3145Journal of Cell Science 111, 3145-3156 (1998)Printed in Great Britain © The Company of Biologists Limited 1998JCS3826

ELAV protein HuA (HuR) can redistribute between nucleus and cytoplasm and

is upregulated during serum stimulation and T cell activation

Ulus Atasoy 1,*, Janice Watson 1,*, Dhavalkumar Patel 2,3 and Jack D. Keene 1,3,‡

Departments of 1Microbiology, 2Immunology and 3Medicine, Duke University Medical Center, Durham, NC 27710 USA*These two authors contributed equally to this work‡Author for correspondence

Accepted 28 August; published on WWW 14 October 1998

ELAV proteins are implicated in regulating the stabilityand translation of cytokine and growth regulatory mRNAssuch as GM-CSF, IL-2, c-myc, c-fos and GLUT1 by bindingto their AU-rich 3 ′UTRs. The tissue-specific ELAV proteinHuB (aka. Hel-N1) is predominantly cytoplasmic and hasbeen shown to stabilize GLUT1 and c-myc mRNAs and toincrease their translation following ectopic expression in3T3-L1 cells. We report that the most widely expressedmouse ELAV protein, mHuA, is predominately nuclear incultured NIH-3T3 cells, but is localized in the cytoplasmduring early G1 of the cell cycle. Therefore, much like theprimarily cytoplasmic HuB, HuA becomes temporallylocalized in the cytoplasm where it can potentially regulatethe stability or translation of bound mRNAs. Moreover, wereport that stimulation of mouse spleen cells using eithermitogenic or sub-mitogenic levels of anti-CD3/CD28resulted in a dramatic increase in the level of HuA.Upregulation of HuA corresponds to previously

documented increases in cytokine expression which are dueto increased mRNA stability following T cell activation.Consistent with these findings, HuA was down regulated inquiescent cells and upregulated in 3T3 cells followingserum stimulation. The increase of murine HuA during thecell cycle closely resembles that of cyclin B1 which peaksin G2/M. Together with our earlier studies, these dataindicate that mammalian ELAV proteins function duringcell growth and differentiation due in part to their effectson posttranscriptional stability and translation of multiplegrowth regulatory mRNAs. This supports the hypothesisthat ELAV proteins can function as transacting factorswhich affect a default pathway of mRNA degradationinvolved in the expression of growth regulatory proteins.

Key words: RNA binding protein, RRM, AU-rich elements, 3′Untranslated region, RNA stability, Translation, Cytokine,Paraneoplastic disease

SUMMARY

al5)ss

e,

Csngndeed

t

ry.n,ehe

INTRODUCTION

Embryonic lethal abnormal vision (ELAV) RNA bindingproteins are thought to be involved in cellular growth andifferentiation via posttranscriptional regulation (reviewed bAntic and Keene, 1997). ELAV proteins are members of tRNA recognition motif (RRM) superfamily (Query et al.1989) and each consists of three highly conserved RR(Robinow et al., 1988; Szabo et al., 1991; King et al., 199Although their exact functions are not known ELAV proteinhave been implicated in the stability and translation of earesponse gene (ERG) messenger RNAs, such as those encprotooncoproteins and cytokines (Levine et al., 1993; Gaoal., 1994; Jain et al., 1997; Myer et al., 1997). Direct bindiof ERG mRNA 3′ untranslated regions (UTR) by ELAVproteins Hel-N1 and Hel-N2 (here termed HuB) wademonstrated following in vitro selection from combinatoriRNA libraries (Levine et al., 1993; King et al., 1994; Gao al., 1994). To date, four classes of ELAV proteins have bedescribed and all appear to have similar properties of bindto AU-rich elements (ARE) in these 3′UTRs (reviewed byAntic and Keene, 1997). However, differences in tiss

dyhe,Ms4).srlyoding etng

saletening

ue

distribution among the four classes and their temporappearance during embryonic development (Good, 199suggests that protein interaction signals outside of the RRMcould endow each member with unique functional propertie(King et al., 1994; Gao and Keene, 1996; Antic and Keen1998).

Although none of the mammalian ELAV proteins localizesto a single compartment, the tissue-specific forms HuB, Huand HuD, are predominantly cytoplasmic in cultured neuronand medulloblastoma cells and are distributed in clusters alothe dendrites of neurons (Gao and Keene, 1996; Antic aKeene, 1998; reviewed by Antic and Keene, 1997). Whilbiochemical data suggest that the more ubiquitously expressform, HuA (or HuR), is predominately nuclear (Vakaloupoluet al., 1991; Myer et al., 1997; Ma et al., 1996), it is difficulto imagine how HuA could be involved in mRNA stability andtranslation unless it has access to the cytoplasmic machineIn this study, we demonstrate that the mouse ELAV proteimHuA, distributes throughout the cell during breakdown of thnuclear membrane at mitosis and is delayed in its return to tnuclei of daughter cells in G1. Additionally we showredistribution of HuA to the cytoplasm following treatment

3146

1

of

cherrs:

s, 1te.the;nd

rstnd

P2

an

nd

ss,

gizeAb,

odes

rs.eh

suAll-not

en).A+pl ofe- of

m

ns

mor

U. Atasoy and others

with transcription inhibitors actinomycin D (ActD), and 5,6dichloro-β-d-ribofuranosyl benzimidazole (DRB) and reimporinto the nucleus upon washout of DRB. Moreover, we find thin untreated NIH-3T3 cells, endogenous HuA can be foupredominantly in the cytoplasm during early G1 of the cellcycle.

Our previous demonstration that ectopic expression of human ELAV protein HuB (Hel-N1) can result in increasestability and translation of the ERG mRNA encodinendogenous GLUT1 protein (Jain et al., 1997), as well endogenous c-myc mRNA (unpublished data) was unexpecsince ARE-binding proteins were assumed to help destabitarget mRNAs (Vakaloupolu et al., 1991). These observatiowere confirmed by the finding that vascular endothelial growfactor (VEGF) mRNA is stabilized during hypoxia followingectopic HuA (HuR) expression (Levy et al., 1998Accumulated data suggest that ELAV proteins may functiontransacting factors which modulate a default pathway of ARmediated mRNA degradation.

It is well established that cytokine mRNAs are stabilizefollowing proliferation and artificial stimulation of T cells(Lindsten et al., 1989). Bohjanen et al. (1991) demonstrafollowing T cell activation that an inducible protein, AU-Bcross-links to the AREs of RNAs encoding cytokines such IL-2, TNF-alpha and GM-CSF. However, this protein has nbeen identified. We have investigated the expression of ELproteins, in particular HuA, during proliferation and T ceactivation to determine whether its levels increase duriperiods following activation and subsequent cytokinexpression. We report that following costimulation of murinT cells by CD3 and CD28 activation, levels of mHuA increassignificantly, as one might expect of a transacting factorinvolved in ARE-mediated stabilization of cytokine mRNAsSince activation of T cells results in their recruitment froquiescence into the cell cycle, we examined HuA expressin NIH-3T3 cells. We report that rapidly growing 3T3 cellhave increased levels of the mHuA protein, while quiescecells have lower levels. The kinetics of mHuA expression wefound to be similar to those of cyclin B1 expression, whichmaximally expressed during G2/M, but then diminishes.

In total, these results are compatible with our previofindings that ELAV proteins, as exemplified by HuBparticipate in the stabilization of ERG mRNAs presumably vbinding to ARE 3′UTR sequences in the cytoplasm. Thesfindings suggest a role for the ELAV protein, HuA, in cellulaproliferation. Furthermore, by its increased levels in thcytoplasm during and following cell division, mHuA may hava temporal role in mediating expression of mRNAs via thestabilization or translation. These findings have importaimplications for the regulation of cell proliferation duringhomeostatic growth, as well as during immunoregulation.

