emergency supplemental request to congress - 07082014

prev

next

out of 20

Download Emergency Supplemental Request to Congress - 07082014

Upload: frankthorp

Post on 03-Jun-2018

218 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

8/12/2019 Emergency Supplemental Request to Congress - 07082014

1/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

2/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

3/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

4/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

5/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

6/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

7/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

8/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

9/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

10/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

11/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

12/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

13/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

14/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

15/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

16/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

17/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

18/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

19/20
8/12/2019 Emergency Supplemental Request to Congress - 07082014

20/20

Supplemental Material Supplemental Experimental Procedures

Report - October 2008 · IIOCTOBER 30, 2008 REPORT TO CONGRESS 3 SIGIR OBSERVATIONS The Supplemental appropriations passed by the Congress last quarter imposed conditions for the

CRS Report for Congress - iwar.org.uk · CRS Report for Congress Received through the CRS Web Order Code RL32021 Andean Regional Initiative (ARI): FY2003 Supplemental and FY2004 Assistance

Neuropathology Supplemental Guide Supplemental Guide ... · Neuropathology Supplemental Guide . 1 . Supplemental Guide: Neuropathology ... Modifies personal snap freezing technique

Choi et al. Supplemental Information SUPPLEMENTAL ...€¦ · Choi et al. Supplemental Information 1 SUPPLEMENTAL INFORMATION SUPPLEMENTAL METHODS Isolation of Mouse Embryonic Dermal

Supplemental Fig.1 SUPPLEMENTAL FIGURES

Congenital Cardiac Surgery Supplemental Guide Supplemental

SUPPLEMENTAL DATA Supplemental figures · SUPPLEMENTAL DATA Supplemental figures Supplemental Figure 1. ... 28 Rhodanese/Cell cycle control phosphatase superfamily protein At2g40760

Public Law 108–11 108th Congress An ActPUBLIC LAW 108–11—APR. 16, 2003 117 STAT. 559 Public Law 108–11 108th Congress An Act Making emergency wartime supplemental appropriations

Supplemental material Supplemental figures

Public Law 104-19 104th Congress An Act · 109 STAT. 194 PUBLIC LAW 104-19-^nJLY 27, 1995 Public Law 104-19 104th Congress An Act July 27, 1995 [H.R. 1944] Emergency Supplemental

(Original Signature of Member) TH D CONGRESS SESSION ll...(Original Signature of Member) 116TH CONGRESS 2D SESSION H. R. ll Making emergency supplemental appropriations for the fiscal

MID-SESSION REVIEW, BUDGET OF THE U.S. GOVERNMENT, … · a supplemental update of the Budget that was transmitted to the Congress earlier in the year. This supplemental update of

President Obama's Emergency Supplemental Request to Congress

Supplemental Figure 1. Supplemental Figure 2 Supplemental Figure 3 A B

Child Welfare: Social Security and Supplemental Security ... · CRS Report for Congress Prepared for Members and Committees of Congress Child Welfare: Social Security and Supplemental

Document S1. Supplemental Results, Supplemental Experimental

Stone & Tile Restoration Maintenance 07082014

Supplemental Information Bigdeli Supplemental Information ...Supplemental Information Bigdeli 1 Supplemental Information Descriptions of Participating Replication Studies Generation

Shamsuna Draft ESIA 07082014 ECO LZ Final.docx 4

Supplemental Figures Supplemental Figure 1€¦ · Supplemental Figures . Supplemental Figure 1 . Supplemental Figure 1. AdipoChaser mouse models used for cold and thermoneutral exposures

Internal Medicine Supplemental Guide Draft Supplemental ... › ... › InternalMedicineSupplementalGuideDraf… · Internal Medicine Supplemental Guide Draft . 1 . Supplemental Guide:

TH D CONGRESS SESSION H. R. 7264 · 1 day ago · I 116TH CONGRESS 2D SESSION H. R. 7264 To make supplemental appropriations for the Departments of Agriculture, the Interior, Homeland

1. Supplemental Figure 1 - International Journal of ... · Supplemental Figure 1 2. Supplemental Figure 2 3. Supplemental Figure 3 4. Supplemental Figure 4 5. Supplemental Figure

Public Law 116–20 116th Congress An Act · 2019-11-04 · PUBLIC LAW 116–20—JUNE 6, 2019 133 STAT. 871 Public Law 116–20 116th Congress An Act Making supplemental appropriations

Midea Service Manuals 07082014

Online Only Supplemental Material - Springer10.1007/s10654-015-0056... · Supplemental Table S1. ... 8. Someya Y, Kawai S, Saga N, ... Genetics.Conference: 14th International Congress

Collections management-seminar-07082014-132178

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

CONGRESS OF THE UNITED STATES …PREFACE This report describes the size, content, and causes of supplemental appro-priations from 1981 to 1989, and considers ways to reduce supplemental

Doej Trt2r Sp 07082014 - Jud. Adm

Supplement Supplemental Figures and Supplemental Figure

Supplemental Information - Plant Cell · Supplemental Data. Elliott et al. (2014). Plant Cell 10.1105/tpc.114.123620 1 Supplemental Information Supplemental Figures Supplemental Fig

Supplemental Beer Pairing Supplemental W ine Pairing 45.00 ... · Supplemental Beer Pairing 15.00/person Supplemental W ine Pairing 35.00/person Supplemental Full Beverage Pairing

SUPPLEMENTAL REPORT - United States Congress supplemental report shows the cost estimate of the Congres-sional Budget Office with respect to the bill (H.R. 4909), as re-ported, which