elevated prevalence of azole resistant aspergillus fumigatus · 27 introduction 28 aspergillus...
TRANSCRIPT
![Page 1: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/1.jpg)
Elevated prevalence of azole resistant Aspergillus fumigatus in urban versus rural environments in the 1
United Kingdom 2
Thomas R Sewell1, Yuyi Zhang1, Amelie P Brackin, Jennifer MG Shelton, Johanna Rhodes and Matthew C 3
Fisher 4
MRC Centre for Global Infectious Disease Analysis, Department of Infectious Disease Epidemiology, 5
Imperial College London, London, UK 6
1These authors contributed equally to this work 7
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 2: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/2.jpg)
Abstract 8
Azole resistance in the opportunistic pathogen Aspergillus fumigatus is increasing, dominated primarily 9
by two environmentally-associated resistance alleles: TR34/L98H and TR46/Y121F/T289A. Using an 10
environmental sampling strategy across the South of England we assess the prevalence of azole resistant 11
A. fumigatus (ARAf) in soil samples collected in both urban and rural locations. We characterise the 12
susceptibility profiles of the resistant isolates to three medical azoles, identify the underlying genetic 13
basis of resistance and investigate their genetic relationships. ARAf was detected in 6.7% of the soil 14
samples, with a higher prevalence in urban (13.8%) compared to rural (1.1%) locations. Nineteen 15
isolates were confirmed to exhibit clinical breakpoints for resistance to at least one of three medical 16
azoles, with 18 isolates exhibiting resistance to itraconazole, four to voriconazole, with two also showing 17
additional elevated minimum inhibitory concentration to posaconazole. Thirteen of the resistant isolates 18
harboured the TR34/L98H resistance allele and six isolates carried TR46/Y121F/T289A allele. The 19 azole-19
resistant isolates were spread across five csp1 genetic subtypes, t01, t02, t04B, t09 and t18 with t02 the 20
predominant subtype. Our study demonstrates that ARAf can be easily isolated in the South of England, 21
especially in urban city centres, which appear to play an important role in the epidemiology of 22
environmentally-linked drug resistant A. fumigatus. 23
24
Keywords: Aspergillus fumigatus, triazoles, antifungal resistance, fungal pathogen, fungal epidemiology, 25
multidrug resistance, environment 26
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 3: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/3.jpg)
Introduction 27
Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution and a 28
primary ecological niche of decaying vegetation and soil (1). This fungus is the most prevalent species 29
among ~250 described Aspergilli, partly due to its ability to survive and grow in a wide range of 30
conditions, but also through the large-scale dispersal of airborne conidia (1–3). A. fumigatus is also an 31
opportunistic pathogen and is commonly responsible for aspergillosis, a spectrum of clinical syndromes 32
caused by Aspergillus spp. that affects millions of individuals worldwide (4). Invasive aspergillosis (IA), 33
the most severe form of the disease, can lead to serious and even fatal illness in immunocompromised 34
individuals, with a mortality rate of 40 - 90% (5, 6). 35
36
Triazole antifungals are used for the treatment and prophylaxis of Aspergillus spp. infections, although 37
resistance has emerged, often conferred by the presence of mutations in lanosterol 14 alpha 38
demethylase (erg11, syn. CYP51), which is a key component of the ergosterol biosynthetic pathway and 39
target for azole antifungals (7, 8). Recently, azole-resistant A. fumigatus (ARAf) has emerged 40
environmentally, where selection is thought to be driven by the broad application of agricultural azole 41
fungicides; structurally similar to their medical counterparts and indistinguishable in their mode of 42
action (9, 10). Environmentally sourced ARAf are typically found with a tandem repeat mutation in the 43
cyp51A promoter region and linked single nucleotide polymorphisms in the coding region, with common 44
examples being TR34/L98H and TR46/Y121F/T289A (11, 12). 45
46
Studies have shown that ARAf isolates harbouring resistance-associated cyp51A variants are globally 47
distributed, and are often found alongside wild-type A. fumigatus in a diverse set of environmental 48
substrates, including: agricultural soil (13, 14), flower beds (13, 15–17) and timber mills (18). Moreover, 49
clinical cases of aspergillosis with ARAf isolates harbouring either TR34/L98H or TR46/Y121F/T289A 50
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 4: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/4.jpg)
continue to emerge (19, 20), with one study specifically linking a fatal case of aspergillosis to a 51
genotypically indistinguishable isolate sourced from the patients own home (21). Retrospective studies 52
of patients with invasive aspergillosis (IA) and infected with azole-resistant genotypes of A. fumigatus 53
show an excess mortality of 25% at day 90 when compared against patients with wild-type-infections 54
(22). 55
56
Despite a generally good understanding of ARAf global prevalence, very few studies have investigated 57
resistance in the United Kingdom or focused sampling strategies across a diverse set of substrates. In 58
this study, we aim to determine the prevalence of ARAf in soil collected from a wide range of sites 59
