand the role of specific genes in the associated
biological system. This approach was followed for example to clarify the preterm
parturition syndrome in human (Romero et al., 2006). Genomics was used to determine
a genetic predisposition for spontaneous preterm labour. Then, mRNA changes in
reproductive tissues, associated with preterm birth, were determined by
transcriptomics. By means of proteomics, differential protein profiles in the amniotic
fluid from patients with premature labour were established. Finally, metabolic profiling
of amniotic fluid was used to evaluate the risk for preterm delivary. As a whole, the
combination of all these techniques, called high-dimensional biology, can provide insight
into a complex biological phenomenon.
![Page 152: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/152.jpg)
Chapter 7
146
The involvement in embryonic development of the six genes that were selected out of the 62
genes shown to be differentially expressed by SSH, has been documented in several other
species as discussed extensively in CHAPTER 5. However, a lack of data on gene expression in
horse embryos hinders comparative analysis in this field. A recent study describing the
expression of heat shock protein 70 (HSP1A1) in equine in vivo and in vitro blastocysts
(Mortensen et al., 2010) is interesting considering that this was one of the genes shown to be
differentially expressed by SSH. Mortensen et al. (2010) found an increase of HSP1A1 mRNA
relative to 18S rRNA in IVP equine blastocysts when compared to in vivo derived grade 1 equine
blastocysts, but this was primarily due to lower concentrations of 18S rRNA in the IVP
blastocysts. This difference in analysis compared to the methods used in this thesis makes it
difficult to compare and interpret the results.
The purpose of examining gene expression includes fundamental understanding of early
development on the one hand and implementation of the results in order to improve IVP
efficiency on the other. Regarding the latter, it needs to be considered that the expression of a
gene can either reflect a direct influence of the embryo culture medium or it can be secondary
through induction by a downstream effect (embryonic environment -> deregulation of certain
genes -> altered embryo quality -> deregulation of other genes) (Figure 3). The expression of a
particular gene does not necessarily mean that the addition of its substrate to the culture
medium will benefit embryonic development. Okawara et al. (2009) detected the expression of
glycerol kinase in bovine oocytes and embryos, indicating a physiological role of glycerol;
however, the addition of glycerol to the maturation medium appeared to negatively influence
subsequent maturation rates. On the other hand, changes in the culture medium are reflected
by gene expression patterns. For example, during IVP in mice KSOM resulted in higher
blastocyst rates when compared to Whitten’s medium and when, in a later microarray
experiment, gene expression was compared to that of in vivo derived embryos, culture in KSOM
induced far less aberrant gene expression than the suboptimal Whitten’s medium (Gardner and
Lane, 2005).
![Page 153: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/153.jpg)
Chapter 7
147
To improve understanding of both the meaning of the genes identified in CHAPTER 5 and the
influence of uterocalin on IVP embryos, the expression of ODC, HSP90AA1, BEX2, MOBKL3 and
FABP3 was evaluated in equine IVP blastocysts cultured in the presence or absence of
uterocalin. It was hypothesized that the addition of a maternal component to the embryo
culture medium could result in a more ‘in vivo-like’ gene expression pattern. However,
uterocalin did not appear to affect the examined genes.
7.4 GENERAL CONCLUSIONS
In a first part of the thesis, the procedure for in vitro embryo production in the horse was
optimized.
1. IVP of equine blastocysts was successfully introduced to our laboratory. After an initial
period of conventional ICSI, piezo drill assisted ICSI was introduced and subsequently
compared with laser assisted ICSI. Both devices have specific advantages and
disadvantages, but no major effect on subsequent embryonic development was
observed (CHAPTER 3.1).
2. The viability of the IVP equine blastocysts was illustrated by successful embryo transfer,
resulting in the birth of the first ICSI-foal in the Benelux (CHAPTER 3.2).
Based on the results presented in this thesis, the following conclusions can be drawn:
1. A method for reliable determination of gene expression in equine blastocysts was
developed by the optimization of a standard operating procedure for RT-qPCR and
through the determination of the most stable reference genes for normalization. The
geometric mean of UBC, ACTB, RPL32 and GAPDH is recommended as a normalization
factor for RT-qPCR in equine in vivo and in vitro derived blastocysts (CHAPTER 4).
2. Upregulation of genes in in vivo derived equine blastocysts, when compared to IVP
equine blastocysts, was determined by SSH. A total of 62 upregulated genes was
identified, with major involvement in protein synthesis and energy metabolism. The
differential expression was confirmed by RT-qPCR for five out of six developmentally
important genes, namely ODC, HSP90AA1, BEX2, MOBKL3 and FABP3 (CHAPTER 5).
![Page 154: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/154.jpg)
Chapter 7
148
3. The premature intra-uterine transfer of cleavage stage equine IVP embryos (day 2-3) did
not result in successful embryo development (CHAPTER 6).
4. The addition of recombinant uterocalin to the embryo culture medium on day 6
improved capsule formation in equine IVP blastocysts, but did not influence embryonic
development nor the expression of the examined genes (CHAPTER 6).
7.5 FUTURE PERSPECTIVES
The IVP of equine embryos has evolved greatly in recent years, creating the possibility to obtain
foals through the combination of OPU, IVM, ICSI, IVC and ET for research (Jacobson et al., 2010)
as well as for clinical (Colleoni et al., 2007) purposes. However, each of these steps needs
optimization through further research in order to allow large scale application as it happens
already in cattle (Blanco et al., 2009). Recent publications stress the limitations of
superovulation and OPU techniques (Blanco et al., 2009; Jacobson et al., 2010), IVM (Galli et al.,
2007), ICSI (Choi et al., 2002), IVC (Choi et al., 2004) and ET (Panzani et al., 2009). Taken into
account a current blastocyst rate of 10% in one of the most experienced commercial labs
(Barbacini et al., 2009), there is considerable room to improve both the quantity and the quality
of transferable blastocysts by optimizing all these crucial steps.
A clear influence of the maternal environment on embryonic development was observed. An
important role of the oviductal environment was also shown (CHAPTER 6), and further
information on the mechanism involved or on the composition of equine oviductal fluid and the
influence of oviduct epithelial cell secretions on early embryonic stages would be very
interesting. Considering the blastocyst and its uterine environment, a link was made between
the maternal protein uterocalin and the embryonic capsule. However, elucidating underlying
mechanisms of this phenomenon, influence of the addition of ligands for uterocalin and the
role of other components of the uterine histotrophe all require further research.
One way to evaluate embryos is to look at gene expression. Since genetic research in equine
embryos is still in its infancy, plenty of opportunities exist to expand this field in order to
achieve a level of information, which is comparable to that in other species. Growing
![Page 155: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/155.jpg)
Chapter 7
149
knowledge of the equine genome and advances in genetic technologies are opening new
avenues for rapid generation of large amounts of data. Recent work on endometrial gene
expression was performed with a home-made microarray (Klein et al., 2010). Microarray
analysis has generated substantial information on murine (Fernández-González et al., 2009) and
bovine (Vigneault et al., 2009) embryonic gene expression. Embryonic biopsy, combined with
microarray and DNA fingerprinting can contribute to the identification of markers to predict
embryonic developmental competence (Jones et al., 2008). Currently, microarray is in its turn
being replaced by even more advanced techniques like next generation sequencing (deep
sequencing), providing massive amounts of information in a short time (Hurd and Nelson,
2009). Combining knowledge from genomics and transcriptomics with proteomics and
metabolomics is crucial in order to achieve functional insights (Romero et al., 2006; Werner et
al., 2010) in the complex puzzle called ‘early embryonic development’.
REFERENCES
1. Barbacini S., Colleoni S., Duchi R., Necchi D., Lazzari G., Galli C. 2010. An update of
results obtainable with ovum pick up (OPU, intracytoplasmatic sperm injection (ICSI) and
embryo culture (IVC) in equine reproduction. Proc 5. Leipziger Tierärztekongress 304-
306.
2. Betteridge K.J. 2007. Equine embryology: an inventory of unanswered questions.
Theriogenology 68S S9-S2.