MATERIALS AND METHODS

Cloning of HuA forms of ELAV from mouse brain, spleenand testisThe gene for mHuA (accession number U65735) was cloned by us5′ and 3′ RACE (rapid amplification of cDNA ends) techniques usinthe following Clontech products: Marathon-Ready murine spleen abrain cDNA libraries, Advantage KlenTaq Polymerase Mi

-tatnd

thedgas,ted

lizensth

). asE-

d

ted,asotAVllngee

ed(s).mionsntre

is

us,iaere

eirnt

inggndx

(Clontech, Palo Alto, CA). Gene specific HuA primers (GSP5′AGAACCTGAATCTCTGTGCCTGG, position 307; GSP2(5′CCTAGCAGGCGAGTGGTACAGCT, position 261) weredesigned from the partial length murine HuA sequence (kind gift Peter Good, accession number U17595). For 5′ RACE, two nestedPCR were performed following the recommendations in the Clontemanual. For the first reaction, forward primer AP1 and reverse primGSP1 were used. PCR was performed using ‘touchdown’ paramete95°C for 2 minutes, followed by 5 cycles of: 100°C for 2 second72°C for 1 minute then 5 cycles of 100°C for 2 seconds, 70°C forminute; then 20 cycles of 100°C for 2 seconds, 68°C for 1 minuTwo additional rounds of nested PCR were performed as per Clontech protocol using the following primers: forward primer AP2reverse primer GSP2. The final round of nested PCR used AP2 a5′CCACTGAGCTCGGGCGAGCATA, position 422, humansequence HuR, accession U38175). Nested 3′RACE was performedusing published Clontech touchdown parameters. For the fireaction, the following primers were used: reverse primer AP1 aforward primer GSP1 5′CGGTCAGAAGCAGAAGAG, position113. For nested reaction: reverse primer AP2; forward primer GS5′CTCTCCTCTCGCAGCTGTACCACTAGGTTCT, position 227.PCR products were electrophoresed, transferred to Nytrmembranes and probed with 32P-end labeled HuA primers. Positivebands were subcloned into the pNOTA vector (5Prime-3Prime) asequenced in both directions with universal M13 primers (−20 and −48 mers) using ABI technology. Simultaneously, full-length clonewere obtained from the Marathon brain and spleen cDNA librarieusing the following primers (derived from human clone, HuR (HuA)accession U38175) forward primer, 5′ ACAATGTCTAATGGTT-ATGA (position 116) and reverse primer, 5′ GAGCGAGT-TATTTGTGGGA (position 1,106). The reactions were cycled usinthe published Clontech protocol. A solitary band of the expected s(approximately 1 kb), was confirmed by Southern analysis to be Huspecific from both brain and spleen libraries. The full-length 1 kPCR products were subcloned into pNOTA (5Prime-3PrimeBoulder, CO) and sequenced in both directions using the ABI methand universal M13 and HuA specific primers. The sequencobtained from the 5′, 3′ RACE reactions were identical to thoseobtained from the full-length clones generated using human prime

Additionally, putative full-length clones were obtained from moustestis cDNA (Clontech, Palo Alto, CA) using the published Clontecprotocol and the human specific primers described above. 5 µl of thePCR reaction (representing 10% of the total volume) waelectrophoresed, blotted onto Nytran and probed with an internal Hprimer. A prominent and single 1 kb band was identical to the fulength clones obtained from mouse brain and spleen cDNA (data shown).

Derivation of mHuB probeGene specific primers (forward primer 5′ GCGATCAACACT-CTGAATGG and reverse primer 5′ GTCACTGGACCAGCTGTTCT)were designed from a partial length rat ELAV clone which had beused to clone the human ELAV gene, Hel-N1 (King et al., 1994Reverse transcriptase-PCR was performed on mouse brain poly (Clontech) using published Perkin Elmer protocols, the Gene AmRNA PCR kit (Norwalk, CT) and the rat primers above. Geelectrophoresis of the final PCR product revealed a solitary bandthe expected size which was subcloned into pNOTA vector (5Prim3Prime) and confirmed by sequencing to be the murine homolograt HuB cDNA. The plasmid was digested with BamHI and the dscDNA for mouse HuB (Mel-N1) cut out of the gel and used in randoprime labeling with [32P]dCTP using the random nonomer kit from5Prime-3Prime and purified using Stratagene NucTrap colum(LaJolla, CA).

Northern blot analysisNorthern blots of mouse and human tissues, as well as human tu

3147Redistribution and upregulation of HuA (HuR)

tsizetsn.

ths.dct,

(1

ode

orish-uremn0

linnt

ls.

ds

edasinhe

sys

eyti-C-).n

nd

.eidnevee

sisthng

lines (Clontech) were hybridized with a PCR-generated 358 bp Hprobe or with the mHuB probe described above. The PCR prodwas subcloned into the pNOTA vector, sequenced to verify its idenand then used as a template for further reactions. The double-straDNA was labeled by the random nonomer method (Stratagene) the northern blots were hybridized with probes using ExpressHhybridization solution (Clontech) and subjected to autoradiograpfor various times. All northern blots contained 2 µg of poly(A)+ RNAper lane and have been quality tested using actin DNA probecontrol to ensure equivalent amounts of RNA loaded per lane.

Cell linesCell lines were obtained from ATCC except where described acultured under ATCC recommended conditions unless indicaotherwise. HFF (human foreskin fibroblasts) were obtained from Ross McKinney (Duke University Medical Center).

Cell cycle synchronization protocolsSerum starvation of NIH-3T3 cellsNIH-3T3 cells growing in DMEM+10% bovine calf serum (BCSwere trypsinized, split 1:10 and seeded into P150 Petri dishes. Aovernight growth they were washed twice in DMEM and then starvfor 48 hours in DMEM+0.25% BCS. After serum starvation, thmedium was aspirated and fresh DMEM+10% BCS was added. Cwere harvested at various time points (see Results) by trysinizatwashed with ice-cold PBS and then lysed using triple-detergent lybuffer (see below). At each time point, an aliquot of cells was stainwith propidium iodide (PI) and analyzed by FACS to confirm stagof cell cycle. Typically, 86-95% of the cells were in G0 after 48 hoursof serum starvation.

Hydroxyurea block of NIH-3T3 cellsExponentially growing cells in DMEM+10% BCS were serum starveas above for 32-36 hours. These plates were aspirated, washedtimes with DMEM and treated with DMEM+10% BCS containinhydroxyurea (final concentration, 2 mM; Sigma) for 21 hours. Thydroxyurea was removed by washing the cells twice with DMEMDMEM+10% BCS was added back for varying times. Cells weharvested and lysed as described above. Aliquots of unlysed cells assayed by FACS PI staining to confirm stages of cell cycle. The majority of the cells were in G1/S after hydroxyurea treatment.

Activation of murine splenocytesSingle-cell suspensions of freshly teased and Ficoll-Hypaque (FLite, Atlanta Biologics, Atlanta, GA) isolated splenocytes fromC57B6 mice were prepared. These unstimulated murine splenocwere suspended at 2×106/ml with different concentrations of anti-CD3(145-2C11 from Jeff Bluestone, Chicago, IL) and/or anti-CD28 (37.from J. P. Allison, Berkeley, CA) monoclonals. Anti-CD3 at 1:80 mitogenic and gives 100% response on [3H]thymidine uptake; at1:6,400 it is sub-mitogenic and gives a thymidine response of less 10% of maximal. Anti-CD28 at 1:800 does not stimulate by itself bsynergizes with anti-CD3 at 1:6,400 to give maximum response (Let al., 1998). Aliquots of cells were removed at various points, wasand lysed using triple detergent buffer and quantitated using Bradanalysis. Equal amounts of protein were electrophoresed on 12% gel, transferred onto nitrocellulose and blotted with antisera to mHor tubulin.

Antibody production, western blot analysis andquantitationcDNA for HuA was cloned into plasmid pGexKG for overexpressioof the recombinant GST-tagged protein. Thrombin was used inpartial digest to remove the GST tag and the band correspondinfull length HuA cut out of a SDS-PAGE gel and used for polyclonrabbit antibody production (Cocalico, Inc.). For immunofluorescenstaining the antibody was further purified over an affinity colum

uAucttityndedandybhy

as

ndtedDr

)fteredeellsion,sisedes

d two

ghe

.rewerevast

ico-

ytes

51is

thanutee

hedfordSDSuA

n a

g toalcen

(ImmunoLink® Plus, Pierce) of GST-HuA and eluted with 0.1 Mglycine, pH 2.6, and neutralized with Tris-HCl, pH 9.5. Western bloanalysis of cell lysates demonstrated that a band of the expected for HuA was removed from the antibody flow-through and presenas a solitary band in the predicted fractions eluted from the columBy western blot analysis, HuA antisera did not cross-react wiendogenous forms of other neuronal specific ELAV family memberHowever, prior to affinity purification we consistently observed a banof approximately 28 kDa which may represent a degradation produbut also could be an additional ELAV family member.

