engineering affinity and specificity of antibodies

University of ConnecticutOpenCommons@UConn

Doctoral Dissertations University of Connecticut Graduate School

6-28-2019

Engineering Affinity and Specificity of AntibodiesTargeting Protein ModificationsDan LiUniversity of Connecticut - Storrs, [email protected]

Follow this and additional works at: https://opencommons.uconn.edu/dissertations

Recommended CitationLi, Dan, "Engineering Affinity and Specificity of Antibodies Targeting Protein Modifications" (2019). Doctoral Dissertations. 2226.https://opencommons.uconn.edu/dissertations/2226

http://lib.uconn.edu/?utm_source=opencommons.uconn.edu%2Fdissertations%2F2226&utm_medium=PDF&utm_campaign=PDFCoverPages

http://lib.uconn.edu/?utm_source=opencommons.uconn.edu%2Fdissertations%2F2226&utm_medium=PDF&utm_campaign=PDFCoverPages

https://opencommons.uconn.edu?utm_source=opencommons.uconn.edu%2Fdissertations%2F2226&utm_medium=PDF&utm_campaign=PDFCoverPages

https://opencommons.uconn.edu/dissertations?utm_source=opencommons.uconn.edu%2Fdissertations%2F2226&utm_medium=PDF&utm_campaign=PDFCoverPages

https://opencommons.uconn.edu/gs?utm_source=opencommons.uconn.edu%2Fdissertations%2F2226&utm_medium=PDF&utm_campaign=PDFCoverPages

https://opencommons.uconn.edu/dissertations?utm_source=opencommons.uconn.edu%2Fdissertations%2F2226&utm_medium=PDF&utm_campaign=PDFCoverPages

https://opencommons.uconn.edu/dissertations/2226?utm_source=opencommons.uconn.edu%2Fdissertations%2F2226&utm_medium=PDF&utm_campaign=PDFCoverPages

Engineering Affinity and Specificity of Antibodies Targeting Protein Modifications

Dan Li, PhD

University of Connecticut, 2019

Antibodies targeting protein post-translational modifications (PTMs) are an essential tool in

scientific research and clinical investigations. Due to the transient and heterogeneous nature of

protein PTMs, high specificity and affinity of PTM-specific antibodies are critical for their

sensitive and reproducible detection. However, recent studies have revealed an alarming degree

of non-specific binding found in these antibodies, and whether the affinity meets the required

detection sensitivity is unclear. To address these challenges, we investigated whether directed

evolution could be applied to improve the affinity of a high-specific antibody targeting phospho-

threonine 231 of the human microtubule-associated protein tau. We developed a novel approach

using yeast surface display to quantify the specificity of PTM-specific antibodies. This approach

enabled us to measure its affinity and reveal its cross-reactivity towards the non-targets when we

affinity-matured the single-chain variable antibody fragment through directed evolution. We

demonstrate that directed evolution is a viable approach for obtaining high-affinity PTM-specific

antibodies, and highlight the importance of assessing the specificity in the antibody engineering

process.

The yeast surface display approach allows specificity measurement when the sequence of the

antibody is known, which makes it useful for screening antibody variants. However, for many

antibody users, the assay is not readily applicable for measuring specificity, since the antibody

sequence information may be unavailable. Therefore, we developed another assay that enables

PTM-specificity measurement for existing, commercially available antibodies. The assay relies

Dan Li – University of Connecticut, 2019

on multi-color flow cytometry in human embryonic kidney (HEK) cells. We defined a specificity

parameter termed Φ , which measures the fraction of non-specific signal in PTM-specific

antibodies, and successfully applied the HEK cell-based assay to measure the Φ values. We

validated the assay using antibodies with known specificity profiles, and used it to measure the

specificity of 7 widely used phospho-tau antibodies (AT270, AT8, AT100, AT180, PHF-6, TG-3,

and PHF-1) among others. We anticipate that the quantitative approach and parameter introduced

here will be widely adopted as a standard for reporting the specificity for phospho-tau antibodies,

and potentially for PTM-specific antibodies in general.


Dan Li

B.S., Tianjin University, China, 2014

A Dissertation

Submitted in Partial Fulfillment of the

Requirements for the Degree of

Doctor of Philosophy

at the

University of Connecticut

2019

ii

Copyright by

Dan Li

2019

iii

Doctor of Philosophy Dissertation


Presented by

Dan Li, B.S.

Major Advisor _________________________________________________________________

Dr. Yongku Cho

Associate Advisor ______________________________________________________________

Dr. Guoan Zheng


Dr. Xudong Yao


Dr. Yu Lei

University of Connecticut

2019

iv

First of all, I would like to thank my major advisor, Dr. Yongku Cho for the opportunity to learn

and study in his lab at UConn. The amount of patience and effort he was able to exhibit with

regard to my study and research is astounding. Our weekly discussions were always productive

and continually pushed me in the right direction. I thank him for helping my writing and

presentation skill, as well as my professional thinking. The work in this dissertation would not

have been possible without his guidance and support. I am so proud to have the opportunity to

work for him, be mentored by him, and I will look back on our work together fondly.

I would like to thank my associate advisors: Dr. Guoan Zheng, Dr. Xudong Yao and Dr. Yu Lei,

for their time and valuable guidance on my dissertation. I am also very thankful to Dr. Xudong

Yao and Dr. Benjamin Wolozin for their scientific input, kindness and time they dedicated to our

collaboration and research.

I am sincerely grateful to have worked with my lab mates: Shiyao Wang, Azady Pirhanov and

Monika Arbaciauskaite. It has been wonderful to see you and work with you in Dr. Cho’s lab. I

thank you all for both your professional and emotional support in the past. I also want to thank

all of my friends, both at UConn and elsewhere who made my life here pleasant and enjoyable.

In the end, I would like to acknowledge my family: my mom and my brother. Thank you for the

amount of love, encouragement, and support for my study and life. Without their unconditional

support, I could not have the chance to get here, to be the person I am today! I can’t express how

much I miss them at this moment! This work is dedicated to my beloved family.

v

Table of Contents

APPROVAL PAGE ..................................................................................................................... iii

ACKNOWLEDGEMENTS ........................................................................................................ iv

List of tables.................................................................................................................................. ix

List of figures ................................................................................................................................. x

Chapter 1 Introduction ........................................................................................................... 1

Overview ............................................................................................................................. 1

Research objectives ............................................................................................................. 3

Significance and contributions ............................................................................................ 5

Organization of the thesis ................................................................................................... 7

References ........................................................................................................................... 8

Chapter 2 Background and literature review .................................................................... 10

Antibodies targeting protein PTMs ................................................................................... 10

2.1.1 Protein PTMs .................................................................................................... 10

2.1.2 PTM-specific antibodies ................................................................................... 11

Tau protein ........................................................................................................................ 12

2.2.1 Tau PTMs and Alzheimer’s Disease ................................................................. 14

2.2.2 Phosphorylation of tau ...................................................................................... 15

2.2.3 Commonly used phospho-tau antibodies .......................................................... 16

2.2.4 Specificity validation approaches of phospho-tau antibodies ........................... 18

Yeast surface display platform .......................................................................................... 18

References ......................................................................................................................... 21

vi

Chapter 3 Directed evolution of a picomolar-affinity, high-specificity antibody targeting

phosphorylated tau ..................................................................................................................... 26

Introduction ....................................................................................................................... 26

Materials and Methods ...................................................................................................... 29

3.2.1 Yeast surface display of pT231 scFv ................................................................ 29

3.2.2 Peptide modification and purification ............................................................... 30

3.2.3 Directed evolution of pT231 scFv .................................................................... 31

3.2.4 Purification of pT231 scFvs .............................................................................. 33

3.2.5 Fluorescent tagging of purified pT231 scFvs ................................................... 34

3.2.6 Immunocytochemistry in HEK 293 cells .......................................................... 34

3.2.7 Immunohistochemistry in brain tissue sections ................................................ 35

Results ............................................................................................................................... 36

3.3.1 Yeast surface display of a phospho-tau scFv .................................................... 36

3.3.2 Chemical labeling of peptides to generate distinctively labeled epitopes ........ 37

3.3.3 Verification of binding activity of yeast displayed pT231 scFv ....................... 38

3.3.4 Assessment of antibody phospho-specificity using yeast surface display ........ 40

3.3.5 Directed evolution of pT231 scFv for improved affinity .................................. 42

3.3.6 Characterization of affinity and specificity of scFv mutants ............................ 45

3.3.7 Cell and tissue section labeling using purified scFvs ....................................... 48

Discussion ......................................................................................................................... 52

Conclusion ........................................................................................................................ 55

Reference .......................................................................................................................... 57

vii

Chapter 4 High specificity of widely used phospho-tau antibodies validated using a

quantitative whole-cell based assay ........................................................................................... 62

Introduction ....................................................................................................................... 62

Materials and Methods ...................................................................................................... 64

4.2.1 Cloning of recombinant constructs of tau and mutant tau ................................ 64

4.2.2 Cell culture and transfection ............................................................................. 66

4.2.3 Tau antibodies ................................................................................................... 66

4.2.4 Quantitation of antibody specificity .................................................................. 68

4.2.5 Measurement of Φ: validation of phospho-tau antibody specificity ................ 69

4.2.6 Immunocytochemistry in HEK293FT cells ...................................................... 71

4.2.7 Mouse hippocampus dissection ........................................................................ 71

4.2.8 HEK293FT and mouse primary cell lysate preparation and western blotting .. 72

Results ............................................................................................................................... 73

4.3.1 Φ: A generalizable parameter for measuring the specificity of phospho-tau

antibodies .......................................................................................................................... 73

4.3.2 Co-expression of glycogen synthase kinase-3b enhances tau phosphorylation 77

4.3.3 Quantifying the phospho-site specificity of commonly used phospho-tau

antibodies .......................................................................................................................... 78

4.3.4 Non-specific binding to cells in phospho-tau antibodies .................................. 81

Discussion ......................................................................................................................... 84

Conclusion ........................................................................................................................ 88

References ......................................................................................................................... 90

Chapter 5 Conclusion and future perspectives .................................................................. 93

viii

Conclusion ........................................................................................................................ 93

Future perspectives ........................................................................................................... 93

5.2.1 Avidity effect on antibody screening assay ...................................................... 93

5.2.2 Application of binding proteins in optogenetics ............................................... 97

Reference ........................................................................................................................ 112

ix

Table 4.1 Primers for Golden Gate assembly of plasmids ............................................................ 65

Table 4.2 Primers used for site-directed mutagenesis .................................................................. 65

Table 4.3 Phospho-tau antibodies ................................................................................................. 67

x

Figure 2.1 Antibody-phosphopeptide interaction revealed by X- ray crystallography ................ 12

Figure 2.2 The transcription, alternative splicing and PTMs of tau. ............................................ 13

Figure 2.3 Putative phosphorylation sites on tau protein and epitopes specific for major tau

antibodies ...................................................................................................................................... 16

Figure 2.4 A schematic overview of scFv scaffold displayed on the surface of yeast ................. 20

Figure 3.1 Schematic representation of antibody specificity quantification using yeast surface

display ........................................................................................................................................... 37

Figure 3.2. Modified peptides purification and confirmation ....................................................... 38

Figure 3.3 Binding activity of yeast displayed pT231 scFv ......................................................... 39

Figure 3.4 Assessment of CDR mutations on phosphopeptide binding of yeast displayed pT231

scFv ............................................................................................................................................... 40

Figure 3.5 Assessment of the specificity of yeast displayed pT231 scFv .................................... 41

Figure 3.6 Directed evolution of yeast displayed pT231 scFv variants with improved affinity .. 43

Figure 3.7 Amino acid sequence of individual mutants isolated from the screen for improved

affinity ........................................................................................................................................... 44

Figure 3.8 High occurrence mutations identified from the screen mapped on WT pT231 scFv

structure ......................................................................................................................................... 45

Figure 3.9 Characterization of affinity and specificity of individual scFvs ................................. 47

xi

Figure 3.10 Confocal microscopy images of HEK293FT cell labeled using purified pT231 scFvs

....................................................................................................................................................... 49

Figure 3.11 Quantification of cell labeling fluorescence intensity using purified pT231 scFvs .. 50

Figure 3.12 Tissue labeling using purified pT231 scFvs .............................................................. 51

Figure 4.1 A ratiometric assay to quantify the specificity of phospho-tau antibodies. ................ 74

Figure 4.2 Validation of the assay using well characterized anti-tau antibodies .......................... 76

Figure 4.3 Measurement of Φala and ΦλPP of phospho-tau antibodies. ..................................... 77

Figure 4.4 Co-expression of GSK-3b in HEK293FT cells enhances phosphorylation of tau. ..... 78

Figure 4.5 Specificity measurements for commonly used phospho-tau antibodies ...................... 81

Figure 4.6 Flow cytometry plots showing binding of isotype-matching control antibodies under

the specificity quantification assay conditions ............................................................................. 82

Figure 4.7 Non-specific binding to HEK293FT cells in phospho-tau antibodies ......................... 84

Figure 5.1 Schematic of the Streptavidin-biotin interaction ......................................................... 96

Figure 5.2 Schematic of yeast surface display formats ................................................................. 97

1

Overview

Antibodies that target post-translationally modified proteins are widely used in biology and

clinical investigations. Antibodies exist that can recognize a single modified amino acid (e.g.,

phosphorylated tyrosine) within the context of diverse nearby amino acid sequence (1,2).

However, most widely used are antibodies binding to a modification site in a defined target

protein sequence, herein referred to as post-translational modification (PTM)-specific antibodies.

Due to the large number of experimentally identified post-translational modification sites (>

87,000) (3), the demand for PTM-specific antibodies continue to grow. Due to the dynamic and

heterogeneous nature of PTMs, the affinity and specificity of PTM-specific (4) antibodies are

critical for sensitive and reproducible detection of PTMs (5). Only a fraction of a protein is

modified at any given time, and the dynamics may vary within a tissue across different cell types

(6-8). Therefore, PTM-specific antibodies should interact only with the modified target site, with

high affinity to capture potentially a small fraction of the modified form.

However, generating high affinity antibodies with high PTM-specificity remains to be

challenging. Existing methods for generating PTM-specific antibodies rely on immunization

approaches, but often fail or produce low affinity antibodies. This is due to the fact that the

peptide epitopes containing PTMs are weak immunogens in mice (9), PTMs undergo rapid

degradation in vivo regardless of the immunization route (10), and that B-cell response shows an

affinity ceiling (11,12). Therefore, screening recombinant antibody libraries in vitro is thought to

be a promising alternative. However, in vitro library screening strategies for PTM-specific

antibodies also tend to result in low affinity antibodies (Kd ~ 100 nM to µM range) (13-15). This

trend has been observed for screening phospho-specific antibodies, but it extends to antibodies

2

targeting other PTMs, such as sulfotyrosine (16). The specificity of PTM-specific antibodies is

recently gaining attention as a critical factor. In case of the microtubule-associated protein tau,

although phospho-specific antibodies are highly sought after for many target proteins, often at

multiple phosphorylation sites, they are currently available in limited cases, and often suffer

from poor specificity and low affinity (17-19).

High affinity and specificity antibodies against phosphorylated tau will enable the detection in

low concentration samples. This would be a major factor in developing diagnostic assays using

patient samples such as cerebrospinal fluid (CSF). Recent studies show that majority of existing

monoclonal antibodies cannot detect phosphorylated tau, due to low affinity. Affinity of

antibodies that recognize PTM tau is also an important factor in developing passive

immunotherapy strategies. Studies in mouse models have shown that for certain tau epitopes,

targeting antibody affinity is not a major factor, while for antibodies targeting soluble tau affinity

was highly correlated with efficacy (20). High affinity antibodies against phosphorylated tau will

be necessary for systematic studies to determine key factors to efficacy.

This work focuses on the development of assays for generating and characterizing PTM-specific

antibodies with high specificity and affinity. To assess the specificity of PTM-targeting

antibodies, we develop an experimental approach based on yeast surface display to quantify

single-chain variable fragment (scFv) binding against a defined set of structurally similar

epitopes. We generate a picomolar affinity scFv targeting phosphorylated T231 of human tau

using directed evolution. The yeast surface display approach allows specificity measurement

when the sequence of the antibody is known, which makes it useful for screening antibody

variants. However, for many antibody users, the assay is not readily applicable for measuring

specificity, since the antibody sequence information may be unavailable. Therefore, we report a

3

robust flow cytometry assay using human embryonic kidney (HEK) cells that enables the

determination of a specificity parameter termed Φ, which measures the fraction of non-specific

signal in antibody binding. We apply our assay to measure the specificity of 7 widely used

phospho-tau antibodies (AT270, AT8, AT100, AT180, PHF-6, TG-3, and PHF-1) among others.

Research objectives

It is the aim of this work to engineer and assess affinity and specificity of antibodies targeting

protein PTM, particularly in tau phosphorylation. The objective of this research can be broken

down into 2 aims:

(1) Develop a screening assay to generate high-affinity and specific PTM-specific antibody using

yeast surface display. According to the x-ray crystal structural of antibody-phosphoepitope

complex, it’s plausible that high-affinity phospho-specific antibodies selectively stabilize either

the peptide sequence or phosphate interactions, leading to increase in cross reactivity towards the

non-phosphoepitope or irrelevant phosphorylation sites. Therefore, we hypothesized that a trade-

off between affinity and specificity might exist in PTM-specific antibodies. To test this

hypothesis, we sought to assess the impact of in vitro affinity maturation on the specificity of

PTM-targeting antibodies.

The specific aims of this project were:

i. Development of an assay to quantify specificity of phospho-specific antibody using

yeast surface display

• Yeast surface display of a phospho-tau-specific scFv

• Chemically labelling peptides to generate distinctively labeled epitopes

• Assessment of scFv phospho-specificity using yeast surface display

4

ii. Engineering antibody phospho-specificity and affinity through directed evolution

• Creation of a yeast displayed scFv library using random mutagenesis and DNA shuffling

• Affinity maturation of yeast displayed scFvs using FACS

iii. Characterization of affinity and specific of scFv mutants

• Validation of scFv mutants using yeast surface display

• Testing the good performing scFv mutants in cell and tissue section labeling

In summary, the outcomes of this project were: introducing a yeast surface display approach to

quantify the specificity of PTM-specific antibodies, and developed a screening assay based on it

to generate PTM-specific antibodies with improved affinity and high specificity through directed

evolution.

(2) Introduce a quantitative whole-cell based assay to validate PTM-specific antibody specificity.

Antibodies binding to phosphorylated tau (phospho-tau) are extensively used in research and

being adopted in clinical diagnosis. However, few validation data have been published and

existing specificity characterization methods relied on immunoblotting approaches which are not

ideal for quantitative measurement due to frequent signal saturation in immunoblotting

experiments. To fill this critical need, we introduced a parameter termed Φ that quantifies

specificity of phospho-tau antibodies and established a generalizable, robust assay to measure it.

The specific aims of this project were:

i. Development of a whole-cell based approach to quantify phospho-tau antibody

specificity using flow cytometry

• HEK293 cells expressing fluorescent tagged full-length tau

• Validation of the assay using previously characterized anti-tau antibodies

• Defining a parameter Φ to quantitatively measure the specificity phospho-tau antibodies

5

ii. Quantifying the phospho-specificity of commonly used phospho-tau antibodies

• Measurement of specificity Φ of commonly used phospho-tau antibodies using flow

cytometry

• Assessment of non-specific binding in phospho-tau antibodies by performing cell

labeling and western blotting

In summary, the outcomes of this project were: providing a whole-cell based approach to

validate the specificity of phospho-tau antibodies, and determined a parameter Φ for phospho-tau

antibodies based on it, that enable quantitative comparison of specificity. We anticipate that this

parameter will be widely adopted in guiding users of the specificity of phospho-tau antibodies,

and potentially PTM-specific antibodies in general.

Significance and contributions

High quality antibodies require high specificity and affinity toward the targets. The specificity

and affinity of PTM-specific antibodies are critical for sensitive and reproducible detection of

protein PTM. However, the current methods for generating PTM-specific antibodies have

drawbacks that make is hard to identify high quality antibodies; and many PTM-specific

antibodies have low affinity and poor specificity. This work improved the success rate of

generating high quality PTM-specific antibodies, and provided an assay to quantitatively

measure the specificity of those antibodies.

This work allows for contributions in the following fields:

i. Introduced a yeast surface display approach to quantify antibody specificity

ii. Developed a screening assay to generate antibodies with improved affinity and high

specificity using yeast surface display

6

iii. Generated a pico-molar affinity scFv targeting phosphorylated T231 of human tau using

directed evolution

iv. Provided information on structure analysis of antibody-antigen interaction

v. Enabled small binders in cell and tissue staining

vi. Developed a whole-call based approach to quantitatively quantify the specificity of PTM-

specific antibodies

vii. Introduced a parameter Φ to measure the specificity of PTM-specific antibodies, which

will be widely adopted in guiding the use PTM-specific antibodies in general

Manuscripts and publications have been resulted from this work as listed below:

1. Li, D., Cho, Y.K.*, High specificity of widely used phospho-tau antibodies validated

using a quantitative whole-cell based assay, in revision, 2019

2. Li, D., Wang, L., Maziuk, B.F., Yao, X., Wolozin, B., Cho, Y.K.*, Directed evolution of

a picomolar affinity high-specificity antibody targeting phosphorylated tau, Journal of

Biological Chemistry, 2018, 293, 12081-12094

3. Knowlton, S., Li, D., Ersoy, F., Cho, Y.K.*, Tasoglu S.*, Building Blocks for Bottom-

Up Neural Tissue Engineering: Tools for In Vitro Assembly and Interrogation of Neural

Circuits (book chapter), Neural Engineering, 2016

4. Cho, Y.K.*, Li, D., Optogenetics: Basic Concepts and Their Development (book chapter),

Methods in Molecular Biology, 2016

7

Organization of the thesis

Chapter 2 provides an overview of the background, concepts and significances of PTM-specific

antibodies. It begins with a brief introduction of protein PTMs and the antibodies that targets

such antigens. Antibodies targeting tau PTMs are highlighted, specifically discussing the

antibodies targeting phosphorylated tau that is associated with Alzheimer’s Disease. In the end of

this chapter, we review a yeast surface display technique, that is vital in in vitro recombinant

antibody screening assays.

In Chapter 3, we introduce an approach using yeast surface display to quantify the specificity of

phospho-specific antibodies. We develop a screening assay based on it to generate PTM-specific

antibodies with improved affinity and high specificity. We demonstrate that in vitro affinity

maturation leads to cross-reactivity in PTM-specific antibodies. However, quantifying the

specificity allows identifying an antibody with improved affinity and specificity.

In Chapter 4, we provide a whole-cell based approach to validate the specificity of phospho-tau

antibodies. We introduce the parameter Φ for phospho-tau antibodies, that enable quantitative

comparison of specificity. Using our assay, we quantified the specificity Φ of 7 widely used

phospho-tau antibodies (AT270, AT8, AT100, AT180, PHF-6, TG-3, and PHF-1) as well as 2

additional phospho-tau antibodies (1H6L6 and pS404).

Chapter 5 presents a summary of this work and provides the future perspectives of this work.

First, we will assess the avidity effect of the yeast surface displayed scFvs for the targets, and

apply it in developing a novel in vitro screening assay. Second, we will develop small binding

protein for tau, combined with optogenetics tools allows the visualization of complex structures

such as synapse.

8

References

1. Rush, J., Moritz, A., Lee, K. A., Guo, A., Goss, V. L., Spek, E. J., Zhang, H., Zha, X. M., Polakiewicz, R. D., and Comb, M. J. (2005) Immunoaffinity profiling of tyrosine phosphorylation in cancer cells. Nature biotechnology 23, 94-101

2. van der Mijn, J. C., Labots, M., Piersma, S. R., Pham, T. V., Knol, J. C., Broxterman, H. J., Verheul, H. M., and Jimenez, C. R. (2015) Evaluation of different phospho-tyrosine antibodies for label-free phosphoproteomics. J Proteomics 127, 259-263

3. Khoury, G. A., Baliban, R. C., and Floudas, C. A. (2011) Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep 1

4. Min, S. W., Chen, X., Tracy, T. E., Li, Y., Zhou, Y., Wang, C., Shirakawa, K., Minami, S. S., Defensor, E., Mok, S. A., Sohn, P. D., Schilling, B., Cong, X., Ellerby, L., Gibson, B. W., Johnson, J., Krogan, N., Shamloo, M., Gestwicki, J., Masliah, E., Verdin, E., and Gan, L. (2015) Critical role of acetylation in tau-mediated neurodegeneration and cognitive deficits. Nature medicine

5. Lothrop, A. P., Torres, M. P., and Fuchs, S. M. (2013) Deciphering post-translational modification codes. FEBS Lett 587, 1247-1257

6. Bayes, A., and Grant, S. G. (2009) Neuroproteomics: understanding the molecular organization and complexity of the brain. Nat Rev Neurosci 10, 635-646

7. Prabakaran, S., Lippens, G., Steen, H., and Gunawardena, J. (2012) Post-translational modification: nature's escape from genetic imprisonment and the basis for dynamic information encoding. Wiley Interdiscip Rev Syst Biol Med 4, 565-583

8. Witze, E. S., Old, W. M., Resing, K. A., and Ahn, N. G. (2007) Mapping protein post-translational modifications with mass spectrometry. Nature methods 4, 798-806

9. Brumbaugh, K., Johnson, W., Liao, W. C., Lin, M. S., Houchins, J. P., Cooper, J., Stoesz, S., and Campos-Gonzalez, R. (2011) Overview of the generation, validation, and application of phosphosite-specific antibodies. Methods in molecular biology 717, 3-43

10. Czernik, A. J., Girault, J. A., Nairn, A. C., Chen, J., Snyder, G., Kebabian, J., and Greengard, P. (1991) Production of phosphorylation state-specific antibodies. Methods in enzymology 201, 264-283

11. Batista, F. D., and Neuberger, M. S. (1998) Affinity dependence of the B cell response to antigen: a threshold, a ceiling, and the importance of off-rate. Immunity 8, 751-759

12. Foote, J., and Eisen, H. N. (1995) Kinetic and affinity limits on antibodies produced during immune responses. Proceedings of the National Academy of Sciences of the United States of America 92, 1254-1256

13. Koerber, J. T., Thomsen, N. D., Hannigan, B. T., Degrado, W. F., and Wells, J. A. (2013) Nature-inspired design of motif-specific antibody scaffolds. Nature biotechnology 31, 916-921

14. Shih, H. H., Tu, C., Cao, W., Klein, A., Ramsey, R., Fennell, B. J., Lambert, M., Ni Shuilleabhain, D., Autin, B., Kouranova, E., Laxmanan, S., Braithwaite, S., Wu, L., Ait-Zahra, M., Milici, A. J., Dumin, J. A., LaVallie, E. R., Arai, M., Corcoran, C., Paulsen, J. E., Gill, D., Cunningham, O., Bard, J., Mosyak, L., and Finlay, W. J. (2012) An ultra-

9

specific avian antibody to phosphorylated tau protein reveals a unique mechanism for phosphoepitope recognition. The Journal of biological chemistry 287, 44425-44434

15. Feldhaus, M. J., Siegel, R. W., Opresko, L. K., Coleman, J. R., Feldhaus, J. M., Yeung, Y. A., Cochran, J. R., Heinzelman, P., Colby, D., Swers, J., Graff, C., Wiley, H. S., and Wittrup, K. D. (2003) Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library. Nature biotechnology 21, 163-170

16. Kehoe, J. W., Velappan, N., Walbolt, M., Rasmussen, J., King, D., Lou, J., Knopp, K., Pavlik, P., Marks, J. D., Bertozzi, C. R., and Bradbury, A. R. (2006) Using phage display to select antibodies recognizing post-translational modifications independently of sequence context. Molecular & cellular proteomics : MCP 5, 2350-2363

17. Bordeaux, J., Welsh, A., Agarwal, S., Killiam, E., Baquero, M., Hanna, J., Anagnostou, V., and Rimm, D. (2010) Antibody validation. BioTechniques 48, 197-209

18. Petry, F. R., Pelletier, J., Bretteville, A., Morin, F., Calon, F., Hebert, S. S., Whittington, R. A., and Planel, E. (2014) Specificity of anti-tau antibodies when analyzing mice models of Alzheimer's disease: problems and solutions. PloS one 9, e94251

19. Dopfer, E. P., Schopf, B., Louis-Dit-Sully, C., Dengler, E., Hohne, K., Klescova, A., Prouza, M., Suchanek, M., Reth, M., and Schamel, W. W. (2010) Analysis of novel phospho-ITAM specific antibodies in a S2 reconstitution system for TCR-CD3 signalling. Immunology letters 130, 43-50

20. Congdon, E. E., Lin, Y., Rajamohamedsait, H. B., Shamir, D. B., Krishnaswamy, S., Rajamohamedsait, W. J., Rasool, S., Gonzalez, V., Levenga, J., Gu, J., Hoeffer, C., and Sigurdsson, E. M. (2016) Affinity of Tau antibodies for solubilized pathological Tau species but not their immunogen or insoluble Tau aggregates predicts in vivo and ex vivo efficacy. Mol Neurodegener 11, 62

10

Antibodies targeting protein PTMs

Antibodies that target proteins post-translation modifications (PTMs) are widely used in biology

and clinical investigations. Some antibodies can bind to a single modified amino acid (e.g.,

phosphorylated tyrosine) within the context of diverse nearby peptide sequences (1,2). However,

most widely used are antibodies specific to a modification site in a defined target protein

sequence, herein referred to as PTM-specific antibodies. Due to a large number of

experimentally identified post-translational modification sites (> 87,000) (3), the demand for

PTM-specific antibodies continues to grow.