3. Blanco I.D.P., Devito L.G., Ferreira H.N., Araujo G.H.M., Fernandes C.B., Alvarenga M.A.,
Landim-Alvarenga F.C. 2009. Aspiration of equine oocytes from immature follicles after
treatment with equine pituitary extract (EPE) alone or in combination with hCG. Anim
Reprod Sci 114 203-209.
4. Bui L.C., Léandri R.D., Renard J.P., Duranthon V. 2005. SSH adequacy to preimplantation
mammalian development: scarce specific transcripts cloning despite irregular
normalization. BMC Genomics 6 155.
5. Bustin S.A., Benes V., Nolan T., Pfaffl M.W. 2005. Quantitative real-time RT-PCR: a
perspective. J Mol Endocrinol 34 597-601.
![Page 156: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/156.jpg)
Chapter 7
150
6. Bustin S.A., Nolan T. 2004. Pitfalls of quantitative real-time reverse-transcription
polymerase chain reaction. J Biomol Tech 15 155-166.
7. Chin P.Y., Macpherson A.M., Thompson J.G., Lane M., Robertson S.A. 2009. Stress
response genes are suppressed in mouse preimplantation embryos by granulocyte-
macrophage colony-stimulating factor (GM-CSF). Hum Reprod. 24, 2997-3009.
8. Choi Y.H., Love C.C., Love L.B., Varner D.D., Brinsko S.P., Hinrichs K. 2002.
Developmental competence in vivo and in vitro of in vitro-matured equine oocytes
fertilized by intracytoplasmic sperm injection with fresh or frozen-thawed sperm.
Reproduction 123 455-65.
9. Choi Y.H., Love L.B., Varner D.D., Hinrichs K. 2004. Factors affecting developmental
competence of equine oocytes after intracytoplasmic sperm injection. Reproduction
127 187-194.
10. Choi Y.H., Harding H.D., Hartman D.L., Obermiller A.D., Kurosaka S., McLaughlin K.J.,
Hinrichs K. 2009. The uterine environment modulates trophectodermal POU5F1 levels in
equine blastocysts. Reproduction 138 589-599.
11. Colleoni S., Barbacini S., Necchi D., Duchi R., Lazzari G., Galli C. 2007. Application of
ovum pick-up, intracytoplasmic sperm injection and embryo culture in equine practice.
Proc AAEP 53 554-559.
12. Corcoran D., Fair T., Park S., Rizos D., Patel O.V., Smith G.W., Coussens P.M., Ireland J.J.,
Boland M.P., Evans A.C. and Lonergan P. 2006. Suppressed expression of genes involved
in transcription and translation in in vitro compared with in vivo cultured bovine
embryos. Reproduction 131 651-660.
13. Cui X.S., Jeong Y.J., Lee H.Y., Cheon S.H., Kim N.H. 2004. Fetal bovine serum influences
apoptosis and apoptosis-related gene expression in porcine parthenotes developing in
vitro. Reproduction 127 125-130.
14. Dafforn A., Chen P., Deng G., Herrler M., Iglehart D., Koritala S., Lato S., Pillarisetty S.,
Purohit R., Wang M., Wang S., Kurn N. 2004 Linear mRNA amplification from as little as
5 ng total RNA for global gene expression analysis. Biotechniques 37 854-857.
![Page 157: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/157.jpg)
Chapter 7
151
15. Dheda K., Huggett J.F., Chang J.S., Kim L.U., Bustin S.A., Johnson M.A., Rook G.A., Zumla
A. 2005. The implications of using an inappropriate reference gene for real-time reverse
transcription PCR data normalization. Anal Biochem 344 141-143.
16. Diatchenko L., Lau Y.F., Campbell A.P., Chenchik A., Moqadam F., Huang B., Lukyanov S.,
Lukyanov K., Gurskaya N., Sverdlov E.D., Siebert P.D. 1996. Suppression subtractive
hybridization: a method for generating differentially regulated or tissue-specific cDNA
probes and libraries. Proc National Academy of Sciences of the USA 93 6025-6030.
17. Fernàndez-Gonzàlez R., de Dios Hourcade J., López-Vidriero I., Benguría A., Rodríguez De
Fonseca F., Gutiérrez-Adán A. 2009. Analysis of gene transcription alterations at the
blastocyst stage related to the long-term consequences of in vitro culture in mice.
Reproduction 137 271-283.
18. Galli C., Colleoni S., Duchi R., Lagutina I., Lazzari G. 2007. Developmental competence of
equine oocytes and embryos obtained by in vitro procedures ranging from in vitro
maturation and ICSI to embryo culture, cryopreservation and somatic cell nuclear
transfer. Anim Repod Sci 98 39-55.
19. Gardner D.K., Lane M. 2005. Ex vivo early embryo development and effects on gene
expression and imprinting. Reprod Fertil Dev 17 361-370.
20. Giritharan G., Talbi S., Donjacour A., Di Sebastiano F., Dobson A.T., Rinaudo P.F. 2007.
Effect of in vitro fertilization on gene expression and development of mouse
preimplantation embryos. Reproduction 134 63-72.
21. Goossens K., Van Soom A., Van Poucke M., Vandaele L., Vandesompele J., Van Zeveren
A., Peelman L. 2007. Identification and expression analysis of genes associated with
bovine blastocyst formation. BMC Dev Biol 7 64.
22. Goto Y., Noda Y., Masahide S., Kishi J., Nonogaki T., Mori T. 1993. The fate of embryos
transferred into the uterus. J Assist Reprod Genet 10 197-201.
23. Guan C., Ye C., Yang X., Gao J. 2010. A review of current large-scale mouse knockout
efforts. Genesis 48 73-85.
![Page 158: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/158.jpg)
Chapter 7
152
24. Hinrichs K., Schmidt A.L. 2000. Meiotic competence in horse oocytes: interactions
among chromatin configuration, follicle size, cumulus morphology, and season. Biol
Reprod 62 1402-1408.
25. Hoelker M., Rings F., Lund Q., Ghanem N., Phatsara C., Griese J., Schellander K., Tesfaye
D. 2009. Effect of the microenvironment and embryo density on developmental
characteristics and gene expression profile of bovine preimplantative embryos cultured
in vitro. Reproduction 137 415-425.
26. Hurd P.J., Nelson C.J. 2009. Advantages of next-generation sequencing versus the
microarray in epigenetic research. Brief Funct Genomic Proteomic 8 174-183.
27. Hunter R.H.F. 1998. Have the fallopian tubes a vital role in promoting fertility? Acta
Obstet Gynecol Scand 77 475-486.
28. Jacobson C.C., Choi Y.H., Hayden S.S., Hinrichs K. 2010. Recovery of mare oocytes on a
fixed biweekly schedule, and resulting blastocyst formation after intracytoplasmic sperm
injection. Theriogenology 73 1116-1126.
29. Jones G.M., Cram S.D., Song B., Kokkali G., Pantos K., Trounson A.O. 2008. Novel
strategy with potential to identify developmentally competent IVF blastocysts. Hum
Reprod 23 1748-1759.
30. Klein C., Scoggin K.E., Ealy A.D., Troedsson M.H. 2010. Transcriptional profiling of equine
endometrium during the time of maternal recognition of pregnancy. Biol Reprod. 83
102-113.
31. Magnani L., Cabot R.A. 2008. In vitro and in vivo derived porcine embryos possess
similar, but not identical, patterns of Oct4, Nanog, and Sox2 mRNA expression during
cleavage development. Mol Reprod Dev 75 1726-1735.
32. McElroy S.L., Kim J.H., Kim S., Jeong Y.W., Lee E.G., Park S.M., Hossein M.S., Koo O.J.,
Abul Hashem M.D., Jang G., Kang S.K., Lee B.C., Hwang W.S. (2008). Effects of culture
conditions and nuclear transfer protocols on blastocyst formation and mRNA expression
in pre-implantation porcine embryos. Theriogenology 69 416-425.
33. Mohan M., Hurst A., Malayer J.R. 2004. Global gene expression analysis comparing
bovine blastocysts flushed on day 7 or produced in vitro. Mol Reprod Dev 68 288-298.