across the UK's southernmost region. Sampling locations include ancient woodlands, agricultural fields, 60
tourist attractions and densely populated city centres. We show that the UK has similar prevalence rates 61
to other countries and that both TR34/L98H and TR46/Y121F/T289A can be regularly isolated from 62
urbanised locations, especially flower beds in close proximity to city centre hospitals. 63
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 5: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/5.jpg)
Materials and Methods 64
Environmental sampling 65
Samples were collected from 16 sites across South England between May and July 2018. Locations were 66
selected to include a range of habitat types and included remote forested regions, urban city centre, 67
agricultural and flower fields. At each sample site, dry surface soil was loosened and collected into a 5ml 68
Eppendorf tube (Eppendorf AG, Hamburg, Germany). All tubes were labelled with site description, 69
longitude and latitude coordinates. All samples were stored at 4OC until processing. 70
71
Recovering of A. fumigatus and screening for azole resistance 72
To isolate A. fumigatus from environmental samples 2 g of each sample was suspended in 8 ml of sterile 73
distilled water with 0.85% NaCl (SIGMA, Sigma-Aldrich Chemie Gmbh, Steinheim, Germany) plus 0.01% 74
Tween 20 (SIGMA, Sigma-Aldrich Chemie Gmbh, Steinheim, Germany) and vortexed vigorously for 1 75
min. After 1 min settling, 200 µl of supernatant was added to two control plates, containing sabouraud 76
dextrose agar (CM0041, Oxoid Ltd, Basingstoke, Hants, UK) supplemented with 16 g/ml penicillin G 77
sodium salt (SIGMA, Sigma-Aldrich Chemie Gmbh, Steinheim, Germany) and 16 g/ml streptomycin 78
sulfate salt (SIGMA, Sigma-Aldrich Chemie Gmbh, Steinheim, Germany), and two azole-containing plates 79
containing sabouraud dextrose agar supplemented with 16 g/ml penicillin G sodium salt, 16 g/ml 80
streptomycin sulfate salt and 8 g/ml tebuconazole (PESTANAL analysis standard, Sigma-Aldrich AG 81
Industriestrasse, Switzerland). These plates were incubated at 42OC and examined for growth after 72 82
hours. A. fumigatus isolates were identified by observation of their macro and microscopic morphology. 83
84
In vitro susceptibility testing - Minimal inhibitory concentration (MIC) measurement 85
Seven wild-type isolates and 19 suspected azole-resistant isolates were tested for antifungal drug 86
susceptibility against three medical azoles, itraconazole (ITC), voriconazole (VRC) and posaconazole 87
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 6: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/6.jpg)
(PSC) using the European Committee Antimicrobial Susceptibility Testing (EUCAST) microdilution 88
method using MICRONAUT-AM EUCAST MIC (Minimum Inhibitory Concentration) plates (Merlin 89
Diagnostika GmbH, Bornheim, Germany). The reference wild-type clinical A. fumigatus isolates Af293 90
and an environmental azole-resistant isolate BUU09 (TR34/L98H) were used as control strains. All isolates 91
were grown for 72 hours at 37 OC before washing with 8 to 10 ml of 0.01% Tween 20. The resulting 92
conidial suspension was filtered through Whatman 1 filter paper (Whatman plc, GE Healthcare Life 93
Sciences, UK) to remove hyphae and debris. The filtered conidial suspension was adjusted to 0.5 94
McFarland with phosphate-buffered saline (PBS pH7.4 (1X), gibco, Life Technologies Limited, Paisely, UK) 95
using a BioTek ELx808 spectrophotometer (BioTek Instruments Ltd, Winooski, USA). The adjusted 96
conidial suspension (0.5 ml) was added to 9.5 ml of the MICRONAUT-RPMI medium (MICRONAUT-RPMI 97
Medium + MOPS + Glucose, Merlin Diagnostika GmbH, Bornheim, Germany) and 100 µl of the mixture 98
was then used to populate the MICRONAUT-AM test plate. All plates were examined after 48-hour 99
incubation at 37OC in a humid chamber. The MIC endpoint was read visually and determined as the 100
lowest concentrations of the azoles yielding no visible growth. The results of all susceptibility tests were 101
interpreted using EUCAST clinical breakpoints [91]. The isolates were regarded as susceptible when the 102
MIC was ≤ 1 mg/l for ITC and VRC, and ≤ 0.125 mg/l for POS; and resistant when the MIC was > 2mg/l for 103
ITC and VRC, and > 0.25 mg/l for POS. Isolates with MIC values in between the susceptible and resistant 104
breakpoint were considered to be intermediately susceptible. 105
106
DNA extraction for sequence analysis 107
Genomic DNA was extracted using a modified MasterPure Yeast DNA Purification (Lucigen Corporation, 108
Cambridge, UK) protocol which included an additional bead-beating treatment to enhance DNA yield. 109
110
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 7: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/7.jpg)
Cultured A. fumigatus isolates were washed in 10 ml of 0.05% Tween 20; 1.8 ml of the conidial 111
suspension was transferred into a 2 ml Eppendorf tube and centrifuged at 8000 rpm for 5 mins. The 112
condial pellet was mixed with 300 µl of Yeast Cell Lysis Solution and 1 µl of 5 g/l RNase A and transferred 113
into a new 2 ml Eppendorf tube containing 1.0 mm diameter Zirconia/Silica Bead (Thistle Scientific, 114
Glasgow, UK). The tube was subjected to bead beating for 3 x 45 seconds at 30 m/s in a TissueLyser II 115
(Qiagen, Hilden, Germany) and placed on ice for 2 mins before repeating. The lysate was transferred to a 116