2.1.1 Protein PTMs

In the last few decades, researchers discovered that the human proteome is more complex than

human genome. The increase of the complexity of proteome to genome is facilitated by many

different mechanisms, including PTMs. PTM is covalent and enzymatic modification of proteins

following protein biosynthesis. It occurs after the mRNA is translated into the protein sequence

in ribosomes. PTMs process the protein by adding different biochemical group (such as

phosphorylation, methylation), or adding different small protein molecule (such as

ubiquitination), or splicing protein sequence at specific sites. PTM is involved in nearly all

aspect of biological, and plays important role in regulating protein level and function. For

instance, phosphorylation, which is the most common PTM, alters biological activity of enzymes

(3). Many enzymes and receptors are switched "on" or "off" by phosphorylation and

dephosphorylation.

PTM is a key mechanism that enables reversible regulation of protein activity, conformation,

localization, turnover rate, and interactions. Abnormal PTMs result in dysregulation of these

11

processes and are often associated with pathological conditions, including heart disease, cancer,

and neurodegeneration (4-8). In case of tau protein, numerous abnormal PTMs regulate its

biology, and are associated with several neurodegenerative diseases including Alzheimer’s

Disease (AD), collectively referred to as tauopathies (9).

2.1.2 PTM-specific antibodies

Since protein PTMs are included in many pathological conditions, detection of protein PTMs is

valuable in identifying the cause and tracking the progression of these diseases. However, robust

detection of PTMs is challenging due to their dynamic and heterogeneous nature. Only a fraction

of a protein is modified at any given time, and the dynamics may vary within a tissue across

different cell types (10-12). Therefore, the affinity and specificity of PTM-specific antibodies are

critical for sensitive and reproducible detection of PTMs (13). PTM-specific antibodies should

interact only with the modified target site, with high affinity to capture potentially a small

fraction of the modified form.

Recently, an x-ray crystal structure of an antibody in complex with a phosphoepitope peptide of

tau (PDB code 4GLR) revealed a recognition motif, in which a sector of residues from the

complementarity determining region (CDR)-H2 interact with the phosphate group of

phosphorylated threonine 231of tau and another sets of CDR residues contacting the peptide

sequence (Figure 2.1) (14). Such distinct recognition sectors were also found in structural

analyses of other phospho-specific antibodies (15).

12

Figure 2.1 Antibody-phosphopeptide interaction revealed by X- ray crystallography The interaction is mediated by recognition of the phosphate group by CDR-H2 (solid) and the surrounding residues by other CDRs(dashed). Image generated based on PDB code 4GLR.

In case of tau PTM-specific antibodies, their affinity and specificity are particularly important,

since they dictate their efficacy in a wide range of applications. High-affinity antibodies are

superior in detecting tau PTMs from clinical samples (16), but mouse model experiments suggest

that high specificity antibodies may be more beneficial for passive immunotherapy targeting tau

(17).

Tau protein

Tau is a microtubule-associated protein tau (MAPT) which are found mostly in neurons. Its

major functions are to promote microtubule assembly and maintain the stability of the neurons

through binding to the microtubules. Tau has two ways to control microtubule stability: tau

isoforms and tau phosphorylation.

13

Human MAPT gene for encoding tau protein is located on the human chromosome 17q21,

having 16 exons (18). Alternative splicing of exons 2,3 and 10 leads to formation of six tau

isoforms which are composed of 352 - 441 amino acid residues with molecular weight of ~ 37 -

46 kDa (Figure 2.2) (19,20). Tau isoforms contain either 0, 1 or 2 inserts of 29 amino acids at

the N-terminus (exon 2 and 3), and 3 or 4 microtubule-binding repeats at the C-terminus (exon

10). Six isoforms of tau have been found in adult human brains (21).

Figure 2.2 The transcription, alternative splicing and PTMs of tau. By transcription and alternative splicing at exons 2, 3 and 10 of tau mRNA, six isoforms of tau protein are generated from a single gene located on the chromosome 17q21 in human. Different tau isoforms are named according to the numbers of the N-terminal inserts and/or C-terminal microtubule-binding domain (such as 2N4R) or according to the clones (such as Tau40) (19).

14

2.2.1 Tau PTMs and Alzheimer’s Disease

The complexity of the tau isoforms can be further increased by PTMs (Figure 2.2). During

normal development, tau protein undergoes various PTM, including phosphorylation,

glycosylation, acetylation, ubiquitination, truncation etc. Recent studies suggest that the PTMs of

tau may participate in the regulations of intracellular signal transduction, development and

viability of the neurons (22).

The abnormal PTM, such as hyper-phosphorylation, has been found in a number of

neurodegenerative disorder, known as tauopathy, such as AD, corticobasal degeneration, Down’s

syndrome. Phosphorylation sites at or near the repeat elements of the microtubule binding

domains are particularly important for the pathophysiology of tauopathy (23). An increase in tau

phosphorylation, on average from 2 - 3 to 7 - 8 phosphate per molecule (23) results in

preferential phosphorylation at sites that decrease microtubule binding (24,25), and increases its

propensity to form oligomers and high order aggregates (23,26). Levels of tau oligomers showed

a strong correlation with memory loss in a mouse model of tauopathy (27). Acetylation at

specific lysine residues interferes with ubiquitination and subsequent degradation by the

proteasome, resulting in accumulation of phosphorylated tau and associated toxicity in mouse

models (28-31).

The tau hypothesis states that, in AD brains, tau becomes hyperphosphorylated, resulting in

reduced affinity for microtubules and self-aggregating into paired helical filament (PHF), leading

to formation of neurofibrillary tangles (32,33). This process causes the microtubules

depolymerisation, and finally breaks the neurons. Therefore, these phosphorylated neurofibrillary

tangles are often seen in AD brain and thought to be a hallmark of AD.

15

AD is a progressive neurodegenerative disease, it’s the most well-known form of dementia,

accounting for 50-60% of all cases (34). AD patients often suffer from memory loss, confusion

and behavioral issues. Gradually, bodily functions are lost, ultimately leading to death. In 2018,

50 million people have dementia in worldwide, and there will be one new case every 3 second,

so that more than 150 million people will live with dementia by 2050. In 2018 the global societal

cost of dementia is 1 trillion US dollars, and it will rise to 2 trillion by 2030. Until now, there are

no drugs available that can prevent or even slower this course.

2.2.2 Phosphorylation of tau

On the basis of tau hypothesis, abnormal PTM of tau is currently the most common disease-

modifying target. Among these PTMs, tau phosphorylation is the most common and the best-

studied. In AD brains, the level of the hyper-phosphorylated tau is 3-4 fold higher than that of

tau isolated from normal brains (35,36). There are 85 serine, threonine, or tyrosine

phosphorylation sites in the longest human brain tau isoform, and 45 sites have been identified in

AD brain samples by using mass spectra or antibodies recognition (Figure 2.3) (37,38). And

they are clustered in the proline-rich domain (PRD) and C-terminal region of tau.

16

Figure 2.3 Putative phosphorylation sites on tau protein and epitopes specific for major tau antibodies Red color denotes amino acids phosphorylated in AD brain, green in both AD and normal brain, blue in normal brain, while black color means that those phosphorylation sites have not been fully characterized yet. Tau antibodies specific for phospho-tau epitopes are given in purple, while pink color denotes antibodies specific for non-phosphorylated tau epitopes (38).

2.2.3 Commonly used phospho-tau antibodies

Antibodies targeting tau phosphorylation (phospho-tau) are extensively used in research and

being adopted in clinical diagnosis (39-44). According to antibody databases (Antibodypedia and

Alzforum), thousands of anti-tau antibodies are currently available, including >180 unique

phospho-tau antibodies. Epitopes recognized by some commonly used phospho-tau and

nonphospho-tau antibodies are shown in Figure 2.3 (38).

17

AT270. This antibody is against phosphorylated epitope T181(45,46), which is in PRD of tau.

AT270 is produced using PHF tau as the immunogen, and it does not recognize recombinant tau,

but does so after phosphorylation with brain extract.

AT8. This antibody is against phosphorylation epitope S199 and/or S202 and/or T205 (45,46),

which are in PRD of tau. Previous study has shown that AT8 recognition requires only S202 to

be phosphorylated in tau (47). AT8 recognizes all isoforms of PHF tau but not tau from normal

mammalian brain, thus the antibody is specific for the Alzheimer state and has the advantage of

reporting on the state of phosphorylation (48).

AT100. This antibody is against doubly phosphorylated epitope T212/S214 (49-52), which are in

PRD of tau. AT100 epitope is formed only when a specific order of phosphorylation occurs (53).

It has also been shown that Thr212 and Ser214 are sequentially phosphorylated by glycogen

synthase kinase 3β (GSK-3b) and protein kinase A (PKA), respectively (53).

AT180. This antibody is against phosphorylated epitope T231 (45,51,54), which is in PRD of tau.

AT180 is produced using PHF tau as the immunogen, and it does not recognize recombinant tau,

but does so after phosphorylation with brain extract.

PHF6. This antibody is against phosphorylated epitope T231 (55,56), which is in PRD of tau.

PHF6 recognizes PHF tau containing phosphorylated T231.

TG-3. This antibody is sensitive to the conformation changes of phosphorylated Thr231, which

is in PRD of tau, it recognizes neurofibrillary tangles of tau in AD, while not reacts to normal tau

(51,57,58).

PHF1. This antibody is against doubly phosphorylated epitope S396/S404 (50,59,60), which are

in C-terminal region of tau. PHF1 recognizes PHF tau containing either individually

18

phosphorylated S396 or S404, but is more sensitive in detection when both serines are

phosphorylated.

2.2.4 Specificity validation approaches of phospho-tau antibodies

Recent studies have shown that some phospho-tau antibodies lack specificity (61-63). Existing

specificity characterization methods relied on immunoblotting approaches using either synthetic

peptides, cell lysates or extracted PHF tau (61-63). Synthetic peptides allow binding

measurement to exactly defined phosphorylation sites, but is prohibitively costly to cover all

phospho-sites across the full-length tau. Cell lysates allow detection of non-specific binding to

non-tau proteins (61), but cannot measure cross-reactivity to non-modified tau or other

phosphorylation sites. Extracted PHF-tau from AD brain homogenates allows characterizing

antibodies that do not recognize normal human adult tau and measuring the cross-reactivity to

nonphospho-tau by treatment with phosphatase, but cannot capture the phospho-site specificity

(63). Steinhilb and colleagues have generated transgenic flies expressing tau with alanine point

mutations at several serine-proline and threonine-proline motifs of human tau (64). In this study,

they used fly head extracts from these transgenic lines to perform western blotting using

phospho-tau antibodies. In principle, this approach may be applied for validating phospho-tau

antibodies. However, all of these approaches are not ideal for quantitative measurement due to

frequent signal saturation in immunoblotting experiments (65).

Yeast surface display platform

Yeast surface display is a powerful method for isolating and engineering antibodies to increase

their affinity and specificity (66). Yeast surface display has been used to engineer antibodies

targeting several proteins, including T cell receptors (67), botulinum neurotoxin (68), and

19

huntingtin protein (69). Yeast display libraries, which has 107-109 transformants, are smaller than

phage or ribosome display libraries, which is 1011-1013, but have many advantages of eukaryotic

expressed proteins. They have eukaryotic expression, processing, and secretory pathway, which

suggest more complex PTMs of proteins (70).

In the yeast surface display system (Fig. 2.4), the antibody is displayed as a single chain variable

fragment (scFv) in which the heavy and light variable chains are connected by a flexible

polypeptide linker (Gly4Ser)3. The scFv is fused to the C-terminal end of agglutinin Aga2 protein,

which forms two disulfide bonds to the agglutinin Aga1 protein on the yeast surface. Both Aga1

and Aga2 protein are controlled under a galactose-inducible promoter. Each yeast cell displays

40,000-50,000 scFvs (66,71), and can be detected through immunofluorescence labeling of either

the c-myc or the hemagglutinin (HA) epitope tag flanking the scFv. The binding to an antigen of

interest can be detected by labeling the yeast cell with antigen and a secondary reagent

conjugated with fluorophore. Yeast surface display library enables quantitative screening using

fluorescence-activated cell sorting (FACS), and the antigen binding signal can be normalized for

expression, eliminating impacts due to host expression bias.

20

Figure 2.4 A schematic overview of scFv scaffold displayed on the surface of yeast The scFv is C-terminal fusion to the Aga2 and flanked by two epitopes: HA at the N-terminus and c-Myc at the C-terminus. The Aga2p forms two disulfide bonds with the Aga1p, which is anchored to the cell wall. Antigen binding is detected with a fluorophore FITC. Display of scFv is detected with a primary mouse anti-c-Myc antibody and a phycoerythrin-conjugated mouse secondary antibody (66).

Once the candidate scFvs are isolated from the library, they are engineered for improved affinity

and specificity (72) using random mutagenesis through error-prone PCR with nucleotide analogs

(73). The mutation frequency can be controlled by altering the number of PCR cycles and the

amount of nucleotide analogs. In addition, DNA shuffling (74,75) can be used to introduce

diversity into the library. The mutagenized library is created by transformation of yeast cells with

the mutated products and linearized vector through homologous recombination in yeast (75).

21

References




4. Cohen, P. (2001) The role of protein phosphorylation in human health and disease. The Sir Hans Krebs Medal Lecture. Eur J Biochem 268, 5001-5010

5. Aletta, J. M., and Hu, J. C. (2008) Protein arginine methylation in health and disease. Biotechnol Annu Rev 14, 203-224

6. Sakamoto, K. M. (2002) Ubiquitin-dependent proteolysis: its role in human diseases and the design of therapeutic strategies. Mol Genet Metab 77, 44-56

7. McIlwain, D. R., Berger, T., and Mak, T. W. (2013) Caspase functions in cell death and disease. Cold Spring Harb Perspect Biol 5, a008656

8. Santos, A. L., and Lindner, A. B. (2017) Protein Posttranslational Modifications: Roles in Aging and Age-Related Disease. Oxid Med Cell Longev 2017, 5716409

9. Li, C., and Gotz, J. (2017) Tau-based therapies in neurodegeneration: opportunities and challenges. Nat Rev Drug Discov 16, 863-883





14. Shih, H. H., Tu, C., Cao, W., Klein, A., Ramsey, R., Fennell, B. J., Lambert, M., Ni Shuilleabhain, D., Autin, B., Kouranova, E., Laxmanan, S., Braithwaite, S., Wu, L., Ait-Zahra, M., Milici, A. J., Dumin, J. A., LaVallie, E. R., Arai, M., Corcoran, C., Paulsen, J. E., Gill, D., Cunningham, O., Bard, J., Mosyak, L., and Finlay, W. J. (2012) An ultra-specific avian antibody to phosphorylated tau protein reveals a unique mechanism for phosphoepitope recognition. The Journal of biological chemistry 287, 44425-44434


16. Rosseels, J., Van den Brande, J., Violet, M., Jacobs, D., Grognet, P., Lopez, J., Huvent, I., Caldara, M., Swinnen, E., Papegaey, A., Caillierez, R., Buee-Scherrer, V., Engelborghs, S., Lippens, G., Colin, M., Buee, L., Galas, M. C., Vanmechelen, E., and Winderickx, J. (2015) Tau monoclonal antibody generation based on humanized yeast models: impact on Tau oligomerization and diagnostics. The Journal of biological chemistry 290, 4059-4074

17. d'Abramo, C., Acker, C. M., Jimenez, H. T., and Davies, P. (2013) Tau passive immunotherapy in mutant P301L mice: antibody affinity versus specificity. PloS one 8, e62402

18. Neve, R. L., Harris, P., Kosik, K. S., Kurnit, D. M., and Donlon, T. A. (1986) Identification of cDNA clones for the human microtubule-associated protein tau and chromosomal localization of the genes for tau and microtubule-associated protein 2. Brain Res 387, 271-280

19. Wang, J. Z., and Liu, F. (2008) Microtubule-associated protein tau in development, degeneration and protection of neurons. Prog Neurobiol 85, 148-175

22

20. Sergeant, N., Delacourte, A., and Buee, L. (2005) Tau protein as a differential biomarker of tauopathies. Biochim Biophys Acta 1739, 179-197

21. Goedert, M., and Jakes, R. (1990) Expression of separate isoforms of human tau protein: correlation with the tau pattern in brain and effects on tubulin polymerization. EMBO J 9, 4225-4230

22. Li, H. L., Wang, H. H., Liu, S. J., Deng, Y. Q., Zhang, Y. J., Tian, Q., Wang, X. C., Chen, X. Q., Yang, Y., Zhang, J. Y., Wang, Q., Xu, H., Liao, F. F., and Wang, J. Z. (2007) Phosphorylation of tau antagonizes apoptosis by stabilizing beta-catenin, a mechanism involved in Alzheimer's neurodegeneration. Proc Natl Acad Sci U S A 104, 3591-3596

23. Kopke, E., Tung, Y. C., Shaikh, S., Alonso, A. C., Iqbal, K., and Grundke-Iqbal, I. (1993) Microtubule-associated protein tau. Abnormal phosphorylation of a non-paired helical filament pool in Alzheimer disease. The Journal of biological chemistry 268, 24374-24384

24. Drewes, G., Trinczek, B., Illenberger, S., Biernat, J., Schmitt-Ulms, G., Meyer, H. E., Mandelkow, E. M., and Mandelkow, E. (1995) Microtubule-associated protein/microtubule affinity-regulating kinase (p110mark). A novel protein kinase that regulates tau-microtubule interactions and dynamic instability by phosphorylation at the Alzheimer-specific site serine 262. The Journal of biological chemistry 270, 7679-7688

25. Sengupta, A., Kabat, J., Novak, M., Wu, Q., Grundke-Iqbal, I., and Iqbal, K. (1998) Phosphorylation of tau at both Thr 231 and Ser 262 is required for maximal inhibition of its binding to microtubules. Arch Biochem Biophys 357, 299-309

26. von Bergen, M., Friedhoff, P., Biernat, J., Heberle, J., Mandelkow, E. M., and Mandelkow, E. (2000) Assembly of tau protein into Alzheimer paired helical filaments depends on a local sequence motif ((306)VQIVYK(311)) forming beta structure. Proceedings of the National Academy of Sciences of the United States of America 97, 5129-5134

27. Berger, Z., Roder, H., Hanna, A., Carlson, A., Rangachari, V., Yue, M., Wszolek, Z., Ashe, K., Knight, J., Dickson, D., Andorfer, C., Rosenberry, T. L., Lewis, J., Hutton, M., and Janus, C. (2007) Accumulation of pathological tau species and memory loss in a conditional model of tauopathy. The Journal of neuroscience : the official journal of the Society for Neuroscience 27, 3650-3662

28. Min, S. W., Cho, S. H., Zhou, Y., Schroeder, S., Haroutunian, V., Seeley, W. W., Huang, E. J., Shen, Y., Masliah, E., Mukherjee, C., Meyers, D., Cole, P. A., Ott, M., and Gan, L. (2010) Acetylation of tau inhibits its degradation and contributes to tauopathy. Neuron 67, 953-966

29. Cohen, T. J., Guo, J. L., Hurtado, D. E., Kwong, L. K., Mills, I. P., Trojanowski, J. Q., and Lee, V. M. (2011) The acetylation of tau inhibits its function and promotes pathological tau aggregation. Nature communications 2, 252

30. Irwin, D. J., Cohen, T. J., Grossman, M., Arnold, S. E., McCarty-Wood, E., Van Deerlin, V. M., Lee, V. M., and Trojanowski, J. Q. (2013) Acetylated tau neuropathology in sporadic and hereditary tauopathies. The American journal of pathology 183, 344-351


32. Mokhtar, S. H., Bakhuraysah, M. M., Cram, D. S., and Petratos, S. (2013) The Beta-amyloid protein of Alzheimer's disease: communication breakdown by modifying the neuronal cytoskeleton. Int J Alzheimers Dis 2013, 910502

33. Mohandas, E., Rajmohan, V., and Raghunath, B. (2009) Neurobiology of Alzheimer's disease. Indian J Psychiatry 51, 55-61

34. Burns, A., and Iliffe, S. (2009) Alzheimer's disease. BMJ 338, b158

23

35. Khatoon, S., Grundke-Iqbal, I., and Iqbal, K. (1992) Brain levels of microtubule-associated protein tau are elevated in Alzheimer's disease: a radioimmuno-slot-blot assay for nanograms of the protein. J Neurochem 59, 750-753

36. Khatoon, S., Grundke-Iqbal, I., and Iqbal, K. (1994) Levels of normal and abnormally phosphorylated tau in different cellular and regional compartments of Alzheimer disease and control brains. FEBS Lett 351, 80-84

37. Hanger, D. P., Anderton, B. H., and Noble, W. (2009) Tau phosphorylation: the therapeutic challenge for neurodegenerative disease. Trends Mol Med 15, 112-119

38. Simic, G., Babic Leko, M., Wray, S., Harrington, C., Delalle, I., Jovanov-Milosevic, N., Bazadona, D., Buee, L., de Silva, R., Di Giovanni, G., Wischik, C., and Hof, P. R. (2016) Tau Protein Hyperphosphorylation and Aggregation in Alzheimer's Disease and Other Tauopathies, and Possible Neuroprotective Strategies. Biomolecules 6, 6

39. Chai, X., Wu, S., Murray, T. K., Kinley, R., Cella, C. V., Sims, H., Buckner, N., Hanmer, J., Davies, P., O'Neill, M. J., Hutton, M. L., and Citron, M. (2011) Passive immunization with anti-Tau antibodies in two transgenic models: reduction of Tau pathology and delay of disease progression. J Biol Chem 286, 34457-34467

40. Boutajangout, A., Ingadottir, J., Davies, P., and Sigurdsson, E. M. (2011) Passive immunization targeting pathological phospho-tau protein in a mouse model reduces functional decline and clears tau aggregates from the brain. Journal of neurochemistry 118, 658-667

41. Kayed, R. (2010) Anti-tau oligomers passive vaccination for the treatment of Alzheimer disease. Hum Vaccin 6, 931-935

42. Asuni, A. A., Boutajangout, A., Quartermain, D., and Sigurdsson, E. M. (2007) Immunotherapy targeting pathological tau conformers in a tangle mouse model reduces brain pathology with associated functional improvements. J Neurosci 27, 9115-9129

43. Boutajangout, A., Quartermain, D., and Sigurdsson, E. M. (2010) Immunotherapy targeting pathological tau prevents cognitive decline in a new tangle mouse model. J Neurosci 30, 16559-16566

44. Lewis, J., McGowan, E., Rockwood, J., Melrose, H., Nacharaju, P., Van Slegtenhorst, M., Gwinn-Hardy, K., Paul Murphy, M., Baker, M., Yu, X., Duff, K., Hardy, J., Corral, A., Lin, W. L., Yen, S. H., Dickson, D. W., Davies, P., and Hutton, M. (2000) Neurofibrillary tangles, amyotrophy and progressive motor disturbance in mice expressing mutant (P301L) tau protein. Nat Genet 25, 402-405

45. Goedert, M., Jakes, R., Crowther, R. A., Cohen, P., Vanmechelen, E., Vandermeeren, M., and Cras, P. (1994) Epitope mapping of monoclonal antibodies to the paired helical filaments of Alzheimer's disease: identification of phosphorylation sites in tau protein. Biochem J 301 ( Pt 3), 871-877

46. Caccamo, A., Majumder, S., Richardson, A., Strong, R., and Oddo, S. (2010) Molecular interplay between mammalian target of rapamycin (mTOR), amyloid-beta, and Tau: effects on cognitive impairments. J Biol Chem 285, 13107-13120

47. Goedert, M., Jakes, R., Crowther, R. A., Six, J., Lubke, U., Vandermeeren, M., Cras, P., Trojanowski, J. Q., and Lee, V. M. (1993) The abnormal phosphorylation of tau protein at Ser-202 in Alzheimer disease recapitulates phosphorylation during development. Proc Natl Acad Sci U S A 90, 5066-5070

48. Biernat, J., Mandelkow, E. M., Schroter, C., Lichtenberg-Kraag, B., Steiner, B., Berling, B., Meyer, H., Mercken, M., Vandermeeren, A., Goedert, M., and Mandelkow, E. (1992) The switch of tau protein to an Alzheimer-like state includes the phosphorylation of two serine-proline motifs upstream of the microtubule binding region. EMBO J 11, 1593-1597

49. Goedert, M., Jakes, R., and Vanmechelen, E. (1995) Monoclonal antibody AT8 recognises tau protein phosphorylated at both serine 202 and threonine 205. Neurosci Lett 189, 167-169

24

50. Gotz, J., Probst, A., Spillantini, M. G., Schafer, T., Jakes, R., Burki, K., and Goedert, M. (1995) Somatodendritic localization and hyperphosphorylation of tau protein in transgenic mice expressing the longest human brain tau isoform. EMBO J 14, 1304-1313

51. Gotz, J., Chen, F., Barmettler, R., and Nitsch, R. M. (2001) Tau filament formation in transgenic mice expressing P301L tau. J Biol Chem 276, 529-534

52. Yanamandra, K., Kfoury, N., Jiang, H., Mahan, T. E., Ma, S., Maloney, S. E., Wozniak, D. F., Diamond, M. I., and Holtzman, D. M. (2013) Anti-tau antibodies that block tau aggregate seeding in vitro markedly decrease pathology and improve cognition in vivo. Neuron 80, 402-414

53. Zheng-Fischhofer, Q., Biernat, J., Mandelkow, E. M., Illenberger, S., Godemann, R., and Mandelkow, E. (1998) Sequential phosphorylation of Tau by glycogen synthase kinase-3beta and protein kinase A at Thr212 and Ser214 generates the Alzheimer-specific epitope of antibody AT100 and requires a paired-helical-filament-like conformation. Eur J Biochem 252, 542-552

54. Nakamura, K., Greenwood, A., Binder, L., Bigio, E. H., Denial, S., Nicholson, L., Zhou, X. Z., and Lu, K. P. (2012) Proline isomer-specific antibodies reveal the early pathogenic tau conformation in Alzheimer's disease. Cell 149, 232-244

55. Hoffmann, R., Lee, V. M., Leight, S., Varga, I., and Otvos, L., Jr. (1997) Unique Alzheimer's disease paired helical filament specific epitopes involve double phosphorylation at specific sites. Biochemistry 36, 8114-8124

56. Sankaranarayanan, S., Barten, D. M., Vana, L., Devidze, N., Yang, L., Cadelina, G., Hoque, N., DeCarr, L., Keenan, S., Lin, A., Cao, Y., Snyder, B., Zhang, B., Nitla, M., Hirschfeld, G., Barrezueta, N., Polson, C., Wes, P., Rangan, V. S., Cacace, A., Albright, C. F., Meredith, J., Jr., Trojanowski, J. Q., Lee, V. M., Brunden, K. R., and Ahlijanian, M. (2015) Passive immunization with phospho-tau antibodies reduces tau pathology and functional deficits in two distinct mouse tauopathy models. PloS one 10, e0125614

57. Dickson, D. W., Crystal, H. A., Bevona, C., Honer, W., Vincent, I., and Davies, P. (1995) Correlations of synaptic and pathological markers with cognition of the elderly. Neurobiol Aging 16, 285-298; discussion 298-304

58. Jicha, G. A., Lane, E., Vincent, I., Otvos, L., Jr., Hoffmann, R., and Davies, P. (1997) A conformation- and phosphorylation-dependent antibody recognizing the paired helical filaments of Alzheimer's disease. Journal of neurochemistry 69, 2087-2095

59. Greenberg, S. G., Davies, P., Schein, J. D., and Binder, L. I. (1992) Hydrofluoric acid-treated tau PHF proteins display the same biochemical properties as normal tau. J Biol Chem 267, 564-569

60. Otvos, L., Jr., Feiner, L., Lang, E., Szendrei, G. I., Goedert, M., and Lee, V. M. (1994) Monoclonal antibody PHF-1 recognizes tau protein phosphorylated at serine residues 396 and 404. J Neurosci Res 39, 669-673


62. Ercan, E., Eid, S., Weber, C., Kowalski, A., Bichmann, M., Behrendt, A., Matthes, F., Krauss, S., Reinhardt, P., Fulle, S., and Ehrnhoefer, D. E. (2017) A validated antibody panel for the characterization of tau post-translational modifications. Mol Neurodegener 12, 87

63. Mercken, M., Vandermeeren, M., Lubke, U., Six, J., Boons, J., Van de Voorde, A., Martin, J. J., and Gheuens, J. (1992) Monoclonal antibodies with selective specificity for Alzheimer Tau are directed against phosphatase-sensitive epitopes. Acta Neuropathol 84, 265-272

64. Steinhilb, M. L., Dias-Santagata, D., Fulga, T. A., Felch, D. L., and Feany, M. B. (2007) Tau phosphorylation sites work in concert to promote neurotoxicity in vivo. Molecular biology of the cell 18, 5060-5068

65. Janes, K. A. (2015) An analysis of critical factors for quantitative immunoblotting. Sci Signal 8, rs2

66. Boder, E. T., and Wittrup, K. D. (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nature biotechnology 15, 553-557

25

67. Kieke, M. C., Cho, B. K., Boder, E. T., Kranz, D. M., and Wittrup, K. D. (1997) Isolation of anti-T cell receptor scFv mutants by yeast surface display. Protein Eng 10, 1303-1310

68. Razai, A., Garcia-Rodriguez, C., Lou, J., Geren, I. N., Forsyth, C. M., Robles, Y., Tsai, R., Smith, T. J., Smith, L. A., Siegel, R. W., Feldhaus, M., and Marks, J. D. (2005) Molecular evolution of antibody affinity for sensitive detection of botulinum neurotoxin type A. J Mol Biol 351, 158-169

69. Colby, D. W., Garg, P., Holden, T., Chao, G., Webster, J. M., Messer, A., Ingram, V. M., and Wittrup, K. D. (2004) Development of a human light chain variable domain (V(L)) intracellular antibody specific for the amino terminus of huntingtin via yeast surface display. J Mol Biol 342, 901-912

70. Bowley, D. R., Labrijn, A. F., Zwick, M. B., and Burton, D. R. (2007) Antigen selection from an HIV-1 immune antibody library displayed on yeast yields many novel antibodies compared to selection from the same library displayed on phage. Protein Eng Des Sel 20, 81-90

71. Cho, Y. K., Chen, I., Wei, X., Li, L., and Shusta, E. V. (2009) A yeast display immunoprecipitation method for efficient isolation and characterization of antigens. Journal of immunological methods 341, 117-126

72. Hackel, B. J., Kapila, A., and Wittrup, K. D. (2008) Picomolar affinity fibronectin domains engineered utilizing loop length diversity, recursive mutagenesis, and loop shuffling. J Mol Biol 381, 1238-1252

73. Zaccolo, M., Williams, D. M., Brown, D. M., and Gherardi, E. (1996) An approach to random mutagenesis of DNA using mixtures of triphosphate derivatives of nucleoside analogues. J Mol Biol 255, 589-603

74. Stemmer, W. P. (1994) DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution. Proc Natl Acad Sci U S A 91, 10747-10751

75. Swers, J. S., Kellogg, B. A., and Wittrup, K. D. (2004) Shuffled antibody libraries created by in vivo homologous recombination and yeast surface display. Nucleic Acids Res 32, e36

26

Introduction

Antibodies that target post-translationally modified proteins are widely used in biology and

clinical investigations. Some antibodies can bind to a single modified amino acid (e.g.,

phosphorylated tyrosine) within the context of diverse nearby peptide sequences (1,2). However,

most widely used are antibodies specific to a modification site in a defined target protein

sequence, herein referred to as PTM-specific antibodies. Due to a large number of

experimentally identified post-translational modification sites (3), the demand for PTM-specific

antibodies continues to grow.

