effects of saponin fractions from fenugreek (trigonella ...s/stadtlander.pdfeffects of saponin...

$: Effects of saponin fractions from Fenugreek (Trigonella ...s/Stadtlander.pdfEffects of saponin fractions from. Fenugreek (Trigonella foenum-graecum) and the desert date (Balanites$
Effects of saponin fractions fromFenugreek (Trigonella foenum-graecum) and

the desert date (Balanites aegyptiaca)in diets for Nile tilapia

T. Stadtlander, W. K. B. Khalil, B. Levavi-Sivan, H. Dweik,M. Qutob, S. Abu-Lafi, Z. Kerem, U. Focken and K. Becker

Aquaculture Systems and Animal Nutrition

BackgroundSaponins - introduction

Saponins are secondary plant compounds, present in many plant ordersand species but also in some marine invertebrates

They act soap-like in water by forming stable foams

They consist of a lipophilic part called sapogenin and one or more hydrophilicsugar side chains

Chemically divided in triterpenoidal and steroidal saponins according to thestructure of their sapogenin

Present in many plant derived alternate protein sources and animal feedstuffs

Based on the great variability of their structure many saponins with differentproperties exist

Generally known for their hemolytic effects and for being piscicidals


BackgroundSaponins - antinutrients

Effect of saponins in fish Reference

Damaging the respiratory epithelia

Increased oxygen consumption, RBC, hemoglobin and haematocrit levels

Active components in traditionally used fish poisons

Intestinal mucosa damaged at >1500 ppm in rainbow trout and chinook salmon

No negative effects of saponins in diet of Atlantic salmon; ethanol extract of soybean meal caused growth retardation

Roy et al. 1990

Roy & Munshi 1989

Francis et al. 2001a

Bureau et al. 1989

Krogdahl et al. 1995

Francis et al. 2002a


BackgroundPrevious studies on carp and Nile tilapia

Species Saponin source: Quillaja saponaria Reference

Carp

-Saponin supplementation with 150 ppm led to highest mass gain

-Supplementation with 150 ppm resulted in significantly increased MGR, FCE, PPV and ALC

Francis et al. 2002b

Francis et al. 2002c

Tilapia

-Fish supplemented with 300 ppm saponinsshowed highest total mass gain-During first 3 weeks the 150 ppm group grew faster

-Maximum growth achieved at 150 ppmsupplementation

-No reproduction in tilapia fed with 2000 ppmQuillaja saponins

Francis et al. 2001b

Francis et al. 2002d

Steinbronn et al. 2004


BackgroundHypothesis

Balanites aegyptiaca and Trigonella foenum-graecum are rich in saponins(Marker et al. 1947, Dawidar and Fayez 1969, Hosny et al. 1992,Kamel 1998, Murakami et al. 2000) and common in the middle east

T. foenum-graecum contains at least 19 different saponins (Murakami et al. 2000)fractionation of saponins by flash-chromatography

EU prohibits from 01.01.2006 the administration of sub-therapeuthic levels ofanti-biotics as growth promoters in fish (EC|1831|2003)

ObjectiveTo test saponin fractions from two candidate plants as possible

growth promoters in Nile tilapia, Oreochromis niloticus

To test whether their effects can be linked to molecular parameterslike expression of growth related genes (growth hormone, GH

and insulin-like growth factor-1, IGF-1)


Material & MethodsSaponin extraction

Material was ground, dried, defatted (Soxhlet, hexane), ethanol (70% v/v)centrifuged and supernatant filtered

Filtrate was purified by flash chromatography (CombiFlash RETRIEVE,Teledyne Isco, Lincoln, NE )


Material & MethodsSaponin concentration & proximatecomposition in the diets

DietSaponin eluate/fraction

60% Trigonella 80% Trigonella 80% Balanites

Control

60TS300 300 mg kg-1

60TS600 600 mg kg-1

80TS300 300 mg kg-1

80BA300 300 mg kg-1

Proximate composition of the fish meal based diets (g kg-1 DM)

crude protein crude lipids crude ash gross energy(MJ kg-1 DM)

