8/2/2019 Enhancers

1/11

Cell, Vol. 58, 767-777, August 25, 1989, Copyright 0 1989 by Cell Press

An Enhancer Stimulates Transcription in TransWhen Attached to the Promotervia a Protein BridgeHans-Peter Muher, Jose M. Sogo,tand Waiter Schaffner* lnstitut fur Molekularbiologie II der Univers itat ZurichHiinggerbergCH-8093 ZurichSwitzerlandtlnstitut fur ZellbiologieETH ZurichHdnggerbergCH-8093 ZurichSwitzerland

Two principal models have been invoked to explaintranscriptional stimulation of RN A polymerase II genesby enhancers/up stream promoter elements : in one,upstream regulatory sequences directly interact withproximal promoter elements via proteins bound to theDNA (looping model); in the other, R NA polymeraseII (or a transcription factor) binds to distal sequen cesand then sc ans along the D NA until it reaches the pro-moter (scanning or Entry site model). So far, it hasbeen reported that enhancers or upstream promoterelements transm it their effect on a gene only via cova-lently closed DN A, i.e., in a cia configuration. Thelooping model predic ts, however, that the effec t canbe transm itted also in certain trans con figurations.Here we demons trate that an enhancer from SV40 orcytome galovirus can stimulate trans cription in vitroeven when noncovalently attached to the Pglobin pro-moter via the proteins atreptavidin or avidin. Thesefindings are consist ent with the looping model ratherthan the scanning model. In addition, stimulation oftranscription in frana, as shown by our experime nts,may be found in nature in phenomena such a s trana-vection, where one chromosome affects gene expres-sion in the paired homolog.IntroductionEnhancers stimulate transcription of nearby genes in anorientation-independent manner and act, at least in vivo,relatively independently of their distance from the initia-tion site (Banerji et al., 1981; Moreau et al., 1981). Thisstimulation is associated with an increased density ofRN A polymerase II on a linked gene (Weber and Schaff-ner, 1985; Treisman and Maniatis, 1985). Enhancers andupstream promoter sequences can physically and func-tionally overlap and are typically compo sed of a variety ofsequence motif s (modules, elements) that bind differenttranscription factors (reviewed in Serfling et al., 1985;Maniatis et al., 1987; Miller et al., 1988). In many case sthe individual module can, when multiplied, also act as anenhancer (Veldman et al., 1985; Schirm et al., 1987; On-dek et al., 1987; Pierce et al., 1988). This suggests that

many proteins binding to enhancers or distal promoterelements act via a common mechanism, involving, for ex-ample, negatively charged residues in the protein domainthat activat es transcription (Hope and Struhl, 1988; Maand Ptashne, 1987; reviewed in Ptashne, 1988).

Many models for the mechanism of enhancer actionhave been discussed (Moreau et al., 1981; Serfling et al.,1985; Picard, 1985; Courey et al., 1986; Plon and Wang ,1986; Ptashne, 19 86; Gasser and Laemm li, 1987; Maniatiset al., 1987; Schleif, 1987; Miiller et al., 1988). The en-hancer e ffect on transcription can be reproduced in ex-tracts of mam malian cells in the absence of chroma tin, al-beit with a more pronounced distance effec t than in vivo(Sassone-Corsi et al., 1984; Sergeant et al., 1984; Wilde-man et al., 1984; Schdler and Gruss, 1985; Westin et al.,1987; Hai et al., 1988). Both in vivo and in vitro, transcrip-tion factors bound to enhancers/ups tream promoter ele-ments are thought to interact with RNA polymerase IIand/or other fac tors such as the TAT A box factor, in orderto promote transcription (Hai et al., 1988; Horikoshi et al.,1988; Allison and Ingles, 1989; Brandle and Struhl, 1989).There are two principal models for this interaction, eachof which can explain some o f the experimental findings.

The first model proposed was the scanning, or entrysite, model. Enhancers or upstream promoter elem entsare postulated to have a high affinity for RN A polymeraseII (or a transcription factor), which after binding slides ineither direction along the DNA until it reaches proximalpromoter elements and facilitates the formation of a tran-scription initiation complex (Moreau et al., 1981). Supportfor th is model cam e from experiments in yeast, where i twas shown that the bacterial LexA operator/repressor ora transcription terminator element strongly reduced tran-scription when inserted betw een the upstream activatorsequence UASo and the TATA box (Brent and Ptashne,1984). Experimen ts with enhancers and tandem pro-moters in mammalian cel ls have shown in some cases ,but not in all, a preferential activation of the closer pro-moter, which would support the scanning model (reviewedin Miiller et al., 1988).

The basic concept of the second principal model, thelooping model, is that initiation of transcription is facili-tated by the interaction of enhancers/ups tream promoterelements with proximal promoter elements via proteinsbound to the DNA. The DN A between them is therebylooped out. DN A looping has been described in prokary-otes in several case s, including cooperative repressorbinding over a distance, site-s pecific recombination, andreplication (Dunn et al., 1984; Hochs child and Ptashne,1986; Griffith et al., 1986; Kram er et al., 1987; Mukherjeeet al., 1988; reviewed in Ptashne, 1986; Gellert and Nas h,1987; Schleif, 1988; Wang and Giaever, 1988; Gralla,1989). There is also some evidence for DNA looping in eu-karyot es, where cooperative action or binding o f transcrip-tion factors over a distance has been observed (Thevenyet al., 1987; Schijle et al., 1988; Cohen and Mese lson,1988; Schiile et al., 1989). How ever, there is less evidence

8/2/2019 Enhancers

2/11

Ce l l76 6

cut with Xho If i l l in w i thbiotinylatednucleotides (0) 1

avidin orstreptavidin (X)1

for the involveme nt of looping in the interaction of proteinsbinding to enhancers/ups tream promoter elements withgeneral transcription factors (e.g., the TATA box factor). Itwas reported that addition of an odd number of half-helicalturns between the SV40 early promoter upstream ele-men ts and the TATA box reduced the level of transcription(Takahashi et al., 1988) which could im ply cooperativefactor binding and looping out of the intervening DN A.How ever, this experiment addressed only short-range in-teractions (inserts of at mos t 30 bp). Furthermore, half-helical turn inserts do not always affe ct eukaryotic tran-scription efficiency (Chodosh et al., 1987; Wirth et al.,1987; Ruden et al., 1988; Wu and Berk, 1988; l? Matth ias,F! Kijnzler, and W. Schaffner, unpublished data). The latterfinding does not exclude looping, since some transcrip-tion factors m ight be more flexible and therefore less dis-turbed by half-helical turn inserts than others, as dis-cusse d by Ruden et al. (1988). No data published so farrule out either the scanning or the looping model.

The looping model predicts that enhancers/ups treampromoter elements are also able to stimulate transcriptionof a gene in some c onfigurations where they are not cova-lently linked to the gene. We have addressed this questionwith the experimental approach described in Figure 1. In-deed, we show that the SV40 enhancer or the cytomeg alo-virus (CMV) enhancer can stimulate in vitro transcriptionof the rabbit 8-globin gene, e ven when linked to its pro-moter via the proteins streptavidin or avidin. O ur findingsare thus con sistent with the looping model for the actionof enhancers/upstream promoter elements.