![Page 159: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/159.jpg)
Chapter 7
153
34. Mtango N.R., Harvey A.J., Latham K.E., Brenner C.A. 2008. Molecular control of
mitochondrial function in developing rhesus monkey oocytes and preimplantaion-stage
embryos. Reprod Fertil Dev 20 846-859.
35. Okawara S., Hamano S., Tetsuka M. 2009. Bovine oocytes and early embryos express
mRNA encoding glycerol kinase but addition of glycerol to the culture media interferes
with oocyte maturation. J Reprod Dev 55 177-182..
36. Panzani D., Crisci A., Rota A., Camillo F. 2009. Effect of day of transfer and treatment
administration on the recipient on pregnancy rates after equine embryo transfer. Vet
Res Commun 33 (Suppl 1) S113–S116.
37. Perrimon N., Ni J.-Q., Perkins L. 2010. In vivo RNAi: today and tomorrow. Cold Spring
Harb Perspect Biol 2 a003640.
38. Pfeffer P.L., Sisco B., Donnison M., Somers J., Smith C. 2007. Isolation of genes
associated with developmental competency of bovine oocytes. Theriogenology 68 S84-
S90.
39. Pomar F.J., Teerds K.J., Kidson A., Colenbrander B., Tharasanit T., Aguilar B., Roelen B.A.
2005. Differences in the incidence of apoptosis between in vivo and in vitro produced
blastocysts of farm animal species: a comparative study. Theriogenology 63 2254-2268.
40. Rambags B.P., van Tol H.T., van den Eng M.M., Colenbrander B., Stout T. 2008.
Expression of progesterone and oestrogen receptors by early intrauterine equine
conceptuses. Theriogenology 69 366-375.
41. Rinaudo P., Schultz R.M. 2004. Effects of embryo culture on global pattern of gene
expression in preimplantation mouse embryos. Reproduction 128 301-311.
42. Rizos D., Gutiérrez-Adán A., Pérez-Garnelo S., De La Fuente J., Boland M.P., Lonergan P.
2003. Bovine embryo culture in the presence or absence of serum: implications for
blastocyst development, cryotolerance, and messenger RNA expression. Biol Reprod 68
236-243.
43. Romero R., Espinoza J., Gotsch F., Kusanovic J.P., Friel L.A., Erez O., Mazaki-Tovi S., Than
N.G., Hassan S.,Tromp G. 2006. The use of high-dimensional biology (genomics,
![Page 160: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/160.jpg)
Chapter 7
154
transcriptomics, proteomics, and metabolomics) to understand the preterm parturition
syndrome. BJOG 113 (Suppl3) 118-135.
44. Schellander K., Hoelker M., Tesfaye D. 2007. Selective degradation of transcripts in
mammalian oocytes and embryos. Theriogenology 68S S107-S115.
45. Smits K., Goossens, K., Van Poucke M., Van Soom A., Peelman L. 2008. Optimization of
standard operating procedure for quantitative real-time PCR in equine embryos. Proc 1st
Benelux qPCR Symposium.
46. Squires EL, Carnevale EM, McCue PM, Bruemmer JE. 2003. Embryo technologies in the
horse. Theriogenology 59 151-170.
47. Sun X., Li F., Tan Y., Piao Y., Tang S., Wang Y. 2004. Determination of genes involved in
the early process of embryonic implantation in Rhesus Monkey (Macaca mulatta) by
suppression subtractive hybridization. Biol Reprod 70 1365-1373.
48. Tremoleda J.L., Stout T.A., Lagutina I., Lazzari G., Bevers M.M., Colenbrander B., Galli C.
2003. Effects of in vitro production on horse embryo morphology, cytoskeletal
characteristics, and blastocyst capsule formation. Biol Reprod 69 1895-1906.
49. Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A., Speleman
F. 2002 Accurate normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome Biol 3 0034.1-0034.11.
50. Vigneault C., Gravel C., Vallée M., McGraw S., Sirard M.A. 2009. Unveiling the bovine
embryo transcriptome during the maternal-to-embryonic transition. Reproduction. 137
245-257.
51. Wen L.I., Guang-xiu L.U. 2007. Difference of gene expression between 8-cell early
embryos and 8-cell compacted embryos in mice. J Cent south Univ (MedSci) 32 252-258.
52. Werner T. 2010. Next generation sequencing in functional genomics. Brief Bioinform
Epub ahead of print http://bib.oxfordjournals.org/cgi/reprint/bbq018v.
53. Yanagida K., Katayose H., Yazawa H., Kimura Y., Konnai K., Sato A. 1998. The usefulness
of a piezo-micromanipulator in intracytoplasmic sperm injection in humans. Hum
Reprod 14 448-453.
![Page 161: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/161.jpg)
Chapter 7
155
54. Young L.E., Fernandes K., McEvoy T.G., Butterwith S.C., Gutierrez C.G., Carolan C.,
Broadbent P.J., Robinson J.J., Wilmut I., Sinclair K.D. 2001. Epigenetic change in IGF2R is
associated with fetal overgrowth after sheep embryo culture. Nat Genet 27 153-154.
![Page 162: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/162.jpg)
![Page 163: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/163.jpg)
Summary
157
SUMMARY
In vitro produced equine embryos are valuable, not only to investigate aspects of early
embryonic development, but also from a clinical point of view. The low success of conventional
IVF contributed to the initial slow development and implementation of IVP in the horse.
However, once ICSI was introduced almost 15 years ago progress became much more rapid.
Despite this advance, the other steps of the IVP process (oocyte collection - IVM – ICSI – IVC)
still pose specific problems, and need optimization to enhance the efficiency of the overall
procedure.
The blastocyst stage embryo is particularly interesting, being on the one hand the endpoint of
the IVP process and on the other hand the first embryonic stage, which is unique to the uterus,
allowing the possibility to atraumatically collect in vivo blastocysts from donor mares as well as
to transfer in vivo or in vitro produced blastocysts to recipient mares. Comparing IVP blastocysts
with their counterparts derived in vivo reveals differences in the kinetics of development and in
morphology, reflecting the influence of the unique equine maternal environment. CHAPTER 1
represents a general introduction.
The purpose of this thesis (CHAPTER 2) is to contribute to the optimization of the IVP of equine
embryos by considering some technical aspects of the process (CHAPTER 3) and through
fundamental understanding of differences between in vitro produced and in vivo derived
equine blastocysts, with the emphasis on gene expression (CHAPTER 4,5) and on the influence
of the maternal environment on early equine embryonic development (CHAPTER 6).
The method of choice for fertilizing equine oocytes is ICSI. After an initial period of conventional
ICSI, the piezo drill was introduced and was associated with higher cleavage rates and more
consistent results, even though no direct comparison with conventional ICSI had been
performed. Since the piezo drill also has some disadvantages, like the toxicity of mercury, other
advanced injection technologies should also be considered. Therefore in CHAPTER 3.1 piezo-
assisted ICSI was compared with laser-assisted ICSI. No major influence on subsequent
embryonic development was observed; a slightly higher cleavage rate was obtained after laser-
![Page 164: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/164.jpg)
Summary
158
assisted ICSI, but blastocyst rates were not significantly affected. Further technical advantages
of the laser included the absence of mercury and the ease of use, since it was less sensitive to
exact 3-dimensional positioning than the piezo drill. On the other hand, laser-assisted ICSI
requires the making of several adjacent holes in the zona pellucida, after which conventional
ICSI needs to be applied anyway to penetrate the oolemma. This occurs less fluently than in
piezo-assisted ICSI, in which both the zona and the oolemma are penetrated in one
manipulation. However, the difference in duration of the procedure was not significant.
The IVP of equine embryos was introduced to the laboratory. The feasibility of the IVP protocol
used in this thesis and the viability and developmental competence of the resulting IVP
blastocysts was confirmed through the birth of the first ICSI foal in the Benelux, as described in
CHAPTER 3.2.