Whole cell lysates were prepared at 107 cells per ml in triple lysisbuffer of 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 1%Nonidet P40, 0.5% sodium deoxycholate and protease inhibitorsmM PMSF, 10 µg/ml aprotenin, 1 µg/ml leupeptin, 1 µg/ml pepstatinfrom Sigma) and sonicated for 10 seconds three times. This methsolubilized all cellular proteins. Protein concentrations werdetermined by Bradford assay and 20-40 µg loaded per lane in 1×Laemmli buffer. Following transfer to nitrocellulose and blockingwith 5% non-fat milk in TBS-Tween, primary antibody incubationswere carried out in TBS-Tween for 2 hours at room temperature overnight at 4°C. The secondary antibodies conjugated to horseradperoxidase (HRP) (Amersham) were incubated at room temperatfor 30 minutes and blots were developed using the ECL systeaccording to the manufacturer’s directions (Amersham). Anti-tubulimurine monoclonal antibody was used at a dilution of 1:2,00(Amersham).

Western blots were scanned densitometrically and HuA and tubusignals in the linear range were quantitated using ImageQua(Molecular Dynamics). To calculate relative HuA signal indensitometric units, the values were normalized to the tubulin signaLimiting dilution western blots for HuA and tubulin were done usingECL and 125I-labelled Protein A. The 125I blots were scanned byphosphoroimager and quantitated using ImageQuant. Both methoyielded results consistent with one another.

Immunofluorescence staining3T3 cells were grown in chamber slides (Nunc). Cells were washin PBS and fixed in paraformaldehyde in poly-lysine and stained described previously (Gao and Keene, 1996). A further fixation 50% v/v acetone/methanol for 1 minute was found to increase tintensity of staining for HuA. Affinity purified antibody was useddiluted 1:1 in blocking buffer. For identification of 3T3 cells in Sphase combined with HuA staining, bromodeoxyuridine (BrdU) waincluded in the culture medium for one hour as described bDeGregori et al. (1995). DAPI was added at 2 mg/ml for 2-5 minuteat room temperature, following immunostaining protocols wherdescribed. There was no staining when anti-HuA primary antibodwas omitted. Secondary antibodies used included a donkey anrabbit-Texas Red (Jackson ImmunoResearch, Inc.) and an FITconjugated mouse monoclonal against BrdU (AmershamMonoclonal antibody 4B10 to hnRNPA1 was provided by GideoDreyfuss (University of Pennsylvania).

Cell fractionation3T3 cells were separated into fractions based on the Weinberg aPenman (1968) method. Cells were resuspended at 107/ml in ahypotonic buffer of 10 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1.5 mMMgCl2 with protease inhibitors and allowed to swell for 5 minutesLysis was achieved by addition of 0.5% Nonidet NP40 and nuclwere pelleted at 1,000 g for 2 minutes. The supernatant was removeand stored as cytoplasmic fraction C1. The outer nuclear membra(and attached material) was removed by washing nuclei in the abobuffer containing 1% NP40 and 0.5% sodium deoxycholate. Thsolubilized supernatant after centrifugation at 1,000 g for 2 minuteswas designated C2. The nuclear pellet was sonicated in triple lybuffer and the fraction termed N. SDS-PAGE gels were loaded wiequal cell equivalents per lane. Transcription was inhibited by treati

3148

othg.edA.6

yndndorotlyd,vefgAdsees.useslykbd

able

dn).

seen

U. Atasoy and others

cells with 5 µg/ml actinomycin D for up to 3 hours. 5,6-dichloro-β-d-ribofuranosyl benzimidazole (DRB) (Sigma) was also used inhibit transcription at 100 µM for 3 hours and was reversed bwashing out the drug following a further incubation in medium forhours.

RESULTS

Cloning and expression of mHuAWe derived full length cDNAs (from brain and spleenencoding the mouse ELAV protein corresponding to XenopuselrA using the partial mouse clone derived by Dr Peter Goat the National Institutes of Health (Good, 1995). Expressof elrA and its human counterpart HuR (HuA) has bereported at the mRNA level (Good, 1995; Ma et al., 199Okano and Darnell, 1997). elrA has also been detectedXenopusoocytes by immunoblotting (Wu et al., 1997). Winvestigated expression of HuA protein in a variety mammalian cell types using high titer polyclonal rabbantisera prepared against recombinant mHuA and fourelative differences between levels in transformed (Fig. 1A aB, lanes 3 and 4) and nontransformed (Fig. 1B, lanes 1 ancell lines. Human foreskin fibroblasts and embryonic kidnfibroblasts were chosen to illustrate extreme examples (F1B, lanes 1 and 4, respectively). In all cases examineddiscrete protein of the expected size of 34 kDa was detecusing affinity purified mouse HuA antiserum. These and othdata not shown demonstrated that the antiserum recognmouse HuA (mHuA) and human HuA equally well. Since thewere differences in relative protein expression levels amocell types, it was important to examine mHuA mRNexpression in a variety of cell lines.

surd,Daatndthed

fre

ng.

icts

he2.6reerneuB oftent

Fig. 1. Immunoblot of exponentially growing cells showingexamples of relative levels of HuA. Extracts from the following cellines are shown in A; lanes 1, HL60 (human lymphoblastoid line);Namalwa, Burkitt’s lymphoma; 3, 245MG, glioblastoma; 4, DT2H3neuroblastoma. B: 1, HFF, human foreskin fibroblasts; 2, NIH-3T33, HeLa; 4, 293T, human embryonic kidney. 30 mg of protein extraper cell line was separated on a 15% SDS-acrylamide gel, blottedwith anti-mHuA rabbit serum and visualized by ECL. In B, tubulinlevels on the same blot are shown for comparison.

toy 3

)

odionen6; ineofitndndd 2)eyig., ateder

izedreng

A

Brain and testes express unique forms of HuA mRNABy northern blot analysis we assessed the expression of bHuA and HuB in a variety of mouse tissues. As shown in Fi2 quantitative and qualitative differences were also observamong the tissues examined. In the majority of tissues Huwas expressed as a single unique mRNA of approximately 2kb (Fig. 2A, upper panel) that varied in relative intensitamong cell lines. However, in brain and testes the 2.6 kb bawas not expressed or was barely detectable, while new aunique mRNA species of 6.6 kb and 1.8 kb appeared. Fcomparison upon reprobing, the same northern bldemonstrated the expression of HuB mRNAs of approximate4.5 kb in brain and testes (Fig. 2A, lower panel). As expecteother tissues and cell lines that expressed HuA did not hahigh levels of mHuB mRNA under the same conditions oblotting. These findings were confirmed further by examinina variety of human tissues and tumors for expression of HumRNAs (Fig. 2B, both upper and lower). The mRNAs detectein these human tissues corresponded precisely with thoobserved with the mouse tissues including brain and testThus, it is clear that HuA represents a generic or ubiquitomember of the mammalian ELAV family which is detectablin every tissue of mouse and human examined. PreviouOkano and Darnell (1997) reported the presence of a 1.8 band of HuA mRNA in testes but did not report a higher sizemRNA transcript in brain. Ma et al. (1996) reported only single sized band using RT-PCR, which may not have been ato detect all potential transcripts.