Figure 1. Experimental Approach(A) The SV40 enhancer or the CMV enhancer stimulates transcriptionfrom the rabbit 6-globin promoter via covalently closed DN A (top).When the plasmid is l inearized at the Xhol s ite and biotinylated, theenhancer can no longer stimu late transcription in vitro, since it is nowseparated by several kilobase s from the transcription initi ation site(middle ). Enhancer and promoter are brought together in close prox-imity, s imilar to the situation shown at the top, but noncovalently l inkedvia the protein streptavidin or avidin. This is sufficient for the transmis-sion of the stimulatory effect of each enhancer (bottom).(B) The SV40 enhancer or the CMV enhancer can be located on adifferent DNA fragment and sti l l stimulate transcription from the6-glob in promoter, as long as the two fragments are linked via strep-tavid in or avid in.(C) A possible alignment of enhancer and promoter, which are linkedvia streptavid in or avid in, according to the looping model.

Streptavidin or Avidin Efficiently RecircularizeslConcatemerizes Biotinylated DNAThe proteins streptavidin (isolated from the bacteriumStreptom yces avidinii) and avidin (isolated from eggwhite) both form very strong and specific noncovalentcomp lexes with the vitamin biotin (Ko = 10-15; reviewedby Argarana et al., 1988). Several groups have shown thatstreptavidin and avidin can bind efficiently to DNA labeledwith dUTP-ll-biotin (for review see Theveny and Rev et,1987). Because streptavidin and avidin consist of fouridentical subunits and can bind four molecules of biotin,they were ex pected to be useful too ls to link biotinylatedDN A ends via a non-DNA bridge in order to study themech anism of the transcriptional stimulation by en-hancers and upstream promoter elements (sum marizedin Figure 1).

The construc ts described in Figure 2 were linearizedwith Xhol or Sall (between enhancer and promoter) andfilled in with Klenow polymerase using dUTP-11-biotin in-stead of dTTP They were then incubated with differentamoun ts of streptavidin or avidin and analyzed by agarosegel electrophoresis and electron mic roscop y. F igure 3show s an agarose gel from such an experiment with strep-tavidin. The plasmids were incubated without (Figure 3,lane l), with an equimolar amount (lane 2), or with a 450-fold molar exce ss of streptavidin (lane 3). The pattern ob-served in lane 2 is similar to that obtained by ligation ofa linear plasmid with T4 DN A ligase (not shown). In Figure

8/2/2019 Enhancers

3/11

An Enhancer Can Stimulate Transcription in Trans76 9

SV243fj

-198 -175 SV198fl

sv133p

-425 ~1" Barn HI

Xba I

5?- rabbit DNA SV40 enhancerFigure 2. Schematic Representation of the Rabbit l3-Globin C on-structsConstructs with the SV40 enhancer at d ifferent positions upstream ofthe rabbit @globin gene are shown (S V243b. SV1988, SV13 3B, SV77p).The corresponding enhancerless constructs with the Xho l site at thesame positions are not shown (243!3, 198l3 , 1338, 778). Constructs 778and SV77 b bear a Sail s ite at position -38, just upstream of the TATAbox. In addition, a construct was made that contains the CMV en-hancer instead of the SV40 enhancer at position -133 upstream of theinit iation site(CMV133b; not shown). The black boxes indicate b-globinpromoter eleme nts (Dierks et al., 1983).

3, lane 3, only one band is seen and it migrates slightlymore slowly than the linear D NA in lane 1, as expected ifa streptavidin tetramer is bound at each end of the linearDNA . Consistent re8ults were obtained when the samesamp les were analyzed by electron m icroscop y (Table 1).Reaction 1, without strepta vidin, yielded 100% linear plas-mids, as expected. Most of the plasmids also remained aslinear monome rs (97.7%) after incubation with a 450-foldmolar excess of streptavidin. This is most l ikely a satura-tion effect, due to the binding of a streptavidin tetramer ateach end (reaction 3).

Many different form s of strepavidin-linked plasmidswere observed after incubation of the DNA with an equi-molar amount o f streptavidin (reaction 2): circular mono-mers (27.8% o f the total number of plasmids), which areseen as the prominent band in the agarose gel (Figure 3,lane 2); linear monom ers (9%); and linear and circularconcate mers (63.20/o), which appear as a number ofbands migrating more slowly in the agarose gel (Figure 3,lane 2). Some of these forms are shown in Figure 4. Al-though no protein-DNA cross-linking reagents such asglutaraldehyde were used, streptavidin molecules boundto the DNA ends were seen with most of the plasmids inreaction 2 (Figure 4) and reaction 3 (not shown). The link-ing of biotinylated DN A ends with avidin w as equally effi-

Ml 23

9421 , .~6558 i\_51504974 -=4271 .

Figure 3. Analysis of Streptavid in-DNA Complexes by Agarose GelElectrophoresisXhol-l inearized and biotinylated SV77p DNA was incubated with differ-ent amounts of streptavidin and subsequently analyzed by agarose g elelectrophoresis. Lane 1. no streptavid in. Lane 2. with an equimolaramou nt of streptavidin. Lane 3, with a 450-fold molar excess of strep-tavidm. Phage h DNA digested with EcoRl and Hindll l was used forsize markers (lane M). The forms expected for the three promi nentbands are indicated (+, b iotinylated DNA; 8, streptavid in tetramer).The numerous, more slowly migrating bands seen in lane 2 come fromplasmids complexed as linear and circular concatemers.

cient (not shown ), although at high concentrations avidinalso binds nonspecifically to DN A, most probably as a re-sult of its basic isoelec tric point (Green, 1975).The SV40 Enhancer Can Stimulate In VitroTranscription from the Rabbit P-Globin P romoterWhen Linked via Streptevidin or AvidinThe transcriptional activities of the cons tructs describedin Figure 2 were as sayed by in vitro transcription in severalindependent experiments using different nuclear extrac tsfrom BJA-B cel ls. Not all extracts gave the same extent oftranscriptional stimulation, but results within one experi-men t, and even between different e xperiments using thesame ex tract, were highly reproducible. In all the experi-men ts enhancer-containing cons tructs were tested in par-allel with the corresponding enhancerless cons tructs . Fig-ure 5A show s the result of such an experiment.