The major part of this thesis was focusing on the differences between equine blastocyts
produced in vitro and those derived in vivo. The evaluation of gene expression was selected as
an approach to gain fundamental insight into these differences. The aim was to identify genes
which were upregulated in golden standard in vivo derived blastocysts, when compared to in
vitro produced embryos. Considering the limited knowledge on embryonic gene expression in
the horse and the scarcity of embryonic RNA, SSH was at the time the method of choice for
initial genetic analysis (CHAPTER 5). Using this technique, 62 genes were identified that were
expressed at a higher level in in vivo derived equine blastocysts than in their in vitro produced
counterparts. Functional analysis revealed substantial involvement of these genes in protein
synthesis and energy metabolism. The possibility to generate false positive results by SSH
required confirmation of these results using a very sensitive and specific technique, as offered
by RT-qPCR. Six genes, resulting from the SSH and described in the literature as being involved
in embryonic development, namely BEX2, FABP3, HSP90AA1, MOBKL3, MCM7 and ODC, were
selected for RT-qPCR.
In order to obtain reliable results by RT-qPCR, careful assay and data analysis is crucial. An
important aspect is correct normalization of the data. The method of choice to achieve this
consists of the calculation of a normalization factor, from the geometric mean of the most
![Page 165: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/165.jpg)
Summary
159
stably expressed reference genes in the tissue of interest. To this end, the expression of eight
reference genes was evaluated in in vivo derived and in fresh and frozen-thawed in vitro
produced equine blastocysts. This analysis indicated the geometric mean of ACTB, UBC, RPL32
and GAPDH as a reliable normalization factor for RT-qPCR data in experiments with equine in
vivo and in vitro blastocysts (CHAPTER 4).
This normalisation factor was subsequently used for the analysis of the RT-qPCR data of the 6
developmentally important genes, generated from SSH. For 5 of these genes, namely BEX2,
FABP3, HSP90AA1, MOBKL3, and ODC, a higher level of expression in in vivo derived horse
blastocysts, when compared to in vitro produced blastocysts, was confirmed by means of RT-
qPCR (CHAPTER 5).
In CHAPTER 6 the influence of the maternal environment during embryonic development was
examined. A first experiment examined the necessity of the oviduct for normal early embryonic
development through the premature intra-uterine transfer of day 2-3 equine embryos
produced in vitro. Flushing of the recipient mares on day 7 yielded no viable blastocysts and
pregnancy diagnosis on day 14 revealed no pregnancies, suggesting that the uterus cannot
replace the oviductal environment as a support for the development of early cleavage stage
horse embryos.
In a second experiment the influence of the uterus was assessed, and more specifically the
influence of an important protein component of endometrial secretions, uterocalin.
Recombinant uterocalin was added to IVC medium on day 6 and subsequent in vitro produced
blastocysts were evaluated on day 9-9.5. No differences in blastocyst production, blastocyst
diameter or cell number were found between the embryos cultured in the presence or absence
of uterocalin. Uterocalin did not affect the expression of the genes shown to be upregulated in
vivo embryos (CHAPTER 5) either. However, the presence of uterocalin in the IVC medium
appeared to stimulate embryonic capsule formation.
CHAPTER 7 represents a general discussion and the conclusions of this thesis:
![Page 166: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/166.jpg)
Summary
160
In a first part of the thesis, the procedure for in vitro embryo production in the horse was
optimized.
1. IVP of equine blastocysts was successfully introduced to our laboratory. After an
initial period of conventional ICSI, piezo drill assisted ICSI was introduced and
subsequently compared with laser assisted ICSI. Both devices have specific
advantages and disadvantages, but no major effect on subsequent embryonic
development was observed (CHAPTER 3.1).
2. The viability of the IVP equine blastocysts was proven by successful embryo transfer,
resulting in the birth of the first ICSI-foal in the Benelux (CHAPTER 3.2).
Based on the results presented in the second part of this thesis, the following conclusions can
be drawn:
1. A method for reliable determination of gene expression in equine blastocysts was
developed by the optimization of a standard operating procedure for RT-qPCR and
through the determination of the most stable reference genes for normalization.
The geometric mean of UBC, ACTB, RPL32 and GAPDH is recommended as a
normalization factor for RT-qPCR in equine in vivo and in vitro derived blastocysts
(CHAPTER 4).
2. Upregulation of genes in in vivo derived equine blastocysts, when compared to IVP
equine blastocysts, was determined by SSH. A total of 62 upregulated genes was
identified, with major involvement in protein synthesis and energy metabolism. The
differential expression was confirmed by RT-qPCR for five out of six developmentally
important genes, namely ODC, HSP90AA1, BEX2, MOBKL3 and FABP3 (CHAPTER 5).
3. The premature intra-uterine transfer of cleavage stage equine IVP embryos (day 2-3)
did not result in successful embryo development (CHAPTER 6).
4. The addition of recombinant uterocalin to the embryo culture medium on day 6
improved capsule formation in equine IVP blastocysts, but did not influence
embryonic development nor the expression of the examined genes (CHAPTER 6).
![Page 167: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/167.jpg)
![Page 168: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/168.jpg)
![Page 169: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/169.jpg)
Samenvatting
163
SAMENVATTING
In vitro geproduceerde paardenembryo’s zijn waardevol, niet alleen voor onderzoek met als
doel fundamenteel inzicht te verwerven in de vroege embryonale ontwikkeling, maar ook
vanuit een klinisch standpunt. Het beperkte succes van conventionele IVF heeft bijgedragen tot
een initieel trage opgang van de IVP bij het paard. ICSI werd echter met succes geïntroduceerd
en tijdens het laatste decennium werd een snelle vooruitgang geboekt. Ondanks deze
progressie stellen de verschillende stappen van het IVP proces (eicelverzameling – IVM – ICSI -
IVC) nog steeds meerdere specifieke problemen, waarbij optimalisatie vereist is om de
efficiëntie van de techniek te verbeteren.
Het blastocyststadium is in het bijzonder interessant omdat het enerzijds het eindpunt van het
IVP proces betekent en omdat het anderzijds het stadium is dat zich onder fysiologische
omstandigheden in de baarmoeder bevindt, waardoor het mogelijk is om op atraumatische
wijze zowel in vivo blastocysten te verzamelen van donormerries, als om in vivo of in vitro
geproduceerde blastocysten over te planten in receptormerries. Wanneer IVP blastocysten met
hun in vivo verzamelde tegenhangers worden vergeleken, zijn er verschillen in ontwikkeling en
morfologie, die de invloed van de maternale omgeving weerspiegelen. Een algemene inleiding
wordt gegeven in HOOFDSTUK 1.
Het doel van deze thesis (HOOFDSTUK 2) is om bij te dragen aan de optimalisatie van de IVP van
paardenembryo’s door bepaalde technische aspecten van het proces te onderzoeken
(HOOFDSTUK 3) en door de fundamentele verschillen tussen in vivo en in vitro geproduceerde
paardenblastocysten trachten te begrijpen, met de nadruk op genexpressie (HOOFDSTUK 4,5)
en op de invloed van de maternale omgeving op de vroege embryonale ontwikkeling bij het
paard (HOOFDSTUK 6).
De voorkeurstechniek om paardeneicellen te bevruchten is ICSI. Na een initiële periode van
conventionele ICSI werd de piëzo drill geïntroduceerd voor ICSI bij het paard, wat werd
geassocieerd met hogere delingspercentages en meer herhaalbare resultaten. Een directe
vergelijking met conventionele ICSI werd echter nooit gemaakt. Aangezien de piëzo drill ook
![Page 170: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/170.jpg)
Samenvatting
164
problemen stelt, zoals de toxiciteit van kwik, moeten andere vooruitstrevende technologieën
ook overwogen worden. Daarom werd in HOOFDSTUK 3.1 piëzo-geassisteerde ICSI vergeleken
met laser-geassisteerde ICSI. Er werden geen grote invloeden op de daaropvolgende
embryonale ontwikkeling vastgesteld. Een iets hoger delingspercentage werd bekomen na
laser-geassisteerde ICSI, maar de blastocystpercentages werden niet significant beïnvloed.