new 1.5 Eppendorf tube and was twice centrifuged at 13000 rpm for 2 mins to pellet debris. The 117
supernatant was transferred to a 1.5 Eppendorf tube and incubated at 65OC for 15 mins before placing 118
on ice for another 30 mins. After incubation, 150 µl of MPC Protein Precipitation Reagent was added to 119
the sample and mixed by pulse vortexing for 10 seconds. For further pelleting of cellular debris, the 120
mixture was centrifuged at 13000 rpm for 2 mins and the supernatant was transferred to a clean 1.5 121
Eppendorf tube. DNA was precipitated by adding 500 µl of isopropanol (SIGMA, Sigma-Aldrich Chemie 122
Gmbh, Steinheim, Germany) to the supernatant before 4OC centrifugation at 14000 rpm for 10 mins. The 123
supernatant was removed, and the remaining DNA pellet washed with 500 µl of 70% ethanol (SIGMA, 124
Sigma-Aldrich Chemie Gmbh, Steinheim, Germany) before centrifugation at 13000 rpm for 2 mins. After 125
removing the ethanol, the DNA pellet was air-dried for approximately 10-15 mins in a biosafety cabinet. 126
Finally, 40 µl of nuclease-free water was added to the DNA pellet and left to resuspend at 4OC for 24 127
hours. The DNA was either used immediately or stored at -20OC until required. DNA yield was quantified 128
using a Qubit 2.0 Fluorometer (Invitrogen by Thermo Fisher Scientific corporation, Massachusetts, USA) 129
and the Qubit dsDNA BR (Broad-Range) Assay Kit (Invitrogen) according to the products guidelines. 130
131
PCR amplification 132
PCR was used to amplify part of the cyp51A gene and promoter, the csp1 region and beta-tubulin as 133
previously described [45], [80]. Amplification of cyp51A was performed using the L98HR primer (5′-134
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 8: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/8.jpg)
TTCGGTGAATCGCGCAGATAGTCC-3′) and TR34R primer (5′-AGCAAGGGAGAAGGAAAGAAGCACT-3′) 135
(Invitrogen) at 100 nM, 20.125 µl nuclease-free water (Qiagen, Hilden, Germany), 2.5 µl PCR Buffer 136
(Qiagen PCR Buffer containing 15mM MgCl2, Qiagen, Hilden, Germany), 0.5 µl dNTP mix (dNTP Set, PCR 137
Grade, 10mM each, Qiagen, Hilden, Germany), 0.125 µl Taq DNA Polymerase (5 units/L, Qiagen, Hilden, 138
Germany) and 1 µl of DNA template. Amplification conditions were: a 2 mins denaturation step at 94OC, 139
followed by 35 cycles of 15 seconds at 94OC, 30 seconds at 57OC, and 30 seconds at 72OC. A final 140
elongation step for 2 mins at 72OC was followed after the last cycle. Amplification of csp1 was 141
performed using the CSP1F primer (5′-TTGGGTGGCATTGTGCCAA-3′) and CSP1R primer (5′-142
GAGCATGACAACCCAGATACCA-3′) at 100 nM, 20.125 µl nuclease-free water, 2.5 µl PCR Buffer, 0.5 µl 143
dNTP mix, 0.125 µl Taq DNA Polymerase and 1 µl of DNA template. Amplification conditions were: a 5 144
mins denaturation step at 94OC, followed by 35 cycles of 15 seconds at 94OC, 30 seconds at 55OC, and 30 145
seconds at 68OC. A final elongation step for 2 mins at 68OC was followed after the last cycle. 146
Amplification of beta-tubulin was performed using the Bt2A_F primer (5′- 147
GGTAACCAAATCGGTGCTGCTTTC - 3′) and Bt2A-R primer (5′ - ACCCTCAGTGTAGTGACCCTTGGC - 3′) at 148
100 nM, 20.125 µl nuclease-free water, 2.5 µl PCR Buffer, 0.5 µl dNTP mix, 0.125 µl Taq DNA Polymerase 149
and 1 µl of DNA template. Amplification conditions were: a 5 mins denaturation step at 95OC, followed 150
by 35 cycles of 30 seconds at 95OC, 30 seconds at 55OC, and 1 min at 72OC. A final elongation step for 5 151
mins at 72OC was followed after the last cycle. 152
153
PCR product visualisation, purification and sequencing 154
Both cyp51A gene and csp1 gene PCR products were visualised on a 2% agarose gel using agarose gel 155
electrophoresis. 100 ml of 2% agarose solution was prepared by mixing 2 g of agarose powder with 100 156
ml of TBE buffer. 10 µl of SafeView Nucleic Acid Stain was added for visualisation of the PCR product in 157
the gel. Before loading the samples and molecular weight ladder (Quick-load Purple 50 bp DNA Ladder 158
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 9: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/9.jpg)
and Quick-load Purple 1 kb DNA Ladder, New England Biolabs Inc, UK) to the gel, 1 µl of Gel Loading Dye 159
was mixed with 5 µl of each sample. Finally, the gel was run at 120 to 130 V for approximately 45 to 60 160
mins. The DNA fragments were visualised using a G:Box Gel Image Analysis System (Syngene UK, 161
Cambridge, UK). The PCR products were then purified using ExoSAP-IT PCR Product Cleanup Reagent 162
(ThermoFisher Scientific, Massachusetts, USA) following the product guidelines. Briefly, 7.5 µl of each 163
post-PCR reaction product was mixed with 3 µl of the reagent. The mixture was incubated for 15 mins at 164
37OC in order to degrade the remaining nucleotides and primers in the PCR product, followed by 165
incubation of 15 mins at 80OC to inactivate the reagent. The treated products were then stored at -20OC 166
until required. The treated PCR products and sequencing primers, L98HR, TR34R, CSP1F and CSP1R were 167
prepared for sequencing following the DNA Sanger sequencing sample submission guidelines provided 168
by GENEWIZ (GENEWIZ UK LTD, Takeley, UK). They were then sent away for Sanger sequencing by 169
GENEWIZ UK laboratory. 170
171
Sanger sequencing of cyp51A mutations, csp1 types and beta-tubulin 172