PTM is a key mechanism that enables reversible regulation of protein activity, conformation,

localization, turnover rate, and interactions. Abnormal PTMs result in dysregulation of these

processes and are often associated with pathological conditions. In case of the microtubule-

associated protein tau, numerous abnormal PTMs regulate its biology, and are associated with

several neurodegenerative diseases including AD, collectively referred to as tauopathies (4). Tau

contains 85 putative phosphorylation sites (5) and 14 putative acetylation sites (6).

Phosphorylation sites at or near the repeat elements of the microtubule binding domains are

particularly important for the pathophysiology of tauopathy (7). An increase in tau

phosphorylation, on average from 2-3 to 7-8 phosphate per molecule (7) results in preferential

phosphorylation at sites that decrease microtubule binding (8,9), and increases its propensity to

form oligomers and high order aggregates (7,10). Levels of tau oligomers showed a strong

correlation with memory loss in a mouse model of tauopathy (11). Acetylation at specific lysine

residues interferes with ubiquitination and subsequent degradation by the proteasome, resulting

27

in accumulation of phosphorylated tau and associated toxicity in mouse models (12-15).

Therefore, detection of tau PTMs at specific sites is valuable in identifying the cause and

tracking the progression of tauopathies.

However, robust detection of PTMs is challenging due to their dynamic and heterogeneous

nature. Only a fraction of a protein is modified at any given time, and the dynamics may vary

within a tissue across different cell types (16-18). Therefore, the affinity and specificity of PTM-

specific antibodies are critical for sensitive and reproducible detection of PTMs (19). PTM-

specific antibodies should interact only with the modified target site, with high affinity to capture

potentially a small fraction of the modified form. In case of tau PTM-specific antibodies, their

affinity and specificity are particularly important, since they dictate their efficacy in a wide range

of applications. High-affinity antibodies are superior in detecting tau PTMs from clinical

samples (20), but mouse model experiments suggest that high specificity antibodies may be more

beneficial for passive immunotherapy targeting tau (21).

Even though many PTM-specific antibodies exist, high-affinity antibodies with high PTM-

specificity are rarely found. Rodent immunization approaches often fail or produce low-affinity

antibodies. This is because the peptide epitopes containing PTMs are weak immunogens in mice

(22), PTMs undergo rapid degradation in vivo regardless of the immunization route (23), and B-

cell response shows an affinity ceiling (24,25). Screening recombinant antibody libraries in vitro

is a promising alternative. However, in vitro library screening strategies tend to generate PTM-

specific antibodies with a low or moderate affinity (Kd ~ µM to 100 nM range) (26-29).

Obtaining high specificity antibodies targeting PTMs is even more challenging. In fact, many

commercially available PTM-specific antibodies have not been validated for their specificity.

Recent evidences using various approaches, including immunoassays using synthetic peptides

28

and peptide arrays, have shown that indeed a significant fraction of existing PTM-targeting

antibodies lack specificity (30-34). These studies have identified major species that non-

specifically bind to the antibodies, including non-modified epitopes with the target amino acid

sequence and those with modifications at non-target sites (31,34).

Recently, X-ray crystal structures of phospho-specific antibodies have revealed a key insight on

how PTM-targeting antibodies may gain specificity (26,27). In these antibodies, a set of

complementarity determining region (CDR) residues were found to interact with the phosphate

group, while others make contacts with the amino acid residues nearby, leading to recognition of

both the modification and target sequence. Therefore, balancing the stability of interaction of

these distinct sets of CDR residues seems to be important in gaining both the affinity and

specificity. It is plausible that high-affinity PTM-targeting antibodies can achieve such tight

binding by stabilizing the interaction towards either the modified amino acid or peptide sequence,

potentially leading to unwanted cross-reactivity. Therefore, we hypothesized that a trade-off

between affinity and specificity might exist in PTM-targeting antibodies.

To test this hypothesis, we sought to assess the impact of in vitro affinity maturation on the

specificity of PTM-targeting antibodies. Starting from an existing high-specificity antibody (27)

targeting phosphorylated T231 of human tau (pT231, numbering based on the 441 amino acid

2N4R isoform), we generated a single-chain variable fragment (scFv) and improved its affinity

using directed evolution. To assess the specificity of PTM-targeting antibodies, we developed an

experimental approach based on yeast surface display (35) to quantify scFv binding against a

defined set of structurally similar epitopes. Specifically, peptides representing the

phosphorylated epitope, non-phosphorylated epitope, or a phosphorylated epitope with the same

amino acid composition, but scrambled sequence were labeled for detection. Their interactions

29

with yeast displayed antibody fragments were quantified using flow cytometry. Indeed, the

original high-specificity phospho-tau scFv showed nearly perfect specificity in this assay, in

agreement with previous characterizations (27). We found that through directed evolution, the

affinity could be improved by > 20-fold, reaching picomolar monovalent dissociation constants.

However, the majority of affinity-improved scFvs showed significant non-specific binding to the

non-phosphorylated epitope but not to the scrambled phospho-epitope, suggesting that high-

affinity clones tend to gain affinity by stabilizing the interaction with the amino acid residues

surrounding the modification site. Even though the majority of clones showed a trade-off

between their affinity and specificity, this was not necessarily the case for some unique clones.

By assessing the binding specificity, we identified a picomolar-affinity clone with specificity

profiles that match the original high-specificity antibody. These results demonstrated that a

quantitative assessment of both affinity and specificity was critical for identifying high affinity

and specificity antibodies targeting PTMs.

Materials and Methods

3.2.1 Yeast surface display of pT231 scFv

Amino acid sequence of VL and VH from an anti-tau pT231 antibody (27) was back-translated

to DNA sequence, yeast-codon optimized and synthesized (Integrated DNA Technologies). A

(G4S)3 linker was inserted between the VL and VH sequences (5’-VL-linker-VH) to create a

fusion construct encoding a scFv sequence. The synthesized scFv gene was cloned using PCR to

add a 5’ NheI and a 3’ BsrGI (New England Biolabs) restriction sites. The PCR products were

ligated into the vector pCT4RE (35) (a gift from Dr. Eric Shusta). This plasmid included an N-

30

terminal c-myc epitope tag and a C-terminal FLAG epitope tag. The pCT4RE plasmid was

transformed into S. cerevisiae EBY100 (35) (a gift from Dr. Dane Wittrup).

3.2.2 Peptide modification and purification

All peptides used were purchased from a commercial source (Peptide 2.0). Peptides contained a

C-terminal cysteine for chemical modification. Peptides to be modified were dissolved at 1 mM

in phosphate-buffered saline (PBS, 8 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4, 0.24 g/L

KH2PO4, pH 7.4) at room temperature. A 10 mM stock solution of Alexa Fluor 488 C5

maleimide (Thermo Fisher Scientific) was prepared in deionized H2O, and a 100 mM stock

solution EZ-link maleimide-PEG11-biotin (Thermo Fisher Scientific) was prepared in dimethyl

sulfoxide (DMSO). The Alexa Fluor 488 C5 maleimide stock solution was protected from light

by wrapping container with aluminum foil. For peptide modification, either Alexa Fluor 488 C5

maleimide or EZ-Link maleimide-PEG11-biotin stock solution was added to the peptide PBS

solution at a final reagent concentration of 2 mM. The reactions proceeded at 4 oC overnight in

the dark.

Modified peptides were purified using an HPLC system (Shimadzu SCL-10Avp), equipped with

a preparative column (Waters, Atlantis T3, 100 Å, 10 µm, 10 mm x 250 mm). For the mobile

phase, solvent A consisted of 99.9 % H2O and 0.1 % trifluoroacetic acid, and solvent B consisted

of 99.9 % methanol and 0.1 % trifluoroacetic acid. Solvent flow rate was 3.5 mL/min. The

column temperature was set at 50 oC. For each HPLC run, 100 µL of the peptide reaction mixture

was injected. The gradient for peptides was as following: 0 % solvent B at 0 min, 20 % solvent B

at 1 min, 40 % solvent B at 26 min, solvent 75 % B at 31 min, and 100 % solvent B at 36 min.

Purified peptide fractions, which were detected at 214 nm, were collected, lyophilized, and

stored at - 20 oC.

31

Mass spectrometry of the modified peptides was conducted using a QStar Elite hybrid QTOF

mass spectrometer (AB Sciex). TOF spectra ((300-2000 m/z) were acquired using Analyst QS

2.0 software.

3.2.3 Directed evolution of pT231 scFv

pT231 scFv was randomly mutagenized as described previously (36) with the following

modifications. Error-prone PCR using a mixture of triphosphates of nucleoside analogs. Each

PCR consisted of ~ 250 ng of plasmid template, 0.5 µM of forward and reverse primer, 200 uM

of dNTP mix (Thermo Fisher Scientific), Taq PCR buffer (without MgCl2), 2 mM of MgCl2, 2.5

units of Platinum Taq DNA polymerase (Thermo Fisher Scientific), 2 µM of 8-Oxo-2'-

deoxyguanosine-5'-triphosphate (Tri-Link Biotechnologies, 8-Oxo-dGTP) and 2 µM of 2'-

Deoxy-P-nucleoside-5'-Triphosphate (Tri-Link, Biotechnologies dPTP) in a 50 µL of reaction

volume. The mixture was denatured at 94 oC for 3 min followed by 19 cycles of 94 oC for 45 s,

55 oC for 30 s, and 72 oC for 60 s and a final extension of 72 oC for 10 min on a thermocycler.

The PCR product was gel-purified using a gel extraction kit (Zymo Research). 2 µL of purified

mutagenesis product was added to a 100 µL of PCR reaction solution without using nucleoside

analogs to amplify the mutated fragments. About 6.4 µg of mutated pT231 scFv gene, and 1 µg

of vector pCT4RE (a gift from Dr. Eric Shusta) were combined with 200 µL of electrocompetent

EBY 100 (a gift from Dr. Dane Wittrup) and electroporated at 2.5 kV and 25 µF capacitance

using the GenePulser (Bio-Rad, 0.2 cm Electrode gap cuvette). The electroporated cells were

grown in SD-CAA media (0.1 M sodium phosphate, pH 6.0, 6.7 g/L yeast nitrogen base, 5 g/L

casamino acids, 20 g/L glucose) at 30 oC and 250 rpm. Frozen aliquots of the library were

prepared by freezing 10x library diversity in yeast freezing media (2 % glycerol and 6.7 g/L

yeast nitrogen base) at - 80 oC for long-term storage.

32

For the following rounds of gene diversification, it was realized by shuffling the library screened

in the previous round, followed by the above random mutagenesis procedure to incorporate

additional mutations. The plasmid DNA from the library pool was isolated using a yeast plasmid

miniprep kit (Zymo Research). pT231 scFv library gene was PCR amplified with primers

flanking the region. 2-4 µg of the PCR product was digested with 0.0015 unit of DNase I (New

England BioLabs) per µL in 100 µL of reaction mixture for 15 min at room temperature.

Fragments of 10-50 bp were purified from 2 % low melting agarose gel by electrophoresis and

then re-suspended in 50 µL of PCR reaction without primers. A PCR program of 94 oC for 3 min;

29 cycles of 94 oC for 30 s, 55 oC for 30 s, 72 oC for 30 s, and 72 oC for 10 min was used on a

thermocycler. Mixtures of DNA fragments were reassembled into a gene at defined positions

based on gene homology.

Fluorescence activated cell sorting was used to screen for yeast cells displaying high-affinity

scFvs. 10x library diversity of cells were pelleted and washed with 1 mL of phosphate-buffered

saline with bovine serum albumin (PBSA, 8 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4, 0.24 g/L

KH2PO4, 1 g/L bovine serum albumin, pH 7.4) twice. The cells were incubated with Pphos-b in 3

mL PBSA at room temperature for 1 hour. After labeling with peptide, the cells were primarily

stained with mouse anti-FLAG (Sigma, 1:1000 dilution) in 1 mL of PBSA on ice for 30 min, and

then secondarily stained with goat anti-mouse Alexa Fluor 488 (Thermo Fisher Scientific, 1:100

dilution) and streptavidin R-phycoerythrin (SAPE, Thermo Fisher Scientific, 1:100 dilution) in 1

mL of PBSA on ice for 30 min. Pelleting and washing the cells with 500 µL of PBSA were

required between all labeling steps to remove any unbound peptides and antibodies. After

labeling, the cells were re-suspended in 3 mL of PBSA and treated with 1 µM of unmodified

phosphopeptide at room temperature for 7 min. The screening was carried out on a Becton-

33

Dickinson FACSAria II, which was equipped with five different lasers. Data of cell screening

was acquired using BD FACSDiva software. The collected cells were grown in SD-CAA media

plus 1 % kanamycin at 30 oC, 250 rpm overnight. After several rounds of cell propagation, 10x

library diversity of cells were archived in yeast freezing media at -80 oC.

3.2.4 Purification of pT231 scFvs

The pT231 scFv gene was inserted into the vector pRS316 (a gift from Dr. Eric Shusta), which

had been restriction-digested with NheI and BsrGI (New England Biolabs). This plasmid

included a C-terminal hexa-histidine epitope tag. The pRS316 plasmid was transformed into S.

cerevisiae YVH10 cells (37) (a gift from Dr. Eric Shusta) for protein secretion and purification.

Cells were grown in 500 mL of SD-CAA plus tryptophan media at 30 oC, 250 rpm for 3 days,

pelleted, and re-suspended in 500 mL of SG-CAA plus tryptophan with 0.1% bovine serum

albumin (Sigma-Aldrich) at 20 oC, 250 rpm for 3 days to induce and secrete the scFvs. The cells

were pelleted, and supernatant containing scFv was collected and filtered using bottle-top filter

(Corning, PES membrane, 0.22 µm) to remove the yeast cells and cell lysate. The scFv

supernatant was firstly concentrated to 50 mL by ultrafiltration using a selective permeable

membrane (Millipore Sigma, 10 kDa) under nitrogen pressure. The concentrated supernatant was

then dialyzed to exchange buffer in 5 L of phosphate-buffered saline (0.01 M sodium phosphate,

0.15 M NaCl, pH 8.0) at 4 oC overnight. The dialyzed scFvs solution was purified as described

previously (38), using the SuperFlow Ni-NTA beads (Qiagen). The purified scFvs were resolved

using SDS-PAGE in tris-glycine running buffer (14.4 g/L glycine, 1 g/L SDS, 3.03 g/L Tris base)

with 12 % Bis-Tris gels. SeeBlue® pre-stained protein standard (Thermo Fisher Scientific) was

used to determine the molecular weights.

34

3.2.5 Fluorescent tagging of purified pT231 scFvs

The scFv elution fractions were pooled and concentrated using a centrifugal filter unit (Millipore

Sigma, Amicon Ultra, 10 kDa MWCO). The concentrated scFvs were diluted to 3 mg/mL in 0.1

M sodium bicarbonate buffer at pH 8.3. The amine-reactive dye Alexa Fluor 594 NHS ester

(Thermo Fisher Scientific) was prepared in dimethylformamide (DMF) at 10 mg/mL

immediately before use. 35 µg of Alexa Fluor 594 NHS ester from the stock solution was added

to 100 µg of purified scFv. The reaction mixture was incubated for 1 hour at room temperature in

the dark. Unreacted dye was removed using the Zeba desalting columns (Thermo Fisher

Scientific, 7 kDa MWCO), and the concentrations of modified scFvs were determined using a

Bradford assay (Thermo Fisher Scientific).

3.2.6 Immunocytochemistry in HEK 293 cells

The HEK 293 cells were transfected with pRK5-EGFP-Tau (Addgene 46904), which contained

human tau (MAPT 0N4R) fused to EGFP at the N-terminus. Cells were rinsed once with 0.5 mL

of ice-cold PBSCM buffer (0.15 M NaCl, 1.9 mM NaH2PO4, 8.1 mM Na2HPO4, 1 mM CaCl2,

0.5 mM Mg2SO4, pH 7.4), fixed in 4% paraformaldehyde (Sigma) in PBSCM at room

temperature for 15 min, and then permeabilized using 0.1% Triton X-100 (Acros Organics) in

PBSCM at room temperature for 15 min. After washing three times with PBSCM, the cells

incubated with 0.1 µM of Alexa Fluor 594 conjugated scFv in 0.5 mL of PBSCM with 40% goat

serum (PBSG) at 4 oC overnight in the dark. The cells were washed three times with ice cold 0.5

mL PBSCM, stained with 0.3 µM of DAPI (Thermo Fisher Scientific) at room temperature for 5

min, washed once with 0.5 mL of ice-cold PBSCM. The cells were imaged using a Nikon A1R

confocal microscope (UConn Center for Open Research Resources and Equipment).

35

3.2.7 Immunohistochemistry in brain tissue sections

All mouse (n=3 PS19, 3 wild-type C57BL6/J, and 3 tau knock-out) and human (n=2 AD cases

and n=2 aged control) tissues were sectioned at 30 µm stained as free floating sections using

Netwell baskets (VWR Cat#29442-132) in 12-well Falcon plates (Cat#353043). Extracted mouse

tissues were flash frozen on dry ice, sectioned onto slides (Millenia 2.0 Adhesion Slides Catalog

# 318), and fixed in cold 4% PFA for 3 minutes prior to staining. Human tissues were fixed and

stored in PLP until sectioned using a Leica VT1200S vibratome. To quench lipofuscin

autofluorescence, human tissue sections were photobleached under a 1500 lumen white LED

bulb for 72 hours at 4°C while suspended in PBS with no lid or covering (39). Following mouse

tissue fixation and human tissue bleaching, all sections were then washed three times in PBS for

30 seconds per wash followed by a 5-minute incubation in detergent media (TBS with 0.25%

Triton-X). Tissue was then incubated for 30 minutes in citrate-based antigen unmasking solution

(Vector Cat#H-3300) at 95°C. Tissue was blocked with gentle rotating for 2 hours in detergent

media with 5% donkey serum (Sigma-Aldrich D9663-10mL). After blocking, free floating

human tissue sections were moved into separate wells of a 24-well plate with 300 µL of the

appropriate scFv dilution and no basket; mouse tissue was stained directly on the slides with 200

µL of the appropriate scFv dilution. Tissues were incubated with the scFvs for 3 hours at room

temperature with gentle rotation.

Following scFv incubation, tissue sections were incubated with 1 µg/mL of DAPI in the dark for

5 minutes at room temperature. Tissues were then washed four times in PBS for 5 minutes each

and carefully placed on Millenia 2.0 slides using a histology brush if free floating (Fisher

Scientific Cat#NC0344756). Excess water was allowed to evaporate for 15 minutes, then each

slide was mounted with 100uL of Prolong Gold Antifade Reagent (Thermo Fisher Cat#P36930)

36

and a 1 mm cover slip. Imaging was done using a Zeiss LSM 710 confocal microscope, ensuring

equal parameters for digital gain (790), pinhole (30 um), and laser power (4.4%) for all images.

Following imaging, images were processed using the Fiji distribution of ImageJ. The magic

wand tool was used to select individual tangles as a region of interest (ROI) which was then

measured for average fluorescence intensity

Results

3.3.1 Yeast surface display of a phospho-tau scFv

To test our hypothesis, we first developed an assay to quantify antibody specificity using yeast

surface display (Figure 3.1). Synthetic peptides that represent the exact target epitope, as well as

other potentially cross-reacting species were labeled for detection. Since yeast surface display

allows surface expression of 40,000-50,000 scFvs per cell (35,40), we anticipated that binding of

multiple structurally-related epitopes displayed on yeast could be quantified using multicolor

flow cytometry (Figure 3.1). To demonstrate this concept, we used the previously identified

high-specificity anti-phospho-tau antibody which targets pT231 (27). We cloned the antibody as

a VL-VH single-chain variable region fragment (pT231 scFv), fused to the N-terminus of the

yeast cell wall protein Aga2p (Figure 3.1).

37

Figure 3.1 Schematic representation of antibody specificity quantification using yeast surface display Individual peptide epitope binding to single chain variable region fragments displayed on yeast can be quantified. By labeling multiple peptides with distinct tags, competitive binding of potentially cross-reacting epitopes, such as a phosphopeptide and non-phosphopeptide (peptide mix indicated by a dotted box) can be quantified using multicolor flow cytometry.

3.3.2 Chemical labeling of peptides to generate distinctively labeled epitopes

To detect the interaction between pT231 scFv and the target phosphoepitope, a synthetic

phosphopeptide (Pphos, KKVAVVRpTPPKpSPSSAKC) was labeled with Alexa 488 at the C-

terminal cysteine using Alexa Fluor 488 C5 maleimide. The resulting peptide was purified using

high-performance liquid chromatography (HPLC), and the label was validated using mass

spectrometry (Figure 3.2a). To quantify the specificity of the scFv to structurally similar

epitopes, including the non-phosphoepitope and a phosphoepitope with scrambled amino acid

sequence, we labeled peptides representing the non-phosphoepitope (Pnonphos,

KKVAVVRTPPKSPSSAKC) and a scrambled phosphoepitope (Pscram,

KAVpSASVPVSRKpTKPPKC) with biotin at the C-terminal cysteine using maleimide-PEG11-

biotin (Figure 3.2, data not shown). To enable measurement of binding curve, we also generated

a phosphopeptide labeled with a second tag, biotin (Figure 3.2b).

38

Figure 3.2. Modified peptides purification and confirmation a, conjugation of Alexa Fluor 488 C5 maleimide to cysteine-Pphos and HPLC purification. HPLC elution profiles of free cysteine-Pphos (top), free Alexa Fluor 488 C5 maleimide (second), and conjugation reaction of the cysteine-Pphos to Alexa Fluor 488 C5 maleimide (bottom). A good separation between the Pphos-A488conjugate and other reactants facilitates purification. b, mass spectra showing Pphos-b and Pnonphos-b conjugate with no free cysteine-peptide.

3.3.3 Verification of binding activity of yeast displayed pT231 scFv

The scFv expression on the yeast cell surface and binding to the phosphoepitope were confirmed

using confocal microscopy (Figure 3.3a), using Streptavidin-R-phycoerythrin (SA-PE) as a

detection reagent. The affinity (dissociation constant Kd) of the yeast displayed pT231 scFv, as

determined by titrating the biotinylated phosphopeptide (Pphos-b) was 2.2 ± 0.4 nM (Figure

3.3b, mean ± standard deviation), which is lower than the monovalent affinity for the full-length

IgG (Kd = 0.35 nM) generated using the same variable regions (27). Even though scFv constructs

are highly advantageous for imaging (41) and delivery (42-44), a 5 to 15-fold reduction in

39

affinity upon conversion of IgG to scFv had been reported (42,45), potentially due to higher

stability and functional concentration of full IgGs.

Figure 3.3 Binding activity of yeast displayed pT231 scFv a, confocal microscope images of yeast displayed pT231 scFv and an isotype-matched control scFv. scFv expression shown in red was detected using a mouse anti-FLAG antibody to assess full-length scFv expression. Cognate phosphopeptide (Pphos) binding is indicated in green. Scale bars, 5 µm. b, affinity measurement of yeast displayed pT231 scFv. The yeast cells were incubated with serial dilution of Pphos. Error bars indicate standard deviation from three independent experiments.

To confirm that the yeast displayed scFv was properly folded, we generated alanine point

mutations in the CDR residues that interacted with the phosphoepitope (Figure 3.4), according

to the published x-ray structure of the antibody-phosphopeptide complex (27). Alanine point

mutations in all phosphoepitope interacting CDRs (single alanine substitutions in either CDR-H2,

CDR-H3, CDR-L1, CDR-L2, or CDR-L3) substantially reduced phosphopeptide binding

(Figure 3.4), indicating that CDR residues were correctly presented in the yeast displaying scFv.

40

Figure 3.4 Assessment of CDR mutations on phosphopeptide binding of yeast displayed pT231 scFv Alanine point mutations were introduced to scFv residues that directly interact with the phosphopeptide, according to the pT231 Fab-phosphopeptide crystal structure (PDB entry 4GLR). Yeast displayed wild-type pT231 scFv and alanine point mutants at indicated amino acid positions were incubated with Pphos-b at 1 µM. Control scFv indicates an isotype-matched random scFv. Amino acid numbering and CDRs are defined according to Kabat numbering scheme. Error bars indicate standard deviation from three independent experiments. Dunnett's multiple comparisons test, * P ≤ 0.05, **** P ≤ 0.0001, otherwise, P > 0.05.

3.3.4 Assessment of antibody phospho-specificity using yeast surface display

Having verified the binding activity of the pT231 scFv, we quantified the specificity of the scFv

to structurally similar epitopes, including the non-phosphoepitope and a phosphoepitope with

scrambled amino acid sequence. When we assessed the binding of pT231 to the phosphopeptide

labeled with Alexa 488 (Pphos-A488) using flow cytometry, we found that the signal intensity of

scFv-phosphopeptide was lower, compared to the signal obtained from Pphos-b (data not shown).

Such a difference could be attributed to the fact that the brightness of R-phycoerythrin (molar

absorption coefficient ´ quantum yield = 19.6 ´ 105 M-1cm-1 ´ 0.82 = 16.1 ´ 105 M-1cm-1) (46) is

41

24-fold higher than that of Alexa 488 (0.73 ´ 105 M-1cm-1 ´ 0.92 = 0.67 ´ 105 M-1cm-1,

manufacturer specifications). Therefore, we amplified the signal from Alexa 488, using an anti-

Alexa 488 antibody (rabbit polyclonal) followed by an anti-rabbit IgG conjugated with Alexa

488, which resulted in 10-fold increase in the scFv-Pphos-A488 signal (data not shown). When

yeast cells displaying the pT231 scFv were incubated with an equimolar mixture of Pphos-b and

Pphos-A488 (both at 0.5 µM), signals from both labels were detected using flow cytometry

(Figure 3.5), as anticipated in the multi-color labeling scheme (Figure 3.1). To assess the

specificity, yeast cells displaying pT231 scFv were incubated with a mixture of either Pphos-

A488 and Pnonphos-b (both at 0.5 µM) or Pphos-A488 and Pscram-b (both at 0.5 µM). In these

experiments, the yeast cells showed labeling almost exclusively by the target phosphopeptide

(Pphos-A488), and no detectable binding to the non-phosphopeptide (Pnonphos-b) or scrambled

phosphopeptide (Pscram-b) (Figure 3.5). These results confirmed the previous report of high

specificity of the pT231 antibody (27), and demonstrated the effectiveness of our specificity

quantification assay.

Figure 3.5 Assessment of the specificity of yeast displayed pT231 scFv Flow cytometry dot plots for yeast displayed WT pT231 scFv (top row) or an isotype-matched control scFv

42

(bottom row). The first column shows data for scFv expression and biotinylated phosphopeptide (Pphos-b) binding. In the following columns, yeast cells were incubated with a mixture of either Pnonphos-b and Pphos-A488 (second column), or Pscram-b and Pphos-A488, or Pphos-b and Pphos-A488, all at 0.5 µM.

3.3.5 Directed evolution of pT231 scFv for improved affinity

We performed directed evolution of the pT231 scFv by applying selection pressure to enhance

the affinity (Figure 3.6a). We generated a random mutation library of the pT231 scFv using

error-prone PCR (47) followed by electroporation in yeast (48), yielding approximately 3 ´ 107

transformants displaying the scFv variants. The scFv library was subjected to three rounds of

fluorescence-activated cell sorting (FACS) (Figure 3.6a). After round 1 and 2, the sorted scFv

sequences were further diversified using DNA shuffling followed by random mutagenesis

(Figure 3.6a). Throughout the FACS process, selection pressure for higher affinity was applied

by incubating yeast cells displaying pT231 mutants with progressively lower concentration of

Pphos-b (Figure 3.6a) followed by incubation with 1 µM of unlabeled phosphopeptide (Pphos)

for dissociation (49), and sorting for high Pphos-b binding vs. scFv expression (using anti-c-Myc

antibody) (Figure 3.6b). After three rounds of FACS, a population of high Pphos-b was enriched

(Figure 3.6c).