Verdere technische voordelen van de laser behelsen de afwezigheid van kwik en het
gebruiksgemak, waarbij de laser ook minder gevoelig is voor de 3-dimensionale positionering
van de micromanipulatoren dan de piëzo. Aan de andere kant moeten er bij laser-geassisteerde
ICSI verschillende gaten in de zona pellucida gemaakt worden, waarna alsnog conventionele
ICSI toegepast dient te worden om de eicelmembraan te penetreren. Dit verloopt minder vlot
dan bij piëzo-geassisteerde ICSI, waarbij zowel de zona als de eicelmembraan in één vloeiende
manipulatie kunnen worden gepenetreerd. Er was echter geen significant verschil in tijd tussen
beide technieken.
De IVP van paardenembryo’s werd in het laboratorium geïntroduceerd. De kwaliteit van het
protocol voor IVP dat in deze thesis gebruikt werd, wordt bevestigd door de vitaliteit en het
ontwikkelingspotentieel van de resulterende IVP blastocysten en door de geboorte van het
eerste ICSI-veulen van de Benelux, die beschreven wordt in HOOFDSTUK 3.2.
In deze thesis lag de nadruk echter op de verschillen tussen in vitro versus in vivo
geproduceerde paardenblastocysten. De evaluatie van hun genexpressie werd gekozen als
benadering om fundamenteel inzicht te verwerven in deze verschillen. Het doel was om genen
te identificeren die opgereguleerd worden bij in vivo blastocysten, die als gouden standaard
gebruikt worden, in vergelijking met in vitro blastocysten. Rekening houdend met de beperkte
kennis over embryonale genexpressie bij het paard en de schaarsheid aan embryonaal RNA,
was SSH de voorkeurstechniek voor een initiële genetische analyse (HOOFDSTUK 5). Op deze
manier werden 62 genen geïdentificeerd, die meer tot expressie kwamen bij in vivo
geproduceerde paardenblastocysten dan bij hun in vitro geproduceerde tegenhangers.
Functionele analyse onthulde een belangrijke betrokkenheid van deze genen in de
eiwitsynthese en het energiemetabolisme. De mogelijkheid van het genereren van vals
![Page 171: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/171.jpg)
Samenvatting
165
positieve resultaten met SSH vereist echter een extra bevestiging door middel van een zeer
gevoelige en specifieke techniek, namelijk RT-qPCR. Uit de SSH werden zes genen geselecteerd
op basis van hun in de literatuur beschreven betrokkenheid bij de embryonale ontwikkeling,
namelijk BEX2, FABP3, HSP90AA1, MOBKL3, MCM7 en ODC.
Om betrouwbare resultaten te verkrijgen met RT-qPCR is een zorgvuldige methode en data-
analyse cruciaal. Hierbij is een correcte normalisatie van de data van belang. De
voorkeursmethode om dit te bereiken bestaat uit de berekening van een normalisatiefactor,
zijnde het geometrisch gemiddelde van de stabielste referentiegenen in het weefsel van
interesse. Daarom werd de expressie van 8 referentiegenen geëvalueerd zowel in in vivo
geproduceerde als in verse en ontdooide in vitro geproduceerde paardenblastocysten. Deze
analyse bepaalde het geometrisch gemiddelde van ACTB, UBC, RPL32 en GAPDH als een
betrouwbare normalisatiefactor voor RT-qPCR data in experimenten met zowel in vivo als in
vitro paardenblastocysten (HOOFDSTUK 4).
De op deze manier bepaalde normalisatiefactor werd vervolgens gebruikt voor de analyse van
de RT-qPCR data van de zes geselecteerde genen. Voor vijf van deze genen, namelijk BEX2,
FABP3, HSP90AA1, MOBKL3, and ODC, werd de hogere expressie in in vivo geproduceerde
paardenblastocysten in vergelijking met in vitro geproduceerde paardenblastocysten bevestigd
door middel van RT-qPCR (HOOFDSTUK 5).
In HOOFDSTUK 6 werd de invloed van de maternale omgeving tijdens de embryonale
ontwikkeling onderzocht. Een eerste experiment stelde de cruciale rol van de eileider in vraag
door gedeelde embryo’s van 2 à 3 dagen oud vroegtijdig over te planten naar de baarmoeder.
Er werden geen blastocysten gevonden na baarmoederspoeling van de receptormerries op dag
7 en er werden ook geen drachten vastgesteld na echografie op dag 14 wat suggereert dat de
baarmoeder de eileideromgeving niet kan vervangen om de ontwikkeling van vroege gedeelde
embryonale stadia bij het paard te ondersteunen.
In een tweede experiment werd de invloed van de baarmoeder nagegaan en meer specifiek de
invloed van een belangrijk eiwit in de baarmoedersecreties, uterocaline. Recombinant
uterocaline werd toegevoegd aan het IVC medium op dag 6 en de in vitro geproduceerde
![Page 172: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/172.jpg)
Samenvatting
166
blastocysten werden 9 tot 9,5 dagen na ICSI geëvalueerd. Geen verschillen in
blastocystpercentage, diameter of celaantal werden gevonden tussen de embryo’s die werden
gekweekt in de aan- of afwezigheid van uterocaline. Uterocaline had ook geen invloed op de
expressie van de genen die opgereguleerd zijn in vivo (HOOFDSTUK 5). De aanwezigheid van
uterocaline in het cultuurmedium bleek echter wel de embryonale kapselvorming te
stimuleren.
HOOFDSTUK 7 bestaat uit een algemene discussie, gevolgd door de conclusies van deze thesis:
In een eerste deel van de thesis werd de procedure voor de in vitro productie van
paardenembryo’s geoptimaliseerd.
1. De IVP van paardenembryo’s werd in ons laboratorium ingevoerd. Na een initiële
periode van conventionele ICSI werd piëzo-geassisteerde ICSI geïntroduceerd en
vergeleken met laser-geassisteerde ICSI. Beide apparaten hadden specifieke voor- en
nadelen, maar geen groot effect op de daaropvolgende embryonale ontwikkeling werd
vastgesteld.
2. De leefbaarheid van de IVP paardenblastocysten werd bewezen door succesvolle
embryotransplantatie die resulteerde in de geboorte van het eerste ICSI-veulen van de
Benelux.
De conclusies op basis van het onderzoek in het tweede deel van deze thesis zijn:
3. Een methode voor betrouwbare bepaling van genexpressie bij paardenblastocysten
werd op punt gesteld door middel van de optimalisatie van het protocol voor RT-qPCR
en door de bepaling van de stabielste referentiegenen voor datanormalisatie. Het
geometrisch gemiddelde van ACTB, UBC, RPL32 en GAPDH wordt aanbevolen als
normalisatiefactor voor RT-qPCR van in vivo en in vitro geproduceerde
paardenblastocysten.
4. Opregulatie van genen in in vivo geproduceerde paardenblastocysten, in vergelijking
met in vitro geproduceerde paardenblastocysten, werd bepaald met SSH. In totaal
werden 62 genen geïdentificeerd, die een belangrijke betrokkenheid bij eiwitsynthese
![Page 173: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/173.jpg)
Samenvatting
167
en energiemetabolisme vertonen. De differentiële expressie werd bevestigd door RT-
qPCR voor vijf van de zes belangrijke ontwikkelingsgenen, namelijk BEX2, FABP3,
HSP90AA1, MOBKL3 en ODC.
5. De voortijdige transplantatie naar de baarmoeder van IVP gedeelde paardenembryo’s
ondersteunde de verdere embryonale ontwikkeling niet.
6. De toevoeging van recombinant uterocaline aan het embryocultuurmedium op dag 6
stimuleerde de kapselvorming bij IVP paardenblastocysten, maar had geen invloed op
de embryonale ontwikkeling of op de expressie van de onderzochte genen.