Sanger sequencing results from all selected isolates were trimmed and assembled using CLC Main 173
Workbench 8.0.1 software (QIAGEN Bioinformatics, Hilden, Germany), with alignment stringency set to 174
medium. The forward and reverse reads were merged into a consensus sequence using the assemble 175
sequences function. The consensus cyp51A sequences of each environmental isolates, and the known 176
TR34/L98H isolate BUU09, were aligned against the referenced wild-type isolate, A. fumigatus Af293. The 177
isolates that exhibited the same 34-bp tandem repeat as the isolate BUU09 were confirmed to harbor 178
the TR34/L98H allele. The isolates that had a 46-bp tandem repeat were compared with A. fumigatus 179
isolate VRJ056 (GenBank accession number: MF070884.1), a known clinical isolate harboring the 180
TR46/Y121F/T289A mutation, to confirm their resistant mechanism. The csp1 types of each 181
environmental isolates and two control isolates were assigned according to the csp1 typing 182
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 10: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/10.jpg)
nomenclature described previously (23), which was based on manually inspecting the repeat regions in 183
each consensus csp1 sequences. 184
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 11: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/11.jpg)
Results 185
Environmental A. fumigatus isolates 186
A total of 178 soil samples were collected across Southern England, including soil and compost samples 187
obtained from public gardens, parks, cemeteries, and flower beds outside hospitals. Samples were 188
collected in Central London (n = 64), Bath (n = 8), flower beds around Stonehenge (n = 8), remote 189
forested regions in the New Forest National Park (n = 46), a lavender farm in Surry (n = 13) and farmland 190
in Cambridgeshire (n = 39). Of the 178 soil samples, 131 (74%) were positive for A. fumigatus type 191
growth on control plates, with a varied recovery rate amongst different sampling sites (Table 1). The 192
highest recovery rate was from Central London (93.8%) and the lowest from Cambridgeshire (35.9%). 193
Eleven A. fumigatus positive soil samples yielded a total of 83 A. fumigatus type isolates that were able 194
to grow on the azole-containing plates. Nine of these soil samples were collected from urban locations 195
in London (n=8) and Bath (n=1). Among the eight samples from London, four were collected from flower 196
beds outside Royal Free Hospital and The Whittington Hospital, and another two samples were obtained 197
from compost in Waterlow Park, 500 meters away from The Whittington Hospital. Nineteen putatively 198
resistant isolates were selected for further MIC testing and sequence analysis, ensuring representation 199
from each azole positive soil samples. Seven control isolates were randomly selected for further 200
analyses, representing each sampling site. All 26 isolates were identified as A. fumigatus by sequencing 201
of the beta-tubulin gene. 202
203
MIC measurement 204
All 19 azole-tolerant isolates were confirmed to be resistant to at least one of the three medical azoles 205
tested (Table 2). Eleven of these exhibited resistance to itraconazole only and were susceptible to both 206
voriconazole and posaconazole but with elevated MICs. Six isolates were resistant to voriconazole and 207
four of them were also resistant to itraconazole, with the remaining two having intermediate resistance 208
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 12: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/12.jpg)
against itraconazole. Isolate L2731 was cross-resistant against itraconazole and posaconazole, whereas 209
isolate L3131 was resistant to itraconazole and had intermediate resistance toward posaconazole. 210
Interestingly, isolates from the same soil sample yielded different susceptibility results. Among the 211
seven azole-susceptible isolates, six of them were confirmed to be susceptible to all three medical 212
azoles. One isolate (F311), exhibited resistance to itraconazole and elevated MIC values for voriconazole 213
and posaconazole, 0.25 g/ml and 0.125 g/ml, respectively. 214
215
Molecular determination of the azole resistance mechanisms 216
The molecular mechanisms of azole resistance were determined by sequencing part of the cyp51A gene 217
and its promoter region. Of the 19 azole-resistant isolates, 13 were found to be harbouring the 218
TR34/L98H allele and six the TR46/Y121F/T289A allele (Table 2). All six azole susceptible isolates had the 219
wild-type cyp51A allele. Both the negative and positive control isolates (Af293 and BUU09) carried the 220
wild-type and TR34/L98H allele respectively. 221
222
Molecular characterisation of A. fumigatus 223
Sequence typing of csp1 yielded 9 different csp1 types (Table 2). The six azole-susceptible wild-type 224
environmental isolates were distributed over csp1 subtypes t03 (1/6), t04A (3/6), t05 (1/6) and t08 (1/6). 225
The 20 azole-resistant isolates were spread across five csp1 subtypes, t01 (2/20), t02 (14/20), t04B 226
(2/20), t09 (1/20) and t18 (1/20). All the TR34/L98H and TR46/Y121F/T289A isolates predominantly 227
belonged to csp1 subtype t02. The 13 isolates with the TR34/L98H allele were distributed over three csp1 228
subtypes t01 (1/13), t02 (10/13) and t04B (2/13). The isolates carrying TR46/Y121F/T289A allele were 229
grouped into four csp1 subtypes: t01 (1/6), t02 (3/6), t09 (1/6) and t18 (1/6). The control isolate Af293, 230