The enhancer effec t was the same for both the circularcons tructs (Figure 5A, compare lanes 1 and 2,7 and 8, 13and 14, 19 and 20) and the corresponding cons tructs lin-earized 2500 bp downstrea m at the Xbal site (not shown ).This wa s in agreement with results from earlier in vitrotranscription experiments (Sergeant et al., 1984; Wes tin etal., 1987). Unlike the situation in vivo, where an enhancercan activate transcription over a distance of a few kilobasepairs, in vitro there is a pronounced distance effec t (Ser-geant et al., 1984). Accordingly, the SV40 enhancer nolonger stimulated transcription in vitro when the con-struc ts were linearized (and biotinylated) at the Xhol sitebetween the enhancer and the P-globin promoter, sincethe enhancer was thereby removed several kilobasesfrom the promoter (Figure 5A, compare lanes 3 and 4, 9and 10, 15 and 16, 21 and 22). Stimulation of transcription

8/2/2019 Enhancers

4/11

Cell77 0

Table 1. Analysis of DNA-Streptavid in Complexes by Electron MicroscopyNumber of Complexes (%)

FormLinear monomerCircular monomerLinear d imerLinear tr imerCircular d imerCircular trimer4-, 5-, 6-, 7-merNon-analyzable aggregate9

Reaction 1386 (100)---

--

Reaction 289 (9.0)

276 (27.8)51 (10.3)26 (7.9)56 (11.2)

1 (0.3)64 (265)3 (5.0)

Reaction 3 * l554 (97.7)

1 (0.2)6 (2.1)-

---

Total number of p lasmids 368 992 567Xhol-l inearized and biotinylated SV776 DNA was incubated without streptavid in (*); with an equimolar amount of streptavid in (); or with a 450foldmolar excess of streptavidin ( l * ). Dimers, trimers and larger forms have been scored as units, inde pende nt of the number of plasmid s presentin each case. Numbers in parentheses represent the percentage of the total number of plasmids in each reaction.a A few aggregates could not be analyzed, because the exact number of concatemerized plasmids could not be determined. We estimated aboutlo-20 plasmids per aggregate; for the calculation we assumed one each of a 14-, 16-, and 20-mer.

by the enhancer could be rescued, howev er, when theXhol-cleaved and biotinylated const ructs w ere recircula-rizedlconcatemerized with equimolar amoun ts of strep-tavidin prior to in vitro transcription. This become s evidentby comparing the signals obtained with enhancerless andenhancer-containing recircularizedlconcatemerized con-struc ts (Figure 5A, compare lanes 5 and 6, 11 and 12, 17and 1 8, 23 and 24; Table 2). This su ggests that the SV40enhancer can stimulate transcription from the j3-globinpromoter even when linked via streptavidin.

The effect is not simply due to some unusual configura-tion of the SV40 enhancer, streptavidin, and the P-globinpromoter. Significant stimulation of transcription was ob-served with cons tructs bearing the SV40 enhancer atdifferent ups tream positions while the distance betweenthe enhancer and the site of biotinylation was kept con-stant (Figure 5A). The distance between the enhancer andthe biotinylated site was also varied: The 77p and SV776cons tructs w ere linearized and biotinylated just upstreamof the TATA box at the Sall site (-38), 39 bp from the en-hancer (instead of 23 bp as in the cons tructs biotinylatedat the Xhol site). Recircularizationlconcateme rization withstreptavidin again resulted in a stimulation of transcription(Figure 5B, lanes 25 and 26). Ho weve r, the level of tran-scription with these templates (with and without en-hancer) w as lower than with the corresponding covalentlyclosed plasmids (not shown ), mos t probably owing to thebound streptavidin, which might sterically hinder the TATAbox factor.

Both streptavidin and avidin (Figure 5 , lanes 33-38)could s erve as a protein bridge to transm it the stimulatoryeffec t of the SV40 enhancer, although the two proteinsstrongly differ in some biochemical properties (concern-ing isoelectric point [IEP] , amino acid compo sition, andcarbohydrate content). Unlike streptavidin, avidin is basic(IEP, = 10; IEP,,rep = 7) owing to its different aminoacid compo sition and is a glycoprotein (Chaiet and Wo lf,1964; Green, 1975; Argarana et al., 1986). We noted thatthe background level of transcription with streptavidin-linked enhancerless plasmids was elevated relative to the

background level with the same linear plasmid withoutstreptavidin (Figures 5A and 58, compare lanes 3 and 5,9 and 11, 15 and 17, 21 and 23, 29 and 31). By co ntrast,avidin did not produce any elevation, but rather produceda slight reduction, of the background level of transcriptionwhen i t was bound to the enhancerless constructs, asshown w ith the Xhol-linearized 133p plasmid (Figure 5,compare lanes 35 and 37,41 and 43,47 and 49). In all ourexperiments we compared enhancerless and enhancer-containing recircularized/concatemerized cons tructs tocorrect for effec ts of the protein bridge on the backgroundlevel of transcription.

The results described so far imply that an enhancer canstimulate transcription from a promoter even when non-covalently attached via streptavidin or avidin. Therefore itwas crucial to show that DN A ends linked via a proteinbridge are not covalently closed by some ligation activityin nuclear extrac t from BJA-B cells. Various cons tructs ,with or without s treptavidin, were incubated under in vitrotranscription conditions, with or without e xtrac t, and ana-lyzed by electron micros copy (Table 3). About 10% of the198f3 plasmids , which were linearized with Xbal (stick yends), were found to be ligated in the nuclear extrac t (Ta-ble 3, compare columns A and B). How ever, no ligationwas detectable in nuclear extrac t with biotinylated andtherefore blunt-ended linear SV77p DN A, irrespective ofwhether the DN A was incubated beforehand with strep-tavidin (Table 3, column s C-F).The CM V Enhancer Also Stimulates TranscriptionWhen Attac hed to the j3-Globin Promotervia Streptavidin or AvidinTo test the rather unlikely possibility that the above-described results represented some peculiar property ofthe SV40 enhancer, we also tested a const ruct containingthe CMV enhancer. The plasmids 1336 and CMV1336were linearized with Xhol, biotinylated, and recircula-rized/concatem erized with streptavidin or avidin. Therecircularized/concatemerized CM V enhancer-contain-ing plasmid also showed a higher level of transcription

8/2/2019 Enhancers

5/11

An Enhancer Can Stimu late Transcript ion in Tram77 1

Figure 4. Analysis o f Streptavidin-DNA Complexes by Electron MicroscopyXhol- l inearized and biot inylated SV7 76 DNA was incubated with an equim olar amou nt of streptavidin and subsequently analyzed by electron micros-copy. Monomeric (a, b) and mult imeric forms (c, d) were observed; 27.6% of the plasmids were circular monom ers (a), and 9% were l inear m onomers(b). The major ity of the plasmids (63.2%) were concatemerized. as for examp le the circular dimer (c) or the l inear tetramer (d). The arrows indicatestreptavidin tetramers. which were seen to be complexed with most of the plasmids.

than the corresponding recircularizedlconcatemerized Viral Enhancers Stimulate In Vi tro Transcr ipt ionenhancer less construct (Figure 58, compare lanes 31 and from the P-Globin Promoter Also When Located32 and lanes 43 and 44; and also Figure 5C, lanes 49 and on a Separate DNA Fragment50). Two di fferent exper iments showed that the SV40 and the