Full length mHuA clones from both brain and spleen haidentical sequences in the open reading frame (data not showAdditionally, full-length clones obtained from mouse testicDNA libraries by PCR and Southern blotting also weridentical in size to those obtained from mouse brain and sple(data not shown). At the protein level, different sized bandwere not observed in whole mouse brain extracts using opolyclonal antibody raised against recombinant HuA. Indeewe have consistently observed a band of approximately 34 kwhich corresponds to mHuA. Hence, it seems plausible ththe differences in transcript size in mouse brain, spleen atestis are due to differences in the untranslated regions of mRNAs. Okano and Darnell (1997) have reporteheterogeneity in the 3′UTRs of mHuA. However, we have notruled out differential splicing or the existence of isoforms othe HuA mRNA in these tissues. We conclude that there aHuA transcripts in both mouse brain and spleen encodiidentical full-length open reading frames of the HuA protein

Expression of HuA and mHuB during mouseembryogenesisGiven the potential role of ELAV proteins in differentiation(Robinow and White, 1991; Wu et al., 1998; reviewed by Antand Keene, 1997), we decided to probe northern blorepresenting different stages of murine development with tmHuA probe. There was a single band of the expected size (kb) on days 11, 15 and 17 (Fig. 2C, upper). However, thewas no mHuB transcript detected at day 7 (Fig. 2C, lowpanel, lane 1) which is consistent with the fact that the murinervous system begins to develop after day eight. Hence mHis expressed about the time of the earliest developmentneurons in the murine central nervous system and is consiswith the time of appearance of ELAV in Drosophila (Robinow

l 2,,;ct

3149Redistribution and upregulation of HuA (HuR)

ss.)llsh

t).

ic.ate

oteof

t

eess

edn

ne

Fig. 2.Northern blots showing variations in HuA mRNA species expressed in mouse (A, upper panel) and human (B, upper panel) proliferatingcell lines and in developing mouse embryos (C, upper panel). Lower panels in A and C show the same blots probed for mHuB (Mel-N1). A:Various mouse tissues were probed for mRNAs using mHuA (upper) and mHuB (lower) cDNA probes. Lanes: 1, heart, 2, brain, 3, spleen, 4,lung, 5, liver, 6, skeletal muscle, 7, kidney, 8, testis. B: mRNA from human tissues (lanes 1-10) and cell lines (lanes 11-18) were probed withonly mouse HuA cDNA. Lanes: 1, spleen; 2, thymus; 3, prostate; 4, testis; 5, ovary; 6, small intestine; 7, colon; 8, peripheral blood leukocyte;9, heart; 10, brain; 11, HL-60; 12, HeLa; 13, CML/K562; 14, T lymphoblastic leukemia, MOLT-4; 15, Burkitt’s/Raji; 16, colorectaladenocarcinoma, SW480; 17, lung carcinoma, A549; 18, melanoma, G361. C: mRNA from developing mouse embryos probed with cDNA ofmHuA (upper panel) and mHuB (lower panel). Lanes: 1, embryos from day 7; 2, embryos from day 11; 3, embryos from day 15; 4, embryosfrom day 17.

et al., 1988). In contrast to the developmental expressionmHuB, however, mHuA appeared to be constitutiveexpressed throughout development as determined at day 7 (1), the earliest time examined. Furthermore, mHuA continuto be expressed throughout intrauterine development as wobe expected of a constitutive generic cell protein. The fact tthe 6.6 kb and 1.8 kb transcripts were not detected developmental northern blots is probably due to tvanishingly small amounts of the tissues from brain and tesrepresented during these early stages of development. conclude that mHuA is expressed at early stages of murdevelopment, which is consistent with its being generic and tissue-specific.

Expression of mHuA during cell cycle progressionin NIH-3T3 cellsGiven the apparent variation in expression of mHuA prote(Fig. 1) and RNA (Fig. 2) among the cell lines examined, wwondered whether there may be differences in protein levelvarious proliferative stages for any given cell type. Therefocell cycle synchronization experiments were carried out us3T3 with two established protocols: either serum starvationhydroxyurea block, followed in both cases by serurestimulation. Levels of mHuA were monitored by westeblotting using affinity purified antiserum. As shown in Fig. 3Astarved cells in G0 showed very low levels of protein (lane 2)but the levels gradually increased after serum was added bto cells, peaking at 18 hours post stimulation (arrow, lane

oflylaneeduld

hatin

hetesWeinenot

ine

s atre,ing ormrn,,ack5).

HuA levels as measured in arbitrary densitometric unitincreased approximately 2-fold during these experimentFACS staining of these same cells with propidium iodide (PI(not shown), confirmed that serum starvation placed the cein G0 and upon serum re-stimulation they progressed througthe cell cycle normally. The 18 hour time point (lane 5), duringwhich mHuA levels reached maximum, represented G2/M with41% of the cells in G2/M by FACS PI staining (data notshown). We reproducibly observed an inexplicable slighdecrease in mHuA at 24 hours post serum addition (lane 8Nonsynchronous 3T3 cells when harvested during logarithmgrowth showed higher levels of mHuA (lanes 1 and 9)Consistent with these findings, nonsynchronous cells threached 100% confluence showed lower levels of mHuA (lan10). Therefore, although the degree of synchrony was noptimal when using the serum starvation method, a definitivcorrelation between the levels of mHuA and certain stages proliferation was evident.

We further synchronized 3T3 cells using the more efficienmethod of hydroxyurea block which arrests cells in G1/S (Jonget al., 1995) followed by reentry into the cell cycle afterreaddition of serum and removal of drug. Throughout thesexperiments, FACS PI staining was used to monitor the stagof cell cycle (data not shown). As shown in Fig. 3B, the levelof mHuA decreased from time 0 (G1/S, lane 1) to 3 hours postrelease (lane 2), increased progressively as proliferation ensureaching a peak at 8 hours (arrow, lane 4) and theprogressively decreased. The 8 hour time point shown in la

3150

lses.ndeedlyll

at

n, of

e

alt39;,

1

eg

orei-

,ch

e).

neneA

ingeofls.lls

dy

hovelr

re,e in

U. Atasoy and others

Fig. 3.Western blot analysis showing expression of mouse HuA inNIH-3T3 (A and B) or mouse splenocytes (C) following treatmentsto activate proliferation. (A) Mouse 3T3 cells following serumstarvation (0.25%) and reactivation by serum addition (10%). Lan1, exponentially growing, unstarved cells; 2, serum starved for 48hours (G0); lanes 3-8: post serum addition; 3, 10 minutes; 4, 6 hou5, 18 hours; 6, 20 hours; 7, 22 hours; 8, 24 hours; 9, exponentiallgrowing 3T3 from another experiment; 10, confluent cells (G0). B:mouse 3T3 cells following growth blockage with hydroxyurea andsubsequent release. Lanes: 1, t=0, no serum added; lanes 2-6: pserum addition; 2, 3 hours; 3, 6 hours; 4, 8 hours; 5, 10 hours; 6, hours; 7, starved cells with no hydroxyurea treatment; 8, untreatecells; 9, positive control, exponentially growing 3T3 cells. G2/M isapproximately marked by arrows. C: mouse spleen cells treated wanti-CD3 and/or anti-CD28 to activate T cells. Lanes: 1, cells at d0; 2, cells unstimulated at day 1; 3, cells unstimulated at day 2; la4-9, stimulated with either or both antibodies; 4, anti-CD3 (1:80) aday 1; 5, anti-CD28 (1:800) at day 1; 6 anti-CD3 (1:6400)+anti-CD28 (1:800) at day 1; 7 anti-CD3 (1:80) at day 2; 8 anti-CD28(1:800) at day 2; 9 anti-CD3 (1:6400)+anti-CD28(1:800) at day 2;10, control 3T3 cells in log phase of growth. In each blot, equivaleamounts of protein were loaded in each lane and tubulin was proon the same blots as control. Results shown are representative othree separate experiments.

4 represents G2/M as assayed by FACS PI staining and bmonitoring maximal cyclin B1 expression (Fig. 3B). Cyclin Bis known to peak at G2/M in the mammalian cell cycle (Maityet al., 1995). Interestingly, mHuA expression paralleled cycB1 expression with the peak occurring around G2/M and thelowest levels in G0/G1. In the hydroxyurea block-releaseexperiment shown in Fig. 3B, the levels of mHuA as measuin arbitrary densitometric units varied up to 5-fold, whereas cyclin B1 levels varied by about 5-fold. Consistent with resushown in Fig. 3A, serum starved 3T3 cells (Fig. 3B, lane

y1

lin

redthelts7)

and exponentially growing cells (Fig. 3B, lane 9) showed leveof mHuA that correlated with the proliferative state, while thhigher levels were always observed in actively growing cellThe cells in lane 8 were untreated (negative control) acompletely confluent. Thus, the levels of HuA in thesuntreated cells were very similar to those observed with starvcells (lane 7). We conclude that levels of the ubiquitousexpressed ELAV protein, mHuA, are higher during ceproliferation reaching a peak around G2/M and they appear toapproximate the expression of cyclin B1.