which was isolated from a patient with invasive aspergillosis belonged to csp1 subtype t06 and the azole 231
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 13: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/13.jpg)
resistant control isolate BUU09 belonged to the t04B csp1 subtype, which agreed with previously 232
published results (24). 233
234
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 14: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/14.jpg)
Discussion 235
Given that ARAf continues to emerge globally, it is imperative that environmental monitoring, 236
particularly in previously unsampled locations, is sustained. Here we present environmental sampling of 237
London and the south east of England, home to approximately 15 million people living both urban and 238
rural lifestyles. We show that azole-resistant A. fumigatus was detected in 6.7% (12/178) of the soil 239
samples collected, and in 9.2% (12/131) of the soil samples positive for A. fumigatus growth. The 240
prevalence of ARAf in the environment was 13.8% in urban areas (10/72), which included Greater 241
London and Bath. In contrast, zero resistant isolates were found in soil samples collected from 242
agricultural land and just two resistant isolates were found in rural samples collected from non-243
agricultural land (1.1%). We also report the UK's first environmental ARAf isolates confirmed to be 244
carrying the TR46/Y121F/T239A resistance allele, alongside an expanded distribution of the TR34/L98H 245
allele. 246
247
Prevalence of ARAf in the UK was found to be lower than that of other European countries and 248
Colombia (15, 17, 25–29), but higher than most Asian countries (24, 30–33), with the exception of India 249
(29, 34). Our findings are also in close agreement with a recent UK-based environmental prevalence 250
study in Wales, where ARAf was detected in 4.5% (30/671) of soil samples, with resistance 251
predominantly found in urban city locations (13). However, they also describe a notable contrast to the 252
only other UK based study, which found zero ARAf in urban locales but four resistant isolates from 253
agricultural sites (1.7%) (14). 254
255
Our findings, and that of the Welsh study (13), appear to contradict the hypothesis that UK ARAf is 256
driven by the environmental application of azoles in arable agriculture (35, 36). Indeed, of the 53 257
samples collected directly on or surrounding agricultural land, zero azole-tolerant isolates were 258
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 15: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/15.jpg)
identified. Rather, we found that the prevalence of resistance was higher in urban city centres, 259
specifically flower beds and gardens, a finding that lends itself more readily to the hypothesis that the 260
expanding range of ARAf stems more from the distribution and cultivation of horticultural crops, such as 261
flowers, ornamentals and vegetables (15–17) 262
263
One particularly concerning discovery was the repeat isolation of ARAf genotypes – TR34/L98H and 264
TR46/Y121F/T289A – from flower beds surrounding city centre hospitals. Owing to the opportunistic 265
nature of A. fumigatus, its ability to cause debilitating illnesses in immunocompromised patients and the 266
elevated mortality that is associated with IA caused by azole-resistant genotypes (22), the gardened 267
areas around hospitals could be considered high risk locations if ARAf is present. Concern over the use of 268
azole treated flower bulbs in hospital environments has been raised previously (15, 16, 37), and 269
although we do not link any cases of azole-resistant aspergillosis to the isolates found in this study, our 270
findings do add to a worrying trend of ARAf populated soil sampled from flower beds (15, 17). 271
272
The continued emergence of ARAf in urban city centres fits with the observation that most isolates 273
belonged to a single csp1 subtype (t02), a pattern consistent with the selective sweep of drug resistant 274
genotypes (38). However, despite this obvious pattern of selection, city centres still harboured greater 275
diversity than rural locations. All csp1 subtypes identified during this study were found in Central 276
London, suggesting an anthropological driver facilitating the migration of many A. fumigatus genotypes 277
into a densely populated metropolis. Consequently, urban city centres, where A. fumigatus diversity is 278
high, could facilitate a ‘melting pot’, where resistance alleles inadvertently brought into the city are 279
given the opportunity to introgress onto novel genetic backgrounds via recombination, increasing the 280
diversity potential of ARAf. Indeed, in London alone, TR34/L98H was found on two csp1 subtypes and 281
TR46/Y121F/T298A on four CSP subtypes. 282
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 16: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/16.jpg)
283
Ultimately, this study highlights the importance of urban environments in the epidemiology of ARAf. We 284
have shown that although ARAf appears to be environmental by origin, urban city centres, that are 285
densely populated, are of high importance when mitigating strategies are considered. The use of azole 286
treated bulbs in the environment around hospitals should be reconsidered and the continuous global 287
monitoring of ARAf is imperative. 288
289