8/2/2019 Enhancers

6/11

Cel l77 2

A

90 um .i .,rw

67

B

131415161718 1920 2122 23 24I / I , 1fl, icttest

ref

CM P 45 46 47 48 49 50

::c rt I

76 Q* :67

51 52 53 54I 1 1- fl, ict

mnf~ test

ref

Figure 5. Quantitat ive Sl Mapp ing of Rabbit 6-Globin RNA Transcribed in Nuclear Extracts of SJA-B CellsVarious constructs with the SV40 enhancer or the CMV enhancer were tested in dif ferent nuclear extracts of SJA-6 cells, always together with thecorresponding enhancerless constructs. Not al l extracts gave the same stimulatory effects, but experiments with the same extract were highly repro-duc ib le .(A) Plasmids (with the SV40 enhancer at dif ferent upstream posit ions, as indicated at the top of each lane) were either circular (1 and 2, 7 and 8,13 and 14, 19 and 20) l inear ized and b io t iny la ted a t the Xho l s i te (b io ; 3 and 4 , 9 and 10, 15 and 16, 21 and 22) or l inear ized and b io t iny la ted a tthe Xhol site and incubated with an equim olar amou nt of streptavidin before transcr ipt ion in vitro (bio + strep; 5 and 6, 11 and 12 , 17 and 18 , 23

8/2/2019 Enhancers

7/11

An Enhancer Can Stimu late Transcript ion in Trans77 3

Table 2. Quantif ication of the Gels Sh own in Figure 5Constructs Lanes (Figure 5) I I ISV77 6177 6 (2/l; 6/5) 16.3 (100%) 6.2 (38%)SVI 336/l 336 (S/7; 12111) 11.6 (100%) 4.6 (41%)SVI 966/i 966 (1403; 16117) 4.5 (100%) 2.4 (53%)SV24 36124 36 (20/19; 24/23) 2.9 (100%) 1.6 (62%)SV7761776 (26/25) - 5.0 (-)CMV1 33611 336 (26/27; 32/31) 3.1 (100%) 2.0 (65%)SVl33 6/133 6 (34133; 30137) 6.0 (100%) 4.0 (67%)CMV l33611 336 (40139; 44143) 4.6 (100%) 2.9 (58%)CMV1 33611 336 (46/45; 50149) 3.9 (100%) 3.0 (77%)SV24 36/243 6 (W51; 54/53) - 2.0 (-)

2.4 (-)Colum n I l ists st imulatory effects of the SV4 0 or CMV enhancer in cova-lently closed plasmids. Colum n II l ists st imulatory effects of the SV40or CMV enhancer in streptavidin- or avidin-complexed plasmids. Num-bers in parentheses give the st imulatory effect as a percentage of theeffect with the corresponding covalently closed plasmids.

Different extracts were used in the course of these experiments. Notall extracts gave the same stimulatory effects. However, the effectsin one experiment, and also between different e xperiments using thesame extract, were highly reproducible. The st imulatory effect is ex-pressed as the rat io of the levels of transcr ipt ion for each pair of plas-mids (with/without enhancer). The levels of transcr ipt ion, normalizedto the reference gene signal, were determine d by Cerenkov countingof ge l bands.

CM V enhancers can st imulate transcr ipt ion in a frans con-f iguration when attached to the 5-globin promoter viastreptavidin or avidin. The construc ts 1335 and CMV1335were linearized with Xhol and biotinylated , recircula-r ized/concatemerized with avidin, and then fur ther di -gested wi th Xbal . This resul ted in a population of com-plexes consist ing of two DNA fragments l inked solely viaavidin (see Figure 16). The resul t of an in vi tro transcr ip-t ion exper iment wi th these complexes (and correspondingcontrol templates) is shown in Figure 5C, lanes 45-50. Thestimulatory effects obtained were about the same , i r -respective of whether the recircular ized/concatemerizedtemplates were fur ther d igested wi th Xbal (Figure 5C ,compare lanes 49 and 50 wi th 43 and 44).

In a second type of exper iment, the plasmids were l in-ear ized wi th Xhol , biot inylated, and then digested wi thXbal , which resul ted in two fragmen ts, one containing thef3-globin promoter/gene (A) and the other ei ther the en-hancer plus vector sequences or vector sequences alone

and 24). In lanes 3 and 4 and lanes 9 and 10, transcr ipt ion levels below the usual background level result from cutt ing the DNA relat ively closeto the init iat ion site.(6) Plasmids 776 and SV776 (bio + strep; 2 5 and 26) were l inearized and biot inylated at the Sal1 site (-38) just upstream of the TATA box andcomplexed with an equim olar amou nt of streptavidin before transcr ipt ion in vitro. (The site of biot inylat ion is moved relat ive to the posit ion of theenhancer; see also text.) Constructs 1336 and WV1336 ( lanes 27-32) were tested in the same way as the other constructs in (A). Lanes 33-36and 39-44 show two experiments performed as in (A) but with avidin (av) instead of streptavidin.(C) Stimulatory effect of the SV4 0 and CMV enhancers in trans. Lanes 45-50 show an experiment similar to that in lanes 39-44 except that al l testtemplates were digested with Xba l before in vitro transcr ipt ion, which produces the DNA fragments indicated at the bottom: Xba-l inea rized plasmids(45,46); two DNA fragments, one containing the @glo bin gene/promoter, the other containing the CMV enhancer or control sequences (47.46); andcomplexes consist ing of two fragments l inked via avidin (49, 50). Two different forms of streptavidin-DNA complex were tested in the experimentshown in lanes 51-54. Plasmids 2436 and SV24 36 were l inearize d and biot inylated at the Xhol site and either directly recircular ized/concatemerizedwith streptavidin (51,52) or further digested with Xba l fol lowed by agarose gel pur if ication of the result ing DNA fragments and l inkage with streptavidin(53, 54).

Lanes M, size marker, pBR32 2 digested with Hpall. Lanes P, Sl probe. f l . ful l- length Sl probe (undigested): ict, incorrectly init iated transcriptsof the test templates; test, correctly init iated transcripts of the test template ; ref, reference gene transcripts.

(BSV or B). The fragments were pur i f ied over an agarosegel , mixed in a 1:5 molar rat io (rat io of A fragments to Bor BSV fragmen ts) , and subsequently l inked with strep-tavidin. Figure 5C, lanes 53 and 54, show s the resul t of anin vi tro transcr ipt ion exper iment wi th such complexes ( inthis exper iment wi th 2433 and SV2435). The st imulationof transcr ipt ion was sl ightly higher than the effect ob-tained with the same recircular izedlconcatemerized con-structs (2.4- fold versus 2.0- fold; lanes 53 and 54 versus 51and 52, Figure 5C).DiscussionViral Enhancers Stimulate Transcr ipt ionfrom a Promoter Even When Linkedvia Streptav idin or AvidinThe st imulatory effect of an enhancer is transmitted invi tro even via a protein br idge. We bel ieve that this isgeneral ly val id for the fol lowing reasons: First, the st imula-tory effect of the SV40 enhancer is transmitted via the pro-tein bridge in al l tested c onstructs wi th enhancer and pro-tein br idge located at di f ferent posi t ions. Second, ei therbacter ial streptavidin or avian avidin can serve as a pro-tein br idge, al though the two proteins have some ve rydi fferent biochemical propert ies (concerning isoelectr icpoint, amino acid composi t ion, and carbohydrate con-tent) . Third, the CM V enhancer can also transmit i tsst imulatory effect v ia a streptavidin or avidin br idge.