The higher level of mHuA found following hydroxyureablockage (Fig. 3B, lane 1) is consistent with the fact thblockage occurs at the G1/S boundary. However, thesignificance of the reproducible dip in HuA expressiofollowing serum re-stimulation is presently unknown (Fig. 3Blane 2). Given these observations which indicate that levelsmHuA vary with the state of proliferation, we decided toexamine the response of mHuA during activation of immuncell proliferation.

mHuA expression is upregulated during T cellactivation in mouse splenocytesOne of the established examples in which post transcriptionregulation at the level of mRNA stability is known to affeccytokine protein expression is that of T cell activation via CDand CD28 signaling (June et al., 1987; Lindsten et al., 198Thompson et al., 1989). Since the ELAV family membersincluding mHuA, have been shown to bind to the 3′UTRs ofcytokine mRNAs and mHuA is the first known ELAV familymember to be expressed in cells of lymphoid lineage (Figsand 2; spleen, thymus, MOLT-4, a T cell line, Burkitt’slymphoma and Namalwa, a type of Burkitt’s lymphoma) winvestigated whether mHuA levels were also altered durinactivation of T cells. We examined mouse spleen cells flevels of mHuA following standard methods of activation (seMaterials and Methods) with either mitogenic levels of antCD3 or with sub-mitogenic, synergistic levels of anti-CD3plus anti-CD28 (Lindsten et al., 1989). As shown in Fig. 3Clane 1, mHuA was barely detectable in untreated cells, whiis consistent with the quiescent (G0) state. Interestingly,unstimulated human peripheral blood lymphocytes havnearly undetectable levels of HuA mRNA (Fig. 2B, lane 8Following stimulation with mitogenic levels of anti-CD3, anincrease in mHuA was evident by as early as 24 hours (la4), but no change occurred upon addition of anti-CD28 alo(lane 5) or in untreated controls (lane 2). An increase in mHuexpression was also observed at day 1 when co-stimulatwith sub-mitogenic doses of anti-CD3 plus anti-CD28 (lan6). By day 2 in the presence of anti-CD3 (lane 7) the level mHuA was higher as compared to unstimulated controTherefore, consistent with data shown above using 3T3 ce(Fig. 3A), mitogenic stimulation of T cells also upregulatelevels of HuA up to 12-fold as measured in arbitrardensitometric units.

Moreover, when these lymphoid cells were stimulated witsub-mitogenic levels of both anti-CD3 and anti-CD28, for twdays, there was approximately a 12-fold increase in the leof mHuA (lane 9) as compared with either unstimulated oanti-CD28 controls (lanes 2 and 8, respectively). Furthermoby day 2 following costimulation using both antibodies (lan9) the levels of mHuA reached those consistently observed

es:

rs;y

ost12d

ithaynest

ntbedf

3151Redistribution and upregulation of HuA (HuR)

ig.Botandedig.

laysf

d FuAter

einenter

inser4)arm

ellso-

ed

arhee

ig.to

us

elsbyg

heichterrity

asm

as1)ctDuAlearthe

ithe

hely has.sal

ngof

all of our exponentially-growing 3T3 cells (lane 10Stimulation with only anti-CD3 at sub-mitogenic leve(1:6,400) showed negligible HuA upregulation (data nshown). These data demonstrate that stimulation of quiesT cells using antibodies to CD3 and CD28 surface receptormitogenic or submitogenic levels resulted in dramatic increain the expression levels of the ELAV protein, mHuA. Hulevels increase following stimulation of either NIH-3T3 celor murine splenocytes. The greatest increases are seen whcells are stimulated. This may be due to the fact that ne100% of unstimulated murine splenocytes are in G0, whereasthe previously employed methods used to block NIH-3T3 cenever block 100% of the cells.

The sub-mitogenic response used in the experiment of 3C corresponds with well documented increases in cytokmRNA stability following costimulation of T cells (June et al1987; Lindsten et al., 1989). Furthermore, it is consistent wour findings that the ELAV protein, HuB (Hel-N1) results istabilization of target mRNAs following transfection of 3T3Lcells (Jain et al., 1997; Antic and Keene, 1997; unpublishdata) and that ectopic HuA expression stabilizes VEGF mR(Levy et al., 1998).

The correlation shown above between increased levelsmHuA, previously documented increases in cytokine mRNstabilization and T cell activation may appear to be inconsistwith the reported localization of HuR to the nucleu(Vakalopoulou et al., 1991; Myer et al., 1997). However, shown below, mHuA can be detected also in the cytoplasmNIH-3T3 cells in low amounts and has a predominacytoplasmic presence at a particular stage of the cell cycle

Cellular localization of mHuAGiven the potential regulation of mHuA during ceproliferation, as shown above, it is believed that the stabiand translation of ERG polyadenylated mRNA most liketakes place in the cytoplasm (see Richter, 1996, and artitherein). The putative localization of mHuA to the nucleus wbased previously upon biochemical fractionation and bindof cell extracts to ERG RNAs in vitro (Vakalopoulou et a1991; Myer et al., 1997). Since antibodies to mHuA have been available to assess its expression in mammalian cellsused our antiserum against mHuA to examine its intracellulocation. Our affinity purified antiserum reacts only with thubiquitous protein HuA and does not recognize any other proteins or other ELAV proteins based upon western blottof many cells and tissues. As expected, examination of 3cells by indirect fluorescence using this antiserum reveapredominantly nuclear staining (Fig. 4A). However, whenlarge number of fields were examined, separating daugcells or recently separated cells were observed in whcytoplasmic staining was dramatically increased (Fig. 4C aD). The rarity of these cells appears to reflect the short tiperiod during which cells are in this stage of the cell cycInterestingly, these cells had a strong pattern very similathat reported previously with medulloblastoma ceexpressing the HuB ELAV proteins Hel-N1 and Hel-N2 (Gaand Keene, 1996). This suggests that at a distinct peduring the cell cycle, presumably during early G1, mHuAprotein is located in the cytoplasm and later returns to nucleus. Double staining with anti-BrdU-FITC to track thephase of the cell cycle clearly demonstrated mHuA w

).lsotcents insesAlsen T

arly

lls

Fig.ine.,ithn1ed

NA

ofAentsas ofnt.

lllitylyclesasingl.,not, welare

cellingT3led ahterichndmele.r tollso

riod

the Sas

predominantly nuclear during periods of DNA synthesis (F5A and B). The recently divided cells in Fig. 5A and (arrow), which displayed cytoplasmic mHuA staining did nincorporate BrdU and hence were not in S phase. Fig. 5C D, as well as Fig. 5E and F, indicate cells which were involvin various stages of mitosis as detected by DAPI staining. F5D (arrow) outlines the condensed chromosomes and dispdiffuse HuA staining (Fig. 5C) which may be a result onuclear membrane breakdown during mitosis. Fig. 5E andemonstrate the predominantly cytoplasmic staining of Hat times when the DAPI staining shows that new daughnuclei have formed.

Staining of endogenous HuA suggested that the protcould redistribute to the cytoplasm in a cell cycle dependmanner. We further investigated HuA localization aftinhibition of transcription which, originally shown forhnRNPA1, can cause redistribution of some nuclear proteinto the cytoplasm (Pinol-Roma and Dreyfuss, 1991). A furthrationale for this experiment comes from Katz et al. (199who described a UV-crosslinked ARE binding protein similin size (34 kDa) to mHuA that accumulated in the cytoplasof T cells following actinomycin D (ActD) treatment. Uponaddition of ActD (5 µg/ml, 3 hours) to NIH-3T3 cells, mHuAdramatically increased in the cytoplasm leaving in some cthe nucleus almost devoid of staining (Fig. 4B). 5,6-dichlorβ-d-ribofuranosyl benzimidazole (DRB), which inhibitstranscription by a different mechanism than Act D also causredistribution of HuA to the cytoplasm (Fig. 6A). Followingwashout of DRB, HuA returned to its predominantly nucledistribution (Fig. 6D). This experiment demonstrated both texport of HuA into the cytoplasm and its reimport into thnucleus. The effect of DRB (Fig. 6B) and DRB washout (F6E) on hnRNPA1 staining is also shown. In comparison HuA, the proportion of hnRNPA1 that leaves the nucleduring treatment with inhibitor was small.

To further confirm these observations the expression levof HuA in the different compartments were investigated fractionation of Act D treated 3T3 cells and western blottin(Fig. 7). Subcellular fractionation was performed using tmethod outlined by Weinberg and Penman (1968) whallows separation of the cytoplasm into soluble (C1) and ounuclear membrane-associated (C2) components. The integof the fractionation before and after ActD treatment wconfirmed by monitoring of nuclear antigens, U1 70K and S(data not shown). In untreated cells (control), HuA wpredominantly nuclear (N) but some soluble cytoplasmic (Cand detergent extractable protein (C2) was also evident. Atreatment resulted in a significant increase in the mHcytoplasmic signal and a corresponding decrease in the nucsignal. These data demonstrate a dramatic transition of ubiquitously-expressed ELAV protein HuA as compared wthe other ELAV family members which appear to bpredominantly cytoplasmic.