![Page 174: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/174.jpg)
![Page 175: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/175.jpg)
169
DANKWOORD/ACKNOWLEDGEMENTS
Een woord van dank begint bij het begin. Mijn ouders nemen dan ook de eerste plaats in. Papa, mama, jullie hebben me steeds alle kansen gegeven om mijn eigen weg te zoeken, Me laten kiezen tussen mensen en dieren, tussen kleine en grote, tussen praktijk en onderzoeken. Enkel bij die laatste keuze heb ik enige beïnvloeding ervaren, toen ik zei: ‘Die voorgestelde onderwerpen boeien me niet zo, doctoreren is wellicht niet echt iets voor mij. Ik wil iets met paarden, iets klinisch en tof.’ ‘Wel,’ zei mijn papa, ‘neem dan zelf het initiatief en schrijf naar je prof.’ Professor de Kruif, toen kwam ik bij u aankloppen. U kwam met het meest fantastische onderwerp op de proppen. ‘IVF bij het paard, wat is je gedacht?’ ‘Prima voor mij!’ en zo werd ik aangenomen op de DI08. Ik begin mijn professionele bedanking nu ongegeneerd met een man, maar de meeste dank ben ik verschuldigd aan mijn promotor, Ann. Bedankt om zo in het paardenonderzoek te geloven. Na 2 jaar geploeter, kwam mijn kopje toch boven. Bedankt voor het enthousiasme, de ideeën en contacten, Bedankt voor de steun als de moed even zakte. Mijn co-promotor, professor Peelman, Luc, uw genetische inbreng werd zeer geapprecieerd. Bedankt voor uw hulp, ik heb op genetica veel geleerd. Karen, zonder jou was ik er nooit geraakt. Jij hebt mijn onzichtbare pellets en mijn real time-initiatie meegemaakt. Was het een labotechniek, een genetisch programma of een reviewer-commentaar, Vier jaar lang stond je altijd voor mij klaar. I would also like to express my gratitude towards the members of the examination committee. Prof. Stout, Prof. Deleuze, Prof. Martens, Dr. Palmer, Dr. Daels, thank you for improving my PhD. A special thanks goes to Prof. Galli, Silvia Colleoni and the rest of the wonderful Avantea crew. Prof. Betteridge, Prof. Kennedy, Aline et Thomas de Cryozootech, it was very nice to collaborate with you. Home sweet home, daarom een dikke merci aan mijn bureaugenoten, Catharina, Maarten en Jan, Bedankt voor de opleiding in de kliniek, jullie kunnen er wat van! Bedankt ook om mij zo veel tijd te geven voor mijn onderzoek en mijn doctoraat. Ik vind het jammer dat ik jullie niet meer heb kunnen teruggeven, nu ik jullie al verlaat. Jan, heel veel succes met de eicellen en met de dvd! Catharina, ik zal de vrouwengesprekken missen tussen ons twee. Maarten, nog een extra merci voor mijn kaft, en ik weet Dat jij dagelijks de kleur van mijn bh zal raden, ook al zit ik aan de andere kant van de planeet. Op onze rommelige bureau (bedankt om hier af en toe orde te scheppen, Nicole en co) voelde ik me prima thuis, Al werd die op tijd en stond ingeruild voor een etentje of een sangria in het Middenstandshuis.
![Page 176: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/176.jpg)
170
Ook de andere collega’s van paard, bedankt voor de merrie-opvolging, Katrien, Emilie en Kim, en voor jullie deelname aan de embryoverzameling. De nieuwere generatie staat alweer klaar, Hilde, Sarah en Bart, zorg goed voor het paardenteam en voor elkaar. Verder werd de samenwerking met de grote embryotransfercentra in de buurt geapprecieerd Een woord van dank is dan ook voor Diergaerdhof, Keros en Hof ter Leeuwe gereserveerd. Initieel was ik de enige paardentrut in het IVF-labo, Naast Leen, Mirjan, Mohamed en Mohammad van rund, Muriel en Tom met de kleine en voor de varkens Josine en Jo. Eline, aan jou kon ik mijn mensenvragen stellen. Bedankt allemaal voor de hulp en de multi-species tips. En Muriel, Jo en Mirjan (en natuurlijk ook leider Philippe), merci voor de gezellige ski-trips! Isabel en Petra, jullie hebben me in alle staten gezien. Kwaad als mijn tijdsschema eraan ging omdat ik iets niet vond, ronddansend bij het vinden van een blastocyst of tien! Bedankt voor de lange en trouwe hulp van jullie zijde. Het IVF-labo heeft geluk met jullie beiden. Ook hartelijk dank aan de mensen van het IVF-labo van het UZ in Gent. Ik ben meer dan eens voor ICSI-pipetjes naar daar gerend. Het slachthuis in Rekkem mag ik ook niet vergeten. Ik heb quasi al hun paardeneierstokken gekregen, hoewel ik waarschijnlijk nooit een paard zal eten. De nachtelijke keizersnedes heb ik eigenlijk altijd graag gedaan, Al moest ik soms toch dringend een wacht ruilen om naar de zee te gaan. Gelukkig had ik super collega’s met wie dat omruilen vlot ging. Bedankt Davy, Miel, Sebastiaan, Alfonso, Vanessa, Josine, Hilde, Cyriel, Ellen en Liesbeth voor jullie respect voor mijn surfverslaving. Sebastiaan, je bent intussen een echte zakenman die kalkoenen promoot, Rijzig, sereen en lankmoedig worden kleine jongens groot. De vele andere collega’s van verloskunde, evenals de collega’s van weleer, Wil ik ook bedanken voor hun hulp en voor de aangename sfeer. Willy, Dirk, Wilfried, Marnik en Véronique, bedankt om de proefmerries en mijn Smicsi’tje zo goed te soigneren. Bedankt ook Els, Ria, Leïla, Sandra en tante Nadine; Steven en Miel, van jullie kan ik nog veel computergeheimen leren. Mijn 2de vakgroep bevond zich aan de overkant. UNO en ijsjes, het was daar plezant! Verder heb ik ook hulp gehad van Kelly en Jip voor de dot blot en van Prof. De Graaf en Marleen Brunain voor de uterocalineconcentratie, Evenals van Prof. Vandesompele voor mijn genetische statistiek en van Dries voor de microscopie-evaluatie.
![Page 177: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/177.jpg)
171
‘Of all the things which wisdom provides to make us entirely happy, much the greatest is the possession of friendship’ zei Epicurus zo goed. Het zijn mijn familieleden en vrienden aan wie ik een diepe dankbaarheid richten moet. Mama en papa, jullie heb ik in het begin al vermeld. Het is dan ook een ‘dank u’ die dubbel telt. Ines, mijn allerliefste zus, aan u kan ik al mijn avonturen vertellen, We zullen onze paardrijritjes tijdelijk moeten vervangen door Skypegewijs bellen. Wouter en Margo, jullie hebben steeds een vrolijke aanhang mee, Als ik terugkom van Aruba, is ons Lennertje al twee. Oma, bomama en bonpapa, zo’n fiere grootouders hebben, doet me veel plezier. Het rijmseltje is dan ook speciaal voor jullie vertier. Pascale, wij hebben samen het doctoraatsleven gedeeld, Samen gestudeerd, gereisd, gewoond, gefeest, en ons alleszins zelden verveeld. Katrien en Charlotte, jullie hebben me een prima studententijd gegeven. Nele, Sabine en Karen, jullie zijn ook vriendinnen voor het leven. Alle andere vrienden die mijn leven kleur geven opsommen, daar ga ik niet toe geraken. Voor mijn surfmaatjes zal ik nog even een uitzondering maken. Geen betere compensatie voor een overdosis wetenschap dan een lekkere zuid-west. Stein, Pieter, Seppe, Sven,… jullie begrijpen dit als geen ander, merci voor de zalige tijden op ‘t water, you’re the best! Bedankt allemaal, ik ga jullie missen!
![Page 178: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/178.jpg)
![Page 179: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/179.jpg)
173
CURRICULUM VITAE Katrien Smits werd geboren op 11 april 1982 te Zoersel. Na het behalen van het diploma hoger
secundair onderwijs aan het Sint-Jan Berchmanscollege (Latijn-Wetenschappen) te Westmalle,
begon zij in 2000 met de studie Diergeneeskunde aan de Universiteit Gent. In 2006 behaalde ze
het diploma van dierenarts (optie Paard) met grote onderscheiding.
Op 1 oktober 2006 trad ze in dienst van de Vakgroep Voortplanting, Verloskunde en
Bedrijfsdiergeneeskunde als doctoraatsbursaal (BOF). Daar verrichtte ze onderzoek naar de
ontwikkeling en genexpressie van in vitro geproduceerde paardenembryo’s. Naast haar
onderzoek was Katrien Smits ook werkzaam in de kliniek verloskunde, waar ze participeerde in
de nacht- en weekenddiensten.