The st imulation obtained with recircular ized/concate-mer ized constructs was, on average, about 58% of thestimulation obtained with the corresponding covalentlyclosed constructs (Table 2) . This was to be expected, be-cause only about 80% of the recircular ized/concatemer-ized plasmids were in the correct configuration ( i .e., wi ththe enhancer l inked to the promoter; see also Resul ts andExper imental Procedures). In accordance with this no-t ion, a sl ightly better resul t wa s obtained when the fractionof productive templates was increased by l inking excessenhancer to the promoter (Figure 5C, lanes 51-54).Impl ications for the Mecha nism of Transcr ipt ionalStimulation by Enhancers/UpstreamPromoter ElementsThe looping mode l predicts that enhancers/upstream pro-moter elements are able to st imulate transcr ipt ion from a

8/2/2019 Enhancers

8/11

Ce l l77 4

Table 3. Electron Microscopic Analysis of Templa tes after In Vitro TranscriptionNumber (%)

Form A 0 C D E FLinear monom er 473 (99.4) 345 (69.2) 447 (99.3) 350 (96.3) 345 (96.6) 501 (96.1)Circular monom er 1 (0.2) 2 (0.5) 1 (0.2) - 1 (0.3) -Linear dimer 1 (0.4) 20 (10.3) 1 (0.5) 3 (1.7) 2 (1.1) 5 (1.9)Total number of p lasmids 476 367 450 356 350 511Dimers w ere scored as units. Numbers in parentheses represent the percentage of the total number of plasmids in each experiment. Al l constructswere incubated under in vitro transcription conditions. Columns A and B: 1966 DNA was linearized with Xbal (sticky ends) and incubated without(A) or with BJA-B extract (6). Columns C-F: S V77@ DNA was linearized at the Xhol s ite and biotinylated with Klenow polymerase (blunt ends);complexed beforehand with an equimolar amount of streptavid in (E, F); incubated without (C, E) or with BJA-8 extract (D, F).

Samples incubated with BJA-B cell extract contained a low number of DNA fragments smaller than unit length, aris ing most probably as a conse-quence of some nuclease activity in the extract. For processing of the samples, see Experi mental Procedures.

promoter even when attached via a non-DNA bridge (e.g., cons tructs in which a lac operator was inserted betweenvia the proteins streptavidin or avidin). Since we have the SV40 enhancer and the rabbit fi-globin promoter. Weshown that this is indeed the case, our results are consis- found that bound lac repressor did not affec t the level oftent with the looping model. At the same time, the results specifically initiated transcripts , but strongly reduced thedo not support a strict scanning model in which RNA poly- level of readthrough transcripts that were incorrectly initi-merase II (or a transcription factor) slides from the en- ated further upstream (H.-P Miiller and W. Schaffner, un-hancer/upstream promoter eleme nts to the proximal pro- published data). These observations imply that bound lacmoter elemen ts, remaining in permanent contac t with the repressor does not interfere with the enhancer action andDNA . We cannot exclude, however, the possibi li ty that a that transcription by RNA polymerase II between the en-factor scanning along the DN A can jump over an obstacle hancer and the promoter is not necessa ry for the trans-such as streptavidin or avidin. mission of the stimulatory effect of the enhancer.

Taken at face value, our data are in conflict with somein vivo studies w ith mammalian cells (Courey et al., 1986)and with yeast (Brent and Ptashne, 1984). Courey and col-leagues demonstrated that psoralen-modified DNA (orprokaryotic vector sequences) inserted between the SV40enhancer and the human P-globin gene inhibited the en-hancer effec t in vivo. At that time, the authors argued thattheir data were consiste nt with a scanning model ratherthan a looping model. Howev er, psoralen-modified DN Aexhibits altered physical properties (Sinden and Hager-man, 1984; Shi et al., 1988; Zhen et al., 1988). The sa memight be true for inhibitory prokaryotic sequenc es, whichusually have a high G+C content (Banerji et al., 1981;Courey et al., 1986; E. Schreiber and W. Schaffner, un-published data). DN A sequences with a high G+C contentwere reported to be less flexible than other D NA (Hager-man, 1988). He nce it is also conceivable that psoralen-modified DN A (and some prokaryotic DNA ) interferes withlooping.The previous experiments of Brent and Ptashne (1984)

addressed the question of scanning. Constructs with aLexA operator inserted between the UASG (upstream ac-tivator sequence) and the TATA box of the GAL7 gene weretested in yeas t. A strong reduction of transcription was ob-served when LexA was coexpressed. Although theseauthors now consider DN A looping as the mo st likelymech anism for remote transcriptional control (Ptashne,1986), at that time it seemed more plausible that LexA in-terfered with RNA polymerase II (or a transcription factor)scanning along the DN A, though ste ric hinderance phe-nomena were also discuss ed. We have done similar ex-periments in vitro with mammalian cell extrac ts, using

The transcription experimen ts described in this reportwere all carried out in vitro, for one m ain reas on: This en-abled us to retrieve and analyze the templates after com-pletion of the transcription reaction in vitro, and to excludeartifacts such as covalent DNA joining due to repair activ-ity and/or differential compa rtmentalization of protein-linked versu s naked DN A. In the currently available in vitrotranscription system s, the effect of enhancers is stronglydistance dependent and vanishes beyond distances o fabout 500 bp from the initiation site. (In our experimentsthe mos t distant enhancer spanned nucleotide positions-438 to -243 upstream of the initiation site.) Therefore,our findings address only situations where the enhanceris located relatively close to the initiation site. It remainsa sem antic problem whether the activity of an enhancerin vitro is called an enhancer or an upstream promoter ac-tivi ty. In eukaryotes, the enhancer effect is widely ex-ploited for remote gene control: one gene can be subjectto multiple types o f regulation, and a given enhancer canactivate m ore than one gene. N evertheles s, even in vivothere is no clear-cut evidence that the mech anism of tran-scriptional activation is qualitatively different from an up-stream prom oter position as compared with a remote en-hancer position (see also Introduction). Therefore, thestrong d istance effec ts in vitro may reflect a quantitativedeficiency of the available cell-free s yste ms . Taken to-gether, i t seems l ikely that the mechanism of activationover a few hundred base pairs in vitro is not fundamentallydifferent from an even stronger activation over a few kilo-base pairs seen in vivo, although this remains to be inves-tigated.