Although small amounts of HuA can be detected in tcytoplasm of cells at all phases of the cell cycle, it is highabundant during a specific phase of the cell cycle, and thusthe opportunity to interact with ERG RNAs in the cytoplasmThis observation does not preclude the possibility that a balevel of movement in and out of the cytoplasm is occurricontinually, even though the predominant localization mHuA appears nuclear.

3152 U. Atasoy and others

Fig. 5. Double staining of 3T3 cells with mHuAantisera and anti-BrdU reveals nuclear localizationof mHuA during S phase of cell cycle andcytoplasmic distribution after mitosis. (A and B)Cytoplasmic mHuA distribution in recentlydividing cells (arrow). Cells in B which stain withanti-BrdU (FITC) are in S phase and co-localize inthe nucleus with mHuA (Texas Red). (C and D) Acell with condensed chromosomes about toundergo mitosis (arrow). (E and F) Cells whichhave recently completed mitosis. Blue DAPIstaining clearly outlines nuclear material.

Fig. 4. Indirect immunofluorescenceshowing the localization of mHuA inmouse 3T3 cells. (A) Predominantlynuclear localization of mHuA inexponentially growing, nonsynchronizedcells; B, cytoplasmic localization ofmHuA following treatment ofnonsynchronized 3T3 cells for 3 hourswith 5 µg/ml actinomycin D; (C and D)same as A, but showing fields in whichmHuA is localized in the cytoplasm ofrecently separated 3T3. HuA wasvisualized using Texas Red.

3153Redistribution and upregulation of HuA (HuR)

etDaym

herh

wsnt

g7).,

A D

B E

C F

Fig. 6.Staining of 3T3 cells forHuA and hnRNPA1 (monoclonalantibody 4B10) followingtreatment with 100 µM DRB for 3hours demonstrates the extensiverelocalization of HuA (A) anddetectable redistribution ofhnRNPA1 (B, arrows) to thecytoplasm. Two examples ofrepresentative fields are shown.Wash-out of DRB and a further 3hours of incubation in mediaresulted in HuA and hnRNPA1returning to their original nuclearstaining (D and E). Double stainingfor HuA and hnRNPA1 is shown inboth cases in C (DRB treatment)and F (DRB washout).

DISCUSSION

ELAV proteins have all been found to bind to AU-richsequences present in the 3′UTRs of mRNAs encoding proto-oncoproteins and cytokines. While HuA appears to have same in vitro RNA binding specificity as HuB, HuC and HuDit shows differences in expression and intracellular localizatiwhich may indicate distinct functions. In this paper we hainvestigated the level of expression, tissue specificity aintracellular localization of HuA. We prepared rabbit antiseruagainst recombinant HuA that does not recognize the neuroELAV proteins, thus allowing specific detection of endogenoHuA in all tissues examined. Good (1995) first cloned tXenopuscounterpart, elrA, and detected its mRNA expressiby northern blot analysis. Previous reports concernimammalian HuA protein expression failed to deteendogenous protein, possibly due to weak immunoreactivitythe antisera used (Okano and Darnell, 1997; Wakamatsu

the,

onvendmnal

usheonngct ofand

Weston, 1997) but protein expression of the Xenopus proteinhas been described (Wu et al., 1997). More recently, Levyal. (1998) reported detecting two bands of 34 kDa and 30 kwhich are close to the predicted size of HuA (36 kDa) bwestern blotting of 293T cells using a Hu patient antiseruaffinity purified against recombinant GST-HuR (HuA).However, these authors did not rule out the presence of otELAV proteins in their 293T cells that may have reacted wittheir paraneoplastic patient serum.

Intracellular localization of the HuA ELAV proteinSequence comparisons of the mammalian ELAV proteins shothat there is strong identity in the RRMs which is consistewith their RNA binding activities being virtuallyindistinguishable (Query et al., 1989; Levine et al., 1993; Kinet al., 1994; Gao et al., 1994; Ma et al., 1996; Myer et al., 199While all ELAV proteins can bind the same RNAs in vitroapparent differences in the intracellular localization of ELAV

3154

n1-id

Mary ininy.e).

ar

ne

et-epeal.,lyeotye

ate

c8ndo

g.dngsm

al.d

lely

tedt

norble

dn

U. Atasoy and others

Fig. 7.Western blot showing redistribution of HuA from the nucleuto the cytoplasm of mouse 3T3 cells. Immunoblot of 3T3cytoplasmic extracts (C1); deoxycholate extracted from nuclei (C2and nuclear extracts (N). Proteins were separated on 15% SDS-acrylamide gels and probed with HuA-specific rabbit antiserum.

proteins has raised the question of how they might find accto the same mRNA targets in vivo. For example, the Hproteins, Hel-N1 and Hel-N2, are predominantly cytoplasmwith some nuclear staining (Gao and Keene, 199Endogenous HuA, on the other hand, appears to be monuclear but during certain times of the cell cycle is cleacytoplasmic (Fig. 4). Interestingly, Hel-N2 and HuA are thmost similar to one another among all human members ofELAV family in that they lack hinge segments and are expresin proliferating cells (Gao et al., 1994; Ma et al., 1996; Gao aKeene, 1996; Antic and Keene, 1997). In this study, we repthat HuA is located predominantly in the cytoplasm followinmitosis and appears at that time to have an intracelludistribution very similar to the HuB proteins (Gao and Keen1996), before it later returns to the nucleus during G1. Nuclear-cytoplasmic movement of hnRNPA1 and other RRM proteihas also been demonstrated previously by blocktranscription with actinomycin D and DRB (Pinol-Roma anDreyfuss, 1991, 1992). However, by direct comparison of Hand hnRNPA1, we observed that HuA redistributed moextensively to the cytoplasm following these same treatmeIt is logical to assume that HuA can interact with ERG mRNAin the cytoplasm and as shown previously for HuB (Gao aKeene, 1996), would be available to affect mRNA stability atranslation (Antic and Keene, 1997; Jain et al., 1997).

During revision of this manuscript, Fan and Steitz (199reported that the human homolog of HuA is a shuttling protbased upon its ability to move between nuclei in heterokaryformed between human and mouse cells. Our data consistent with HuA being able to shuttle between the nucland cytoplasm like other RNA binding proteins reportepreviously (Katz et al., 1994; Pinol-Roma and Dreyfuss, 191992; Zinsnzer et al., 1997; Peng et al., 1998). A wcharacterized type of nuclear export signal (NES) is a leucirich sequence first described in HIV-1 Rev (Fischer et al., 19and in PKI, a polypeptide inhibitor of the cAMP-dependeprotein kinase (Wen et al., 1995). Bogerd et al. (1996) hshown the spacing between leucines (or isoleucines)important and can be either 3-3-1 (Rex), 2-2-1 (Rev) or 3-2(PKI) while the identity of these surrounding residues can vaThe sequence 78-I S T L N G L R L Q-87 in loop 5 of RR

essuBic

6).stlyrlye

thesedndortglare,

nsingd

uAre

nts.s

ndnd

8)einonsareeusd

91,ellne-94)ntave is-1ry.

M

1 of mHuA is a potential NES of the Rev-type whose locatiomay allow access to interacting factors. Interestingly, the U70K snRNP protein was found to contain a basic amino acnuclear localization signal in the same position of the RRstructure (Romac et al., 1994). The differences in intracellullocalization among ELAV family members cannot be solelcontrolled by this putative NES since this sequence existsthem all. The surrounding structure, including differences potential phosphorylation sites which are unique to HuA, macontrol accessibility of the NES to interacting proteinsPhosphorylation is known to play an important role in thlocalization of many proteins (reviewed by Jans, 1995Additionally, the intracellular distribution of ELAV membersmay result from a balance between their individual nucleexport and import.

