elucidating the role of the protein vire3 in agrobacterium rhizogenes ability toinfect host cells...
TRANSCRIPT
![Page 1: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/1.jpg)
Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes’ Ability to
Infect Host Cells
Sarah Layoun Dr. Walt Ream Laboratory
Source: International Society for Microbial Ecology
![Page 2: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/2.jpg)
Only known prokaryote which can integrate segments of its DNA into eukaryotic DNA
Soil bacteria known to infect a variety of plants
About Agrobacterium
Source: ag.ndsu.edu
Crown Galls Disease
Source: forestryimages.org
Hairy Root Disease
![Page 3: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/3.jpg)
Type IV Secretion System H. pylori, L. pneumophila, B. pertussis, N.
gonorrhoeae1
Frequently used as a vector for creating GMOs4
5.34 billion pounds of crop increase3
46.6 million pounds of pesticide reduction3
About Agrobacterium
![Page 4: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/4.jpg)
Method of Tumor Induction
![Page 5: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/5.jpg)
Understanding the necessity of virE3 in T-DNA insertion and integration into host nucleus
Comparing wild-type A. rhizogenes to virE3 mutants in ability to induce tumors
Project Overview
![Page 6: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/6.jpg)
Project Description
VirE3
Galls
1.2. VirE3
VirE3
Suicide Plasmid
3.
![Page 7: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/7.jpg)
Project Description
10,oo0 bp6,000
bp4,000 bp
3,000 bp
2,000 bp1,500 bp
1,000 bp
VirE3
pRi1724
1,350 bpEco
RISal
Galls
VirE3
![Page 8: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/8.jpg)
Project Description
HindIII
VirE3
Klenow Fragment
dNTPs
VirE3 VirE3
Mutated version of virE3
Creating the Mutated Form of VirE3
![Page 9: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/9.jpg)
Project DescriptionCreating the Mutated Form of
VirE3
Suicide plasmid containing wild-type VirE3
HindIII
AGCTTAGCTTCTCGATGACGTTCGA
AGCTACTGCAAGCT AGCTTAGCTTTCGATGACGTTCGA TCGAATCGAA
Klenow FragmentdNTPs
AGCTACTGCAAGCTAGCTTAGCTTTCGATGACGTTCGATCGAATCGAA
AGCTACTGCA ATCGAA
G
Blunt End Ligation
HindIII digestion
![Page 10: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/10.jpg)
Project Description Continued
VirE3
KanamycinR
AmpicillinR
VirE3
KanamycinR
AmpicillinR
E. coli
![Page 11: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/11.jpg)
Project Description
Transformed E.coli
![Page 12: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/12.jpg)
Project Description
VirE3
E. coli
VirE3
A.Rhizogenes
Electroporation
SacB
GentamicinR
![Page 13: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/13.jpg)
Project Description Electroporation
Source: pnas.org
Low voltage pulse induces membrane pore formation
![Page 14: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/14.jpg)
Project Description
VirE3
A. rhizogenes
HomologousRecombination
A. rhizogenes
![Page 15: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/15.jpg)
Project Description
Arabidopsis thaliana source: nature.com
• Infect several plant species, including potatoes, carrots, and A. thaliana
![Page 16: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/16.jpg)
Means of preventing plant diseases
Improvement of GMO synthesis
Possible insight into Type IV Secretion Systems
Significance of Findings
![Page 17: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/17.jpg)
Ernest and Pauline Jaworski Howard Hughes Medical Institute Dr. Kevin Ahern Dr. Walt Ream Larry Hodges
Acknowledgements
![Page 18: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International](https://reader035.vdocuments.us/reader035/viewer/2022070306/55164fac550346b2068b5858/html5/thumbnails/18.jpg)
References
1. Fronzes, Rémi; Christie, Peter J.; Waksman, Gabriel. The Structural Biology of type IV secretion systems. Nature Reviews Microbiology, Oct2009, Vol. 7 Issue 10, p703-714.
2. The FDA list of Completed Consultations of Bioengineered Foods. http://www.accessdata.fda.gov/scripts/fcn/fcnNavigation.cfm?rpt=bioListing. Updated on April 30, 2011.
3. Tonouchi, Naoto. Merits and the Global Status of Genetically Modified (GM) Crops. Foods Food Ingredients J. Jpn., Vol. 210, No.7, 2005
4. Vaidya, M., Li, J., Krichevsky, A.,Citovsky, V. Uncoupling of the Functions of the Arabidopsis VIP1 Protein in Transient and Stable Plant Genetic Transformation by Agrobacterium. Proc Natl Acad Sci USA. April 2005, 102 (16) pg. 5733-8.