We show in this paper that the stimulatory effects of the

8/2/2019 Enhancers

9/11

An Enhancer Can Stimulate Transcription in Trans77 5

SV40 and CM V enhancers are efficiently transmitte d invitro even when the enhancer and f3-globin p romoter arenoncovalently linked via a protein (streptavidin or avidin).Although our data do not strictly e xclude all imaginableforms of scanning by RNA polymerase II or a transcriptionfactor, they are consis tent with the looping model, wherethe enhancer/upstream promoter elements interact withproximal prom oter elements via DN A binding proteins. Inaddition, stimulation of transcription in tram, a s shown b your experiments, may also be found in nature in pheno-mena such as transvection, where the expression of agene on one chromosom e is affected by its allele on thepaired homolog (reviewed in Judd, 19 88; Wu and Gold-berg, 1989).Experimental ProceduresPlasmid ConstructsAll enzymatic manipulations were done according to standard proce-dures (Maniatis et a l., 1982). OVEC-Ref, our internal control gene, wasdescribed by Westin et al. (1987). SV 776 was constructed by liga tingthe oligonucleotide

TCGAGAGCTCACTGTGTCGACCTTGGGCATAAAAGGCAGAGCACTGCACTCGAGTGACACGGCTGGAACCCGTATTTTCCGTCTCGTG

in to SVOV EC (Westin et a l., 1987) that had been digested with Xhol andPstl (F! Matthia s, unpubl ished data). Clon e 776 was constructed byligating the oligonucleotide

CGAGAGCTCACTTGTGTCGAGCTCTCGAGTGAACACAGCI

in to OVEC (Westin et a l., 1987) that had been digested with Sacl andSall. The clones 776 and SV776 were opened with Xhol and BamH lfor the construction of 13381988, and 2436 as well as SV1336, SV1988.and SV2436. Xhol-B amtil fragments of CAJ44, CAJ40, and CAJ5 wereligate d into the prepared vectors. The CAJ clones (J. Bane rji an d W.Schaffner, unpublished data) bear the rabbit 8-globin gene with Bal31-resected upstream sequences. In the clones 7 76 and SV 778 the firstintron of the rabbit 8-globin gene is deleted, and point mutations wereintroduced at positions -14 and -15 to distinguish between non-digested Sl probe and readthrough transcripts (Westin et al., 1967).The plasmid C MV1338 was constructed by ligating the Xhol-Xbal frag-ment of 1338 with the Xhol-Xbal fragment of CMV(rev)OVEC (gift ofGunnar Westin; unpublished data), which contains the CMV enhancerand pUC18 sequences.Linking of DNA Ends with Streptavid in/AvidinThe constructs were linearized with Xhol and the ends were bio-tinylated by fi l l ing in with Klenow polymerase, using dGTP, dCTP, dATRand dUTP-11-biotin (GIBCO) instead of dTTf? The free nucleotideswere removed by gel f i l tration using a P-30 column (Bio-Rad). One hun-dred fifty nanograms (37 fmol) of b iotinylated DNA was incubated with2.2 ng (37 fmol) or 1 pg (16.6 pmol) of streptavid in (GIBCO) in 15 ulof M5 buffer. (With avid in [Sigma], s imilar amounts were used.) TheM5 buffer contained 10 mM HE PES (pH 7.9) 17.6 mM KCI, 5 mM mag-nesium acetate, 0.1 mM EDTA , 0.1 mM DTT, and 5.8% glycerol. Aftera 15 min incubation at 22C aliquots were taken for analysis byagarose gel electrophoresis and electron microscopy.Analysis of the DNA-Streptavid in and DNA-Avidin ComplexesAgarose Gel ElectrophoresisFour microliter samples (40 ng of DNA) of the DNA-streptavid in orDNA-avidin complexes were loaded on a 0.8% agarose gel, which wasrun at 10 V/cm in 80 mM Tris-phosphate (pH 7.5). 8 mM EDTA. 0.5 uS/mtethid ium bromide.Electron MlcroscopySamples contain ing DNA or DNA-protein complexes were diluted toa DNA concentration of 0.4 &ml in 5 mM Tris-t-0 (pH 8.0) and 10 mM

magne sium acetate, adsorbed to mica (Type Ruby B; Balzers) an dprocessed for electron microscopy as described by Sogo et al. (1987)but without g lutaraldehyde fixation.

Prepar ation of Nuclear Extracts and In Vitro TranscriptionBJA-B cells were cultured in suspension in 6 l iter round bottles with 4liters of RPM 1640 medium (Sigma) contain ing 10% fetal calf serum(Boehringer), 100 U/ml penicil l in (GIBCO), and 100 ug/ml streptomycin(GIBCO). The cells were grown to a density of 0.8 x 106/m l. Nuclearextracts were prepared as described by Dign am et al. (1983) with minormodifications. After ammoniu m sulfate precip itation (0.33 g/ml) the pel-let was resuspended in and dia lyzed against 20 mM HEP ES (pH 7.9)20% glycerol, 20 mM KCI, 0.2 mM EDTA, 05 m M DTT.

In vitro transcription reactions (15 ul) contained 24 ug of nuclear ex-tract, 110 ng of test gene DN A (complexed with streptavid in or avid inwhere indicated), 110 ng of OVEC-Ref, 220 ng of pBR327 as carrier,10 mM H EPE S (pH 7.9). 8.5% glycerol, 20 mM KCI. 7 mM NaCI, 5 mMmagnesium acetate, 0.1 mM EDTA, 0.15 mM DTT, 5 mM creatine phos-phate, and 0.5 mM each of ATP, GTP, UTP and CTP RNA preparationand Sl mapping were performed as described by Westin et a l. (1987).

The quantif ication of the stimulatory effects of both enhancers (Ta-ble 2) was done as fo llows: The levels of transcription were determinedby Cerenkov counting of the bands from th e gels shown in Fig-ure 5. Each value was normalized to the reference gene signal. Thestimulatory effects by the enhancers were determined as ratios of thelevels of transcription for each pair of plasmids (with/w ithout en-hancer). With recircularized/concatemerized template s, the stimula-tory effect of both enhancers was, on average, about 58% of the ef-fect obtain ed with the corresponding covalently closed constructs.This was to be expected, because according to the electron micro-scopic analysis (Table l), 63% of p lasmids complexed with equimolaramounts of streptavidin are concatemerized, mea ning that statisticallyonly half of these p lasmids (i.e., 31.5%) have the enhancer close to thepromoter. The other h alf have either two enhancers or two promotersdirectly l inked to each other. In addition, 28% of the total number ofplasmids are recircularized monom ers. Hence, in theory, the stimula-tory effect by the enhancer can result at most from 595% of thestreptavidin-comple xed plasmid s (i.e., 315% [half of the concatemer-ized plasmids ] plus 28% [the recircularized monomers]). Al l the con-structs linked with streptavidin or avidin showe d a simila r pattern whenanalyzed by agarose gel electrophoresis. Therefore the electron micro-scopic analysis of Xhol-l inearized and biotinylated SV776 DN A (Table1) was also taken as representative for the other constructs. The theo-retically possible stimulatory effect for recircularizedrconcatemerizedconstructs (59.5% o f the effect obtain ed with the corresponding cova-lently closed constructs) comes very close to the actually measured ef-fects (on average 58%).