Upregulation of HuA expression and immune cellactivationHuA levels increase dramatically following activation ofmouse spleen T cells suggesting a possible role in immufunction. T cell activation involving CD28 as the co-stimulatory molecule with CD3 has been shown to involvstabilization of cytokine mRNAs (Lindsten et al., 1989). Postranscriptional cytokine mRNA stabilization mediated via thCD28 signaling pathway, allows activated T cells to escaapoptosis and secrete large amounts of cytokines (Noel et 1996). In contrast, cells activated solely via the TCR using onanti-CD3 secrete small amounts of cytokines beforundergoing apoptosis. However, T cell stimulation does nresult in indiscriminate ARE mRNA stabilization as seen bthe stark increase in cytokine mRNAs in comparison with thsmall increase in protooncogene mRNAs followingcostimulation (Lindsten et al., 1989). This suggests thadditional regulatory factors discriminate between thesmRNAs. We report HuA upregulation during both mitogenianti-CD3, as well as sub-mitogenic anti-CD3 and CD2stimulation. Further experiments will be needed to understathe role(s) of HuA and other factors in regulating these twmodes of T cell activation.

Umlauf et al. (1995) confirmed the importance of mRNAstabilization in T cell activation by detecting a 20-foldupregulation in IL-2 mRNA levels and up to a 100-foldincrease in secreted IL-2 following T cell co-activation usinboth anti-CD3 and anti-CD28 but not only anti-CD3Interestingly, nuclear pre-spliced IL-2 mRNA levels increaseby 8-fold and they suggested that a transacting RNA bindiprotein capable of shuttling between the nucleus and cytoplamay interact with IL-2 mRNA. In fact, three proteins whichcan bind to the AU-rich sequences of cytokine 3′UTRs asdetected by UV-crosslinking were described by Bohjanen et (1991, 1992). Two of these, AU-B and AU-C, were upregulateduring T cell activation. The third protein, AU-A, is a 34 kDapredominantly nuclear protein that is believed to shuttbetween the nucleus and cytoplasm and is constitutiveexpressed. However, AU-A was reported not to be upregulafollowing T cell activation by the methods they used (Katz eal., 1994). Cloning of these factors has not been reported, have they been biochemically defined and it remains possithat AU-A and HuA are related proteins.

It is logical to expect that many proteins are upregulateduring cellular stimulatory processes which result i

s

)

3155Redistribution and upregulation of HuA (HuR)

heosithive

l

sd

.

ell in

-

al

,es.

y

ces

d

he

et

proliferation or metabolic activation. For example, othinvestigators have reported that some hnRNP proteins elevated in PHA stimulated T cells (Biamonti et al., 1993Since ELAV proteins have been demonstrated to stabilARE-containing mRNAs (Jain et al., 1997; Levy et al., 1998the consequences of HuA upregulation for cytokine productin the immune system is an obvious possibility. Our resusuggest that the ELAV protein, HuA, is an ideal candidate a transacting factor which interacts with cytokine mRNAs aregulates their expression. These results do not rule out a for HuA in also regulating proto-oncogene mRNA stabilitieAdditional experiments will be necessary to determine wheththese interactions directly influence cytokine production duriimmunoregulation.

Implications for cell proliferation and differentiationLittle is known about post-transcriptional regulation of thmammalian cell cycle. Protooncogenes, such as c-fos anmyc are upregulated during the transition from G0 to G1,although the levels of c-fos are transient and c-myc remahigh throughout the cell cycle. Among the known cyclins, oncyclins B1 and A are known to be regulated postranscriptionally. In recent papers, Maity et al. (1995 and 199showed that the mRNA half-lives of both cyclins vary by amuch as 4- to 5-fold during the cell cycle, although they peat different times. The cyclin E mRNA half-life, however, dinot appreciably change. Hence, the cell posttranscriptionaregulates cyclins B1 and A but not E. Although the 3′UTRs ofboth cyclin B1 and A contain multiple AU repeats (HanleyHyde et al., 1992; Ravnik and Wolgemuth, 1996), RNbinding proteins which interact with these mRNAs have nbeen elucidated. The overlapping temporal upregulationHuA and cyclin B1 is intriguing.

We suggest that ERG products have evolved a defapathway of mRNA degradation as marked by the ARE in t3′UTRs and that transacting factors like the ELAV proteinhave the ability to reverse this effect by binding the mRNinstability sequence. The functions of ERGs in the seemindistinct pathways of growth and differentiation may involvdifferences in localization by ELAV proteins and bounmRNA. Results with HuA reported here suggest that like HN2, its expression correlates with increased proliferatiduring cell growth in culture, as well as in isolated spleen cewhich are activated in vitro (Fig. 3).

Although our data are consistent with a role for HuA in thcytoplasm, they do not preclude a role for HuA in RNstability, splicing or mRNA transport, while in the nucleu(Antic and Keene, 1997, 1998). Data presented here compatible with earlier hypotheses implicating mammaliaELAV proteins in the regulation of gene expression via theinteractions with growth regulatory mRNAs (King et al., 199Gao and Keene, 1996; Antic and Keene, 1998). It is likely ththey participate in both nuclear and cytoplasmic functions binding to an mRNA subset and regulating their processand/or transport during growth and development. It will binteresting to define other cellular components involved these regulatory pathways via their interactions with ELAproteins. These factors can be more readily investigated usa recently devised cell-free deadenylation/degradation sysin which HuA and HuB were shown to stabilize AREcontaining transcripts (unpublished data).

erare).ize),

ionltsforndroles.er

ng

ed c-

inslyt-7)sakdlly

-Aot

of

ulthesAglyedel-onlls

eAsarenir

4;at

byingeinVing

tem-

We thank Scott Tenenbaum for assisting with the graphics, tNevins laboratory for assistance with cell cycle techniques, CarlSune for providing cell lysates, Dawn Jones for assistance wsplenocytes and the Cell Culture Facility of the Duke ComprehensCancer Center.

REFERENCES

Antic, D. and Keene, J. D.(1997). Embryonic lethal abnormal visual RNA-binding proteins involved in growth, differentiation, and posttranscriptionagene expression. Am. J. Hum. Genet. 61, 273-278.

Antic, D. and Keene, J. D.(1998). Messenger ribonucleoprotein complexecontaining human ELAV proteins: interactions with cytoskeleton antranslational apparatus. J. Cell Sci.111, 183-197.

Biamonti, G., Bassi, M. T., Cartegni, L., Mechta, F., Buvoli, M., Cobianchi,F. and Riva, S. (1993). Human hnRNP protein A1 gene expressionStructural and functional characterization of the promoter. J. Mol. Biol.230,77-89.

Bogerd, H. P., Fridell, R. A., Benson, R. E., Hua, J. and Cullen, B. R.(1996). Protein sequence requirements for function of the human T-cleukemia virus type 1 Rex nuclear export signal delineated by a novelvivo randomization-selection assay. Mol. Cell. Biol.16, 4207-4214.

Bohjanen, P. R., Petryniak, B., June, C. H., Thompson, C. B. and Lindsten,T. (1991). An inducible cytoplasmic factor (AU-B) binds selectively toAUUUA multimers in the 3′ untranslated region of lymphokine mRNA.Mol. Cell. Biol.11, 3288-3295.

Bohjanen, P. R., Petryniak, B., June, C. H., Thompson, C. B. and Lindsten,T. (1992). AU RNA-binding factors differ in their binding specificities andaffinities. J. Biol. Chem.267, 6302-6309.

DeGregori, J., Leone, G., Ohtani, K., Miron, A. and Nevins, J. R.(1995).E2F-1 accumulation bypasses a G1 arrest resulting from the inhibition of G1cyclin-dependent kinase activity. Genes Dev.9, 2873-2887.

Fan, X. C. and Steitz, J. A.(1998). Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of AREcontaining mRNAs. EMBO J.17, 3448-3460.

Fischer, U., Meyer, S., Teufel, M., Heckel, C., Luhrmann, R. andRautmann, G. (1994). Evidence that HIV-1 Rev directly promotes thenuclear export of unspliced RNA. EMBO J.13, 4105-4112.

Gao, F. B., Carson, C., Levine, T. and Keene, J. D.(1994). Selection of asubset of mRNAs from combinatorial 3′ untranslated region libraries usingneuronal RNA-binding protein Hel-N1. Proc. Nat. Acad. Sci. USA91,11207-11211.

Gao, F. B. and Keene, J. D.(1996). Hel-N1/Hel-N2 proteins are bound topoly(A)+ mRNA in granular RNP structures and are implicated in neurondifferentiation. J. Cell Sci.109, 579-589.

Good, P. J.(1995). A conserved family of elav-like genes in vertebrates. Proc.Nat. Acad. Sci. USA92, 4557-4561.