Katrien Smits is auteur of mede-auteur van verschillende publicaties in internationale en
nationale wetenschappelijke tijdschriften en nam actief deel aan diverse internationale en
nationale congressen.
![Page 180: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/180.jpg)
![Page 181: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/181.jpg)
175
BIBLIOGRAPHY
PUBLICATIONS
Govaere J., Hoogewijs M., De Schauwer C., Van Zeveren A., Smits K., Cornillie P., de Kruif A.
2009. An abortion of monozygotic twins in a warmblood mare. Reprod Domest Anim 44 852-
854.
Govaere J., Maes S., Saey V., Hoogewijs M., De Schauwer C., Smits K., Roels K., Vercauteren G.,
de Kruif A. 2010. Uterine fibrosarcoma in a Warmblood mare. Reprod Domest Anim in press.
Hoogewijs M., De Vliegher S., De Schauwer C., Govaere J., Smits K., Hoflack G.G., de Kruif A.,
Van Soom A. 2010. Validation and usefulness of the Sperm Quality Analyzer V equine for equine
semen analysis. Theriogenology in press.
Moyaert H., Decostere A., Pasmans F., Baele M., Ceelen L., Smits K., Ducatelle R., Haesebrouck
F. 2007. Acute in vivo interactions of Helicobacter equorum with its equine host. Equine Vet J 39
370-372.
Smits K., Goossens K., Van Soom A., Govaere J., Hoogewijs M., Vanhaesebrouck E., Galli C.,
Colleoni S., Vandesompele J., Peelman L. 2009. Selection of reference genes for quantitative
real-time PCR in equine in vivo and fresh and frozen-thawed in vitro blastocysts. BMC Res Notes
Smits K., Govaere J., Hoogewijs M., De Schauwer C., Van Haesebrouck E., Van Poucke M., van
den Berg M., Vullers T., Van Soom A. 2010. Birth of the First ICSI Foal in the Benelux. Vlaams
Diergeneesk Tijdschr 79 134-138.
2 246.
Smits K., Goossens K., Van Soom A., Govaere J., Hoogewijs M., Vandesompele J., Peelman L.J.
2010. In vivo derived horse blastocysts show upregulation of developmentally important genes
compared to in vitro produced horse blastocysts. Reprod Fertil Dev in press.
![Page 182: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/182.jpg)
176
Smits K., Govaere J., Peelman L.J., Goossens K., de Graaf D.C., Vercauteren D., Vandaele L.,
Hoogewijs M., Stout T., Van Soom A. 2010c. Influence of the uterine environment on the
development of equine in vitro embryos. Reproduction submitted.
Smits K., Govaere J., Hoogewijs M., Piepers S., Van Soom A. 2010. A different approach to the in
vitro production of horse embryos: a pilot study of laser-assisted versus piezo drill ICSI. Reprod
Domest Anim submitted.
Vanhaesebrouck E., Govaere J., Smits K., Durie I., Vercauteren G., Martens A., Schauvliege S.,
Ducatelle R., Hoogewijs M., De Schauwer C., De Kruif A. 2010. Ovarian teratoma in the mare: a
review and two cases. Vlaams Diergeneesk Tijdschr 79 32-41.
ORAL PRESENTATIONS AND POSTERS AT NATIONAL AND INTERNATIONAL CONFERENCES
Smits K., De Graaf D., Lemahieu I., Van Damme P., Piepers S., Peelman L., Van Soom A. 2008.
Influence of uterocalin on bovine in vitro blastocyst rate: a preliminary trial. FNRS meeting,
Mons, Belgium.
Smits K., Goossens K., Van Poucke M., Peelman L., Van Soom A. 2008. Optimization of standard
operating procedure for quantitative real-time PCR in equine embryos. Benelux qPCR
symposium, Ghent, Belgium.
Smits K., Goossens K., Van Soom A., Peelman L. 2009. Selection of reference genes for
quantitative real-time PCR in equine in vivo derived and in vitro produced blastocysts. Fertility
2009 Conference, Edinburgh, Scotland.
Smits K., Goossens K., Van Soom A., Peelman L. 2009. Identification of differentially expressed
genes in in vivo versus in vitro equine blastocysts by suppression subtractive hybridization
(SSH). ESDAR, Ghent, Belgium.
Smits K., Govaere J. Van Soom A. 2009. Intra-uterine transfer of equine cleaved embryos. COST
meeting, Alghero, Italy.
![Page 183: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/183.jpg)
177
Smits K., Goossens K., Van Soom A., Peelman L. 2010. Differential gene expression in in vivo
derived versus in vitro produced equine blastocysts as determined by RT-qPCR. IETS, Cordoba,
Argentina.
![Page 184: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/184.jpg)
![Page 185: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/185.jpg)
179
ADDENDUM 1 PROTOCOL IN VITRO PRODUCTION
EQUINE EMBRYOS Based on Galli et al., 2007; Lagutina et al., 2005
MEDIA
- Flush medium
o DPBS, 50 µg/ml BSA, 25 IU/ml heparin
- Dissection medium
o HEPES buffered TCM199, 1 mg/ml bovine serum albumin (BSA), 1 mg/ml
polyvinyl alcohol (PVA), 10 µg/ml heparin, 50 µg/ml gentamicin
o pH: 7.45; 280 mosm
- Maturation medium
o DMEM-F12, 10% (v:v) serum replacement, 50 ng/ml epidermal growth factor, 10
µg/ml pFSH, 2 µg/ml pLH, 0.1 µg/ml cystine, 50 ng/ml cysteamine, 0.5 µl/ml
lactic acid, 0.1 µg/ml glutamine, 0.075 µg/ml ascorbic acid, 25 ng/ml PVA, 5
ng/ml myoinositol, 1 mM sodium pyruvate, 1 µl/ml insulin transferring sodium
selenite, 50 µg/ml gentamicin
o For DMEM-F12: pH:7.43; 286 mosm
- SOF-IVF
o Synthetic oviductal fluid, no glucose, 1µg/ml heparin
o pH: 7.45; 280 mosm
- Ca++free TALP
o pH: 7.4; 280 mosm
- H-SOF
o HEPES-buffered synthetic oviductal fluid
o pH: 7.38; 275 mosm
- Culture medium
o DMEM-F12, 10% fetal calf serum
![Page 186: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/186.jpg)
180
o For DMEM-F12: pH:7.43; 286 mosm
OOCYTE COLLECTION
- Preparations before going to the slaughterhouse:
o Put 3l of sterile NaCl-solution in the heating bath (38°C)
o Media
Prepare flush medium and keep at room temperature
Put dissection medium in the incubator without CO2
Prepare maturation medium and put 500 µl of it in each well of a 4-well-
plate. Put the 4-well plate in the incubator with 5% CO2. The remaining
medium is also placed in the incubator with unscrewed lid.