To test for the ligation activity of the nuclear extracts, Xbal-l inearize d1988 DNA (110 ng) as well as Xhol-l inearized and biotinylated SV776DNA (110 ng), complexed with an equimolar amount of streptavid inwhere indicate d (2.2 ng), were incubate d under in vitro transcriptionconditions with or withou t BJA-B cell extract (as described above). Thesamples were then diluted to give a solution contain ing 2.2 pg/ml DNAand 4 pglml tr imethylpsoralen (Sigma). The DNA was cross-linked byirradiation with ultravio let l ight (380 nm, San Gabrie l UV lamp) for 30min at a distance of 7 cm (Sogo et a l., 1984). The samples were boiledfor 3 min in 1% SDS, digested with proteinase K (100 &!/ml, Sigma)for 30 min at 50C, phenolized, and precip itated with ethanol. This pro-tocol was used because the streptavidin-DN A complexes could not becompletely d isrupted unless they were boiled in SDS. Psoralen cross-linking prevented denaturation of the DNA under these conditions. Theprocessing for electron microscopy was as described above.

AcknowledgmentsWe are grateful to Charles Weissmann for initia lly suggesting the ex-periment and to Sandro Rusconi for many helpful d iscussions. Wethank Julian Baner ji and Gunnar Westin for generously providing theCAJ clones and a plasmid contain ing the CMV enhancer, respectively;Fritz Ochsenbein for expert graphic work; Deborah Magu ire, MarkusThali, Michael M. Miller, and Charles Wessmann for crit ical readingof the manuscript; and Theo K eller (ETH Zijrich) for his interest. This

8/2/2019 Enhancers

10/11

Ce l l77 6

work was supported by the Kanton of Ziir ich and the Swiss N ationalScience F oundation (grants 3.558.0.86 and 3.279.0.83).

The costs of public ation of this article w ere defrayed in part by thepayment of page charges. This article must therefore be herebymarked adverfisement in accordance with 18 USC. Section 1734solely t o indicate this fact.Received December 20, 1988; revised June 16, 1989.

Allison, L. A., and Ingles, C. J. (1989). Mutations in RNA polymeraseII enhance or suppress mutations in GAL4. Proc. Natl. Acad. Sci. USA86, 2794-2798.Argarana, C. E., Kuntz, I. D., Birken, S., Axel, Ft., and Cantor, C. R.(1986). Molecular c loning and sequence of the strepatavid in gene.Nucl. Acids Res. 74, 18711882.Bane rji, J., Rusconi, S., and Schaffner, W. (1981). Expression of a!3-globin gene is enhanced by remote SV 40 DNA sequences. Cell 27,299-308.Brandle, C. J., and Struhl, K. (1989). Yeast GCN4 transcriptional activa-tor protein interacts with RNA polym erase II in vitro. Proc. Natl. Acad.Sci. USA 86, 2652-2856.Brent, R .. and Ptashne , M. (1984). A bacterial repressor protein or ayeast transcriptional terminator can block upstream activation of ayeast gene . Nature 372, 812-815.Chaie t, L., and Wolf, F. J. (1964). The properties of streptavidin, abiotin-binding protein produced by streptomycetes. Arch. Biochem.Biophys. 706, 1-5.Chodosh, L. A., Carthew, R. W., Morgan, J. G., Crabtree, G. R., andSharp, I? A. (1987). The adenovirus major late transcription factor acti-vates the rat gamma-fibrinogen promoter. Science 238, 684-688.Cohen, R. S., and Meselson, M. (1988). Periodic interactions of heatshock transcriptional elemen ts. N ature 332, 856-858.Courey, A. J., Plon, S. E., and Wang, J. C. (1986). The use of psoralen-modified DNA to probe the mechanism of enhancer action. Cell 45,567-574.Dierks, P., van Ooyen, A., Cochran, M. D., Dobkin, C., Reiser J., andWeissmann, C. (1983). Three regions upstream from the cap site arerequired for efficient and accurate trenscription of the rabbit bglobi ngene in mouse 3T8 cells. Cell 32, 695-706.Dign am, J. D., Lebovitz, R. M., and Roeder, R. G. (1983). Accuratetranscription in it iation by RNA polymerase II in a soluble extract fromisolated mamm alian nuclei. Nucl. Acids Res. 5, 1475-1489.Dunn, T. M., Hahn, S., Ogden, S., and Schleif, R. F. (1984). An operatorat -280 base pairs that is required for repression of araBA D operonpromoter: addition of DNA helical turns between the operator and pro-moter cyclically hinders repression. Proc. Natl. Acad. S ci. US A 81,5017-5020.Gasser, S. M., and Laemm li, U. K. (1987). A glimpse at chromosomalorder. Trends Genet. 3, 16-22.Gellert, M., and Nash, H. (1987). Communication between segmentsof DNA during site-specific recombination. Nature 325, 401-404.Gralla, J. D. (1989). B acteria l gene regulation from distant DNA sites.Cell 57; 193-195.Green, N. M. (1975). Avidin. In Advances in Protein Chemistry, C. B.Anfinsen, J. T. Edsall, and F. M. Richards, eds. (New York: AcademicPress), pp. 85-133.Griff ith, J., Hochschild, A., and Ptashne, M. (1986). D NA loops inducedby cooperative bindi ng of lamb da repressor. Nature 322, 750-752.Hagerman, P J. (1988). Flexib il ity of DNA. Annu. Rev. Biophys. Chem.77, 265-287.Hai, T., Horikoshi, M., Roeder, R. G., and Green, M. R. (1988). Analysisof the role of the transcription factor ATF in the assembly of a function alprein it iation complex. Cell 54, 1043-1051.Hochschild, A., and Ptashne, M. (1986). Cooperative binding of 1repressors to sites separated by integr al turns of the DNA hel ix. Cell44, 681-687.