Hanley-Hyde, J., Mushinski, J. F., Sadofsky, M., Huppi, K., Krall, M.,Kozak, C. A. and Mock, B.(1992). Expression of murine cyclin B1 mRNAsand genetic mapping of related genomic sequences. Genomics13, 1018-1030.

Jain, R. G., Andrews, L. G., McGowan, K. M., Pekala, P. H. and Keene,J. D. (1997). Ectopic expression of Hel-N1, an RNA-binding proteinincreases glucose transporter (GLUT-1) expression in 3T3-L1 adipocytMol. Cell. Biol. 17, 954-962.

Jans, D. A. (1995). The regulation of protein transport to the nucleus bphosphorylation. Biochem. J.311, 705-716.

Jong, A. Y., Wang, B. and Zhang, S. Q.(1995). Pulsed field gelelectrophoresis labeling method to study the pattern of Saccharomycerevisiae chromosomal DNA synthesis during the G1/S phase of the cellcycle. Anal. Biochem.227, 32-39.

June, C. H., Ledbetter, J. A., Gillespie, M., Lindsten, T. and Thompson,C. B. (1987). T-cell proliferation involving the CD28 pathway is associatewith cyclosporine-resistant interleukin 2 gene expression. Mol. Cell. Biol.7, 4472-4481.

Katz, D. A., Theodorakis, N. G., Cleveland, D. W., Lindsten, T. andThompson, C. B. (1994). AU-A, an RNA-binding activity distinct fromhnRNP A1, is selective for AUUUA repeats and shuttles between tnucleus and the cytoplasm. Nucl. Acids Res.22, 238-246.

King, P. H., Levine, T. D., Fremeau, R. T., Jr. and Keene, J. D.(1994).Mammalian homologs of Drosophila ELAV localized to a neuronal subscan bind in vitro to the 3′UTR of mRNA encoding the Id transcriptionalrepressor. J. Neurosci.14, 1943-1952.

3156

old

sus

1g

is

inith

f

s

U. Atasoy and others

Lee, D., Staats, H. F., Sundy, J. D., Patel, D., Sempowski, G. D., ScearcR. M., Jones, D. M. and Haynes, B. F.(1998). Immunologiccharacterization of CD7-deficient mice. J. Immunol., 160, 5749-5756.

Levine, T. D., Gao, F., King, P. H., Andrews, L. G. and Keene, J. D.(1993).Hel-N1: an autoimmune RNA-binding protein with specificity for 3′uridylate-rich untranslated regions of growth factor mRNAs. Mol. Cell. Biol.13, 3494-3504.

Levy, N. S., Chung, S., Furneaux, H. and Levy, A. P.(1998). Hypoxicstabilization of vascular endothelial growth factor mRNA by the RNAbinding protein HuR. J. Biol. Chem.273, 6417-6423.

Lindsten, T., June, C. H., Ledbetter, J. A., Stella, G. and Thompson, C. B.(1989). Regulation of lymphokine messenger RNA stability by a surfacmediated T cell activation pathway. Science244, 339-343.

Ma, W. J., Cheng, S., Campbell, C., Wright, A. and Furneaux, H.(1996).Cloning and characterization of HuR, a ubiquitously expressed Elav-lprotein. J. Biol. Chem.271, 8144-8151.

Maity, A., McKenna, W. G. and Muschel, R. J.(1995). Evidence for post-transcriptional regulation of cyclin B1 mRNA in the cell cycle and followinirradiation in HeLa cells. EMBO J.14, 603-609.

Maity, A., McKenna, W. G. and Muschel, R. J.(1997). Cyclin A messagestability varies with cell cycle. Cell Growth Differ.8, 311-318.

Myer, V. E., Fan, X. C. and Steitz, J. A.(1997). Identification of HuR as aprotein implicated in AUUUA-mediated mRNA decay. EMBO J.16, 2130-2139.

Noel, P. J., Boise, L. H., Green, J. M. and Thompson, C. B.(1996). CD28costimulation prevents cell death during primary T cell activation. J.Immunol.157, 636-642.

Okano, H. J. and Darnell, R. B.(1997). A hierarchy of Hu RNA bindingproteins in developing and adult neurons. J. Neurosci.17, 3024-3037.

Peng, S.-Y. S., Chen, C.-Y. A., Xu, N. and Shyu, A.-B.(1998). RNAstabilization by the AU-rich element binding protein, HuR, an ELAVprotein. EMBO J.17, 3461-3470.

Pinol-Roma, S. and Dreyfuss, G.(1991). Transcription-dependent andtranscription-independent nuclear transport of hnRNP proteins. Science253,312-314.

Pinol-Roma, S. and Dreyfuss, G.(1992). Shuttling of pre-mRNA bindingproteins between nucleus and cytoplasm. Nature355, 730-732.

Query, C., Bentley, R. C. and Keene, J. D.(1989). A common RNArecognition motif identified within a defined U1 RNA binding domain othe 70K U1 snRNP protein. Cell 57, 89-101.

Ravnik, S. E. and Wolgemuth, D. J.(1996). The developmentally restrictedpattern of expression in the male germ line of a murine cyclin A, cyclin Asuggests roles in both mitotic and meiotic cell cycles. Dev. Biol.173, 69-78.

e,

-

e-

ike

g

f

2,

Richter, J. D. (1996). Dynamics of poly(A) addition and removal duringdevelopment. In Translational Control(ed. J. W. B. Hershey, M. Mathewsand N. Sonenberg), pp. 481-503. Cold Spring Harbor Laboratory Press, CSpring Harbor, NY.

Robinow, S., Campos, A. R., Yao, K. M. and White, K.(1988). The elavgene product of Drosophila, required in neurons, has three RNP consenmotifs. Science242, 1570-1572.

Robinow, S. and White, K.(1991). Characterization and spatial distributionof the ELAV protein during Drosophila melanogaster development. J.Neurobiol.22, 443-461.

Romac, J. M., Graff, D. H. and Keene, J. D.(1994). The U1 small nuclearribonucleoprotein (snRNP) 70K protein is transported independently of UsnRNP particles via a nuclear localization signal in the RNA-bindindomain. Mol. Cell. Biol.14, 4662-4670.

Szabo, A., Dalmau, J., Manley, G., Rosenfeld, M., Wong, E., Henson, J.,Posner, J. B. and Furneaux, H. M.(1991). HuD, a paraneoplasticencephalomyelitis antigen, contains RNA-binding domains and homologous to elav and sex-lethal. Cell 67, 629-639.

Thompson, C. B., Lindsten, T., Ledbetter, J. A., Kunkel, S. L., Young, H.A., Emerson, S. G., Leiden, J. M. and June, C. H.(1989). CD28 activationpathway regulates the production of multiple T-cell-derivedlymphokines/cytokines. Proc. Nat. Acad. Sci. USA 86, 1333-1337.

Umlauf, S. W., Beverly, B., Lantz, O. and Schwartz, R. H.(1995).Regulation of interleukin 2 gene expression by CD28 costimulation mouse T-cell clones: both nuclear and cytoplasmic RNAs are regulated wcomplex kinetics. Mol. Cell. Biol.15, 3197-3205.

Vakalopoulou, E., Schaack, J. and Shenk, T.(1991). A 32-kilodalton proteinbinds to AU-rich domains in the 3′ untranslated regions of rapidly degradedmRNAs. Mol. Cell. Biol.11, 3355-3364.

Wakamatsu, Y. and Weston, J. A.(1997). Sequential expression and role oHu RNA-binding proteins during neurogenesis. Development124, 3449-3460.

Weinberg, R. A. and Penman, S.(1968). Small molecular weightmonodisperse nuclear RNA. J. Mol. Biol.38, 289-304.

Wen, W., Meinkoth, J. L., Tsien, R. Y. and Taylor, S. S.(1995).Identification of a signal for rapid export of proteins from the nucleus. Cell82, 463-473.

Wu, L., Good, P. J. and Richter, J. D.(1997). The 36-Kilodalton Embryonic-Type Cytoplasmic Polyadenylation Element-Binding Protein in Xenopulaevis is ElrA, a Member of the ELAV Family of RNA-Binding Proteins.Mol. Cell. Biol.17, 6402-6409.

Zinszner, H., Sok, J., Immanuel, D., Yin, Y. and Ron, D.(1997). TLS (FUS)binds RNA in vivo and engages in nucleo-cytoplasmic shuttling. J. Cell Sci.110, 1741-1750.