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 17: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/17.jpg)
Acknowledgments 290
The authors would like to thank Ali Abdolrasouli, Darius Armstrong-James and Andrew 291
Scourfield for their helpful discussions whilst analysing the data. We also acknowledge joint 292
Centre funding from the UK Medical Research Council and Department for International 293
Development. Funding: T.R.S., A.P.B., J.R. and M.C.F. were supported by the Natural 294
Environmental Research Council (NERC; NE/P001165/1) and all authors were supported by the 295
Medical Research Council (MRC; MR/R015600/1). 296
297
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 18: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/18.jpg)
References 298 299 1. Mullins J, Harvey R, Seaton A. 1976. Sources and incidence of airborne Aspergillus fumigatus 300
(Fres). Clin Exp Allergy 6:209–217. 301
2. Samson RA, Hong S, Peterson SW, Frisvad JC, Varga J. 2007. Polyphasic taxonomy of Aspergillus 302
section Fumigati and its teleomorph Neosartorya. Stud Mycol 59:147–203. 303
3. Kwon-Chung KJ, Sugui JA. 2013. Aspergillus fumigatus-What makes the species a ubiquitous 304
human fungal pathogen? PLoS Pathog 9:1–4. 305
4. Brown GD, Denning DW, Gow NAR, Levitz SM, Netea MG, White TC. 2012. Hidden killers: Human 306
fungal infections. Sci Transl Med 4:165rv13. 307
5. Dagenais TRTT, Keller NP. 2009. Pathogenesis of Aspergillus fumigatus in invasive aspergillosis. 308
Clin Microbiol Rev 22:447–465. 309
6. Kosmidis C, Denning DW. 2015. The clinical spectrum of pulmonary aspergillosis. Thorax 70:270–310
277. 311
7. Alcazar-Fuoli L, Mellado E. 2012. Ergosterol biosynthesis in Aspergillus fumigatus: Its relevance as 312
an antifungal target and role in antifungal drug resistance. Front Microbiol 3:1–6. 313
8. Parker JE, Warrilow AGS, Price CL, Mullins JGL, Kelly DE, Kelly SL. 2014. Resistance to antifungals 314
that target CYP51. J Chem Biol 7:143–161. 315
9. Fisher MC, Hawkins NJ, Sanglard D, Gurr SJ. 2018. Worldwide emergence of resistance to 316
antifungal drugs challenges human health and food security. Science 360:739–742. 317
10. Verweij PE, Snelders E, Kema GH, Mellado E, Melchers WJ. 2009. Azole resistance in Aspergillus 318
fumigatus: a side-effect of environmental fungicide use? Lancet Infect Dis 9:789–795. 319
11. Mellado E, Garcia-Effron G, Alcázar-Fuoli L, Melchers WJG, Verweij PE, Cuenca-Estrella M, 320
Rodríguez-Tudela JL. 2007. A new Aspergillus fumigatus resistance mechanism conferring in vitro 321
cross-resistance to azole antifungals involves a combination of cyp51A alterations. Antimicrob 322
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 19: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/19.jpg)
Agents Chemother 51:1897–904. 323
12. Van Der Linden JWM, Camps SMT, Kampinga GA, Arends JPA, Debets-Ossenkopp YJ, Haas PJA, 324
Rijnders BJA, Kuijper EJ, Van Tiel FH, Varga J, Karawajczyk A, Zoll J, Melchers WJG, Verweij PE. 325
2013. Aspergillosis due to voriconazole highly resistant Aspergillus fumigatus and recovery of 326
genetically related resistant isolates from domiciles. Clin Infect Dis 57:513–520. 327
13. Tsitsopoulou A, Posso R, Vale L, Bebb S, Johnson E, White PL. 2018. Determination of the 328
prevalence of triazole resistance in environmental Aspergillus fumigatus strains isolated in South 329
Wales, UK. Front Microbiol 9:1395. 330
14. Bromley MJ, van Muijlwijk G, Fraczek MG, Robson G, Verweij PE, Denning DW, Bowyer P. 2014. 331
Occurrence of azole-resistant species of Aspergillus in the UK environment. J Glob Antimicrob 332
Resist 2:276–279. 333
15. Snelders E, Huis In 't Veld RA, Rijs AJ, Kema GH, Melchers WJ, Verweij PE. 2009. Possible 334
environmental origin of resistance of Aspergillus fumigatus to medical triazoles. Appl Environ 335
Microbiol 75:4053–4057. 336
16. Dunne K, Hagen F, Pomeroy N, Meis JF, Rogers TR. 2017. Intercountry transfer of triazole-337
resistant Aspergillus fumigatus on plant bulbs. Clin Infect Dis 65:147–149. 338
17. Alvarez-Moreno C, Lavergne R-A, Hagen F, Morio F, Meis JF, Le Pape P. 2017. Azole-resistant 339
Aspergillus fumigatus harboring TR34/L98H, TR46/Y121F/T289A and TR53 mutations related to 340
flower fields in Colombia. Sci Rep 7:45631. 341
18. Jeanvoine A, Rocchi S, Reboux G, Crini N, Crini G, Millon L. 2017. Azole-resistant Aspergillus 342
fumigatus in sawmills of Eastern France. J Appl Microbiol 123:172–184. 343
19. Abdolrasouli A, Scourfield A, Rhodes J, Shah A, Elborn JS, Fisher MC, Schelenz S, Armstrong-James 344
D. 2018. High prevalence of triazole resistance in clinical Aspergillus fumigatus isolates in a 345
specialist cardiothoracic centre. Int J Antimicrob Agents 52:637–642. 346
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 20: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/20.jpg)
20. Wiederhold NP, Gil VG, Gutierrez F, Lindner JR, Albataineh MT, McCarthy DI, Sanders C, Fan H, 347
Fothergill AW, Sutton DA. 2016. First detection of TR34/L98H and TR46/Y121F/T289A Cyp51 348
mutations in Aspergillus fumigatus isolates in the United States. J Clin Microbiol 54:168–171. 349
21. Dauchy C, Bautin N, Nseir S, Reboux G, Wintjens R, Le Rouzic O, Sendid B, Viscogliosi E, Le Pape P, 350
Arendrup MC, Gosset P, Fry S, Fréalle E. 2018. Emergence of Aspergillus fumigatus azole 351
resistance in azole-naïve patients with chronic obstructive pulmonary disease and their homes. 352