43

Figure 3.6 Directed evolution of yeast displayed pT231 scFv variants with improved affinity a, flow chart for the directed evolution process. High-affinity variants were sorted using FACS. b, flow cytometry dot plot with a sorting gate used for screening cells with scFv expression and high Pphos-b binding. c, Dot plots comparing yeast displaying WT pT231 scFv (left) and a yeast pool resulting from three rounds of sorting and mutagenesis (right) were labeled for scFv expression and Pphos-A488 binding.

We sequenced individual clones from this pool and identified 27 unique scFv mutant sequences

(Figure 3.7). Even though all 27 clones had distinct sequences with mutations throughout the

scFv sequence, several high occurrence mutations were found (Figure 3.7).

44

Figure 3.7 Amino acid sequence of individual mutants isolated from the screen for improved affinity The sequences in the boxes indicate CDRs. High occurrence mutations are indicated in bold. Kabat numbering is indicated at the top.

The majority of frequent mutations (residues with occurrence labeled in bold in Figure 3.7) were

found in or near the CDRs (Kabat numbering): VLW50L and VLS56C (L2), VLA95T,

VHG100HD (or S), VHD101G, and VHA102T (H3) (Figure 3.8). Mutations VLD57G, VHG74C,

and VHA93V were in the framework regions (Figure 3.8).

45

Figure 3.8 High occurrence mutations identified from the screen mapped on WT pT231 scFv structure Heavy chain is shown in green and light chain in purple. Position of high occurrence mutations are indicated in red, and labeled with the wild-type amino acid. Boxed amino acids indicate those mutated in the scFv 3.24. The structure was generated using CCP4MG, based on protein data bank (PDB) entry 4GLR.

3.3.6 Characterization of affinity and specificity of scFv mutants

To assess the effectiveness of the directed evolution, we characterized the clones isolated after

three rounds of sorting for their affinity and specificity. For these analyses, we chose the first 14

unique clones identified from sequencing (clones 3.1 to 3.14, Figure 3.7). To rapidly compare

the affinity to that of the WT pT231 scFv, we incubated yeast cells displaying mutant scFvs with

2 nM of Pphos-b, which was near the Kd of the WT pT231 scFv. At this peptide concentration, 7

out of 14 clones showed significantly higher binding (normalized to the scFv expression level)

46

compared to that of the WT scFv (Figure 3.9a, P < 0.05, Dunnett’s multiple comparisons test).

Based on the binding/expression level, we chose scFv mutant 3.05 (containing 6 mutations,

Figure 3.7) and measured its affinity by displaying it on yeast and generating a titration curve

for the Pphos-b binding (Figure 3.9b). scFv 3.05 showed a 21-fold improvement in affinity over

that of the WT pT231 scFv, reaching picomolar monovalent binding affinity (Kd = 92 ± 1 pM)

(Figure 3.9b). To characterize the phospho-specificity of the 14 mutant clones, we first

measured the individual binding to Pnonphos-b and Pscram-b of the 14 clones (Figure 3.9c, d).

We found that of the 14 clones, 6 showed significant binding to the Pnonphos-b (Figure 3.9c, P

< 0.01, Dunnett’s multiple comparisons test), while none of the clones showed detectable

binding to the Pscram-b (Figure 3.9d). When we assessed the specificity of the high-affinity

scFv 3.05 using competitive binding between Pphos-A488 and Pnonphos-b, significant binding

to Pnonphos-b was detected (data not shown). Taken together, these results suggested that some

of the clones gained affinity by stabilizing the interaction to the target peptide sequence, while

none of the clones gained affinity to the phosphate group alone to cause cross-reactivity towards

Pscram-b. Conversely, the fact that some of the clones did not show significant binding to the

Pnonphos-b (Figure 3.9c) suggested that improving affinity did not necessarily lead to enhanced

cross-reactivity towards the non-phosphorylated epitope. In order to identify an optimal clone

with improved affinity and high specificity, we selected additional clones based on the sequence

homology and occurrence of mutations (Figure 3.7), and assessed their binding to Pphos-b,

Pnonphos-b, and Pscram-b. From this characterization, we identified scFv 3.24 (containing 5

mutations) that showed 11-fold of improvement in binding affinity over the WT pT231 (Figure

3.9e, Kd = 160 ± 50 pM) and no significant change in binding to Pnonphos-b compared to that of

wild-type pT231 (Figure 3.9f). These results indicate that in phospho-specific antibodies,

47

applying selection pressure towards improved affinity does result in cross-reactivity in a

significant fraction of clones. Therefore, high-affinity clones need to be checked for phospho-

specificity in order to improve the binding affinity through directed evolution.

Figure 3.9 Characterization of affinity and specificity of individual scFvs a, binding intensity normalized to the expression level of yeast displayed WT pT231 scFv and mutants to Pphos-b at 2 nM. The right most sample was the WT pT231 scFv incubated with Pphos-b at 1 µM, as a positive control. b, Affinity titration for yeast-displayed scFv 3.05. Binding intensity of yeast displayed WT

48

pT231 scFv and mutants to Pnonphos-b at 1 µM in c, and Pscram-b at 1 µM in d, respectively. e, affinity titration for yeast-displayed scFv 3.24. f, Binding intensity normalized to the expression level of yeast displayed WT pT231 scFv and mutants to Pnonphos-b at 1 µM. Error bars indicate standard deviation from three independent experiments. Statistics for panels (a, c, d, and f): Dunnett's multiple comparisons test, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001, otherwise, P > 0.05.

3.3.7 Cell and tissue section labeling using purified scFvs

High affinity and specificity reagents are expected to enable sensitive detection of tau

phosphorylation in complex samples. We tested the performance of the scFvs in

immunocytochemistry and immunohistochemistry experiments. In order to perform the labeling

experiments, we cloned the wild-type scFv and mutant 3.24 into a vector containing a synthetic

secretion signal (38) to secrete them using yeast S. cerevisiae. The secreted scFvs were purified

using a hexa-histidine motif at the C-terminus. When we resolved the purified scFvs using SDS-

PAGE followed by Coomassie staining, the gel loaded with purified scFvs showed a single

protein band with a molecular weight of 28 kDa, which is typical for scFvs (50), with ~92%

purity as quantified by densitometry of the gel (data not shown). To enable direct imaging of the

scFvs without the use of secondary reagents, the purified scFvs were fluorescently labeled with

Alexa 594 through modification of lysine residues (NHS-Alexa Fluor 594) and purified. In order

to assess the specificity, the fluorescent scFvs were used to label human embryonic kidney cells

(HEK293FT) transiently expressing human tau (microtubule-associated protein tau (MAPT)

0N4R) as a GFP fusion (EGFP-tau) (51). When high concentrations (100 nM) of the WT pT231

scFv or scFv 3.24 were used for staining, clear scFv signal was detected in HEK293FT cells

expressing wild-type tau (Figure 3.10, top row) but not to the same cells treated with 𝜆

phosphatase (Figure 3.10, second row). These results indicate that the binding of wild-type

pT231 scFv and mutant 3.24 requires phosphorylation of tau, and as reported previously, the tau

expressed in HEK293 cells is phosphorylated (52,53). In order to further assess the specificity of

49

the scFvs, we generated point mutants of human tau at the target phosphorylation site (T231)

either incapable of phosphorylation (T231A) or pseudophosphorylated (T231E). In HEK293FT

cells expressing EGFP-tau T231A, both the wild-type pT231 scFv and mutant 3.24 showed no

detectable binding (Figure 3.10, third row), while in the same cells expressing EGFP-tau T231E,

both scFvs showed clear binding (Figure 3.10, bottom row). These results indicate that the scFv

binding requires tau phosphorylation at T231.

Figure 3.10 Confocal microscopy images of HEK293FT cell labeled using purified pT231 scFvs Purified fluorescently labeled WT pT231 scFv and mutant 3.24 binding to HEK293FT cells expressing WT tau (top row), WT tau treated with lambda phosphatase (second row), tau T231A (third row), and tau T231E (bottom row). All human tau constructs were fused to EGFP at the N-terminus (EGFP-tau). The first column shows DAPI staining in blue. The second column shows tau expression in green. The third column shows scFv binding in red. Scale bars, 50 µm.

When we compared the labeling of WT and scFv 3.24 at lower concentrations, scFv 3.24 showed

significantly higher binding signal above background compared to that of WT at scFv

concentrations ranging from 80 pM to 50 nM (Figure 3.11, P < 0.05, student’s t-test).

50

Figure 3.11 Quantification of cell labeling fluorescence intensity using purified pT231 scFvs Fluorescence intensity of WT pT231 scFv and mutant 3.24 binding to HEK293FT cells expressing WT tau was measured at scFv concentrations from 16 pM to 50 nM. Error bars indicate standard deviation from three independent experiments. Statistics: Student’s t-test, *P ≤ 0.05.

We proceeded to test the fluorescently labeled scFvs in the staining of tissue sections from both

PS19 mouse tissue slices and human AD tissue slices; PS19 mice expressed the aggregation-

prone mutant P301S of human tau (1N4R) under the mouse prion protein (Prnp) promoter (54).

In brain slices of 8-month old PS19 mice, wild-type pT231 scFv and mutant 3.24 demonstrated

staining patterns characteristic of neurofibrillary tangles (Figure 3.12a), suggesting specific

labeling of tau. This staining was dose-dependent for both scFvs (Figure 3.12b). Neither scFv

showed detectable staining in either tau knock-out or WT C57Bl/6 mice (Figure 3.12c). Staining

of human AD tissue also revealed characteristic tangle staining (Figure 3.12d) with no

detectable staining in aged control brain tissues. However, in the human tissues the mutant scFv

3.24 showed significantly higher signal than the WT scFv at the 50 nM working concentration

(Figure 3.12e), suggesting higher affinity and more robust staining for the mutant scFv. These

51

results further demonstrate that the high-affinity antibody generated in this study has

exceptionally high specificity for phospho-tau.

Figure 3.12 Tissue labeling using purified pT231 scFvs a, immunohistochemistry using the scFvs on brain slices of 8-month old mice expressing P301S mutant tau indicates that both scFvs robustly identify neurofibrillary tangles in tissue. Each scFv was used at 50 nM and 10 nM to identify optimal staining concentrations and show a dose response for staining intensity, quantified in b. tau is shown in red with nuclei stained using DAPI in blue. The 10nM concentrations showed significant reduction in staining intensity for both the WT and 3.24 scFv (P ≤ 0.0001 by one-way ANOVA with P ≤ 0.0001 between the 50 nM and 10 nM working concentrations of each scFv using Tukey’s multiple comparisons test). There were no statistical differences between the WT and 3.24 scFv at either concentration. c, neither scFv stained WT or tau knockout mouse tissue at the 50 nM working concentration, indicating no off target staining or background fluorescence. d, immunohistochemistry of human AD and aged control tissues also indicate that both scFvs stain phospho-tau tangles in disease (scFv concentration = 50 nM). However, in the human tissue the high affinity scFv 3.24 shows a significant increase in staining intensity compared to the WT scFv, which is quantified in e (P ≤ 0.0001 using a two-sample t-test assuming unequal variances).

52

Discussion

In this study, we applied directed evolution to enhance the affinity of a phospho-specific

antibody, and quantified the impact of in vitro affinity maturation on specificity. High-affinity

antibody fragments with dissociation constants reaching picomolar range were successfully

generated. Based on the crystal structure of the WT pT231 antibody bound to the

phosphopeptide (27), only one mutation occurred in a residue that directly contacts the

phosphoepitope (Figure 3.8, VLW50L). Five out of 9 high occurrence mutations were located

near the direct contact sites (VLS56C, VLA95T, VHG100HD (or S), VHD101G, and VHA102T).

The pattern of mutations occurring in amino acid positions near, but not at the direct contact site

has been frequently observed in high affinity antibody variants (55,56). Such mutations may

contribute to enhanced affinity through preorganization and rigidification of the paratope (57-59).

Mutations VHG100HD, VHD101G, and VHA102T are also located at the VH-VL interface,

suggesting that stability of interaction between the two domains may contribute to affinity

improvement. Interestingly, high occurrence mutations found in the optimal variant 3.24

(VLD57G, VHG74C, and VHA93V) were exclusively located in the framework region. This

suggests that this variant may have gained affinity through optimization of structural plasticity

(60,61). Further investigation on the impact of individual mutations on affinity and specificity

may provide new insights on designing PTM-specific antibodies.

High-affinity reagents would be highly advantageous in detecting PTMs from complex samples.

Our results show that the high affinity variant scFv generated significantly higher signal

compared to that of the wild-type scFv in detecting tau from human tissue, but not in mouse

tissue. The discrepancy in staining intensities may be explained by differences in the expression

level of human tau and level of phosphorylation. In the transgenic mice PS19, the expression of

53

human tau P301S is driven by the prion protein promoter, which is strongly induced in neuronal

cells (62), leading to 3-5 fold higher levels of tau expression than endogenous levels (54).

Moreover, in PS19 mice, the solubility of tau decreases by 3 months of age, and becomes

hyperphosphorylated (54,63). Therefore, the level of insoluble aggregates of phosphorylated tau

in the mouse tissue may be significantly higher than in human AD patient tissue. Additionally, in

the mouse tissue, the labeling intensity was significantly diminished at a scFv concentration of

10 nM, suggesting a possibility for mass transfer limitation of the labeling reagent. Very slow or

limited antibody penetration has been reported for fixed samples (64). This shows the need for

high antibody concentrations in labeling fixed tissue, and highlights the importance of antibody

specificity.

While the scFv identified in this study can be converted to full-length IgGs, the scFv construct

provides unique advantages for detecting tau due to its small size. Compared to full-length IgGs

(150 kD), scFvs are approximately one-sixth in molecular weight (25 kD). This has led to

significant enhancement in processes that rely on diffusion, such as tissue penetration. For

example, when the blood-brain barrier was transiently opened through focused ultrasound, scFvs

showed 5- to 57-fold higher uptake into the central nervous system compared to IgGs (44). In a

mouse model of tauopathy, intravenously injected scFvs were detected in the brain tissue in

significantly higher levels compared to that of IgGs (41). Moreover, scFv constructs enable

wider modes of delivery since they are encoded by a short single gene that can be packaged in

viruses. For example, intracerebroventricular injection of adeno-associated viruses carrying an

anti-tau scFv resulted in reduced tau accumulation in a mouse model of tauopathy (43). Finally,

we demonstrated cell and tissue staining using scFvs directly labeled with a fluorophore. These

54

reagents have the potential to enable sub-diffraction limit imaging of phospho-tau due to greatly

reduced linkage error, which limit image resolution (65).

Phosphorylation of tau at T231 is a widely recognized modification for its association with AD.

In vitro and in cultured cells, pT231 decreases the ability of tau to bind and stabilize

microtubules (66,67). pT231 seems to occur early in AD progression and precedes paired helical

filament (PHF) formation (68). pT231 was found in the cerebrospinal fluid (CSF) of patients

with mild cognitive impairments who eventually developed AD (69). In addition, levels of

pT231 in the CSF were correlated with rates of hippocampal atrophy in AD patients (70). An

immunoassay of pT231 in the CSF demonstrated a 85% sensitivity (detection in 23 out of 27 AD

samples) and a 97% specificity (detection in 1 out of 31 non-AD samples) in AD brain extracts

(71). The high affinity and specificity pT231 tau antibody developed in this study is expected to

enhance the sensitivity and enable earlier detection of pT231.

A major finding of this study is that in vitro affinity maturation of the phospho-specific antibody

led to an increase in unwanted cross-reactivity towards the non-phosphorylated target sequence

in a majority of high-affinity variants. Considering the fact that the area of interaction available

from a modified amino acid is limited, stabilization of interaction with the nearby amino acid

sequence may be a common phenomenon in high-affinity PTM-specific antibodies. In a recent

study, monoclonal antibodies generated in guinea pig against pT18 of p53 showed picomolar

affinity (Kd = 0.20 nM) but also significant binding to the non-phosphorylated p53 (Kd = 130 nM)

(72). If such antibody is used at concentration ranges commonly used for cell or tissue staining

(10 - 50 nM), false positive signal from cross reactivity towards the non-modified target may be

detected. This illustrates an important point that antibody specificity is a function of antibody

concentration. Therefore, existing PTM-specific antibodies should be validated for their

55

specificity under varying concentrations. We suggest setting an upper concentration limit for

each PTM-specific antibody to prevent false positive detection. Until now, efforts to validate and

enhance specificity has been rarely made. Non-specific antibodies would be a major factor in

irreproducibility in biological experiments. Ongoing efforts to standardize ways to quantify and

document specificity of binding reagents (73) need to consider these aspects of antibody

specificity.

We introduced an approach using yeast surface display to quantify the specificity of PTM-

targeting antibodies. This enabled us to find that even among antibody variants selected only for

improved affinity, a fraction of clones maintained high specificity. This specificity quantification

approach may be widely adopted due to the general applicability of yeast surface display and its

compatibility with flow cytometry. We demonstrated the use of this approach for a phospho-

specific antibody, but it is readily applicable to other PTM-specific antibodies. In principle, this

approach would be suitable for assessing the specificity of affinity reagents in general. The

identified high-affinity variant showed exceptional specificity, as validated by cell and tissue

staining experiments. Due to the compatibility with FACS, this approach has potential to enable

directed evolution of antibody specificity. In particular, it would be useful in engineering the

specificity of antibodies with known cross-reactivity. For example, a recent study showed that a

significant fraction of commercially available PTM-specific tau antibodies has cross reactivity

(34). Directed evolution may be applied to reduce the cross-reactivity of these antibodies.

Conclusion

In this study, we introduced an approach using yeast surface display to quantify the specificity of

phospho-specific antibodies. We demonstrated the use of this approach for a phospho-specific

56

antibody, but it is readily applicable to other PTM-specific antibodies. In principle, this approach

would be suitable for assessing the specificity of affinity reagents in general. We also developed

a screening assay based on it to generate PTM-specific antibodies with improved affinity and

high specificity. We demonstrated that improving PTM- specific antibody affinity through

directed evolution results in cross-reactivity to the non-modified target sequence, there’s a trade-

off between affinity and specificity in PTM antibodies. However, quantifying specificity leads to

identification of a variant with high affinity and specificity.

The results from this study demonstrate that in vitro affinity maturation is a viable option for

improving the affinity of PTM-specific antibodies. In this process, it is essential to quantify the

specificity, particularly to the non-modified target sequence. By quantifying the specificity, it is

possible to apply selection pressures for improved affinity and specificity simultaneously.

57

Reference




4. Li, C., and Gotz, J. (2017) Tau-based therapies in neurodegeneration: opportunities and challenges. Nat Rev Drug Discov 16, 863-883

5. Guo, T., Noble, W., and Hanger, D. P. (2017) Roles of tau protein in health and disease. Acta neuropathologica 133, 665-704

6. Morris, M., Knudsen, G. M., Maeda, S., Trinidad, J. C., Ioanoviciu, A., Burlingame, A. L., and Mucke, L. (2015) Tau post-translational modifications in wild-type and human amyloid precursor protein transgenic mice. Nature neuroscience 18, 1183-1189

7. Kopke, E., Tung, Y. C., Shaikh, S., Alonso, A. C., Iqbal, K., and Grundke-Iqbal, I. (1993) Microtubule-associated protein tau. Abnormal phosphorylation of a non-paired helical filament pool in Alzheimer disease. The Journal of biological chemistry 268, 24374-24384

8. Drewes, G., Trinczek, B., Illenberger, S., Biernat, J., Schmitt-Ulms, G., Meyer, H. E., Mandelkow, E. M., and Mandelkow, E. (1995) Microtubule-associated protein/microtubule affinity-regulating kinase (p110mark). A novel protein kinase that regulates tau-microtubule interactions and dynamic instability by phosphorylation at the Alzheimer-specific site serine 262. The Journal of biological chemistry 270, 7679-7688

9. Sengupta, A., Kabat, J., Novak, M., Wu, Q., Grundke-Iqbal, I., and Iqbal, K. (1998) Phosphorylation of tau at both Thr 231 and Ser 262 is required for maximal inhibition of its binding to microtubules. Arch Biochem Biophys 357, 299-309

10. von Bergen, M., Friedhoff, P., Biernat, J., Heberle, J., Mandelkow, E. M., and Mandelkow, E. (2000) Assembly of tau protein into Alzheimer paired helical filaments depends on a local sequence motif ((306)VQIVYK(311)) forming beta structure. Proceedings of the National Academy of Sciences of the United States of America 97, 5129-5134

11. Berger, Z., Roder, H., Hanna, A., Carlson, A., Rangachari, V., Yue, M., Wszolek, Z., Ashe, K., Knight, J., Dickson, D., Andorfer, C., Rosenberry, T. L., Lewis, J., Hutton, M., and Janus, C. (2007) Accumulation of pathological tau species and memory loss in a conditional model of tauopathy. The Journal of neuroscience : the official journal of the Society for Neuroscience 27, 3650-3662

12. Min, S. W., Cho, S. H., Zhou, Y., Schroeder, S., Haroutunian, V., Seeley, W. W., Huang, E. J., Shen, Y., Masliah, E., Mukherjee, C., Meyers, D., Cole, P. A., Ott, M., and Gan, L. (2010) Acetylation of tau inhibits its degradation and contributes to tauopathy. Neuron 67, 953-966

13. Cohen, T. J., Guo, J. L., Hurtado, D. E., Kwong, L. K., Mills, I. P., Trojanowski, J. Q., and Lee, V. M. (2011) The acetylation of tau inhibits its function and promotes pathological tau aggregation. Nature communications 2, 252

14. Irwin, D. J., Cohen, T. J., Grossman, M., Arnold, S. E., McCarty-Wood, E., Van Deerlin, V. M., Lee, V. M., and Trojanowski, J. Q. (2013) Acetylated tau neuropathology in sporadic and hereditary tauopathies. The American journal of pathology 183, 344-351


58





20. Rosseels, J., Van den Brande, J., Violet, M., Jacobs, D., Grognet, P., Lopez, J., Huvent, I., Caldara, M., Swinnen, E., Papegaey, A., Caillierez, R., Buee-Scherrer, V., Engelborghs, S., Lippens, G., Colin, M., Buee, L., Galas, M. C., Vanmechelen, E., and Winderickx, J. (2015) Tau monoclonal antibody generation based on humanized yeast models: impact on Tau oligomerization and diagnostics. The Journal of biological chemistry 290, 4059-4074

21. d'Abramo, C., Acker, C. M., Jimenez, H. T., and Davies, P. (2013) Tau passive immunotherapy in mutant P301L mice: antibody affinity versus specificity. PloS one 8, e62402

22. Brumbaugh, K., Johnson, W., Liao, W. C., Lin, M. S., Houchins, J. P., Cooper, J., Stoesz, S., and Campos-Gonzalez, R. (2011) Overview of the generation, validation, and application of phosphosite-specific antibodies. Methods in molecular biology 717, 3-43

23. Czernik, A. J., Girault, J. A., Nairn, A. C., Chen, J., Snyder, G., Kebabian, J., and Greengard, P. (1991) Production of phosphorylation state-specific antibodies. Methods in enzymology 201, 264-283

24. Batista, F. D., and Neuberger, M. S. (1998) Affinity dependence of the B cell response to antigen: a threshold, a ceiling, and the importance of off-rate. Immunity 8, 751-759

25. Foote, J., and Eisen, H. N. (1995) Kinetic and affinity limits on antibodies produced during immune responses. Proceedings of the National Academy of Sciences of the United States of America 92, 1254-1256


27. Shih, H. H., Tu, C., Cao, W., Klein, A., Ramsey, R., Fennell, B. J., Lambert, M., Ni Shuilleabhain, D., Autin, B., Kouranova, E., Laxmanan, S., Braithwaite, S., Wu, L., Ait-Zahra, M., Milici, A. J., Dumin, J. A., LaVallie, E. R., Arai, M., Corcoran, C., Paulsen, J. E., Gill, D., Cunningham, O., Bard, J., Mosyak, L., and Finlay, W. J. (2012) An ultra-specific avian antibody to phosphorylated tau protein reveals a unique mechanism for phosphoepitope recognition. The Journal of biological chemistry 287, 44425-44434

28. Feldhaus, M. J., Siegel, R. W., Opresko, L. K., Coleman, J. R., Feldhaus, J. M., Yeung, Y. A., Cochran, J. R., Heinzelman, P., Colby, D., Swers, J., Graff, C., Wiley, H. S., and Wittrup, K. D. (2003) Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library. Nature biotechnology 21, 163-170

29. Kehoe, J. W., Velappan, N., Walbolt, M., Rasmussen, J., King, D., Lou, J., Knopp, K., Pavlik, P., Marks, J. D., Bertozzi, C. R., and Bradbury, A. R. (2006) Using phage display to select antibodies recognizing post-translational modifications independently of sequence context. Molecular & cellular proteomics : MCP 5, 2350-2363

30. Fuchs, S. M., Krajewski, K., Baker, R. W., Miller, V. L., and Strahl, B. D. (2011) Influence of combinatorial histone modifications on antibody and effector protein recognition. Curr Biol 21, 53-58

31. Bock, I., Dhayalan, A., Kudithipudi, S., Brandt, O., Rathert, P., and Jeltsch, A. (2011) Detailed specificity analysis of antibodies binding to modified histone tails with peptide arrays. Epigenetics 6, 256-263

32. Egelhofer, T. A., Minoda, A., Klugman, S., Lee, K., Kolasinska-Zwierz, P., Alekseyenko, A. A., Cheung, M. S., Day, D. S., Gadel, S., Gorchakov, A. A., Gu, T., Kharchenko, P. V., Kuan, S.,

59

Latorre, I., Linder-Basso, D., Luu, Y., Ngo, Q., Perry, M., Rechtsteiner, A., Riddle, N. C., Schwartz, Y. B., Shanower, G. A., Vielle, A., Ahringer, J., Elgin, S. C., Kuroda, M. I., Pirrotta, V., Ren, B., Strome, S., Park, P. J., Karpen, G. H., Hawkins, R. D., and Lieb, J. D. (2011) An assessment of histone-modification antibody quality. Nature structural & molecular biology 18, 91-93



35. Boder, E. T., and Wittrup, K. D. (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nature biotechnology 15, 553-557

36. Burns, M. L., Malott, T. M., Metcalf, K. J., Hackel, B. J., Chan, J. R., and Shusta, E. V. (2014) Directed evolution of brain-derived neurotrophic factor for improved folding and expression in Saccharomyces cerevisiae. Applied and environmental microbiology 80, 5732-5742

37. Shusta, E. V., Raines, R. T., Pluckthun, A., and Wittrup, K. D. (1998) Increasing the secretory capacity of Saccharomyces cerevisiae for production of single-chain antibody fragments. Nature biotechnology 16, 773-777

38. Huang, D., and Shusta, E. V. (2005) Secretion and surface display of green fluorescent protein using the yeast Saccharomyces cerevisiae. Biotechnology progress 21, 349-357

39. Sun, Y., Ip, P., and Chakrabartty, A. (2017) Simple Elimination of Background Fluorescence in Formalin-Fixed Human Brain Tissue for Immunofluorescence Microscopy. J Vis Exp

40. Cho, Y. K., Chen, I., Wei, X., Li, L., and Shusta, E. V. (2009) A yeast display immunoprecipitation method for efficient isolation and characterization of antigens. Journal of immunological methods 341, 117-126

41. Krishnaswamy, S., Lin, Y., Rajamohamedsait, W. J., Rajamohamedsait, H. B., Krishnamurthy, P., and Sigurdsson, E. M. (2014) Antibody-derived in vivo imaging of tau pathology. The Journal of neuroscience : the official journal of the Society for Neuroscience 34, 16835-16850

42. Nisbet, R. M., Van der Jeugd, A., Leinenga, G., Evans, H. T., Janowicz, P. W., and Gotz, J. (2017) Combined effects of scanning ultrasound and a tau-specific single chain antibody in a tau transgenic mouse model. Brain : a journal of neurology 140, 1220-1230

43. Ising, C., Gallardo, G., Leyns, C. E. G., Wong, C. H., Stewart, F., Koscal, L. J., Roh, J., Robinson, G. O., Remolina Serrano, J., and Holtzman, D. M. (2017) AAV-mediated expression of anti-tau scFvs decreases tau accumulation in a mouse model of tauopathy. J Exp Med 214, 1227-1238

44. Liu, H. L., Hsu, P. H., Lin, C. Y., Huang, C. W., Chai, W. Y., Chu, P. C., Huang, C. Y., Chen, P. Y., Yang, L. Y., Kuo, J. S., and Wei, K. C. (2016) Focused Ultrasound Enhances Central Nervous System Delivery of Bevacizumab for Malignant Glioma Treatment. Radiology 281, 99-108

45. Razai, A., Garcia-Rodriguez, C., Lou, J., Geren, I. N., Forsyth, C. M., Robles, Y., Tsai, R., Smith, T. J., Smith, L. A., Siegel, R. W., Feldhaus, M., and Marks, J. D. (2005) Molecular evolution of antibody affinity for sensitive detection of botulinum neurotoxin type A. Journal of molecular biology 351, 158-169

46. Oi, V. T., Glazer, A. N., and Stryer, L. (1982) Fluorescent phycobiliprotein conjugates for analyses of cells and molecules. J Cell Biol 93, 981-986

47. Zaccolo, M., Williams, D. M., Brown, D. M., and Gherardi, E. (1996) An approach to random mutagenesis of DNA using mixtures of triphosphate derivatives of nucleoside analogues. Journal of molecular biology 255, 589-603

48. Swers, J. S., Kellogg, B. A., and Wittrup, K. D. (2004) Shuffled antibody libraries created by in vivo homologous recombination and yeast surface display. Nucleic acids research 32, e36

49. Boder, E. T., and Wittrup, K. D. (1998) Optimal screening of surface-displayed polypeptide libraries. Biotechnology progress 14, 55-62

60

50. Hackel, B. J., Huang, D., Bubolz, J. C., Wang, X. X., and Shusta, E. V. (2006) Production of soluble and active transferrin receptor-targeting single-chain antibody using Saccharomyces cerevisiae. Pharmaceutical research 23, 790-797