419 126 119 20.8


Material & MethodsExperimental design

20 male Nile tilapia (19.0 g ± 0.5, mean ± SD) divided in two groups5 initially slaughtered, 15 experimental fish

Fully automated respirometric system (Focken et al. 1994) with 15 chambers

Water flow was set to 0.3 L min-1

Water temperature was kept at 27°C

5 treatments with 3 replicates each

Feed ration was 4x energy maintenance requirement (3.5 g kg-0.8 day-1)and the total feed ration (14 g kg-0.8 day-1) fed 4x day-1

with automatic feeders

Light cycle was 12 h D : 12 h L

Water quality was kept in optimum range for tilapia(NH4-N < 0.5 mg L-1, NO2

--N < 0.1 mg L-1, NO3--N < 40 mg L-1)


Material & MethodsExperimental design and sampling

The fish were weighed weekly and the new feed rationcalculated accordingly

Experimental period: 8 weeks

At the end fish anaesthetized with MS 222 and

fish killed by decapitation

brain including pituitary, liver and muscle samples takenand stored on liquid nitrogen

Expression of growth hormone (GH), GH receptors 1 and 2, insulin-like growth factor-1 (IGF-1) and IGF-1 receptors a and b

Proximate composition analysis, growth, nutrient utilization andmetabolic parameters


ResultsGrowth and nutrient utilization

Control 60TS300 60TS600 80TS300 80BA300

BMG (g) 32.8 ± 6.03 35.1 ± 6.38 25.6 ± 2.41 27.0 ± 5.09 27.2 ± 2.98

SGR (% day-1) 1.75 ± 0.19 1.85 ± 0.23 1.54 ± 0.11 1.56 ± 0.22 1.58 ± 0.11

FCR 1.13 ± 0.13 1.12 ± 0.17 1.33 ± 0.09 1.35 ± 0.22 1.31 ± 0.10

PPV (%) 34.4 ± 3.33 34.7 ± 4.29 29.5 ± 1.31 28.6 ± 3.16 30.0 ± 1.98

ER (%) 30.5 ± 2.85 30.0 ± 3.45 23.6 ± 2.04 23.9 ± 1.66 24.2 ± 1.23

O2C/CP 2.61 ± 0.13 2.36 ± 0.26 4.34 ± 1.30 3.45 ± 0.74 3.00 ± 0.23

BMG = body mass gain, SGR = specific growth rate (% day-1), FCR = feed conversion ratio,PPV = protein productive value, ER = energy retentionO2C/CP = oxygen consumption (g) / protein accretion (g)

Values = mean ± SEM, N = 3


ResultsOxygen consumption

RMR = routine metabolic rate Values = mean ± SEM, N = 3


ResultsGH and receptor gene expression

Values show expression relative to beta-Actin

Values = mean ± SDN = 3* = p < 0.05


ResultsIGF-1 and receptor gene expression

Values show expression relative to beta-Actin

Values = mean ± SDN = 3* = p < 0.05


Conclusion

Numerically but statistically insignificant higher body mass gains of fish fed60TS300

High expression levels of GH and IGF-1 significantly correlate with growthand nutrient utilization

Fish fed other saponin fractions tended to have inferior performance

Individual fish seemingly cope differently with higher concentrations of 60TS

The tested saponins in the applied concentrations are not suited as growthpromoter for tilapia except 60TS300 where research should beintensified and up scaled


Thank you for your attention


Acknowledgements

We wish to thank the DFG (German Research Foundation)for their financial support

and Beatrix Fischer, Herrmann Baumgärtner and Dominique Lorenzfor their assistance in the analytical lab-work

Furthermore we want to acknowledge the critical reading of the manuscript and presentation by Dr. Peter Lawrence


PCR-ProtocolPrimers

Gene Primer sequence (5’–3’)a Sequence references

GHF: GAA CTG ATG CCA GCC ATG A Ber and Daniel (1992)

R: AGC TAC AGA GTG CAG TTT G

GHR-1F: CCA TCA GAT GAG CAA CTT CTG AAA AGT Jiao et al. (2006)