- Collection ovaries at slaughterhouse
- Transport: 1 hour, ambient temperature, isolated box
- Removal adherent tissues
- Ovaries rinsed twice in sterile NaCl-solution (38°C)
- Ovaries kept in clean sterile NaCl-soution (38°C) on heated surface (37°C) during further
procedure
- Aspiration of follicle fluid into sterile recipient with 16-G needle connected to vacuum
pump and flushing of the follicles with flush medium, using a 20ml-syringe with 18-G
needle
- Recipient with follicle fluid on heated surface (37°C) during entire procedure
- 10 ml of follicle fluid from the bottom of the recipient is pipetted into large Petri dish
and evaluated under stereomicroscope
- Oocytes collected in dissection medium; only oocytes with at least 3 layers of cumulus
cells
- Last 2 steps are repeated until no more oocytes are found
- Oocytes washed twice in dissection medium
![Page 187: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/187.jpg)
181
MATURATION
- Maturation medium
- Wash oocytes in first 3 wells of maturation medium
- 20-50 oocytes / 500 µl medium
- 24 h-28h
- 5% CO2
- 38.5 °C
ICSI
Preparation sperm
- Put Percoll 90% and Ca++free TALP at room temperature 1h before preparing sperm
- Thaw SOF-IVF at room temperature, vortex and leave in incubator at 38.5°C
- Preparation Percoll discontinuous density gradient (45% over 90%)
o 2 ml of Percoll 90% in tube A
o 1.5 ml of Percoll 90% mixed with 1.5 ml of Ca++free TALP in tube B
o 2 ml of 45% solution of tube B is gently pipetted on top of the 2 ml of 90%
Percoll in tube A
- Thawing sperm 1h before ICSI in 26°C H2O
- Sperm is gently put on top of Percoll gradient with 20-G needle on 1 ml syringe
- Centrifugation
o 750 x g = 2041 t/min
o 40 min
o 26°C
- Removal supernatans
- Resuspension sperm pellet in 5 ml of Ca++free TALP
- Centrifugation
o 400 x g = 1490 t/min
o 10 min
![Page 188: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/188.jpg)
182
o 26°C
- Removal supernatans
- Resuspension sperm pellet in 0.3 ml of SOF-IVF
- Just before ICSI: little bit of sperm solution is pipetted on left bottom side of drop of 9%
polyvinylpyrrolidone (PVP)
Preparation oocytes
- Decumulation
o Plate with 2 droplets of 45 µl hyaluronidase (1µg/ml) and 10 droplets of H-SOF
under mineral oil
o In hyaluronidase (1µg/ml)
3 min
Partial denudation with 170 µm pipette
o In H-SOF
Denudation by gently pipetting with 130µm pipette
MII and MI are separated
- Maturation medium
o MII oocytes and MI oocytes in separate droplets of 50 µl of maturation medium
under mineral oil at 38.5°C and 5% CO2 until ICSI
Time scheme preparation ICSI
- 4 h before ICSI: Thaw culture medium at RT, make a 4-well with 20µl
droplets under mineral oil
Make a 4-well with 50 µl droplets of maturation medium
under mineral oil for denuded oocytes
- 2.5 h before ICSI: take out Percoll, Ca++free TALP and SOF-IVF
- 1.5 h prepare plates
![Page 189: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/189.jpg)
183
o 2 decumulation plates: plate with 2 droplets of 45 µl of
hyaluronidase and 10 droplets of 45 µl of H-SOF under
mineral oil
o 2 ICSI plates: plate with 13 droplets of 5 µl of H-SOF under
mineral oil
- 1 h Prepare sperm
- 50 min 1st centrifugation
Denudation oocytes
- 10 min 2nd centrifugation
Preparation microscope and micromanipulation
ICSI
- Preparation plate
o 1 blue droplet of H-SOF is replaced by 9% PVP
o Orange droplets are numbered and +/- 10 oocytes are divided over numbered
droplets (MII oocytes first)
o Sperm is pipetted on left bottom site of PVP-droplet
o The 3 steps are repeated until all mature oocytes are injected
- ICSI
o Heated plate
o Olympus inverted microscope
o Narishige micromanipulation
o Injection of 10 oocytes takes about half an hour
![Page 190: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/190.jpg)
184
o Injected oocytes: culture medium at 38.5 °C and 5% CO2 until all oocytes are
injected
CULTURE
- Culture medium
- Prepare 4-well plate with 20 µl droplets under mineral oil
- Put in the CO2incubator for at least two hours to equilibrate
- 10-20 embryos/20µl-droplet
- 5% CO2, 5% O2, 90 % N2: Put the plates in a turtle, let the gas mix flow through the turtle
during 2 minutes and then close the turtle thoroughly
- 38.5 °C
- Day 2,5:
o Change ½ of medium by adding culture medium
o Only cleaved embryos are kept
- Day 6: Change ½ of medium
- Day 8-9: Evaluation embryos
![Page 191: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/191.jpg)
185
ADDENDUM 2 SUPPRESSION SUBTRACTIVE
HYBRIDIZATION (SSH)
This scheme represents the principle of suppression subtractive hybridization, based on
Diatchenko et al., (1996). The tester cDNA is subdivided into two portions, and each is ligated
with a different adaptor. The SSH involves two hybridizations. In the first one, an excess of
driver cDNA is added to each tester sample. The samples are denatured and allowed to anneal,
generating the type a, b, c and d molecules in each sample. In the second hybridization, the two
samples from the first hybridization are mixed together without prior denaturation, again with
an excess of driver cDNA. Only the remaining equalized and subtracted ss tester cDNAs can
reassociate and form new type e hybrids. After the ends are filled in, the type e molecules have
![Page 192: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/192.jpg)
186
two different primer annealing sites. Subsequently, all molecules are subjected to PCR to
amplify the desired differentially expressed sequences. Type a and d molecules lack primer
annealing sites and can not amplify during the PCR. Most type b molecules form a ‘pan-like’
structure. This suppression effect prevents amplification of the type b molecules. Type c
molecules, having only one primer annealing site, amplify linearly. Only the type e molecules,
representing the differentially expressed sequences, have two different adaptors and can
amplify exponentially. Finally, a second PCR is performed to further reduce background and
enrich the differentially expressed tester specific sequences.
![Page 193: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/193.jpg)
187
ADDENDUM 3 REVERSE TRANSCRIPTION QUANTITATIVE POLYMERASE CHAIN REACTION (RT-QPCR)
Figure 1 qPCR. This scheme represents the PCR reaction, using SYBR Green for quantification.
The 3 PCR steps, denaturation, primer annealing and elongation, are repeated in a cyclical
pattern. This results in exponential amplification of the target sequence. Binding of SYBR Green
to the double stranded DNA results in fluorescence, which is measured during each cycle of the
qPCR.
![Page 194: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/194.jpg)
188
When working with RNA, the RNA strand is first transcribed into complementary DNA (cDNA),
using the enzyme reverse transcriptase (RT). The cDNA can be amplified by means of the
polymerase chain reaction (PCR) (Peake et al., 1989; Mullis, 1990). The PCR cycle consists of 3
different steps. Firstly, DNA denaturation is caused by heating to 95°C. The second step involves
the annealing of primers, specifically developed for the region of interest. In third instance, the
complementary strands are synthesized, using a thermostable DNA polymerase enzyme.
Cyclical repeat of this process results in exponential amplification of the region between the
two target specific primers.
Reverse transcription quantitative PCR (RT-qPCR) is based upon this PCR reaction (Morrison et
al., 1998; Bustin, 2000; for review see Van Guilder et al., 2008). Not only can specific sequences
be detected and amplified, qPCR also allows quantification of the genetic material in the initial
samples. Quantification can be achieved through different methods. In this thesis, a DNA
binding fluorescent dye, namely SYBR Green, was used (Figure 1). Unbound dye exhibits little
fluorescence. Binding to double stranded DNA, makes the dye fluoresce. During qPCR, this
fluorescence is measured during the elongation step of each cycle. The sample fluorescence is
plotted against the qPCR cycle (Figure 2). For each sample, the quantification cycle (cq) value is
determined. This is the point where the sample fluorescence exceeds the background
fluorescence, as represented by the threshold line. A lower cq value means that the threshold
fluorescence is achieved in few cycles, so that the original sample contained a large number of
copies of the target sequence. Vice versa, a high cq value equals many cycles needed to reach
the threshold, representing little material in the initial sample. A difference of 3.3 cq reflects a
10-fold difference in the original template.
![Page 195: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/195.jpg)
189
Figure 2 qPCR amplification graph. Sample fluorescence is measured during each cycle and
plotted against the qPCR cycle. Five samples were evaluated. The orange line represents the
threshold line. Lower levels of fluorescence are considered as background. The quantification
cycle (cq) value represents the point where the sample fluorescence exceeds this threshold line,
for example around 17 for the green sample.
![Page 196: EQUINE EMBRYOS PRODUCED IN VITRO HOW MUCH · PDF filereported equine pregnancy produced by artificial insemination ... both of these techniques, early embryonic development occurs](https://reader031.vdocuments.us/reader031/viewer/2022030422/5aa9f2927f8b9a77188d82ab/html5/thumbnails/196.jpg)