51. Hoover, B. R., Reed, M. N., Su, J., Penrod, R. D., Kotilinek, L. A., Grant, M. K., Pitstick, R., Carlson, G. A., Lanier, L. M., Yuan, L. L., Ashe, K. H., and Liao, D. (2010) Tau mislocalization to dendritic spines mediates synaptic dysfunction independently of neurodegeneration. Neuron 68, 1067-1081

52. Tak, H., Haque, M. M., Kim, M. J., Lee, J. H., Baik, J. H., Kim, Y., Kim, D. J., Grailhe, R., and Kim, Y. K. (2013) Bimolecular fluorescence complementation; lighting-up tau-tau interaction in living cells. PloS one 8, e81682

53. Coutadeur, S., Benyamine, H., Delalonde, L., de Oliveira, C., Leblond, B., Foucourt, A., Besson, T., Casagrande, A. S., Taverne, T., Girard, A., Pando, M. P., and Desire, L. (2015) A novel DYRK1A (dual specificity tyrosine phosphorylation-regulated kinase 1A) inhibitor for the treatment of Alzheimer's disease: effect on Tau and amyloid pathologies in vitro. Journal of neurochemistry 133, 440-451

54. Yoshiyama, Y., Higuchi, M., Zhang, B., Huang, S. M., Iwata, N., Saido, T. C., Maeda, J., Suhara, T., Trojanowski, J. Q., and Lee, V. M. (2007) Synapse loss and microglial activation precede tangles in a P301S tauopathy mouse model. Neuron 53, 337-351

55. Boder, E. T., Midelfort, K. S., and Wittrup, K. D. (2000) Directed evolution of antibody fragments with monovalent femtomolar antigen-binding affinity. Proceedings of the National Academy of Sciences of the United States of America 97, 10701-10705

56. Foote, J., and Winter, G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. Journal of molecular biology 224, 487-499

57. Wedemayer, G. J., Patten, P. A., Wang, L. H., Schultz, P. G., and Stevens, R. C. (1997) Structural insights into the evolution of an antibody combining site. Science 276, 1665-1669

58. Furukawa, K., Akasako-Furukawa, A., Shirai, H., Nakamura, H., and Azuma, T. (1999) Junctional amino acids determine the maturation pathway of an antibody. Immunity 11, 329-338

59. Manivel, V., Sahoo, N. C., Salunke, D. M., and Rao, K. V. (2000) Maturation of an antibody response is governed by modulations in flexibility of the antigen-combining site. Immunity 13, 611-620

60. Yin, J., Beuscher, A. E. t., Andryski, S. E., Stevens, R. C., and Schultz, P. G. (2003) Structural plasticity and the evolution of antibody affinity and specificity. Journal of molecular biology 330, 651-656

61. Adhikary, R., Yu, W., Oda, M., Walker, R. C., Chen, T., Stanfield, R. L., Wilson, I. A., Zimmermann, J., and Romesberg, F. E. (2015) Adaptive mutations alter antibody structure and dynamics during affinity maturation. Biochemistry 54, 2085-2093

62. Baybutt, H., and Manson, J. (1997) Characterisation of two promoters for prion protein (PrP) gene expression in neuronal cells. Gene 184, 125-131

63. Hoffmann, N. A., Dorostkar, M. M., Blumenstock, S., Goedert, M., and Herms, J. (2013) Impaired plasticity of cortical dendritic spines in P301S tau transgenic mice. Acta Neuropathol Commun 1, 82

64. Schnell, U., Dijk, F., Sjollema, K. A., and Giepmans, B. N. (2012) Immunolabeling artifacts and the need for live-cell imaging. Nature methods 9, 152-158

65. Helma, J., Cardoso, M. C., Muyldermans, S., and Leonhardt, H. (2015) Nanobodies and recombinant binders in cell biology. J Cell Biol 209, 633-644

66. Cho, J. H., and Johnson, G. V. (2004) Primed phosphorylation of tau at Thr231 by glycogen synthase kinase 3beta (GSK3beta) plays a critical role in regulating tau's ability to bind and stabilize microtubules. J Neurochem 88, 349-358

67. Amniai, L., Barbier, P., Sillen, A., Wieruszeski, J. M., Peyrot, V., Lippens, G., and Landrieu, I. (2009) Alzheimer disease specific phosphoepitopes of Tau interfere with assembly of tubulin but not binding to microtubules. FASEB J 23, 1146-1152

61

68. Jicha, G. A., Lane, E., Vincent, I., Otvos, L., Jr., Hoffmann, R., and Davies, P. (1997) A conformation- and phosphorylation-dependent antibody recognizing the paired helical filaments of Alzheimer's disease. J Neurochem 69, 2087-2095

69. Arai, H., Ishiguro, K., Ohno, H., Moriyama, M., Itoh, N., Okamura, N., Matsui, T., Morikawa, Y., Horikawa, E., Kohno, H., Sasaki, H., and Imahori, K. (2000) CSF phosphorylated tau protein and mild cognitive impairment: a prospective study. Exp Neurol 166, 201-203

70. Hampel, H., Burger, K., Pruessner, J. C., Zinkowski, R., DeBernardis, J., Kerkman, D., Leinsinger, G., Evans, A. C., Davies, P., Moller, H. J., and Teipel, S. J. (2005) Correlation of cerebrospinal fluid levels of tau protein phosphorylated at threonine 231 with rates of hippocampal atrophy in Alzheimer disease. Arch Neurol 62, 770-773

71. Kohnken, R., Buerger, K., Zinkowski, R., Miller, C., Kerkman, D., DeBernardis, J., Shen, J., Moller, H. J., Davies, P., and Hampel, H. (2000) Detection of tau phosphorylated at threonine 231 in cerebrospinal fluid of Alzheimer's disease patients. Neurosci Lett 287, 187-190

72. Kurosawa, N., Wakata, Y., Inobe, T., Kitamura, H., Yoshioka, M., Matsuzawa, S., Kishi, Y., and Isobe, M. (2016) Novel method for the high-throughput production of phosphorylation site-specific monoclonal antibodies. Sci Rep 6, 25174

73. Uhlen, M., Bandrowski, A., Carr, S., Edwards, A., Ellenberg, J., Lundberg, E., Rimm, D. L., Rodriguez, H., Hiltke, T., Snyder, M., and Yamamoto, T. (2016) A proposal for validation of antibodies. Nature methods 13, 823-827

62

Introduction

Site-specific phosphorylation of the microtubule-associated protein tau is a well-defined

molecular signature linked to normal tau function as well as pathology in neurodegeneration.

Antibodies binding to phosphorylated tau (phospho-tau) are extensively used in research and

being adopted in clinical diagnosis (1-6). According to antibody databases (Antibodypedia and

Alzforum), thousands of anti-tau antibodies are currently available, including >180 unique

phospho-tau antibodies. However, few validation data have been published (7-9), which

indicated an alarming degree of non-specific binding frequently observed in phospho-tau

antibodies. To prevent waste of resource and irreproducibility of results, a standard measure of

specificity, equivalent to dissociation constants (Kd) for measuring affinity, is urgently needed.

Ideally, this parameter should enable users to compare the specificity, identify the source of non-

specificity, and clearly understand what is measured.

Existing specificity characterization methods relied on immunoblotting approaches using either

synthetic peptides, cell lysates or extracted paired helical filament (PHF) tau (7-9). Synthetic

peptides allow binding measurement to exactly defined phosphorylation sites, but is prohibitively

costly to cover all phospho-sites across the full-length tau. Cell lysates allow detection of non-

specific binding to non-tau proteins (for example by using cell lysates from a tau knockout

mouse) (7), but cannot measure cross-reactivity to non-modified tau or other phosphorylation

sites. Extracted PHF-tau from AD brain homogenates allows characterizing antibodies that do

not recognize normal human adult tau and measuring the cross-reactivity to nonphospho-tau by

treatment with phosphatase, but cannot capture the phospho-site specificity (9). Steinhilb and

63

colleagues have generated transgenic flies expressing tau with alanine point mutations at several

serine-proline and threonine-proline motifs of human tau (10). In this study, they used fly head

extracts from these transgenic lines to perform western blotting using phospho-tau antibodies. In

principle, this approach may be applied for validating phospho-tau antibodies. However, all of

these approaches are not ideal for quantitative measurement due to frequent signal saturation in

immunoblotting experiments (11). To fill this critical need, we introduce a parameter termed Φ

(12) that quantifies specificity of phospho-tau antibodies and establish a generalizable, robust

assay to measure it.

The approach leverages flow cytometry for quantitative, multi-dimensional analysis of small

changes in antibody binding to different cell populations. In a typical immunodetection

experiment, signal from specific and non-specific binding cannot be distinguished. We sought to

enable this distinction within a single sample, by generating two populations of cells with

distinct fluorescence reporters. In one population of cells, the target protein (i.e., tau) is

expressed as a fusion to the enhanced green fluorescent protein (EGFP). In another population,

tau containing a site-specific alanine mutation is expressed as a fusion to a near infra-red

fluorescent protein (iRFP). The two populations of cells are mixed, and labeled with a phospho-

specific antibody. For a phospho-site specific antibody, any binding to iRFP-positive cells is

non-specific binding, enabling the measurement of the fraction of non-specific signal among all

antibody binding signals. In order to ensure the measurement of cross-reactivity to non-

phosphorylated tau, the experiment is repeated by replacing alanine mutant expressing cells with

tau expressing cells (iRFP fused to wild-type tau) treated with the lambda protein phosphatase

(λPP). Analogous to the alanine mutation assay, binding to iRFP-positive cells is identified as

non-specific signal. Based on these measurements, the fraction of non-specific signal is

64

calculated, which is subtracted from 1 to obtain Φ. Therefore, Φ indicates the fraction of specific

signal.

Using this measurement, we measured the specificity Φ of 7 commonly used phospho-tau

antibodies (AT270, AT8, AT100, AT180, PHF-6, TG-3, and PHF-1), in addition to others. Our

results show that 5 antibodies (AT8, AT180, PHF-6, TG-3, and PHF-1) have Φ values near 1,

indicating nearly perfect specificity. Antibodies AT270, AT100 showed weak but detectable

non-specific binding to non-tau proteins in cells, with lower Φ values. This resulted in

background fluorescence in flow cytometry and immunocytochemistry experiments. The non-

specific binding also resulted in false positive detection in western blots, evidenced by additional

bands appearing in cell lysates that do not contain human tau. To our knowledge, this is the first

quantitative measurement of antibody specificity that enables specificity comparison with

information on the source of non-specificity.

Materials and Methods

4.2.1 Cloning of recombinant constructs of tau and mutant tau

The following plasmids were obtained from Addgene: a mammalian expression vector pRK5

encoding EGFP tagged wild-type (13) human tau (pRK5-EGFP-tau, # 46904, RRID:

Addgene_46904), which contains four C-terminal repeat regions and lacks the N-terminal

sequences (0N4R), a plasmid encoding iRFP (piRFP670-N1, # 44457, RRID: Addgene_45457),

and a mammalian expression vector pcDNA3 encoding hemagglutinin tagged constitutively

active glycogen synthase kinase-3b (GSK-3β) (S9A) (pcDNA3-GSK3b, # 14754, RRID:

Addgene_14754). The EGFP in pRK5 vector was first replaced by iRFP to construct an iRFP

tagged WT tau by golden gate assembly (pRK5-iRFP-tau) (14). This assembly was performed

65

using a Type IIs restriction enzyme BsaI (New England Biolabs # R3535) and T4 DNA ligase

(New England Biolabs # M0202) (see Table 4.1 for primers used). Seven alanine mutant

variants were generated in iRFP tagged tau to preclude phosphorylation. Alanine mutations were

introduced to either Thr181, Ser202, Thr212/Ser214 (double alanine mutant), Thr231, Ser262,

Ser396/Ser404 (double alanine mutant), or Ser404. For this, site-directed mutagenesis was

conducted using overlap extension PCR (15) using the Phusion DNA polymerase (New England

Biolabs # M0530) (see Table 4.2 for primers used). Residue numbering of tau is according to the

longest adult human brain tau isoform.

Table 4.1 Primers for Golden Gate assembly of plasmids

DNA template Primers pRK5-EGFP-Tau 5’- TCCGCTGAGCCCCG -3’

5’- CCATGGTGGCGACCATC -3’ piRFP670-N1 5’- ATGGTAGCAGGTCATGCC -3’

5’- CGGATCCGCTCTCAAGCGCGG -3’

Table 4.2 Primers used for site-directed mutagenesis

Mutant Primers T181A 5’- GAGCTGGGTGGTGCCTTTGGAGCGGGC -3’

5’- GCCCGCTCCAAAGGCACCACCCAGCTC -3’ S202A* 5’- AGTGCCTGGGGCGCCGGGGCTGC -3’

5’- GCAGCCCCGGCGCCCCAGGCACT -3’ T212A/S214A 5’- GTTGGAAGGGCCGGGGCGCGGGAGCGG -3’

5’- CCGCTCCCGCGCCCCGGCCCTTCCAAC -3’ T231A 5’- GACTTGGGTGGAGCACGGACCACTGCCACCTTCT -3’

5’- AGAAGGTGGCAGTGGTCCGTGCTCCACCCAAGTC -3’ S262A 5’- TTCAGGTTCTCAGTGGCGCCGATCTTGGACTTG -3’

5’- CAAGTCCAAGATCGGCGCCACTGAGAACCTGAA -3’ S396A/S404A§ 5’- CAGACACCACTGGCGCCTTGTACACGATCTC -3’

5’- GAGATCGTGTACAAGGCGCCAGTGGTGTCTG -3’ S404A 5’- AGATGCCGTGGAGCCGTGTCCCCAGAC -3’

5’- GTCTGGGGACACGGCTCCACGGCATCT -3’ Note: *Previous study has shown that AT8 recognition requires only Ser202 to be phosphorylated in tau (13). §S396A/S404A were obtained using the S404A mutant as a template to generate double mutations.

66

4.2.2 Cell culture and transfection

The human embryonic kidney (HEK) 293FT cells a high transfection efficiency isolate of the

HEK293T cells were purchased from ThermoFisher (# R70007), and used without further

authentication. The cell line is not listed as a commonly misidentified cell line by the

International Cell Line Authentication Committee. HEK293FT cells were grown in DMEM

supplemented with 10 % fetal bovine serum. The cells were frozen at early passage and used for

less than 2 months in continuous culture. HEK293FT cells were seeded in 24-well plate in the

same number 2 days before plasmid transfection to reach 70 % confluency. The cells were then

transfected with plasmid using the Lipofectamine 3000 reagent (Invitrogen # L3000001)

according to the manufacturer’s instructions.

4.2.3 Tau antibodies

10 phospho-tau antibodies raised against 7 phosphoepitopes in tau were validated for their

specificity (Table 4.3). The following monoclonal antibodies were commercially available:

AT270 (pThr181), AT8 (pSer202/pThr205), AT100 (pSer212/pSer214), AT180 (pThr231),

PHF-6 (pThr231), 1H6L6 (pThr231), and anti-tau (pSer404). The following monoclonal

antibodies were a gift of Dr. Peter Davies: TG-3 (pThr231 and conformation-specific) and PHF-

1 (pSer396/pSer404). One purified rabbit polyclonal antibody anti-tau (pSer262) was purchased

from Abcam. Tau-5 (Tau210-241, Invitrogen # AHB0042, AB_2536235) is a monoclonal

antibody recognizing phosphorylated and non-phosphorylated tau isoforms. Purified single-chain

antibody variable fragment (scFv) 3.24 targeting pThr231 was reported previously (16).

67

Table 4.3 Phospho-tau antibodies

Name Epitope Host/ Isotype

Source Dilution

Working conc.

𝚽𝐚𝐥𝐚 𝚽𝛌𝐏𝐏

AT270 pT181 Mouse/IgG1, k Invitrogen, # MN1050, RRID: AB_223651

1:100 2 µg/mL 0.80±0.06 0.99±0.01

AT8 pS202/pT205

Mouse/IgG1 Invitrogen, # MN1020, RRID: AB_223647

1:100 2 µg/mL 0.95±0.07 0.95±0.05

AT100 pT212/pS214

Mouse/IgG1, k Invitrogen, # MN1060, RRID: AB_223652

1:100 2 µg/mL N/A N/A

AT180 pT231 Mouse/IgG1, k Invitrogen, # MN1040, RRID: AB_223649

1:100 2 µg/mL 0.99±0.01 0.98±0.01

PHF6 pT231 Mouse/IgG1 Invitrogen, # 35-5200, RRID: AB_2533210

1:250 2 µg/mL 0.98±0.01 0.97±0.00

1H6L6 pT231 Rabbit/IgG Invitrogen, # 701056, RRID: AB_2532360

1:250 2 µg/mL 1.00±0.00 0.99±0.01

TG-3 pT231 Mouse/IgM Peter Davies RRID: AB_2716726

1:100 N/A 0.96±0.01 0.95±0.06

pS262 pS262 Rabbit/IgG Abcam, # ab131354, RRID: AB_11156689

1:500 2 µg/mL 0.32±0.02 0.37±0.01

PHF1 pS396/pS404

Mouse/IgG Peter Davies RRID: AB_2315150

1:100 N/A 0.98±0.00 0.98±0.03

pS404 pS404 Rabbit/IgG Abcam, # ab92676, RRID: AB_10561457

1:200 0.1 µg/mL 1.00±0.00 0.99±0.00

68

4.2.4 Quantitation of antibody specificity

Here we define a generally applicable parameter to quantify antibody specificity, based on

general discussions regarding multi-partner protein interaction by Hall and Daugherty (1). If an

antibody Ab is capable of binding to n different partners X1, X2, … Xn as described by the

following reactions,

𝐴𝑏 + 𝑋012,4 𝐴𝑏𝑋0

𝐴𝑏 + 𝑋612,7 𝐴𝑏𝑋6

…

𝐴𝑏 + 𝑋812,9 𝐴𝑏𝑋8

the specificity of the interaction between Ab and Xi can be defined as Φ: where:

Φ: ≡𝐴𝑏𝑋:𝐴𝑏𝑋<8

<=0= 1 −

𝐴𝑏𝑋<¹:8<=0

𝐴𝑏𝑋<8<=0

From this definition, 0 < Φ: < 1, where 1 indicates perfect specificity (Ab only reacts with its

intended antigen Xi), and 0 indicates no interaction with Xi. We used the following formula to

quantify the specificity of phospho-tau antibodies:

ΦCDEFCDE =[𝐴𝑏 − 𝑇𝑎𝑢CDEF]𝐴𝑏 − 𝐴𝑔MEMNO

where 𝑇𝑎𝑢CDEF indicates phosphorylated epitope sequences of tau at a defined site, and 𝐴𝑔MEMNO

indicates overall potential partners including 𝑇𝑎𝑢CDEF . In our assay, we determined the

specificity using a three-color labeling scheme, where the mixture of HEK293FT cells

transiently expressing EGFP tagged WT human tau and iRFP tagged alanine mutant tau was

incubated with a fluorescence-labeled antibody. In this case, the overall specificity ΦNON can be

obtained by measuring the following parameter:

69

ΦP =[𝐴𝑏 − 𝐴𝑔NON]𝐴𝑏 − 𝐴𝑔MEMNO

where 𝐴𝑔NON indicates antigen with an alanine mutation at the target phosphorylation site.

Therefore, ΦP in this case indicates the fraction of total binding signal to the alanine mutant

(non-specific binding signal from cells expressing the alanine mutant). ΦNON is defined as:

ΦNON = 1 − ΦP

Therefore, ΦNON value of 1 indicates no cross-reactivity to the alanine mutant. Experimentally,

ΦP was determined by measuring the fluorescence intensity of antibody labeling from each cell

in flow cytometry experiments (detailed description on how Φ values were obtained is below).

For example,

ΦP =𝐹𝐿0𝐹𝐿6

where FL1 and FL2 are fluorescence intensity of antibody labeling from HEK293FT cells

transiently expressing alanine mutant tau and WT tau, respectively. Fluorescence intensity was

calculated by subtracting the background fluorescence measured on the same day from a control

antibody with matching isotype. Analogously, ΦSTTis defined by replacing 𝐴𝑔NON with lambda

protein phosphatase (λPP)-treated antigen (𝐴𝑔STT). ΦSTT value of 1 indicates no cross-reactivity

to the de-phosphorylated tau.

4.2.5 Measurement of 𝜱: validation of phospho-tau antibody specificity

To measure ΦNON of phospho-tau antibodies, the HEK293FT cells were co-transfected with

plasmids pRK5-EGFP-tau WT and pcDNA3-GSK3b using the lipofectamine method described

above. In separate wells, HEK293FT cells were co-transfected with plasmids pRK5-iRFP-tau

(alanine mutant) and pcDNA3-GSK3b. Cells were detached from 24-well plate using 0.05 %

trypsin-EDTA (Gibco # 25300-054) for 10 min at 37 oC, then pelleted and washed 1x with ice-

70

cold PBSCM (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, 1 mM CaCl2,

and 0.5 mM MgCl2, pH 7.4). The same number of cells from the two transfections were mixed

and fixed in 4 % paraformaldehyde for 15 min at room temperature in a 1.5 mL microcentrifuge

tube with gentle rotating. The fixed cells were permeabilized using PBSCM with 0.1 % Triton

X-100 for 15 min at room temperature, then blocked in PBSG (PBSCM with 40 % goat serum,

Gibco # 16210-064) for 30 min at room temperature with gentle rotating. For antibody staining,

these cells were incubated overnight at 4 oC in dark with gentle rotating with tau antibodies

diluted in PBSG (see Table 4.3 for dilution). The next day, the cells were incubated with either

Alexa Fluor 594 conjugated secondary anti-mouse IgG antibody (1:500, Invitrogen # A11005,

RRID: AB_2534073), anti-mouse IgM antibody (1:500, Invitrogen # A21044, RRID:

AB_2535713), or anti-rabbit IgG antibody (1:500, Invitrogen # A21442, RRID: AB_2535860)

diluted in PBSG for 1 hour at room temperature in dark with continuous rotating. Pelleting and

washing 1x with ice-cold PBSCM were required in between each incubation steps. After labeling,

the cells were re-suspended in ice-cold PBSCM, and the fluorescence signal from cells was

acquired using Becton-Dickinson Fortessa X20 (UConn Center for Open Research Resources

and Equipment). The experimenter was not blinded during the experiment.

To measure ΦSTT, the HEK293FT cells were co-transfected with plasmids pRK5-EGFP-tau WT

and pcDNA3-GSK3b. In separate wells, cells were transfected with pRK5-iRFP-tau WT plasmid

only (not co-transfected with pcDNA3-GSK3b), since these cells will be treated with λPP to de-

phosphorylate tau. The same number of cells from the two transfections were fixed and

permeabilized, separately. After permeabilization, only the cells expressing iRFP-tau WT were

treated with 2 U/µL λPP (New England Biolabs # P0753) for 3 hours at 30 oC with gentle

rotating. These cells were then mixed with cells expressing EGFP-tau WT. The following

71

blocking, primary and secondary antibody incubation steps follow the same procedure as when

measuring ΦNON, described above. The experimenter was not blinded during the experiment.

4.2.6 Immunocytochemistry in HEK293FT cells

The HEK293FT cells were seeded in a chamber mounted on #1.0 Borosilicate coverglass (Lab-

Tek # 155383), then co-transfected with plasmids pRK5-EGFP-tau WT and pcDNA3-GSK3b as

described above. Cells were rinsed 1x with ice-cold PBSCM and fixed in 4 % paraformaldehyde

for 15 min at room temperature in the chambers. The fixed cells were permeabilized using

PBSCM with 0.1 % Triton X-100 for 15 min at room temperature, blocked in PBSG for 30 min

at room temperature, and then incubated with tau antibodies diluted in PBSG overnight at 4 oC in

dark. The following tau antibodies and dilutions were used: AT270 (1:200), 1H6L6 (1:250), and

AT180 (1:200). The next day, the cells were incubated with either Alexa Fluor 594 conjugated

secondary anti-mouse antibody (1:500, Invitrogen # A11005, RRID: AB_2534073) or anti-rabbit

antibody (1:500, Invitrogen # A21442, RRID: AB_2535860) diluted in PBSG for 1 hour at room

temperature in dark. 300 nM of DAPI was used to stain the nucleus for 1 min at room

temperature. 3x washes with ice-cold PBSCM and 5 min incubation on ice in between were

required during each incubation steps. The cells were imaged using a Nikon A1R confocal

microscope (UConn Center for Open Research Resources and Equipment). The experimenter

was not blinded during the experiment.

4.2.7 Mouse hippocampus dissection

All procedures involving animals were in accordance with the US National Institutes of Health

Guide for the Care and Use of Laboratory Animals and approved by the University of

Connecticut Institutional Animal Care and Use Committee. Hippocampal dissection was

performed according to the methods we have previously described (2,3). No sample calculation

72

was performed, but was based on previous studies (2,3). Timed pregnant Swiss Webster mice

(gestational day 15) were purchased from Taconic. P0 or P1 postnatal mice (randomly selected

from litter using simple randomization (4)) were placed on a physical barrier (such as a glove) on

top of an ice slurry one at a time to induce hypothermia to reduce or terminate movement and

bleeding, and decapitated. Hippocampus was dissected from 6 P0 or P1 postnatal mice in Hank’s

balanced salt solution with 10 mM HEPES, 35 mM glucose, 1 mM kynurenic acid, and 10 mM

MgCl2, pH 7.4. For dissociation, the hippocampal tissue was digested with 50 units of papain

(Worthington Biochemical) for 8 min, and halted with ovomucoid trypsin inhibitor (Worthington

Biochemical).

4.2.8 HEK293FT and mouse primary cell lysate preparation and western blotting

The following cell lysates were prepared: non-transfected HEK293FT cells, HEK293FT cells

expressing EGFP only, HEK293FT cells expressing EGFP-tau WT, and dissociated mouse

hippocampus. Cells were cultured to approximately 80 % confluency on 100 mm polystyrene

tissue culture plates and scraped into 1 mL lysis buffer containing 150 mM NaCl, 5 mM EDTA,

50 mM Tris, 1 % Triton X-100, 0.5 % sodium deoxycholate, and 0.1 % sodium dodecyl sulfate,

protease inhibitor cocktail (Sigma # P8340), and phosphatase inhibitor cocktails 2&3 (Sigma #

5726 & P0044). Cells were lysed on ice for 15 min and then centrifuged at 13,000 g for 15 min

at 4 oC to remove insoluble debris. The concentrations of cell lysate were determined using a

Bradford assay kit (ThermoFisher Scientific # 23200) according to the manufacturer’s

instructions. The lysates were aliquoted and stored at -20 oC avoiding multiple freeze/thaw

cycles.

An equal amount (15 µg) of total cellular protein was separated by SDS-PAGE using 4-12.5 %

Bis-Tris gels and transferred to nitrocellulose membrane (GE Healthcare # 10600006). SeeBlue

73

pre-stained protein standard (Invitrogen # LC5925) was used to determine the molecular weight.

The nitrocellulose membrane was blocked in TBST (20 mM Tris, 150 mM NaCl, and 0.1 %

Tween 20, pH 7.6) with 1 % BSA (bovine serum albumin, ThermoFisher Scientific #149006) for

1 hour at room temperature, and then incubated with the tau antibodies diluted in TBST with 1 %

BSA overnight at 4 oC with continuous agitation. The following antibodies and dilutions were

used: AT270 (1:1000), 1H6L6 (1:2500), and AT180 (1:1000). The following day, the membrane

was washed 3x with TBST and then incubated with either horseradish peroxidase-coupled

secondary anti-mouse antibody (1:2000, Invitrogen # 62-6520, RRID: AB_2533947) or anti-

rabbit antibody (1:5000, Invitrogen # 31460, RRID: AB_228341) for 1 hour at room temperature

with continuous agitation. The peroxidase activity was revealed using an enhanced

chemiluminescence detection kit (GE Healthcare, # 16915806). GAPDH antibody (1:2000,

Invitrogen # MA5-15738-HRP, RRID: AB_2537659) was used as a loading control. The

experimenter was not blinded during the experiment.

Results

4.3.1 𝜱: A generalizable parameter for measuring the specificity of phospho-tau antibodies

To quantify the specificity of phospho-tau antibodies, we developed a whole-cell based approach

using flow cytometry (Figure 4.1). To probe the site-specificity of phospho-tau antibodies, we

generated targeted alanine mutants at defined phosphorylation sites. HEK293FT cells were

transiently transfected with either WT human tau (0N4R isoform) fused to the EGFP (EGFP-tau

WT), or a point mutant (an alanine mutant at the phosphorylation site of interest) fused to the

iRFP (iRFP-tau), in separate wells (Figure 4.1a). Previous reports indicated that endogenous tau

expression is undetected in HEK293 cells (5,6). In addition, when transfected with human tau,

74

endogenous kinases in HEK293FT cells phosphorylated human tau (7,8). Leveraging these facts,

we developed a ratiometric assay to quantify the specificity of phospho-tau antibodies (Figure

4.1a). The EGFP-positive cells (expressing WT tau) and iRFP-positive cells (expressing a tau

point mutant incapable of phosphorylation at a defined site) were mixed in same numbers and

incubated with phospho-tau antibodies (Figure 4.1a). The EGFP (green channel) and iRFP (far-

red channel) positive cells, and their antibody binding (red channel) were clearly distinguished

using flow cytometry (Figure 4.1b, left panel). This assay quantifies the specific binding of the

antibody to a defined phosphorylation site. In this assay, the phospho-tau antibody AT180,

targeting phospho-threonine 231 (pThr231) (9-11), showed almost exclusive labeling to the cells

expressing EGFP-tau WT, and no detectable binding to iRFP-tau T231A (Figure 4.1b),

indicating that AT180 binding requires pThr231.