Indoor Air 28:298–306. 353
22. Lestrade PP, Bentvelsen RG, Schauwvlieghe AFAD, Schalekamp S, van der Velden WJFM, Kuiper 354
EJ, van Paassen J, van der Hoven B, van der Lee HA, Melchers WJG, de Haan AF, van der Hoeven 355
HL, Rijnders BJA, van der Beek MT, Verweij PE. 2018. Voriconazole resistance and mortality in 356
invasive Aspergillosis: A multicenter retrospective cohort study. Clin Infect Dis. 357
23. Klaassen CHW, de Valk HA, Balajee SA, Meis JFGM. 2009. Utility of CSP typing to sub-type clinical 358
Aspergillus fumigatus isolates and proposal for a new CSP type nomenclature. J Microbiol 359
Methods 77:292–296. 360
24. Tangwattanachuleeporn M, Minarin N, Saichan S, Sermsri P, Mitkornburee R, Groß U, 361
Chindamporn A, Bader O. 2016. Prevalence of azole-resistant Aspergillus fumigatus in the 362
environment of Thailand. Med Mycol 55:myw090. 363
25. Bader O, Tünnermann J, Dudakova A, Tangwattanachuleeporn M, Weig M, Groß U. 2015. 364
Environmental Isolates of Azole-Resistant Aspergillus fumigatus in Germany. Antimicrob Agents 365
Chemother 59:4356–4359. 366
26. Riat A, Plojoux J, Gindro K, Schrenzel J, Sanglard D. 2018. Azole resistance of environmental and 367
clinical Aspergillus fumigatus isolates from Switzerland. Antimicrob Agents Chemother 368
62:e02088-17. 369
27. Mortensen KL, Mellado E, Lass-Flörl C, Rodriguez-Tudela JL, Johansen HK, Arendrup MC. 2010. 370
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 21: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/21.jpg)
Environmental study of azole-resistant Aspergillus fumigatus and other aspergilli in Austria, 371
Denmark, and Spain. Antimicrob Agents Chemother 54:4545–9. 372
28. Prigitano A, Venier V, Cogliati M, De Lorenzis G, Esposto MC, Tortorano AM. 2014. Azole-resistant 373
Aspergillus fumigatus in the environment of northern Italy, May 2011 to June 2012. Euro Surveill 374
19:20747. 375
29. Sharma C, Hagen F, Moroti R, Meis JF, Chowdhary A. 2015. Triazole-resistant Aspergillus 376
fumigatus harbouring G54 mutation: Is it de novo or environmentally acquired? J Glob 377
Antimicrob Resist 3:69–74. 378
30. Chowdhary A, Sharma C, van den Boom M, Yntema JB, Hagen F, Verweij PE, Meis JF. 2014. Multi-379
azole-resistant Aspergillus fumigatus in the environment in Tanzania. J Antimicrob Chemother 380
69:2979–83. 381
31. Badali H, Vaezi A, Haghani I, Yazdanparast SA, Hedayati MT, Mousavi B, Ansari S, Hagen F, Meis 382
JF, Chowdhary A. 2013. Environmental study of azole-resistant Aspergillus fumigatus with 383
TR34/L98H mutations in the cyp51A gene in Iran. Mycoses 56:659–663. 384
32. Ahmad S, Khan Z, Hagen F, Meis JF. 2014. Occurrence of triazole-resistant Aspergillus fumigatus 385
with TR34/L98H mutations in outdoor and hospital environment in Kuwait. Environ Res 133:20–386
26. 387
33. Ahmad S, Joseph L, Hagen F, Meis JF, Khan Z. 2015. Concomitant occurrence of itraconazole-388
resistant and -susceptible strains of Aspergillus fumigatus in routine cultures. J Antimicrob 389
Chemother 70:412–5. 390
34. Chowdhary A, Sharma C, Kathuria S, Hagen F, Meis JF. 2014. Azole-resistant Aspergillus fumigatus 391
with the environmental TR46/Y121F/T289A mutation in India. J Antimicrob Chemother 69:555–392
557. 393
35. Berger S, Chazli Y El, Babu AF, Coste AT. 2017. Azole resistance in Aspergillus fumigatus: A 394
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 22: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/22.jpg)
consequence of antifungal use in agriculture? Front Microbiol 8:1–6. 395
36. Chowdhary A, Kathuria S, Xu J, Meis JF. 2013. Emergence of azole-resistant Aspergillus fumigatus 396
strains due to agricultural azole use creates an increasing threat to human health. PLoS Pathog 397
9:3–7. 398
37. Chowdhary A, Kathuria S, Xu J, Sharma C, Sundar G, Singh PK, Gaur SN, Hagen F, Klaassen CH, 399
Meis JF. 2012. Clonal expansion and emergence of environmental multiple-triazole-resistant 400
Aspergillus fumigatus strains carrying the TR34/L98H mutations in the cyp51A Gene in India. PLoS 401
One 7:e52871. 402
38. Abdolrasouli A, Rhodes J, Beale M, Hagen F, Rogers TR, Chowdhary A, Meis JF, Fisher MC. 2015. 403
Genomic context of azole-resistance mutations in Aspergillus fumigatus using whole-genome 404
sequencing. MBio 6:1–11. 405
406
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 23: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/23.jpg)
Figure legends 407
408
Fig 1: Distribution of azole susceptible and resistant Aspergillus fumigatus isolates collected in London 409
(b) and southern UK counties (a). Isolates haboring cyp51a allele TR34/L98H are depicted in red, 410
TR46/Y121F/T289A in blue and wild-type in green. 411
412
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 24: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/24.jpg)
Author Contributions 413
T.R.S., Y.Z. and M.C.F. conceived and designed the study. T.R.S., Y.Z., A.P.B. and J.M.G.S. 414
collected the data. T.R.S., Y.Z. and A.P.B. analyzed the data. T.R.S. and Y.J. wrote the 415
manuscript. T.R.S., Y.Z., A.P.B., J.M.G.S., J.R., and M.C.F. discussed the results and commented 416
on the manuscript417
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 25: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/25.jpg)
Tables 418 419 Table 1. Soil sampling areas and A. fumigatus recovery rate, with azole resistance 420 determined by MIC and cyp51A sequencing. 421
Sampling site Samples collected
(n)
Number of samples with A.