Hope, I. A., and Struhl, K. (1986). F unctional dissection of a eukaryotictranscriptional activator protein, GCN4 of yeast. Cell 46, 885-894.Horikoshi, M., Hai, T., L in, Y.-S., Green, M. R.. and R oeder, R. G.(1988). Transcription factor ATF interacts with the TATA factor to facili-tate establishment of a prein it iation complex. Cell 54, 1033-1042.Judd, B. H. (1988). Transvection: alleli c cross talk. Cel l 53, 841-843.KrBmer, H., Niembller, M., Amouyal, M., Revet, B., von Wilcken-Bergm ann, B., and MOlle r-Hill, 8. (1987). Lac repressor forms loopswith linear DNA carrying two suitably spaced lac operators. EMB O J.6, 1481-1491.Ma, J.. and Ptashne, M. (1987). Deletion analysis of GAL4 defines twotranscriptional activating segments. Cell 48, 847-853.Mania tis, T., Fritsch. E. F., and Sambr ook, J. (1982). Molec ular Clon-ing: A Laboratory Manual (Cold Spring Harbor, New York: Cold SpringHarbor Laboratory).Maniatis, T., Goodbourn, S., and Fischer, J. F. (1987). Regulation of in-ducible and tissue-specific gene expression. Science 236, 1237-124 5.Moreau, P., Hen, R., Wasylyk, B., Everett, R., Gaub, M. I?, and Cham-bon, P (1981). T he SV40 72 base pair repeat has a str ik ing effect ongene expression both in SV40 and other chimeric recombinants. Nucl.Acids Res. 9, 6047-6068.Mukherjee, S., Erickson, H., and Bastia, D. (1988). Detection of DNAlooping due to simultaneous interaction of a DNA-binding protein withtwo spatia lly separated binding sites on DNA. Proc. Natl. Acad. Sci.USA 85, 8287-8291.Miil ler, M . M., Gerster, T., and Schaffner, W. (1988). Enhancer se-quences and the regulation of gene transcription. Eur. J. Biochem. 776.485-495.Ondek, B., Shepard, A., and Herr, W. (1987). Discrete elements with inthe SV 40 enhancer region display different cell-specific enhancer ac-tiv it ies. EMBO J. 6, 1017-1025.Picard, D. (1985). Vira l and cellular transcription enhancers. Oxf. Surv.Euk. Genes 2, 24-48.Pierce, J., Lenardo, M., and Baltimore, D. (1988). Oligonucleotide thatbinds nuclear factor NF-KB acts as a lymphoid-spe cific and induci bleenhancer element. Proc. Natl. Acad. Sci. USA 85. 1482-1486.Plon, S. E., and Wang, J. C. (1986). Transcription of the human !3-globingene is stimulated by an SV40 enhancer to which it is physically l inkedbut topologically uncoupled. Cell 45, 575-580.Ptashne, M. (1988). Gene regulation by proteins acting nearby and ata distance. Nature 322, 697-701.Ptashne , M. (1988). How eukaryotic transcriptional activators work. Na-ture 335, 683-689.Ruden, D. M., Ma, J., and Ptashne, M. (1988). No str ict a lignm ent isrequired between a transcriptional activator b inding site and the TATAbox of a yeast gene. Proc. Natl. Acad. Sci. U SA 85, 4262-4266.Sassone-Corsi, P., Dougherty, J. P, Wasylyk, B., and Cham bon, P(1984). Stim ulati on of in vitro transcription from heterologo us pro-moters by the simian virus 40 enhancer. Proc. Natl. Acad. S ci. USA 81,308-312.Schirm, S., Jiricny, J., and Schaffner, W. (1987). The SV 40 enhancercan be dissected into multip le segments, each with a different cell typespecificity. Genes Dev. 7, 65-74.Schleif, R. (1987). Why should DNA loop ? Nature 327, 369-370.Schleif. R. (1988). DNA looping. Science 240, 127-128.Schiile r, H. R., and Gruss, l? (1985). Cell type-specific enhancem entin vitro requires the presence of transacting factors. EMB O J. 4,3005-3013.Schiile, R., Muller, M., Otsuka-Murakami, H., and Renkawitz, R.(1988). Cooperativity of the glucocorticoid receptor a nd the CACC C-box binding factor. Nature 332, 87-90.Schiile, R., Muller, M., Kaltschmidt, C.. and Renkawitz, R. (1989). Manytranscription factors interact synergistically with steroid receptors.Science 242, 1418-1420.Serfl ing, E., Jasin, M., and Schaffner, W. (1985). Enhancers and eu-karyotic gen e transcription. Trends Genet. 1, 224-230.

8/2/2019 Enhancers

11/11

An Enhancer Can Stimu late Transcript ion in Trans77 7

Sergeant, A., Bohm ann, 0.. Zentgraf, H., Weiher, H., and Keller, W.(1984). A transcr ipt ion enhancer acts in vitro over distances ofhundreds of base-pairs on both circular and l inear templates but noton chromatin-reconstituted DNA. J. Mol. Biol. 780, 577-600.Shi, Y.-B., Grif f i th, J., Gamper, H., and Hearst, J. E. (1988). Evidencefor structural deformation of the DNA he lix by a psoralen diadduct butnot by a monoadd uct. Nucl. Acids Res. 16, 8945-8952.Sinden , R. R.. and Hagerma n, P. J. (1984). Interstrand psoralen cross-l inks do not introduce appreciable bends in DNA. Biochemistry 23,6299-6303.Sogo. J. M., Ness, l? J., Widmer, R. M., Parish, R. W., and Keller, T.(1984). Psoralen-crosslinking of DNA as a probe for the structure of ac-t ive nucleolar chromatin. J. Mol. Biol. 778, 897-928.Sogo, J. M., Stasiak, A., De Bernadin , W.. Losa, R., and Keller, T.(1987). Binding of protein to nucleic acids. In Electron Microscopy inMolecular Biology: A Practical App roach, J. Somm ervil le and U.Scheer, eds. (Oxford: IRL Press), pp. 61-79.Takahashi, K., Vigneron, M., Matthes, H., Wildem an, A., Zenke, M.,and Chamb on, P. (1986). Requirem ent of stereospecific al ignme nts forinit iat ion from the simian virus 40 early promoter. Nature 379, 121-126.Theveny, B., and Revet, B. (1987). DNA orientation using specif icavidin-ferr it in biot in end labell in g. Nucl. Acids Res. 15. 948-958.Theveny, B.. Bail ly, A., Rauch. C., Rauch, M., Delain, E., and Milgrom.E. (1987). Association of DNA-bound progesterone receptors. Nature329, 79-81.Treisman, R., and Maniatis, T. (1985). SV40 enhancer increases thenumber of RNA polymerase II molecules on l inked DNA. Nature 375,72-75.Veldm an, G., Lupton, S., and Kam en, R. (1985). Polyomavirus en-hancer contains mu lt iple redundant sequence elements that activateboth DNA replication and gene expression. Mol. Cell. Biol. 5, 649-658.Wang, J. C., and Giaever, G. N. (1988). A ction at a distance along aDNA. Sc ience 240. 300-304.Weber, F., and Schaffner, W. (1985). SV40 enhancer increases RNApolymerase density w ithin the l inked gene. Nature 375, 75-77.Westin, G., Gerster T., MOller, M. M., Schaffner, G., and Schaffner, W.(1987). OVEC. a versati le system to study transcr ipt ion in mam malia ncells and cell- free extracts. Nucl. Acids Res. 77, 6787-6798 .Wildem an, A. G., Sassone-Corsi, f?, Grundstrdm, T., Zenke, M., andChamb on, P (1984). Stimulation of in vitro transcr ipt ion from the SV40early promoter by the enhancer involves a specif ic transacting factor.EMBO J. 3 , 3129-3133.Wirth, T., Staudt, L., and Balt imore, D. (1987). An octamer ol igonucleo-t ide upstream of a TATA motif is suff icient for lymphoid-specif ic pro-moter activity. Nature 329, 174-178.Wu, C.-T., and Goldberg, M. L. (1989). The Drosophila zeste gene andtransvection. Trends Genet. 5, 189-194.Wu. L.. and Berk, A. (1988). Constraintson spacing between transcr ipt ion factor binding sites in a simple a denovirus promoter. Genes Dev.2, 403-411.Zhen. W.-P, Da hl. O., Buchardt, O., and Nielsen, P E. (1988). On thebendin g by psoralen interstrand crosslinking. A gel electrophoreticstudy. Photochem . Photo biol. 4 8, 643-646.