Figure 4.1 A ratiometric assay to quantify the specificity of phospho-tau antibodies.

75

a, schematic of phospho-tau antibody specificity quantification assay using HEK293FT. HEK293FT cells were transfected with either EGFP-tau WT (12) or iRFP-tau with alanine mutation(s) at the target site (magenta), in separate wells. The cells were then mixed and incubated with phospho-tau antibodies. The antibody binding was detected using an Alexa Flour 594 conjugated secondary antibody (red). In parallel, HEK293FT cells were transfected with either EGFP-tau WT (12) or iRFP-tau WT (magenta), in separate wells. iRFP-tau WT cells were treated with lambda phosphatase (λPP) to de-phosphorylate tau, then mixed with EGFP-tau WT cells. Scale bars, 50 µm. b, representative flow cytometry results for AT180 showing the alanine mutant experiment (left) and de-phosphorylation experiment (right).

In case an antibody shows non-specific binding to the alanine mutant at the target modification

site, the antibody may be recognizing a phosphorylated residue at an off-target site. In addition,

the absence of antibody binding to the alanine mutant does not exclude the possibility that

binding to the non-modified tau is inhibited by the alanine mutation. In other words, the antibody

may possess non-specific binding to unmodified tau, but may not bind to the alanine point

mutant. To assess these possibilities, we transfected HEK293FT cells with either EGFP-tau WT

or iRFP-tau WT separately and treated only the iRFP-tau WT expressing cells with λPP (Figure

4.1a). As in the assay using the T231A mutant, AT180 showed exclusive binding to EGFP-tau

WT cells (Figure 4.1b, right panel). This result provides further support that the AT180 antibody

does not recognize the WT tau epitope without phosphorylation of Thr231.

We tested the assay (Figure 4.1a) for its ability to discern phospho-specificity using 3 previously

characterized anti-tau antibodies. Tau-5 is a pan-tau antibody that shows phosphorylation-

independent binding (13,14), 3.24 is a high specificity scFv to pThr231 tau (15), and ab131354

targets pSer262 tau but have shown cross-reactivity to non-phosphorylated tau (16). Tau-5

indeed showed binding to both EGFP-tau WT and iRFP-tau WT treated with λPP (Figure 4.2a).

3.24 showed binding to EGFP-tau WT, but not to iRFP-tau T231A or iRFP-tau WT treated with

λPP (Figure 4.2b), confirming its high specificity. ab131354 showed cross-reactivity to both

iRFP-tau S262A and iRFP-tau WT treated with λPP (Figure 4.2c), indicating that it is not

specific to pSer262 tau.

76

Figure 4.2 Validation of the assay using well characterized anti-tau antibodies a, flow cytometry plots for the pan-tau antibody Tau-5, which shows binding to both EGFP-tau WT and iRFP-tau WT treated with λPP. b-c, flow cytometry plots for the high specificity single-chain variable fragment 3.24 (b) and ab131354 (c).

Based on this assay, we introduce a parameter termed Φ (see Materials and Methods section for

definition) that quantifies the specificity of phospho-site targeting antibodies. Φ is determined by

the degree of cross-reactivity towards cells expressing the target antigen with an alanine point

mutation at the target phospho-site, or cells expressing the target antigen but were treated with

λPP for de-phosphorylation. Φ ranges from 0 to 1, where 1 indicates perfect specificity (no

binding to the alanine mutant or λPP treated cells), and lower Φ indicates more false positive

detection of nonphospho-tau or phospho-tau at off-target sites. 2 Φ values are derived from the

77

definition: ΦVWV is determined from cross-reactivity to tau with a point alanine mutation at the

target site, while ΦSTT is determined by cross-reactivity to de-phosphorylated tau. The phospho-

site specificity is determined by evaluating both ΦVWV and ΦSTT values. The specificity ΦVWV and

ΦSTT of AT180 were 0.99 ± 0.01 and 0.98 ± 0.01, respectively (Table 4.3, mean ± standard

deviation from 2 independent experiments, all data points shown in Figure 4.3), indicating

nearly perfect phospho-site specificity towards pThr231 tau. The specificity ΦVWV and ΦSTT of

ab131354 were 0.32 ± 0.02 and 0.37 ± 0.01, respectively, reflecting its poor specificity (Figure

4.2). Φ can be used as a general standard to measure and compare the specificity of post-

translational modification (PTM)-site targeting antibodies.

Figure 4.3 Measurement of 𝚽𝐚𝐥𝐚 and 𝚽𝛌𝐏𝐏 of phospho-tau antibodies. Error bars indicate standard deviation from two independent cell culture preparations. Red, ΦSTT. Blue, ΦVWV.

4.3.2 Co-expression of glycogen synthase kinase-3b enhances tau phosphorylation

The assay developed here relies on intracellular phosphorylation of tau due to endogenous kinase

activity in HEK293FT cells. Previous studies have found that tau expressed in HEK293 cells

78

were phosphorylated at various sites, including S214, S262, S396/S404 (17). A major advantage

of our assay is the potential to co-express kinases to induce tau phosphorylation. Since many of

the residues that are phosphorylated on tau are serine or threonine preceding a proline, we co-

expressed glycogen synthase kinase (GSK)-3b, a proline-directed kinase, in HEK293FT cells to

enhance tau phosphorylation. GSK-3b phosphorylates tau at a wide range of sites found in

Alzheimer’s disease patients (18). Co-transfected cells showed a similar level of EGFP-tau WT

expression (Figure 4.4a), but enhanced binding to the phospho-tau antibody AT8, which targets

pSer202 (19-21) (Figure 4.4b), indicating improved phosphorylation. Therefore, to enhance the

detection of phospho-tau antibody binding, we co-transfected tau constructs with GSK-3b in

subsequent experiments.

Figure 4.4 Co-expression of GSK-3b in HEK293FT cells enhances phosphorylation of tau. a, representative flow cytometry plots for AT8 showing tau expression (EGFP-tau) and AT8 binding cells transfected with tau-only (left) or cells co-transfected with tau and GSK-3b (right). b, histograms for tau expression (left) and AT8 binding (right) in cells transfected with tau-only (red) or cells co-transfected with tau and GSK-3b (blue).

4.3.3 Quantifying the phospho-site specificity of commonly used phospho-tau antibodies

Using our assay, we quantified the specificity Φ of 7 widely used phospho-tau antibodies

(AT270, AT8, AT100, AT180, PHF-6, TG-3, and PHF-1) as well as 2 additional phospho-tau

antibodies (1H6L6 and pS404). Collectively these antibodies have been raised against 6 distinct

phosphorylation sites (see Table 4.3 for more information) of high relevance in a wide range of

79

neurodegeneration. We applied the same approach described in Figure 4. 1 to quantify both ΦVWV

and ΦSTT. In Figure 4.5, data in the left two columns show antibody labeling from a mixture of

cells transfected with either EGFP-tau WT or iRFP-tau with the corresponding alanine point

mutant. The right two columns show antibody labeling from cells transfected with either EGFP-

tau WT or iRFP-tau WT treated with λPP. Clear binding to EGFP-tau WT was detected in all

antibodies except AT100 (Figure 4.5, leftmost column). Most antibodies showed exclusive

binding to EGFP-tau WT, and no binding to the alanine point mutant at their corresponding

target site or the iRFP-tau WT treated with λPP (Figure 4.5, second and last columns from left).

From two independent experiments, we obtained highly reproducible measurement of ΦVWV and

ΦSTT from these antibodies (Table 4.3 and Figure 4.3). 5 out of 7 antibodies (AT8, AT180,

PHF-6, TG-3, and PHF-1) had Φ values near 1, indicating these antibodies have nearly perfect

specificity. For AT270, ΦVWV = 0.80 ± 0.06 (Table 4.3), due to the elevated level of binding

signal in cells expressing the T181A mutant (Figure 4.5). However, ΦSTT = 0.99 ± 0.01 (Table

4.3), indicating that the cross-reactivity was not detected in dephosphorylated cells. Taken ΦVWV

and ΦSTT together, the non-specific signal detected from AT270 was phosphorylation-sensitive

(see below for further characterization of non-specific binding in AT270). For AT100, the

absence of binding to EGFP-tau WT cells suggests that the phospho-site (pThr212/pSer214) was

not phosphorylated in HEK293FT cells, even with co-transfection of GSK-3b. Therefore, we

were unable to measure the Φ values for AT100. Taken together, these results validate that the

widely used phospho-tau antibodies AT8, AT180, PHF-6, TG-3, and PHF1 binds specifically to

tau phosphorylated at the target site, but not to non-phosphorylated tau or phosphorylated tau at

off-target sites.

81

Figure 4.5 Specificity measurements for commonly used phospho-tau antibodies Specificity measurements for commonly used phospho-tau antibodies using the flow cytometry assay described in Figure 4.1. Dotted and closed circles indicate observed non-specific binding to cells not expressing tau.

4.3.4 Non-specific binding to cells in phospho-tau antibodies

For the antibody AT270, which showed lower ΦVWV but high ΦSTT, we observed a reproducible

non-specific binding to cells not expressing tau (dotted circles in Figure 4.5). Similar non-

specific binding was detected with AT100, even though AT100 did not bind to EGFP-tau WT.

Although not as prominent, a small fraction and weak level of non-specific binding to tau-

negative cells was detected in antibodies 1H6L6 and TG-3 (closed circles in Figure 4.5). For

other antibodies, background binding to non-transfected cells was not detected. The binding to

cells not expressing tau indicates that these antibodies exhibit non-specific binding to

HEK293FT cells. We conducted experiments to rule out the possibility that the non-specific

binding is originating from the secondary reagents used for detection. Control antibodies having

matched isotype (mouse IgG1, mouse IgM, or rabbit IgG) followed by the secondary antibodies

(see Materials and Methods section) were used to label a mixture of cells transfected with either

EGFP-tau WT, or cells transfected with iRFP-tau WT treated with λPP (Figure 4.6). No non-

specific binding was detected in the secondary reagents, indicating that the non-specific binding

observed was not due to secondary reagents.

82

Figure 4.6 Flow cytometry plots showing binding of isotype-matching control antibodies under the specificity quantification assay conditions

For AT270 and AT100, the population with non-specific binding separated clearly when cells

were treated with λPP (Figure 4.5, right two columns). Based on this result, we hypothesized

that the non-specific bindings of AT270 and AT100 are due to cross-reactivity to other

phosphorylated proteins in HEK293FT cells. In this scenario, cells treated with λPP would show

decreased level of antibody binding, while untreated cells would have generally elevated

antibody binding. To test this, we labeled a mixture of cells transfected with either EGFP (not

EGFP-tau), or cells transfected with iRFP (not iRFP-tau) treated with λPP. In this experiment,

binding was detected only in GFP-positive cells (Figure 4.7a). Since specific binding to

phospho-tau in AT100 was not detected, we further analyzed the non-specific binding of AT270.

83

We also analyzed the non-specific binding of 1H6L6, which showed a weak level of non-specific

binding (closed circles in Figure 4.5). TG-3 was not included in this analysis since the fraction

of tau-negative cells showing non-specific binding was even smaller. To further assess the non-

specific binding found in AT270 and 1H6L6, we conducted immunocytochemistry experiments.

Antibodies AT270 and 1H6L6 showed binding in cells not expressing EGFP-tau, while the

highly specific antibody AT180 showed staining only to EGFP-tau positive cells (Figure 4.7b).

To assess the broadness of proteins that cause the non-specific binding, we conducted western

blotting experiments. We probed cell lysates from non-transfected, EGFP-transfected, EGFP-tau

transfected cells as well as dissociated mouse hippocampus. In these experiments, antibodies

AT270 and 1H6L6 showed bands in addition to a band corresponding to EGFP-tau (Figure 4.7c).

In contrast, a single band corresponding to EGFP-tau was observed in AT180 (Figure 4.7c). For

AT270, off-target bands found in HEK293FT cell lysates were also detected in WT mouse

hippocampal cell lysate. Therefore, this non-specific binding was independent of species, leading

to a non-specific band interfering with the mouse tau signal. However, for 1H6L6, the non-

specific binding was not clearly detected in mouse hippocampal lysate, suggesting that the non-

specific binding may be species or cell-type dependent. These results demonstrate that by using a

whole-cell based approach, we have identified a source of non-specific binding in antibodies

AT270 and 1H6L6 not observable when using peptides for specificity characterization.

84

Figure 4.7 Non-specific binding to HEK293FT cells in phospho-tau antibodies a, flow cytometry plots for AT270 and AT100 to detect non-specific binding to normal HEK293FT cells (EGFP-transfected) vs. λPP-treated cells (iRFP-transfected). b, confocal images of AT180, AT270, and 1H6L6 antibodies binding to HEK293FT cells transfected with EGFP-tau WT. Images show nuclei stained using DAPI (blue), tau expression (12), antibody staining (red), and merge. Scale bars, 25 µm. c, analysis of tau signal and non-specific signal in AT270 and 1H6L6 by western blotting. The proteins were extracted from: lane 1, non-transfected HEK293FT cells; lane 2, HEK293FT cells transfected with EGFP; lane 3, HEK293FT cells co-transfected with EGFP-Tau/GSK-3b; lane 4, mouse hippocampus. Proteins were identified with the following antibodies: AT180, AT270 , and 1H6L6. GAPDH was used as a loading control.

Discussion

Site-specific phosphorylation of tau is critical in understanding the molecular biology of tau and

is a well-defined target in neurodegeneration. The specificity of phospho-tau antibodies is critical

for reproducible and sensitive detection (15,22). Phospho-tau antibodies should interact only

with the target epitope sequence with site-specific phosphorylation, and not with nonphospho-tau

85

or phospho-tau at off-target sites. In particular, considering the fact that phospho-tau antibodies

are being developed for diagnostic tests and clinical trials as therapeutics, a standard measure of

specificity is urgently needed (23-28) In this study, we developed a whole-cell based assay that

enables robust measurement of the specificity of phospho-tau antibodies, and introduced the

specificity parameter termed Φ. Φ is determined by measuring the fraction of binding signal

from cross-reactivity to nonphospho-tau or off-target phosphorylation sites. Φ ranges from 0 to 1,

where 1 indicates perfect specificity and lower Φ indicates more false positive detection of either

nonphospho-tau sequences or the phospho-tau at the off-target site. We measured two Φ values

(ΦVWV and ΦSTT ) to comprehensively capture the specificity. ΦVWV indicates the phospho-site

specificity of the antibody by measuring the fraction of non-specific binding to an alanine point

mutant at the target phospho-site. ΦSTT indicates the phospho-sensitivity of the antibody by

measuring non-specific binding to de-phosphorylated tau. This approach can be easily adapted to

other phosphorylated proteins, and potentially to other PTMs such as methylation and acetylation,

allowing specificity quantification and comparison of any PTM-site specific antibody. In

addition, the Φ values can be combined to a single parameter, to yield a single specificity

parameter. For example,

ΦXYXVW = 1 − ((1 − ΦVWV) + (1 − ΦSTT))

= ΦVWV + ΦSTT − 1

In our calculation of the Φ values, we did not include the fluorescence signal detected from cells

not expressing tau. Therefore, the small non-specific binding to cells we observed for antibody

1H6L6 (and to an even smaller degree in TG-3) is not reflected in their Φ values. As for AT270,

the Φ value captured the non-specific binding to cells, since the non-specific binding was

detected in the cells expressing the alanine mutant but was lost after de-phosphorylation with

86

λPP. We attempted to define another Φ parameter to quantify the non-specific binding to cells

but the resulting values were inconsistent due to variations in the level of non-specific binding

signal and fraction of cells showing binding.

Using our assay, we measured the Φ values of 10 phospho-tau antibodies, 7 of which have been

used in hundreds of previous studies. Out of the 7, we quantified the specificity of 6 antibodies

(AT270, AT8, AT180, PHF-6, TG-3, and PHF-1). We were unable to determine Φ values for

AT100, due to lack of binding to tau expressed in HEK293FT cells. Endogenous kinases in

HEK293FT cells phosphorylate human tau (7,8). We showed that co-transfection of tau with

GSK-3b led to increased phosphorylation of tau, but not for the AT100 target site

(Thr212/Ser214). Previous studies have indicated that the AT100 epitope is formed only when a

specific order of phosphorylation occurs (29). It has also been shown that Thr212 and Ser214 are

sequentially phosphorylated by GSK-3b and protein kinase A (PKA), respectively (29).

Considering that PKA is commonly expressed in cells, tau expressed in HEK293FT cells may

only be phosphorylated at Ser214, leading to lack of AT100 binding. Tau phosphorylation may

be enhanced by using mammalian brain extracts, which contain kinases that phosphorylate tau in

vitro (29-31).

Out of the 6 phospho-tau antibodies (AT270, AT8, AT180, PHF-6, TG-3, and PHF-1), all but

AT270 had Φ values close to 1, indicating near-perfect specificity. For AT270, a weak, but

reproducible binding was detected to tau-negative HEK293FT cells (Figure 4.5). This non-

specific binding was consistently detected in immunocytochemistry experiments, leading to

distinct perinuclear non-specific binding (Figure 4.7b). Western blotting with AT270 revealed

additional bands consistently present in non-transfected HEK293FT cell lysate as well as

primary WT mouse hippocampal lysate (Figure 4.7c). A previous study found multiple bands

87

when probing WT mouse brain lysate (32). The same study also found non-specific binding in

antibodies AT8, AT180, and TG-3, using cell lysate prepared from tau knockout mice. However,

this non-specific binding was not due to the antibodies themselves, and was eliminated by

switching secondary reagents (32). We found that the two Φ values for AT270 was inconsistent

(ΦVWV = 0.80 ± 0.06 vs. ΦSTT = 0.99 ± 0.01). This indicated that the source of cross-reactivity

was lost upon de-phosphorylation with λPP, suggesting that AT270 may bind to another

phosphorylated protein. Indeed, the non-specific binding was only detected from the tau-negative

cells expressing EGFP, but not from the tau-negative cells expressing iRFP with de-

phosphorylation treatment (Figure 4.7a).

A major advantage of our specificity assay is the use of flow cytometry, which allows sensitive,

quantitative detection of antibody binding. We enabled the distinction of non-specific binding

within a single sample by tagging potential cross-reactive proteins with a fluorescent protein

easily distinguishable from the WT target protein. These features led to the reproducible

measurement of Φ values for a wide range of phospho-tau antibodies. Previously, peptide arrays

have been used to validate the specificity of PTM-specific antibodies, such as those targeting

histone modifications (33-35). Synthetic peptides and peptide arrays were also used for

specificity analysis of phospho-tau antibodies (16). The limitation of this approach is the high

cost of synthesizing peptides in order to comprehensively cover tau phosphorylation sites.

Moreover, short peptides do not have strong binding to conformation-sensitive phospho-tau

antibodies, such as TG-3 (10). Our approach allows assessment of binding to full-length tau with

defined sequence variations, and can be co-expressed with kinases to induce tau phosphorylation.

Using our approach, the specificity of the conformation-sensitive pT231 tau antibody TG-3 was

also successfully determined (Figure 4.5 and Table 4.3). Libraries of tau mutations may be

88

generated, and deep sequencing approaches can be used for de novo identification of anti-tau

antibodies. Our approach also revealed non-specific binding of antibodies to irrelevant cellular

proteins. We found that the source of non-specific binding for AT270 is conserved across

HEK293FT cells and mouse primary hippocampal cells, but was not conserved for 1H6L6,

indicating cell-type and species sensitivity of non-specific binding. Further analyses using

immunoprecipitation and mass spectrometry may allow the identification of the cross-reactive

proteins.

Since the cross-reactivity of antibodies would be dependent on the affinity to the off-target sites

or molecules, it is possible that the Φ values are dependent on antibody concentration. In

particular, the Φ values may decrease upon increasing antibody concentration. In our

experiments, we used antibody concentrations typically used for cell labeling experiments (2

µg/mL, Table 4.3). Since we observed high antibody binding signal in these experiments for all

antibodies tested except AT100 (which showed non-specific binding to cells), we did not attempt

to increase the antibody concentration. Also, all antibodies that showed binding had near-perfect

specificity, except AT270 and ab131354. Lowering the antibody concentration for these

antibodies resulted in a significant decrease in antibody binding, and did not result in

improvement of Φ values (data not shown). Even for the high specificity antibodies, users should

be cautious when using them at higher concentrations than what is listed in Table 4.3, since that

may result in increased non-specific binding.

Conclusion

In summary, our study provided a whole-cell based approach to validate the specificity of

phospho-tau antibodies. Using this assay, we determined the parameter Φ for phospho-tau

89

antibodies, that enable quantitative comparison of specificity. We anticipate that this parameter

will be widely adopted in guiding users of the specificity of phospho-tau antibodies, and

potentially PTM-specific antibodies in general.

90

References

1. Hall, S. S., and Daugherty, P. S. (2009) Quantitative specificity-based display library screening identifies determinants of antibody-epitope binding specificity. Protein science : a publication of the Protein Society 18, 1926-1934

2. Cho, Y. K., Park, D., Yang, A., Chen, F., Chuong, A. S., Klapoetke, N. C., and Boyden, E. S. (2019) Multidimensional screening yields channelrhodopsin variants having improved photocurrent and order-of-magnitude reductions in calcium and proton currents. The Journal of biological chemistry 294, 3806-3821

3. Klapoetke, N. C., Murata, Y., Kim, S. S., Pulver, S. R., Birdsey-Benson, A., Cho, Y. K., Morimoto, T. K., Chuong, A. S., Carpenter, E. J., Tian, Z., Wang, J., Xie, Y., Yan, Z., Zhang, Y., Chow, B. Y., Surek, B., Melkonian, M., Jayaraman, V., Constantine-Paton, M., Wong, G. K., and Boyden, E. S. (2014) Independent optical excitation of distinct neural populations. Nature methods 11, 338-346

4. Kim, J., and Shin, W. (2014) How to do random allocation (randomization). Clin Orthop Surg 6, 103-109

5. Kfoury, N., Holmes, B. B., Jiang, H., Holtzman, D. M., and Diamond, M. I. (2012) Trans-cellular propagation of Tau aggregation by fibrillar species. The Journal of biological chemistry 287, 19440-19451

6. Liu, Y., Su, Y., Wang, J., Sun, S., Wang, T., Qiao, X., Run, X., Li, H., and Liang, Z. (2013) Rapamycin decreases tau phosphorylation at Ser214 through regulation of cAMP-dependent kinase. Neurochemistry international 62, 458-467

7. Camero, S., Benitez, M. J., Cuadros, R., Hernandez, F., Avila, J., and Jimenez, J. S. (2014) Thermodynamics of the interaction between Alzheimer's disease related tau protein and DNA. PLoS One 9, e104690

8. Houck, A. L., Hernandez, F., and Avila, J. (2016) A Simple Model to Study Tau Pathology. J Exp Neurosci 10, 31-38

9. Goedert, M., Jakes, R., Crowther, R. A., Cohen, P., Vanmechelen, E., Vandermeeren, M., and Cras, P. (1994) Epitope mapping of monoclonal antibodies to the paired helical filaments of Alzheimer's disease: identification of phosphorylation sites in tau protein. Biochem J 301 ( Pt 3), 871-877

10. Gotz, J., Chen, F., Barmettler, R., and Nitsch, R. M. (2001) Tau filament formation in transgenic mice expressing P301L tau. J Biol Chem 276, 529-534

11. Nakamura, K., Greenwood, A., Binder, L., Bigio, E. H., Denial, S., Nicholson, L., Zhou, X. Z., and Lu, K. P. (2012) Proline isomer-specific antibodies reveal the early pathogenic tau conformation in Alzheimer's disease. Cell 149, 232-244

12. Green, N. M. (1975) Avidin. Adv Protein Chem 29, 85-133 13. LoPresti, P., Szuchet, S., Papasozomenos, S. C., Zinkowski, R. P., and Binder, L. I. (1995)

Functional implications for the microtubule-associated protein tau: localization in oligodendrocytes. Proc Natl Acad Sci U S A 92, 10369-10373

14. Carmel, G., Mager, E. M., Binder, L. I., and Kuret, J. (1996) The structural basis of monoclonal antibody Alz50's selectivity for Alzheimer's disease pathology. The Journal of biological chemistry 271, 32789-32795

15. Li, D., Wang, L., Maziuk, B. F., Yao, X., Wolozin, B., and Cho, Y. K. (2018) Directed evolution of a picomolar-affinity, high-specificity antibody targeting phosphorylated tau. The Journal of biological chemistry 293, 12081-12094


17. Ren, Q. G., Liao, X. M., Chen, X. Q., Liu, G. P., and Wang, J. Z. (2007) Effects of tau phosphorylation on proteasome activity. FEBS Lett 581, 1521-1528

91

18. Mandelkow, E. M., Drewes, G., Biernat, J., Gustke, N., Van Lint, J., Vandenheede, J. R., and Mandelkow, E. (1992) Glycogen synthase kinase-3 and the Alzheimer-like state of microtubule-associated protein tau. FEBS Lett 314, 315-321

19. Pei, J. J., Braak, E., Braak, H., Grundke-Iqbal, I., Iqbal, K., Winblad, B., and Cowburn, R. F. (1999) Distribution of active glycogen synthase kinase 3beta (GSK-3beta) in brains staged for Alzheimer disease neurofibrillary changes. J Neuropathol Exp Neurol 58, 1010-1019

20. Sereno, L., Coma, M., Rodriguez, M., Sanchez-Ferrer, P., Sanchez, M. B., Gich, I., Agullo, J. M., Perez, M., Avila, J., Guardia-Laguarta, C., Clarimon, J., Lleo, A., and Gomez-Isla, T. (2009) A novel GSK-3beta inhibitor reduces Alzheimer's pathology and rescues neuronal loss in vivo. Neurobiol Dis 35, 359-367

21. Hernandez, F., Lucas, J. J., Cuadros, R., and Avila, J. (2003) GSK-3 dependent phosphoepitopes recognized by PHF-1 and AT-8 antibodies are present in different tau isoforms. Neurobiol Aging 24, 1087-1094


23. Chai, X., Wu, S., Murray, T. K., Kinley, R., Cella, C. V., Sims, H., Buckner, N., Hanmer, J., Davies, P., O'Neill, M. J., Hutton, M. L., and Citron, M. (2011) Passive immunization with anti-Tau antibodies in two transgenic models: reduction of Tau pathology and delay of disease progression. J Biol Chem 286, 34457-34467

24. Boutajangout, A., Ingadottir, J., Davies, P., and Sigurdsson, E. M. (2011) Passive immunization targeting pathological phospho-tau protein in a mouse model reduces functional decline and clears tau aggregates from the brain. Journal of neurochemistry 118, 658-667

25. Kayed, R. (2010) Anti-tau oligomers passive vaccination for the treatment of Alzheimer disease. Hum Vaccin 6, 931-935

26. Asuni, A. A., Boutajangout, A., Quartermain, D., and Sigurdsson, E. M. (2007) Immunotherapy targeting pathological tau conformers in a tangle mouse model reduces brain pathology with associated functional improvements. J Neurosci 27, 9115-9129

27. Boutajangout, A., Quartermain, D., and Sigurdsson, E. M. (2010) Immunotherapy targeting pathological tau prevents cognitive decline in a new tangle mouse model. J Neurosci 30, 16559-16566

28. Lewis, J., McGowan, E., Rockwood, J., Melrose, H., Nacharaju, P., Van Slegtenhorst, M., Gwinn-Hardy, K., Paul Murphy, M., Baker, M., Yu, X., Duff, K., Hardy, J., Corral, A., Lin, W. L., Yen, S. H., Dickson, D. W., Davies, P., and Hutton, M. (2000) Neurofibrillary tangles, amyotrophy and progressive motor disturbance in mice expressing mutant (P301L) tau protein. Nat Genet 25, 402-405

29. Zheng-Fischhofer, Q., Biernat, J., Mandelkow, E. M., Illenberger, S., Godemann, R., and Mandelkow, E. (1998) Sequential phosphorylation of Tau by glycogen synthase kinase-3beta and protein kinase A at Thr212 and Ser214 generates the Alzheimer-specific epitope of antibody AT100 and requires a paired-helical-filament-like conformation. Eur J Biochem 252, 542-552

30. Gustke, N., Steiner, B., Mandelkow, E. M., Biernat, J., Meyer, H. E., Goedert, M., and Mandelkow, E. (1992) The Alzheimer-like phosphorylation of tau protein reduces microtubule binding and involves Ser-Pro and Thr-Pro motifs. FEBS Lett 307, 199-205

31. Lichtenberg-Kraag, B., Mandelkow, E. M., Biernat, J., Steiner, B., Schroter, C., Gustke, N., Meyer, H. E., and Mandelkow, E. (1992) Phosphorylation-dependent epitopes of neurofilament antibodies on tau protein and relationship with Alzheimer tau. Proc Natl Acad Sci U S A 89, 5384-5388


33. Egelhofer, T. A., Minoda, A., Klugman, S., Lee, K., Kolasinska-Zwierz, P., Alekseyenko, A. A., Cheung, M. S., Day, D. S., Gadel, S., Gorchakov, A. A., Gu, T., Kharchenko, P. V., Kuan, S.,

92

Latorre, I., Linder-Basso, D., Luu, Y., Ngo, Q., Perry, M., Rechtsteiner, A., Riddle, N. C., Schwartz, Y. B., Shanower, G. A., Vielle, A., Ahringer, J., Elgin, S. C., Kuroda, M. I., Pirrotta, V., Ren, B., Strome, S., Park, P. J., Karpen, G. H., Hawkins, R. D., and Lieb, J. D. (2011) An assessment of histone-modification antibody quality. Nature structural & molecular biology 18, 91-93

34. Bock, I., Dhayalan, A., Kudithipudi, S., Brandt, O., Rathert, P., and Jeltsch, A. (2011) Detailed specificity analysis of antibodies binding to modified histone tails with peptide arrays. Epigenetics 6, 256-263

35. Fuchs, S. M., Krajewski, K., Baker, R. W., Miller, V. L., and Strahl, B. D. (2011) Influence of combinatorial histone modifications on antibody and effector protein recognition. Curr Biol 21, 53-58

93

Conclusion

This work has addressed the problems of generating and characterizing high-specific and high-

affinity phospho-tau antibodies. We introduced a yeast display approach to quantify the

specificity of PTM-specific antibodies, and developed a screening assay based on it to generate

PTM-specific antibodies with improved affinity and high specificity. We demonstrated that

improving PTM-specific antibody affinity through directed evolution results in cross-reactivity

to the non-modified target sequence, there’s a trade-off between affinity and specificity in PTM-

specific antibodies. The results from this study demonstrate that in vitro affinity maturation is a

viable option for improving the affinity of PTM-specific antibodies. In this process, it is essential

to quantify the specificity, particularly to the non-modified target sequence. By quantifying the

specificity, it is possible to apply selection pressures for improved affinity and specificity

simultaneously.