fumigatus growth (%)
Number of samples
recovered azole-resistant A. fumigatus a
Prevalence of azole-
resistant A. fumigatus
London Overall 64 60 (93.8%) 9 14.0%
Kensal Green Cemetery 5 5 (100%) 0 0% Queen Mary's Rose Garden & Regents Park
8 7 (87.5%) 0 0%
The Whittington Hospital & Waterlow Park
5 5 (100%) 3 60.0%
Hampstead Heath 3 1 (33.3%) 0 0% Royal Free Hospital 5 5 (100%) 3 60.0% Green Park & Hyde Park 9 9 (100%) 1 11.1% Charing Cross Hospital & Margravine Cemetery
8 7 (87.5%) 0 0%
Brompton Cemetery 6 6 (100%) 1 16.7% Elstree Open Space 8 8 (100%) 1 12.5% Flower beds in urban city 7 7 (100%) 0 0%
Bath city centre, Somerset Flower beds 8 4 (50%) 1 12.5%
Stonehenge, Wiltshire Flower beds and farm 8 6 (75%) 1 12.5%
New Forest National Park, Hampshire Remote forest 46 37 (80.4%) 1 2.2%
Surrey Lavender farm 13 10 (76.9%) 0 0%
Cambridgeshire Wheat farm 30 12 (40%) 0 0%
Open space surrounded by farm 9 2 (22.2%) 0 0%
COMBINED TOTAL 178 131 (73.6%) 12 6.7%
a. Resistance determined by both MIC testing and sequencing analysis. 422 423
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 26: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/26.jpg)
Table 2. Characteristics of azole-resistant A. fumigatus isolates and the control isolates. 424
Soil sample
Sampling site Isolate MIC (g/ml)a cyp51A mutation
csp1 type
ITC VRC POS
L10 Waterlow Park, London
L1031 2 8 0.0625 TR46/Y121F/T239A t02 L1032 4 4 0.125 TR46/Y121F/T239A t02 L1041 4 8 0.125 TR46/Y121F/T239A t02 L1043 4 0.25 0.125 TR34/L98H t02
L27 Waterlow Park, London
L2731 4 1 0.5 TR34/L98H t02
L2741 4 8 0.125 TR46/Y121F/T239A t09
L28 Whittington Hospital, London
L2831 4 8 0.125 TR46/Y121F/T239A t01
L2841 4 0.25 0.125 unknownb t02
L12 Royal Free Hospital, London
L1231 4 0.5 0.125 TR34/L98H t02
L1241 4 0.25 0.125 TR34/L98H t02
L29 Royal Free Hospital, London
L2931 4 0.125 0.0625 TR34/L98H t01
L31 Royal Free Hospital, London
L3131 4 1 0.25 TR34/L98H t02 L3141 4 0.25 0.125 TR34/L98H t02
L19 Hyde Park, London L1931 2 4 0.0625 TR46/Y121F/T239A t18
L41 Brompton Cemetery, London
L4131 4 0.25 0.125 TR34/L98H t02
BS1 Bath city center BS131 4 0.25 0.125 TR34/L98H t02
BS9
Stonehenge, Wiltshire
BS941 4 0.125 0.0625 TR34/L98H t02 BS942 4 0.125 0.125 TR34/L98H t02
NF63 New Forest, Hampshire
NF6341 4 0.25 0.125 TR34/L98H t04B
F3 Elstree Open Space, London
F311 4 0.25 0.125 TR34/L98H t04B
F44 Lavender farm, Surrey
F4411 0.125
0.031
0.016
wild type t05
F55 Wheat farm, Cambridge
F5511 0.25 0.063 0.031 wild type t04A
L11 Royal Free Hospital, London
L1111 0.25 0.031 0.016 wild type t04A
L42 Brompton Cemetery, London
L4211 0.125 0.031 0.031 wild type t03
BS10 Stonehenge, Wiltshire
BS1011 0.125 0.063 0.031 wild type t04A
NF42 New Forest, Hampshire
NF4211 0.125 0.063 0.016 wild type t08
wild-type control Af293 0.25 0.063 0.016 wild-type t06 azole-resistant control BUU09 4 0.25 0.125 TR34/L98H t04B
a. ITC, itraconazole; VRC, voriconazole; POS, posaconazole. 425 b. Isolate L2841 amplified poorly using the primers in this study. 426
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint
![Page 27: Elevated prevalence of azole resistant Aspergillus fumigatus · 27 Introduction 28 Aspergillus fumigatus is a ubiquitous ascomycete fungus with a pan-global population distribution](https://reader034.vdocuments.us/reader034/viewer/2022050209/5f5c1b2692f67145c8407987/html5/thumbnails/27.jpg)
50.5
51.0
51.5
52.0
−3 −2 −1 0
Allele
51.50
51.55
Allele
Allele
TR34/L98H
TR46/Y121F/T239A
Wild type
.CC-BY-NC-ND 4.0 International licensecertified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (which was notthis version posted April 5, 2019. . https://doi.org/10.1101/598961doi: bioRxiv preprint