We also developed a whole-cell based approach to quantify the specificity of phospho-tau

antibodies and introduced a parameter Φ to measure their specificity. We anticipate that this

parameter will be widely adopted in guiding the use of phospho-tau antibodies, and PTM-

specific antibodies in general.

Future perspectives

5.2.1 Avidity effect on antibody screening assay

Antibody affinity and avidity

94

Antibody affinity measures the interaction strength between an epitope and the antigen binding

site on antibody. It is defined by a measure of dynamic equilibrium of the reversible

biomolecular interaction.

Calculation of binding affinity for antibody-antigen interaction (1 antibody binding site per 1

antigen):

𝐴𝑏 + 𝐴𝑔 ⟺ [𝐴𝑏 − 𝐴𝑔]

where [Ab] is the unbound antibody concentration, [Ag] is the unbound antigen concentration,

and [Ab-Ag] is the concentration of the antibody-antigen complex.

Calculation of dissociation constant, which is the affinity constant (Kd):

𝐾𝑑 =𝑘E``𝑘E8

= 𝐴𝑏 [𝐴𝑔][𝐴𝑏 − 𝐴𝑔]

where 𝑘E8 is a constant used to characterize how quickly the antibody binds to its target, and

𝑘E`` is a constant used to characterize how quickly an antibody dissociates from its target.

High affinity antibodies bind quickly to the antigen, allowing sensitive binding and detection in

assays under difficult conditions. Low affinity antibodies bind slowly and weakly to the antigen

and often fail to detect the antigen in assays.

Antibody avidity refers to the accumulated strength of multiple antigen-binding sites interact

with the target epitopes simultaneously. Avidity is thought as the combined effect of all affinities

involved in the biomolecular interaction, which is referred to as functional affinity (1). Nature

uses multivalency to govern many biological processes.

Avidity effect on antibody screening assay

All antibodies are at least bivalent or multivalent, however, the engineered binding proteins

developed from in vitro screening assay are generally monovalent. When generating novel scFvs

or nanobodies using in vitro screening assay, it is extremely difficult to discover binders in the

95

initial rounds of screening due to their low affinity. The greater valency of an antibody, the

greater the amount of antigen it can bind. Similarly, antigens can demonstrate multivalency

because they can bind to more than one antibody. Multimeric interactions between an antibody

and an antigen slow their dissociation and stabilize the binding. Individually, each binding

interaction may dissociate quickly, however, when many binding interactions are present at the

same time, transient unbinding of a single site does not allow the molecule to dissociate away,

and binding of that weak interaction is likely to be restored. Therefore, we hypothesize that

avidity effect on yeast displayed scFvs can increase the possibility to obtain rare low affinity

binders, and we can develop a new screening assay based on it.

In order to test our hypothesis, we will assess the impact of avidity of yeast displayed pT231

scFv on its binding to the target phosphopeptide. Three parameters are involved in this study,

and the relevant specific aims are:

i. Affinity of the scFv for the phosphopeptide

In Chapter 3, we have identified some scFv mutants those only bind to target phosphopeptide

but have no cross-reactivity to nonphospho-peptide or scrambled phosphopeptide. We will assess

the affinity of yeast displayed mutants for the target phosphopeptide and select the high-affinity

mutants, moderate-affinity mutants, and low-affinity mutants. We will measure the dissociation

rate of these mutants.

ii. Valency of the phosphopeptide

The valency of the phosphopeptide can be increased by streptavidin-biotin interaction.

Streptavidin has the ability to bind up to four biotin molecules (Figure 5.1) with an extremely

high affinity (Kd=10-14 M) (2). The bond between streptavidin and biotin is one of the strongest

96

non-covalent interaction. It is unaffected by pH, temperature, organic solvents and other

denaturing reagents once formed.

Figure 5.1 Schematic of the Streptavidin-biotin interaction Streptavidin can bind up to four biotin or biotinylated molecules, which is conjugated to a target phosphopeptide to form a streptavidin-biotin complex.

The valency of phosphopeptide can be controlled by incubating the streptavidin with different

ratios of biotinylated phosphopeptide and free biotin. We will label the yeast displayed scFv

mutants with those pre-incubated phosphopeptide complex, and measure the dissociation rate of

each mutants in different conditions.

iii. Structural arrangement of the functional scFv

More functional scFvs expression per yeast cell also contributes to the avidity effect. A favorable

structural arrangement of functional scFvs increases the local concentration of phosphopeptide

97

binding sites. Once the first phosphopeptide binds to an scFv on the yeast surface, the chance of

a bivalent, trivalent, and/or tetravalent interaction are improved.

To enable this idea, we will assess the impact of linker length between yeast wall protein Aga2p

and scFv on avidity effect (Figure 5.2). We will insert a longer polypeptide linker between

Aga2p and the pT231 scFv, allowing more functional scFvs cluster together. We will measure

the dissociation rate of the same scFv in different yeast surface display formats.

Figure 5.2 Schematic of yeast surface display formats The yeast surface display vector encodes scFv as a fusion to the C-terminus of Aga2p with a shorter polypeptide linker (left), and a longer polypeptide linker (right).

5.2.2 Application of binding proteins in optogenetics

The discovery of light-gated ion channels and their application to control neural activities have

had a transformative impact on the field of neuroscience. In recent years, the concept of using

light-activated proteins to control biological processes has greatly diversified into other fields,

driven by the natural diversity of photoreceptors and decades of knowledge obtained through

their biophysical characterization. This strategy, commonly referred to as optogenetics, is

98

particularly powerful in deciphering the role of targeted neural cells within their complex native

environment.

The development intracellular binding proteins for neural proteins, such as tau, combined with

optogenetics tools allows the visualization of complex structures such as the synapse that are

critical for understanding neural function. These technologies have the potential to pinpoint the

location of proteins in fine neuronal structures and reveal the changes occurring in these

structures under diseased state. Therefore, our screening assay on improved affinity and high

specific antibody will be applied to develop intracellular binding proteins for key neural target

proteins and coupling optogenetics to these binding proteins for studying target protein function

in the future.

Introduction

The word ‘optogenetics’ was initially used within the context of neuroscience (3), to describe the

approach of using light to image and control neuronal activity in the intact, living brain. The idea

of controlling biological function using light has been around for a long time, but it is in the field

of neuroscience that its need as a truly enabling tool has been envisioned early on (4,5), and

remarkably to the realization of such potential (6-8) with wide acceptance over the past decade.

The success of optogenetics in neuroscience has sparked interest of many scientists and

engineers in other fields, and now the definition of optogenetics has broadened to encompass the

general field of biotechnology that combines genetic engineering and optics to enable gain or

loss of well-defined function, often in the intact animal (9,10).

Original concepts: a brief historical perspective

The seed for the birth of optogenetics in neuroscience may have been planted for a long time by

the pioneering work of Ramón y Cajal, who provided foundational evidence that neurons are the

99

signaling units of the nervous system, and that they exist in many distinctive morphologies (11).

Since then, studies followed to show that indeed many different types of neurons exist, classified

based on their physiological characteristics, anatomical location, morphology, and gene

expression profile (12-14). It is still unclear how many cell types exist in the human brain, but it

is speculated that there are about 1,000 neuronal cell types just within the mammalian cortex

(15,16). In a general sense, it is agreed that a specific cell type carries out the same function

within a neural circuit (17). Therefore, identification of all cell types and mapping out their

connectivity is essential in order to understand how the nervous system works. Identification of

different cell types must be accompanied with functional characterization within their normal

context, the nervous system. For this reason, neuroscientists have been looking for a way to

perturb individual cell types within the intact brain. This was clearly expressed by Francis Crick

in his insightful discussion published in 1979, in which he proposed the need for a ‘method by

which all neurons of just one type could be inactivated, leaving the others more or less unaltered’

(4).

Optogenetics is arguably the first technological breakthrough that enables such experiments. It

makes the crucial connection between cell-type information and the ability to perform gain or

loss of function experiments. Prior to the development of optogenetics, experimental approaches

existed in neuroscience to use light as a way to control neural activity. For example, ‘caged’

compounds such as secondary messenger molecules, ions, and neurotransmitters have been

developed that are initially inert, but become active upon light illumination (18,19). Even

though these photochemical approaches did not provide ways to control specific cell-types, they

laid the groundwork for the use of millisecond timescale illumination in intact cells and tissue

(19). Cell-type specific activation of neurons was first achieved in a series of pioneering work

100

by the Miesenböck group, by heterologously expressing an invertebrate rhodopsin with other

interacting proteins (20), and ligand-gated ion channels that can be activated by synthetic photo-

caged precursors (21,22). Around this time, microbial rhodopsins that function as single

component light-gated ion channels were discovered (23-25). Remarkably, these microbial

photoreceptors could be heterologously expressed in mammalian neurons to optically trigger

action potentials with millisecond timescale precision (6). These findings, along with the fact

that these rhodopsins contain a covalently bound all-trans retinal chromophore naturally

produced in nearly all cell types including mammalian cells and tissues (26,27), catalyzed the

wide adoption of these molecules in neuroscience.

Genetic targeting: cell-type specificity and beyond

As discussed above, cell-type specificity is a defining feature of optogenetic experiments. In

some ways, gain or loss of function experiments on distinct cell types is analogous to genetic

knock-in or knockout experiments in molecular biology. However, while the definition of gene

is clear, the definition of cell type can be ambiguous and variable. This is particularly true in

highly complex systems such as the mammalian neocortex (17,28). To account for such high

complexity, many parameters have been used to describe each cell type, such as developmental

lineage, anatomical location, dendritic and axonal morphology, electrophysiology, and gene

expression. Nonetheless, recent advances in single cell analysis methods have provided evidence

that gene expression patterns can capture many of these diverse cellular phenotypes (12,29).

Therefore, the use of genetically encoded tools is well justified for probing the function of each

cell type, and is likely to expand as we gather more gene expression data.

In principle, optogenetic tools can be driven by cell-type specific promoters or enhancers (30,31)

to achieve cell-type specific expression. However, this approach is not suitable in many cases for

101

several reasons. First, it is rare to find a single genetic regulatory element exclusive for a given

cell type. Cell identity in most cases seems to be defined by a combination of multiple gene

expression patterns (10,12,17,32). Even when cell-type specific genetic regulatory elements are

accessible, they may not drive high enough expression of optogenetic tools for efficient control

(33). Moreover, reproducing endogenous expression pattern of genes requires the entire

transcription unit and all associated regulatory factors (13), which are unknown in many cases,

and can be hard to transport. A widely used strategy to achieve cell-type specific expression that

circumvents these problems is using viral vectors in transgenic animals expressing recombinase

in genetically defined population of cells. In this approach, viral vectors such as lentivirus or

adeno-associated virus (AAV) carry an optogenetic tool under relatively strong promoters such

as EF-1a promoter (Figure 1). The optogenetic tool encoding gene is initially present in reverse

frame to prevent expression, and requires recombinase activity for inversion and subsequent

expression (Figure 1). The recombinase gene expression is driven in genetically defined cell

types, for which the expression level is relatively unimportant. Cre-recombinase has been widely

used for this purpose, due to the availability of increasing number of cell type specific Cre-

transgenic lines (34). Recently, this approach has been further developed to enable targeting of

neural cell types defined by multiple genetic markers. Transgenic animals that express multiple

recombinases driven by independent promoters are infected with viral vectors carrying a

combination of these recombinase sites, resulting in intersectional targeting (35,36).

Using viral vectors also enable other useful modes of targeting. One approach is to target

neurons based on their axonal projections or synaptic connectivity (Figure 1). For example,

modified rabies virus can retrogradely transduce neurons (37,38), while herpes simplex virus and

vesicular stomatitis virus can anterogradely transduce across axon terminals (39,40). These

102

viruses can be used to deliver Cre-recombinase transsynaptically (39,41), allowing the targeting

of neurons projecting to genetically defined populations. Recently, it was also shown that certain

serotypes of AAV also can mediate efficient retrograde transduction (42). These tools enable

targeting optogenetic tools based on their axonal projection (43-45) and potentially synaptic

connectivity.

Another targeting strategy is to express genes using promoters and enhancers induced by

neuronal activity. These genetic elements were identified from immediate early genes that are

known to rapidly induce expression upon neuronal activity (46,47). In many cases, these

elements are triggered by calcium influx that activates calcium-dependent kinases (48). These

promoters have been used to specifically express optogenetic tools in neurons that gain activity

during specific behavioral tasks in rodents, such as fear conditioning (49). In a set of impressive

demonstrations, Liu and others showed that these neurons could be specifically re-activated

using the light-gated ion channel channelrhodopsin-2 (ChR2) driven by the activity-dependent

promoter of c-Fos (49,50). This re-activation recreated the original behavior with only light-

activation, indicating optically controlled memory recall (49). Ramirez and others later used the

same approach to trigger fear response by optically activating a set of neurons activated during

fear conditioning, demonstrating the creation of false memory (51). Conceptually, these

demonstrations show that optogenetics can be used to reactivate cell populations specifically

activated during a behavioral task, enabling activity-based targeting. Considering the diverse

functionality of transcription factors that can sense a wide range of input signals (52-54), such

responsive transcription may be a generalizable approach to express optogenetic tools to control

cell populations that drive a specific functional output.

Customizing photoreceptors for designed control: modes of action

103

The use of microbial rhodopsins in mammalian neural cells is an inspiring demonstration of

customizing naturally existing photoreceptors for controlling physiological properties in a

completely new context. Owing to the diverse modes of action found in photoreceptors (Figure

2), the concept of re-purposing naturally existing parts to control new biological functions has

been implemented in many applications, and is expected to further develop as new

photoreceptors continue to be discovered.

Microbial rhodopsins (type 1 rhodopsins) mediate either transmembrane ion transport (Figure 2a,

b) or light sensing through signal transduction (Figure 2c). Microbial rhodopsins that mediate

light-driven ion transport have been widely used to control membrane potential in mammalian

neurons (7). They can be categorized into two mechanistically distinct forms: ion pumps (Figure

2a) that can transport ions against their gradient and channels (Figure 2b) that passively conduct

ions along the gradient established by other active transporters. Interestingly, all known light-

driven ion pumps result in hyperpolarization of membrane potential through outward transport of

proton or inward transport of chloride ion (55). When heterologously expressed in mammalian

neurons, they generate enough current to enable optical silencing (7,56-58). Recently, a light-

driven chloride pump with high sensitivity for far-red light named Jaws has been described that

enabled non-invasive neural silencing through the intact mouse skull (59). A light-driven

outward sodium pump (KR2) has also been found recently (60), that may be used for optical

silencing of neurons. Unlike ion pumps, microbial rhodopsin ion channels cannot transport ions

against their gradient, but enable control of membrane potential through selective conduction of

specific ions. First described examples are channelrhodopsins found in the green alga

Chlamydomonas reinhardtii (23,24), which conduct cations including proton, sodium, potassium,

and calcium ions (24). Even though the conductance of these channels are relatively low (about

104

100-fold lower than high-conductance ion channels) (61,62), their current depolarize mammalian

neurons above their threshold to initiate action potentials (6). Recently, more than 60

channelrhodopsin homologues were identified by conducting a systematic search of

transcriptome from 127 species of alga (63). This study resulted in a high sensitivity

channelrhodopsin with extremely fast channel kinetics named Chronos, and a red-sensitive

channelrhodopsin named Chrimson that as a pair enabled independent multi-color activation of

two distinct neural populations (63). Another recent study identified anion-conducting light-

gated channels in the cryptophyte Guillardia theta that enabled rapid and reversible optical

silencing of rat neurons (64). So far, microbial sensory rhodopsins have not been applied in

optogenetic experiments, perhaps due to the requirement of transmembrane or soluble

transducers that are not readily compatible with other cell types. In depth discussion of

biophysical properties of microbial rhodopsins and their impact as optogenetic tools have been

discussed elsewhere (65).

Animal rhodopsins (type II rhodopsins) share structural homology to microbial rhodopsins, but

act as G-protein coupled receptors (GPCRs) that upon light illumination, catalyze GDP to GTP

exchange in heterotrimeric G proteins. In fact, rhodopsins constitute the largest GPCR family –

over 700 rhodopsin-like GPCRs have been found in humans (66). Based on the extensive

structure-function relationship studies of GPCRs (67,68), Khorana and colleagues demonstrated

that the cytoplasmic domains of a bovine rhodopsin can be replaced by analogous sequences

from a non-light sensitive GPCR, such as β2-adrenergic receptor (β2-AR) to create a chimeric

light-sensitive β2-AR (69). This strategy has been extended to create light-driven rhodopsins

coupled to Gq and Gs signaling pathways (70), Gi/o coupled pathways (71,72). It was also found

that heterologous expression of unmodified forms of rhodopsins into non-expressing cells can

105

mediate light-driven activation of endogenous G-proteins of the host cell (73). Unlike microbial

rhodopsins that keep the retinal chromophore throughout the photocycle, certain animal

rhodopsins such as bovine rhodopsin lose the chromophore after light-activation, requiring

consistent supply of retinal cofactors (74). Fortunately, in mammalian cells and in brain tissue,

sufficient concentration of retinal cofactors are present to generate enough functional rhodopsins.

However, even in cell types where the retinal chromophore is less abundant, the retinal cofactor

supplementation may be avoided by using ‘non-bleaching’ G-protein coupled opsins that remain

associated with the chromophore (75).

Other than rhodopsins based photoreceptors, light-sensing proteins found in plants and microbes

have been applied in controlling cell signaling in diverse cell types, including mammalian cells,

yeast, and bacteria. These proteins function by inducing light-triggered conformational change

coupled to other protein domains (Figure 2e), homo/hetero dimerization (Figure 2f), or

multimerization (Figure 2g). A prominent example that undergoes conformational change upon

light-activation is the Light-Oxygen-Voltage (LOV) domains found in photoreceptor systems of

plants, fungi, and bacteria (76,77). In these systems, LOV domains may control the activity of an

effector domain directly fused to it through allosteric coupling or steric inhibition. For example,

the bacterial chemosensor FixL was made light-activatable by replacing its Per-ARNT-Sims (78)

motif (which is structurally homologous to LOV domains) with the LOV domain Ytva (79). In

this example, an a-helical coiled coil linker of the LOV domain undergoes a rotational

movement upon light activation, which activates a histidine kinase domain fused to it. In other

examples, the conformational change in the LOV domain leads to unfolding of an a-helix in the

lit-state, resulting in ‘uncaging’ of the effector domain fused to it (Figure 2e). Such light-

activated uncaging approach has been successfully applied in several synthetic constructs

106

including a photo-activatable GTPase Rac1 and Cdc42 (80), peptide binding motifs (81), and

tethered toxins (82). Even though such photo-uncaging approach seems to be a generally

applicable design, in many cases it requires several levels of optimization customized to each

molecule for effective control. For instance, in the photo-activatable Rac1, Ca2+-mediated

interaction between residues at the interface of the LOV domain and Rac1 turned out to be

crucial for effective light control (83). Since such conformation-dependent interactions are hard

to be predicted, de novo design of a photo-activatable construct still remains a challenge. Such

difficulties may be overcome by using Dronpa, which is a photo-activated fluorescent protein

that seems to allow modular design of optical control. Upon light-activation, Dronpa not only

changes fluorescence, but also monomerizes through the unfolding of a β-sheet (84). This feature

has been used to design photo-activatable GTPases and proteases (85).

Another mode of action found in photoreceptor domains is light-induced interaction. Certain

LOV domains, such as the fungal LOV domain Vivid (VVD) (86) and bacterial LOV domain

EL222 (87) homo-dimerize upon light activation (Figure 2f). Other photoreceptor domains such

as Arabidopsis thaliana Cryptochrome-2 (CRY2) and Phytochrome B (PhyB) hetero-dimerize

with a specific partner (Figure 2f), cryptochrome-interacting basic helix-loop-helix 1 (CIB1) and

phytochrome interacting factor (PIF), respectively (76). Such light-induced interactions have

been used primarily to control intracellular signaling, by recruiting signaling proteins to or away

from a specific intracellular site of action, resulting in signal activation or inhibition through

sequestration. Activities of various kinases, including Ras/ERK (88), phosphoinositide-3 kinase

(PI3K) (89), and receptor tyrosine kinase (90) (91) have been controlled using this approach.

Several studies also demonstrated optical control of DNA transcription using light-induced

binders that mediate the recruitment of transcription activation domains (92,93) or activation of

107

Cre-recombinase (94,95). Interestingly, CRY2 has been shown to undergo multimerization upon

illumination (Figure 2g), which has been used to mediate light-dependent activation of Rho

GTPase (96), RTK fibroblast growth factor receptor (97), and actin polymerization (98). The use

of photoreceptors for optogenetic control of cellular signaling pathways has been extensively

reviewed recently (65,99,100).

Engineering photoreceptors: a multi-dimensional problem

Even though it seems that natural photoreceptor systems rely on modularity of light-activated

protein domains for controlling diverse signaling pathways (76,101), development of a new

optogenetic tool in general requires significant engineering efforts for effective control. One

major challenge is achieving adequate expression of optogenetic tools. As seen in the case of

microbial opsins, the expression level of an optogenetic construct may be one of the limiting

factor in achieving effective control. Heterologous expression of photoreceptor domains depends

on the host cell type, and may yield low levels of functionally active form of the optogenetic tool.

For example, a study that systematically compared channelrhodopsin homologues found that less

than half of them show detectable ion conduction when expressed in a mammalian cell line, and

even less are functionally active in neurons (63). One strategy to improve functional expression

is to enhance the protein trafficking to the desired compartment using targeting sequences

(58,102). However, this approach is not generalizable (103), and achieving adequate expression

of optogenetic tools in the desired cell type remains a challenge.

Another major challenge is the fact that optogenetic tools require multiple properties to be

optimized. For example, critical properties of channelrhodopsins that impact their effectiveness

in controlling neural activity include ion conductance, light sensitivity, spectral sensitivity,

channel kinetics, and ion selectivity. Structure-guided mutagenesis studies have resulted in

108

improved channelrhodopsins with fast kinetics (104), enhanced photocurrent (105,106), red-

shifted spectral sensitivity (107), and altered ion selectivity (108,109). These studies

demonstrated that key properties can be tuned using mutagenesis, but also revealed that a single

mutation often affects multiple properties (Figure 3). For example, mutations at E123 in ChR2

(corresponding to D85, which is the Schiff base counter-ion in bacteriorhodopsin), affect channel

kinetics and red-shifts the action spectra (104). Mutation H134R in ChR2 enhances photocurrent

perhaps due to improved membrane expression, but slows channel kinetics (62,110). Mutations

C128 and D156 slow down the channel kinetics drastically, which help to keep open channels for

longer periods of time, effectively enhancing the light sensitivity (111,112). The trend of

multiple property modulation by a single mutation is also found in LOV domains. For example,

in the Avena sativa phototropin 1 LOV2, mutations in the highly conserved residue Q513 reduce

the structural changes between the dark and the lit state and slow down the dark state return rate

(113). In addition, in the LOV domain VVD, mutations in M135 and M165 slow recovery

kinetics and enhance the affinity of the lit-state VVD dimer (114). Therefore, optimization of an

optogenetic tool requires multi-dimensional characterizations to measure all essential parameters

(112), and in certain cases individual properties may not be independently optimized. In other

words, the fitness landscape of photoreceptors is a multi-dimensional space composed of

potentially dependent parameters. Since typical screens used for protein engineering rely on

rapid measurement of one or two parameters, strategies such as directed evolution to optimize

one parameter may result in de-optimization of others that are critical for tool performance.

Currently, the general strategy is to combine random mutagenesis based methods with structure-

guided approaches and rely on additive beneficial effects of multiple mutations to yield an

109

optimal construct (108,109,115,116). In the future, screens that can characterize multiple

parameters may be developed to perform multi-dimensional optimizations.

Analogies to optical imaging: multi-color imaging vs. optogenetics

Another major direction in optogenetics has been to use multiple colors of light to control two

independent cell types or processes using photoreceptor domains that have distinctive spectral

sensitivities. This approach has been extensively explored using microbial opsins. For instance,

ChR2, which has maximal sensitivity for blue light has been combined with a halorhodopsin

which can be activated with yellow light to enable bi-directional control of neural activity

(56,57). Proton pumps with separation in their spectral sensitivity have been used to achieve two-

color neural silencing (58). Even though these studies demonstrated that triggering or inhibiting

action potentials in neurons can be controlled by leveraging the difference in spectral sensitivity

of microbial rhodopsins, a recent study showed that achieving multi-color control relying on

spectral separation alone may result in cross-talk, due to the inherent blue-light sensitivity found

in rhodopsins (63,82). Even the red-sensitive channelrhodopsin Chrimson was shown to trigger

action potentials under strong blue light in neurons with high expression levels (63). However,

detailed biophysical characterization of Chrimson revealed that its channel opening rate under

blue light is substantially slower than that under red light, and is also dependent on light intensity

(63). Therefore, cross-activation of neurons under blue light was minimized by pairing Chrimson

with the fast and light-sensitive channelrhodopsin Chronos and limiting the intensity and

duration of blue light (63). The blue-light sensitivity of microbial rhodopsins may not be

completely abolished unless the choromophore itself is altered. Many photoreceptors, including

LOV domains and cryptochromes are also maximally sensitive to blue light. Therefore, strategies

other than relying on spectral separation alone, such as leveraging differences in light sensitivity

110

and kinetics under blue light may be necessary to reduce cross-talk for multi-color control using

other photoreceptors.

Although the concept of multi-color control in optogenetics may seem analogous to multi-color

fluorescence imaging, there are several practical differences that require caution in designing

optogenetic experiments with multiple light sources. In multi-color fluorescence imaging, cross-

activation of fluorophores occurs quite often, but the emission from multiple fluorophores can be

filtered to obtain cross-talk free images. In experiments using light-activated proteins, any cross-

activation causes change that cannot be filtered or eliminated. Depending on the biological

question asked, small changes induced by cross-activation may become important, such as in

experiments that focus on sub-threshold changes in membrane potential. Therefore, when

designing experiments that require multiple sources of light, such as using light-gated ion

channels with calcium reporters (117), the wavelength of light used for imaging should be

chosen cautiously to prevent activation of optical actuators. It is notable that blue-sensitive

channelrhodopsins that seem to have negligible red-sensitivity can cause membrane

depolarization under intense red light (116). As described above, strategies that capitalize on all

aspects of biophysical properties of photoreceptors may be used to prevent cross-activation, but

may be difficult to completely eliminate small changes induced.

Conclusion and future perspectives

Over the past decade, optogenetics has made a major impact on neuroscience research, by

enabling the control of specific cell types in the intact brain. A powerful integration of optical

control methods with various detection methods enables closed-loop control of biological

systems, as achieved by several studies that demonstrated closed-loop control of neural circuit

(118-120) and feedback-regulated control of cell signaling (121) and gene expression levels

111

(122). These studies indicate that optogenetic approaches will enable us to reveal the underlying

mechanisms behind complex intracellular signaling systems or multi-cellular dynamics and

precisely tune it to achieve a desired outcome. They will also allow us to develop and test models

of intact, complex biological systems.

Successful development of new optogenetic tools and their implementation is an

interdisciplinary effort that requires tools tailored to the specific biological process studied.

Targeting and achieving optimal expression in the desired cell type need to be tested, and the

biophysical properties of photoreceptors used need to be optimized to the spatial and temporal

properties to be controlled. Therefore, users of optogenetic tools need to understand their

biophysical characteristics, and tool developers need to identify key properties and find ways to

tune them.

112

Reference

1. Rudnick, S. I., and Adams, G. P. (2009) Affinity and avidity in antibody-based tumor targeting. Cancer Biother Radiopharm 24, 155-161

2. Green, N. M. (1975) Avidin. Adv Protein Chem 29, 85-133 3. Deisseroth, K., Feng, G., Majewska, A. K., Miesenbock, G., Ting, A., and Schnitzer, M. J. (2006)

Next-generation optical technologies for illuminating genetically targeted brain circuits. The Journal of neuroscience : the official journal of the Society for Neuroscience 26, 10380-10386

4. Crick, F. H. (1979) Thinking about the brain. Scientific American 241, 219-232 5. Crick, F. (1999) The impact of molecular biology on neuroscience. Philosophical transactions of

the Royal Society of London. Series B, Biological sciences 354, 2021-2025 6. Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., and Deisseroth, K. (2005) Millisecond-

timescale, genetically targeted optical control of neural activity. Nature neuroscience 8, 1263-1268

7. Boyden, E. S. (2011) A history of optogenetics: the development of tools for controlling brain circuits with light. F1000 biology reports 3, 11

8. Deisseroth, K. (2010) Controlling the brain with light. Scientific American 303, 48-55 9. Deisseroth, K. (2011) Optogenetics. Nature methods 8, 26-29 10. Miesenbock, G. (2009) The optogenetic catechism. Science 326, 395-399 11. Ramón y Cajal, S. (1911) Histology of the nervous system of man and vertebrates. Oxford

University Press, 1995 translation. 12. Fishell, G., and Heintz, N. (2013) The neuron identity problem: form meets function. Neuron 80,

602-612 13. Gong, S., Zheng, C., Doughty, M. L., Losos, K., Didkovsky, N., Schambra, U. B., Nowak, N. J.,

Joyner, A., Leblanc, G., Hatten, M. E., and Heintz, N. (2003) A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature 425, 917-925

14. Hawrylycz, M. J., Lein, E. S., Guillozet-Bongaarts, A. L., Shen, E. H., Ng, L., Miller, J. A., van de Lagemaat, L. N., Smith, K. A., Ebbert, A., Riley, Z. L., Abajian, C., Beckmann, C. F., Bernard, A., Bertagnolli, D., Boe, A. F., Cartagena, P. M., Chakravarty, M. M., Chapin, M., Chong, J., Dalley, R. A., Daly, B. D., Dang, C., Datta, S., Dee, N., Dolbeare, T. A., Faber, V., Feng, D., Fowler, D. R., Goldy, J., Gregor, B. W., Haradon, Z., Haynor, D. R., Hohmann, J. G., Horvath, S., Howard, R. E., Jeromin, A., Jochim, J. M., Kinnunen, M., Lau, C., Lazarz, E. T., Lee, C., Lemon, T. A., Li, L., Li, Y., Morris, J. A., Overly, C. C., Parker, P. D., Parry, S. E., Reding, M., Royall, J. J., Schulkin, J., Sequeira, P. A., Slaughterbeck, C. R., Smith, S. C., Sodt, A. J., Sunkin, S. M., Swanson, B. E., Vawter, M. P., Williams, D., Wohnoutka, P., Zielke, H. R., Geschwind, D. H., Hof, P. R., Smith, S. M., Koch, C., Grant, S. G., and Jones, A. R. (2012) An anatomically comprehensive atlas of the adult human brain transcriptome. Nature 489, 391-399

15. Koch, C. (2004) The quest for consciousness : a neurobiological approach, Roberts and Co., Denver, Colo.

16. Stevens, C. F. (1998) Neuronal diversity: too many cell types for comfort? Current biology : CB 8, R708-710

17. Luo, L., Callaway, E. M., and Svoboda, K. (2008) Genetic dissection of neural circuits. Neuron 57, 634-660

18. Ellis-Davies, G. C. (2007) Caged compounds: photorelease technology for control of cellular chemistry and physiology. Nature methods 4, 619-628

19. Kaplan, J. H., and Somlyo, A. P. (1989) Flash photolysis of caged compounds: new tools for cellular physiology. Trends in neurosciences 12, 54-59

20. Zemelman, B. V., Lee, G. A., Ng, M., and Miesenbock, G. (2002) Selective photostimulation of genetically chARGed neurons. Neuron 33, 15-22

113

21. Zemelman, B. V., Nesnas, N., Lee, G. A., and Miesenbock, G. (2003) Photochemical gating of heterologous ion channels: remote control over genetically designated populations of neurons. Proceedings of the National Academy of Sciences of the United States of America 100, 1352-1357

22. Lima, S. Q., and Miesenbock, G. (2005) Remote control of behavior through genetically targeted photostimulation of neurons. Cell 121, 141-152

23. Nagel, G., Ollig, D., Fuhrmann, M., Kateriya, S., Musti, A. M., Bamberg, E., and Hegemann, P. (2002) Channelrhodopsin-1: a light-gated proton channel in green algae. Science 296, 2395-2398

24. Nagel, G., Szellas, T., Huhn, W., Kateriya, S., Adeishvili, N., Berthold, P., Ollig, D., Hegemann, P., and Bamberg, E. (2003) Channelrhodopsin-2, a directly light-gated cation-selective membrane channel. Proceedings of the National Academy of Sciences of the United States of America 100, 13940-13945

25. Sineshchekov, O. A., Jung, K. H., and Spudich, J. L. (2002) Two rhodopsins mediate phototaxis to low- and high-intensity light in Chlamydomonas reinhardtii. Proceedings of the National Academy of Sciences of the United States of America 99, 8689-8694

26. Blomhoff, R., and Blomhoff, H. K. (2006) Overview of retinoid metabolism and function. Journal of neurobiology 66, 606-630

27. Zhang, F., Wang, L. P., Boyden, E. S., and Deisseroth, K. (2006) Channelrhodopsin-2 and optical control of excitable cells. Nature methods 3, 785-792

28. Markram, H., Toledo-Rodriguez, M., Wang, Y., Gupta, A., Silberberg, G., and Wu, C. (2004) Interneurons of the neocortical inhibitory system. Nature reviews. Neuroscience 5, 793-807

29. Sugino, K., Hempel, C. M., Miller, M. N., Hattox, A. M., Shapiro, P., Wu, C., Huang, Z. J., and Nelson, S. B. (2006) Molecular taxonomy of major neuronal classes in the adult mouse forebrain. Nature neuroscience 9, 99-107

30. Spergel, D. J., Kruth, U., Hanley, D. F., Sprengel, R., and Seeburg, P. H. (1999) GABA- and glutamate-activated channels in green fluorescent protein-tagged gonadotropin-releasing hormone neurons in transgenic mice. The Journal of neuroscience : the official journal of the Society for Neuroscience 19, 2037-2050

31. Oliva, A. A., Jr., Jiang, M., Lam, T., Smith, K. L., and Swann, J. W. (2000) Novel hippocampal interneuronal subtypes identified using transgenic mice that express green fluorescent protein in GABAergic interneurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 20, 3354-3368

32. McGarry, L. M., Packer, A. M., Fino, E., Nikolenko, V., Sippy, T., and Yuste, R. (2010) Quantitative classification of somatostatin-positive neocortical interneurons identifies three interneuron subtypes. Frontiers in neural circuits 4, 12

33. Zeng, H., and Madisen, L. (2012) Mouse transgenic approaches in optogenetics. Progress in brain research 196, 193-213

34. Gong, S., Doughty, M., Harbaugh, C. R., Cummins, A., Hatten, M. E., Heintz, N., and Gerfen, C. R. (2007) Targeting Cre recombinase to specific neuron populations with bacterial artificial chromosome constructs. The Journal of neuroscience : the official journal of the Society for Neuroscience 27, 9817-9823

35. Fenno, L. E., Mattis, J., Ramakrishnan, C., Hyun, M., Lee, S. Y., He, M., Tucciarone, J., Selimbeyoglu, A., Berndt, A., Grosenick, L., Zalocusky, K. A., Bernstein, H., Swanson, H., Perry, C., Diester, I., Boyce, F. M., Bass, C. E., Neve, R., Huang, Z. J., and Deisseroth, K. (2014) Targeting cells with single vectors using multiple-feature Boolean logic. Nature methods 11, 763-772

36. Madisen, L., Garner, A. R., Shimaoka, D., Chuong, A. S., Klapoetke, N. C., Li, L., van der Bourg, A., Niino, Y., Egolf, L., Monetti, C., Gu, H., Mills, M., Cheng, A., Tasic, B., Nguyen, T. N., Sunkin, S. M., Benucci, A., Nagy, A., Miyawaki, A., Helmchen, F., Empson, R. M., Knopfel, T., Boyden, E. S., Reid, R. C., Carandini, M., and Zeng, H. (2015) Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Neuron 85, 942-958

114

37. Wickersham, I. R., Finke, S., Conzelmann, K. K., and Callaway, E. M. (2007) Retrograde neuronal tracing with a deletion-mutant rabies virus. Nature methods 4, 47-49

38. Wickersham, I. R., Lyon, D. C., Barnard, R. J., Mori, T., Finke, S., Conzelmann, K. K., Young, J. A., and Callaway, E. M. (2007) Monosynaptic restriction of transsynaptic tracing from single, genetically targeted neurons. Neuron 53, 639-647

39. Lo, L., and Anderson, D. J. (2011) A Cre-dependent, anterograde transsynaptic viral tracer for mapping output pathways of genetically marked neurons. Neuron 72, 938-950

40. Beier, K. T., Saunders, A., Oldenburg, I. A., Miyamichi, K., Akhtar, N., Luo, L., Whelan, S. P., Sabatini, B., and Cepko, C. L. (2011) Anterograde or retrograde transsynaptic labeling of CNS neurons with vesicular stomatitis virus vectors. Proceedings of the National Academy of Sciences of the United States of America 108, 15414-15419

41. Wall, N. R., Wickersham, I. R., Cetin, A., De La Parra, M., and Callaway, E. M. (2010) Monosynaptic circuit tracing in vivo through Cre-dependent targeting and complementation of modified rabies virus. Proceedings of the National Academy of Sciences of the United States of America 107, 21848-21853

42. Rothermel, M., Brunert, D., Zabawa, C., Diaz-Quesada, M., and Wachowiak, M. (2013) Transgene expression in target-defined neuron populations mediated by retrograde infection with adeno-associated viral vectors. The Journal of neuroscience : the official journal of the Society for Neuroscience 33, 15195-15206

43. Osakada, F., Mori, T., Cetin, A. H., Marshel, J. H., Virgen, B., and Callaway, E. M. (2011) New rabies virus variants for monitoring and manipulating activity and gene expression in defined neural circuits. Neuron 71, 617-631

44. Apicella, A. J., Wickersham, I. R., Seung, H. S., and Shepherd, G. M. (2012) Laminarly orthogonal excitation of fast-spiking and low-threshold-spiking interneurons in mouse motor cortex. The Journal of neuroscience : the official journal of the Society for Neuroscience 32, 7021-7033

45. Kress, G. J., Yamawaki, N., Wokosin, D. L., Wickersham, I. R., Shepherd, G. M., and Surmeier, D. J. (2013) Convergent cortical innervation of striatal projection neurons. Nature neuroscience 16, 665-667

46. Smeyne, R. J., Schilling, K., Robertson, L., Luk, D., Oberdick, J., Curran, T., and Morgan, J. I. (1992) fos-lacZ transgenic mice: mapping sites of gene induction in the central nervous system. Neuron 8, 13-23

47. Kawashima, T., Okuno, H., Nonaka, M., Adachi-Morishima, A., Kyo, N., Okamura, M., Takemoto-Kimura, S., Worley, P. F., and Bito, H. (2009) Synaptic activity-responsive element in the Arc/Arg3.1 promoter essential for synapse-to-nucleus signaling in activated neurons. Proceedings of the National Academy of Sciences of the United States of America 106, 316-321

48. Bito, H., Deisseroth, K., and Tsien, R. W. (1996) CREB phosphorylation and dephosphorylation: a Ca(2+)- and stimulus duration-dependent switch for hippocampal gene expression. Cell 87, 1203-1214

49. Liu, X., Ramirez, S., Pang, P. T., Puryear, C. B., Govindarajan, A., Deisseroth, K., and Tonegawa, S. (2012) Optogenetic stimulation of a hippocampal engram activates fear memory recall. Nature 484, 381-385

50. Kubik, S., Miyashita, T., and Guzowski, J. F. (2007) Using immediate-early genes to map hippocampal subregional functions. Learning & memory 14, 758-770

51. Ramirez, S., Liu, X., Lin, P. A., Suh, J., Pignatelli, M., Redondo, R. L., Ryan, T. J., and Tonegawa, S. (2013) Creating a false memory in the hippocampus. Science 341, 387-391

52. Sellick, C. A., and Reece, R. J. (2005) Eukaryotic transcription factors as direct nutrient sensors. Trends in biochemical sciences 30, 405-412

53. Chandel, N. S., Maltepe, E., Goldwasser, E., Mathieu, C. E., Simon, M. C., and Schumacker, P. T. (1998) Mitochondrial reactive oxygen species trigger hypoxia-induced transcription. Proceedings of the National Academy of Sciences of the United States of America 95, 11715-11720

115

54. Tamura, T., Yanai, H., Savitsky, D., and Taniguchi, T. (2008) The IRF family transcription factors in immunity and oncogenesis. Annual review of immunology 26, 535-584

55. Ernst, O. P., Lodowski, D. T., Elstner, M., Hegemann, P., Brown, L. S., and Kandori, H. (2014) Microbial and animal rhodopsins: structures, functions, and molecular mechanisms. Chemical reviews 114, 126-163

56. Han, X., and Boyden, E. S. (2007) Multiple-color optical activation, silencing, and desynchronization of neural activity, with single-spike temporal resolution. PloS one 2, e299

57. Zhang, F., Wang, L. P., Brauner, M., Liewald, J. F., Kay, K., Watzke, N., Wood, P. G., Bamberg, E., Nagel, G., Gottschalk, A., and Deisseroth, K. (2007) Multimodal fast optical interrogation of neural circuitry. Nature 446, 633-639

58. Chow, B. Y., Han, X., Dobry, A. S., Qian, X., Chuong, A. S., Li, M., Henninger, M. A., Belfort, G. M., Lin, Y., Monahan, P. E., and Boyden, E. S. (2010) High-performance genetically targetable optical neural silencing by light-driven proton pumps. Nature 463, 98-102

59. Chuong, A. S., Miri, M. L., Busskamp, V., Matthews, G. A., Acker, L. C., Sorensen, A. T., Young, A., Klapoetke, N. C., Henninger, M. A., Kodandaramaiah, S. B., Ogawa, M., Ramanlal, S. B., Bandler, R. C., Allen, B. D., Forest, C. R., Chow, B. Y., Han, X., Lin, Y., Tye, K. M., Roska, B., Cardin, J. A., and Boyden, E. S. (2014) Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Nature neuroscience 17, 1123-1129

60. Inoue, K., Ono, H., Abe-Yoshizumi, R., Yoshizawa, S., Ito, H., Kogure, K., and Kandori, H. (2013) A light-driven sodium ion pump in marine bacteria. Nature communications 4, 1678

61. Feldbauer, K., Zimmermann, D., Pintschovius, V., Spitz, J., Bamann, C., and Bamberg, E. (2009) Channelrhodopsin-2 is a leaky proton pump. Proceedings of the National Academy of Sciences of the United States of America 106, 12317-12322

62. Lin, J. Y., Lin, M. Z., Steinbach, P., and Tsien, R. Y. (2009) Characterization of engineered channelrhodopsin variants with improved properties and kinetics. Biophysical journal 96, 1803-1814

63. Klapoetke, N. C., Murata, Y., Kim, S. S., Pulver, S. R., Birdsey-Benson, A., Cho, Y. K., Morimoto, T. K., Chuong, A. S., Carpenter, E. J., Tian, Z., Wang, J., Xie, Y., Yan, Z., Zhang, Y., Chow, B. Y., Surek, B., Melkonian, M., Jayaraman, V., Constantine-Paton, M., Wong, G. K., and Boyden, E. S. (2014) Independent optical excitation of distinct neural populations. Nature methods 11, 338-346

64. Govorunova, E. G., Sineshchekov, O. A., Janz, R., Liu, X., and Spudich, J. L. (2015) Natural light-gated anion channels: A family of microbial rhodopsins for advanced optogenetics. Science

65. Schmidt, D., and Cho, Y. K. (2015) Natural photoreceptors and their application to synthetic biology. Trends in biotechnology 33, 80-91

66. Fredriksson, R., Lagerstrom, M. C., Lundin, L. G., and Schioth, H. B. (2003) The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Molecular pharmacology 63, 1256-1272

67. Farrens, D. L., Altenbach, C., Yang, K., Hubbell, W. L., and Khorana, H. G. (1996) Requirement of rigid-body motion of transmembrane helices for light activation of rhodopsin. Science 274, 768-770

68. Rosenbaum, D. M., Rasmussen, S. G., and Kobilka, B. K. (2009) The structure and function of G-protein-coupled receptors. Nature 459, 356-363

69. Kim, J. M., Hwa, J., Garriga, P., Reeves, P. J., RajBhandary, U. L., and Khorana, H. G. (2005) Light-driven activation of beta 2-adrenergic receptor signaling by a chimeric rhodopsin containing the beta 2-adrenergic receptor cytoplasmic loops. Biochemistry 44, 2284-2292

70. Airan, R. D., Thompson, K. R., Fenno, L. E., Bernstein, H., and Deisseroth, K. (2009) Temporally precise in vivo control of intracellular signalling. Nature 458, 1025-1029

71. Oh, E., Maejima, T., Liu, C., Deneris, E., and Herlitze, S. (2010) Substitution of 5-HT1A receptor signaling by a light-activated G protein-coupled receptor. The Journal of biological chemistry 285, 30825-30836

116

72. Siuda, E. R., Copits, B. A., Schmidt, M. J., Baird, M. A., Al-Hasani, R., Planer, W. J., Funderburk, S. C., McCall, J. G., Gereau, R. W. t., and Bruchas, M. R. (2015) Spatiotemporal control of opioid signaling and behavior. Neuron 86, 923-935

73. Cao, P., Sun, W., Kramp, K., Zheng, M., Salom, D., Jastrzebska, B., Jin, H., Palczewski, K., and Feng, Z. (2012) Light-sensitive coupling of rhodopsin and melanopsin to G(i/o) and G(q) signal transduction in Caenorhabditis elegans. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 26, 480-491

74. Terakita, A., Koyanagi, M., Tsukamoto, H., Yamashita, T., Miyata, T., and Shichida, Y. (2004) Counterion displacement in the molecular evolution of the rhodopsin family. Nature structural & molecular biology 11, 284-289

75. Koyanagi, M., and Terakita, A. (2014) Diversity of animal opsin-based pigments and their optogenetic potential. Biochimica et biophysica acta 1837, 710-716

76. Moglich, A., Yang, X., Ayers, R. A., and Moffat, K. (2010) Structure and function of plant photoreceptors. Annual review of plant biology 61, 21-47

77. Herrou, J., and Crosson, S. (2011) Function, structure and mechanism of bacterial photosensory LOV proteins. Nature reviews. Microbiology 9, 713-723

78. Jones, R., Sheehan, B., Phillips, P., Juszczak, E., Adams, J., Baldwin, A., Ballard, C., Banerjee, S., Barber, B., Bentham, P., Brown, R., Burns, A., Dening, T., Findlay, D., Gray, R., Griffin, M., Holmes, C., Hughes, A., Jacoby, R., Johnson, T., Jones, R., Knapp, M., Lindesay, J., McKeith, I., McShane, R., Macharouthu, A., O'Brien, J., Onions, C., Passmore, P., Raftery, J., Ritchie, C., Howard, R., and team, D.-A. (2009) DOMINO-AD protocol: donepezil and memantine in moderate to severe Alzheimer's disease - a multicentre RCT. Trials 10, 57

79. Moglich, A., Ayers, R. A., and Moffat, K. (2009) Design and signaling mechanism of light-regulated histidine kinases. Journal of molecular biology 385, 1433-1444

80. Wu, Y. I., Frey, D., Lungu, O. I., Jaehrig, A., Schlichting, I., Kuhlman, B., and Hahn, K. M. (2009) A genetically encoded photoactivatable Rac controls the motility of living cells. Nature 461, 104-108

81. Strickland, D., Lin, Y., Wagner, E., Hope, C. M., Zayner, J., Antoniou, C., Sosnick, T. R., Weiss, E. L., and Glotzer, M. (2012) TULIPs: tunable, light-controlled interacting protein tags for cell biology. Nature methods 9, 379-384

82. Schmidt, D., Tillberg, P. W., Chen, F., and Boyden, E. S. (2014) A fully genetically encoded protein architecture for optical control of peptide ligand concentration. Nature communications 5, 3019

83. Winkler, A., Barends, T. R., Udvarhelyi, A., Lenherr-Frey, D., Lomb, L., Menzel, A., and Schlichting, I. (2015) Structural details of light activation of the LOV2-based photoswitch PA-Rac1. ACS chemical biology 10, 502-509

84. Mizuno, H., Mal, T. K., Walchli, M., Kikuchi, A., Fukano, T., Ando, R., Jeyakanthan, J., Taka, J., Shiro, Y., Ikura, M., and Miyawaki, A. (2008) Light-dependent regulation of structural flexibility in a photochromic fluorescent protein. Proceedings of the National Academy of Sciences of the United States of America 105, 9227-9232

85. Zhou, X. X., Chung, H. K., Lam, A. J., and Lin, M. Z. (2012) Optical control of protein activity by fluorescent protein domains. Science 338, 810-814

86. Zoltowski, B. D., Schwerdtfeger, C., Widom, J., Loros, J. J., Bilwes, A. M., Dunlap, J. C., and Crane, B. R. (2007) Conformational switching in the fungal light sensor Vivid. Science 316, 1054-1057

87. Nash, A. I., McNulty, R., Shillito, M. E., Swartz, T. E., Bogomolni, R. A., Luecke, H., and Gardner, K. H. (2011) Structural basis of photosensitivity in a bacterial light-oxygen-voltage/helix-turn-helix (LOV-HTH) DNA-binding protein. Proceedings of the National Academy of Sciences of the United States of America 108, 9449-9454

88. Toettcher, J. E., Weiner, O. D., and Lim, W. A. (2013) Using optogenetics to interrogate the dynamic control of signal transmission by the Ras/Erk module. Cell 155, 1422-1434

117

89. Idevall-Hagren, O., Dickson, E. J., Hille, B., Toomre, D. K., and De Camilli, P. (2012) Optogenetic control of phosphoinositide metabolism. Proceedings of the National Academy of Sciences of the United States of America 109, E2316-2323

90. Burns, D. H., Rosendahl, S., Bandilla, D., Maes, O. C., Chertkow, H. M., and Schipper, H. M. (2009) Near-infrared spectroscopy of blood plasma for diagnosis of sporadic Alzheimer's disease. J Alzheimers Dis 17, 391-397

91. Grusch, M., Schelch, K., Riedler, R., Reichhart, E., Differ, C., Berger, W., Ingles-Prieto, A., and Janovjak, H. (2014) Spatio-temporally precise activation of engineered receptor tyrosine kinases by light. The EMBO journal 33, 1713-1726

92. Shimizu-Sato, S., Huq, E., Tepperman, J. M., and Quail, P. H. (2002) A light-switchable gene promoter system. Nature biotechnology 20, 1041-1044

93. Liu, H., Gomez, G., Lin, S., Lin, S., and Lin, C. (2012) Optogenetic control of transcription in zebrafish. PloS one 7, e50738

94. Kennedy, M. J., Hughes, R. M., Peteya, L. A., Schwartz, J. W., Ehlers, M. D., and Tucker, C. L. (2010) Rapid blue-light-mediated induction of protein interactions in living cells. Nature methods 7, 973-975

95. Boulina, M., Samarajeewa, H., Baker, J. D., Kim, M. D., and Chiba, A. (2013) Live imaging of multicolor-labeled cells in Drosophila. Development 140, 1605-1613

96. Bugaj, L. J., Choksi, A. T., Mesuda, C. K., Kane, R. S., and Schaffer, D. V. (2013) Optogenetic protein clustering and signaling activation in mammalian cells. Nature methods 10, 249-252

97. Kim, N., Kim, J. M., Lee, M., Kim, C. Y., Chang, K. Y., and Heo, W. D. (2014) Spatiotemporal control of fibroblast growth factor receptor signals by blue light. Chemistry & biology 21, 903-912

98. Taslimi, A., Vrana, J. D., Chen, D., Borinskaya, S., Mayer, B. J., Kennedy, M. J., and Tucker, C. L. (2014) An optimized optogenetic clustering tool for probing protein interaction and function. Nature communications 5, 4925

99. Tischer, D., and Weiner, O. D. (2014) Illuminating cell signalling with optogenetic tools. Nature reviews. Molecular cell biology 15, 551-558

100. Zhang, K., and Cui, B. (2015) Optogenetic control of intracellular signaling pathways. Trends in biotechnology 33, 92-100

101. Losi, A., and Gartner, W. (2012) The evolution of flavin-binding photoreceptors: an ancient chromophore serving trendy blue-light sensors. Annual review of plant biology 63, 49-72

102. Gradinaru, V., Zhang, F., Ramakrishnan, C., Mattis, J., Prakash, R., Diester, I., Goshen, I., Thompson, K. R., and Deisseroth, K. (2010) Molecular and cellular approaches for diversifying and extending optogenetics. Cell 141, 154-165

103. Kralj, J. M., Douglass, A. D., Hochbaum, D. R., Maclaurin, D., and Cohen, A. E. (2012) Optical recording of action potentials in mammalian neurons using a microbial rhodopsin. Nature methods 9, 90-95

104. Gunaydin, L. A., Yizhar, O., Berndt, A., Sohal, V. S., Deisseroth, K., and Hegemann, P. (2010) Ultrafast optogenetic control. Nature neuroscience 13, 387-392

105. Kleinlogel, S., Feldbauer, K., Dempski, R. E., Fotis, H., Wood, P. G., Bamann, C., and Bamberg, E. (2011) Ultra light-sensitive and fast neuronal activation with the Ca(2)+-permeable channelrhodopsin CatCh. Nature neuroscience 14, 513-518

106. Berndt, A., Schoenenberger, P., Mattis, J., Tye, K. M., Deisseroth, K., Hegemann, P., and Oertner, T. G. (2011) High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels. Proceedings of the National Academy of Sciences of the United States of America 108, 7595-7600

107. Prigge, M., Schneider, F., Tsunoda, S. P., Shilyansky, C., Wietek, J., Deisseroth, K., and Hegemann, P. (2012) Color-tuned channelrhodopsins for multiwavelength optogenetics. The Journal of biological chemistry 287, 31804-31812

108. Berndt, A., Lee, S. Y., Ramakrishnan, C., and Deisseroth, K. (2014) Structure-guided transformation of channelrhodopsin into a light-activated chloride channel. Science 344, 420-424

118

109. Wietek, J., Wiegert, J. S., Adeishvili, N., Schneider, F., Watanabe, H., Tsunoda, S. P., Vogt, A., Elstner, M., Oertner, T. G., and Hegemann, P. (2014) Conversion of channelrhodopsin into a light-gated chloride channel. Science 344, 409-412

110. Nagel, G., Brauner, M., Liewald, J. F., Adeishvili, N., Bamberg, E., and Gottschalk, A. (2005) Light activation of channelrhodopsin-2 in excitable cells of Caenorhabditis elegans triggers rapid behavioral responses. Current biology : CB 15, 2279-2284

111. Berndt, A., Yizhar, O., Gunaydin, L. A., Hegemann, P., and Deisseroth, K. (2009) Bi-stable neural state switches. Nature neuroscience 12, 229-234

112. Mattis, J., Tye, K. M., Ferenczi, E. A., Ramakrishnan, C., O'Shea, D. J., Prakash, R., Gunaydin, L. A., Hyun, M., Fenno, L. E., Gradinaru, V., Yizhar, O., and Deisseroth, K. (2012) Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Nature methods 9, 159-172

113. Nash, A. I., Ko, W. H., Harper, S. M., and Gardner, K. H. (2008) A conserved glutamine plays a central role in LOV domain signal transmission and its duration. Biochemistry 47, 13842-13849

114. Zoltowski, B. D., Vaccaro, B., and Crane, B. R. (2009) Mechanism-based tuning of a LOV domain photoreceptor. Nat Chem Biol 5, 827-834

115. Gleichmann, T., Diensthuber, R. P., and Moglich, A. (2013) Charting the signal trajectory in a light-oxygen-voltage photoreceptor by random mutagenesis and covariance analysis. The Journal of biological chemistry 288, 29345-29355

116. Hochbaum, D. R., Zhao, Y., Farhi, S. L., Klapoetke, N., Werley, C. A., Kapoor, V., Zou, P., Kralj, J. M., Maclaurin, D., Smedemark-Margulies, N., Saulnier, J. L., Boulting, G. L., Straub, C., Cho, Y. K., Melkonian, M., Wong, G. K., Harrison, D. J., Murthy, V. N., Sabatini, B. L., Boyden, E. S., Campbell, R. E., and Cohen, A. E. (2014) All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins. Nature methods 11, 825-833

117. Akerboom, J., Carreras Calderon, N., Tian, L., Wabnig, S., Prigge, M., Tolo, J., Gordus, A., Orger, M. B., Severi, K. E., Macklin, J. J., Patel, R., Pulver, S. R., Wardill, T. J., Fischer, E., Schuler, C., Chen, T. W., Sarkisyan, K. S., Marvin, J. S., Bargmann, C. I., Kim, D. S., Kugler, S., Lagnado, L., Hegemann, P., Gottschalk, A., Schreiter, E. R., and Looger, L. L. (2013) Genetically encoded calcium indicators for multi-color neural activity imaging and combination with optogenetics. Frontiers in molecular neuroscience 6, 2

118. Krook-Magnuson, E., Szabo, G. G., Armstrong, C., Oijala, M., and Soltesz, I. (2014) Cerebellar Directed Optogenetic Intervention Inhibits Spontaneous Hippocampal Seizures in a Mouse Model of Temporal Lobe Epilepsy. eNeuro 1

119. Paz, J. T., Davidson, T. J., Frechette, E. S., Delord, B., Parada, I., Peng, K., Deisseroth, K., and Huguenard, J. R. (2013) Closed-loop optogenetic control of thalamus as a tool for interrupting seizures after cortical injury. Nature neuroscience 16, 64-70

120. Sohal, V. S., Zhang, F., Yizhar, O., and Deisseroth, K. (2009) Parvalbumin neurons and gamma rhythms enhance cortical circuit performance. Nature 459, 698-702

121. Toettcher, J. E., Gong, D., Lim, W. A., and Weiner, O. D. (2011) Light-based feedback for controlling intracellular signaling dynamics. Nature methods 8, 837-839

122. Milias-Argeitis, A., Summers, S., Stewart-Ornstein, J., Zuleta, I., Pincus, D., El-Samad, H., Khammash, M., and Lygeros, J. (2011) In silico feedback for in vivo regulation of a gene expression circuit. Nature biotechnology 29, 1114-1116

engineering affinity and specificity of antibodies

Documents