R: ACT TCC TGG TGA ATC AGC CTT A

GHR-2F: CAC AGA CTT CTA CGC TCA GGT CA Kajimura et al. (2004)

R: TGA GTT GCT GTC CAG GAG ACA

IGF-1F: GTC TGT GGA GAG CGA GGC TTT Schmid et al. (2003)

R: AAC CTT GGG TGC TCT TGG CAT G

IGF-1 Ra

F: CTAAGGGCGTGGTTAAGCAC Greene and Chen (1999)

R: TTGTTGGCGTTGAGGTATGC

IGF-1 Rb

F: AGG GAC GAG CCA GAG ACG Greene and Chen (1999)

R:TTC AGA GGA GGG AGG TTG

β-actin F: GTG ATG TGA CGC TGG ACC AAT C Hwang et al. (2003)

R: CCA TGT CAT CCC AGT TGG TCA CAA T


PCR-Protocol

Cycler: Bio-Rad iQ5

25 µl reaction mixture12.5 µl 1x SYBR® Premix Ex TaqTM6.5 µl DEPC-water5 µl cDNA template0.5 µl sense + antisense primer each

1st step: 95.0 C, 3 min.2nd step: 50x

95.0 C, 15 s60.0 C 30 s72.0 C 30 s

3rd step: 71x60.0 C with 0.5 C increase every 10 s to 95.0 C

Melting curve analysis (95.0 C)


BackgroundSaponins

Protodioscin, steroidal saponinGenera Tribulus, Trigonella, Dioscorea

OH

H HH

OH

O

H

Diosgenin, steroidal sapogeninPrecursor for progesterone

Glycyrrhizin, triterpenoid saponinGenus Glycyrrhiza

O

H

H

H

OH

OHO

Glycyrrhetinic acid, triterpenoid sapogeninFlavorant and expectorant

Most important plant orders: Liliales (46 species), Fabales (42), Apiales (26)(Vincken et al. 2007)


BackgroundCalculations

Metabolic Body Mass (MBM (kg0.8) (Live body mass (g) / 1000)0.8

Specific Growth Rate (SGR (% day-1)) 100 x [(ln final mass - ln initial mass) / daysof experiment]

Routine Metabolic Rate (RMR) mean oxygen consumption in 24 h(mg) / metabolic body mass (kg0.8) x 24

Protein Productive Value (PPV) Total protein gain (g) x 100 / total proteinfed (g)

Feed Conversion Ratio (FCR) Feed consumption (dry matter) / livebody mass gain (g)

ER (% of GE fed) ER (kJ) x 100 / Feed energy intake (kJ)


Literature

Ber R and Daniel V; 1992. Structure and sequence of the growth hormone-encoding gene from Tilapia nilotica.Gene, 113: 245-250

Bureau DP, Harris AM and Cho CY, 1989. The effects of purified alcohol extracts from soy products on feed intakeand growth of chinook salmon (Oncorhynchus tshawytscha) and rainbow trout (Oncorhyncus mykiss).Aquaculture 161, 27-43

Dawidar A.A.M. and Fayez M.B.E., 1969. Steroid sapogenins-XIII. The constituents of Balanites aegyptiaca.Phytochemistry 8, 261-265

Focken U., Schiller M., Becker K., 1994. A computer-controlled system for the continuous determination of metabolicrates of fish. In: Kestemont, P., Muir, J., Sevilla, F., Willot, P. (Eds). Measures of Success: Contributions presented atthe International Conference Bordeaux Aquaculture 1994. CEMAGREF edition, Antony, France, pp. 167–171.

Francis G, Makkar HPS and Becker K.; 2001a: Antinutritional factors present in plant-derived alternate fish feedIngredients and their effects in fish

Francis G, Makkar HPS and Becker K; 2001b: Effects of Quillaja saponins on growth, metabolism, egg production andmuscle cholesterol in individually reared Nile tilapia (Oreochromis niloticus). Comparative Biochemistry andPhysiology C 129, 105-114

Francis G, Makkar HPS Kerem Z and Becker K; 2002a: The biological action of saponins: a review. British Journal ofNutrition 88, 587-605

Francis G, Makkar HPS and Becker K; 2002b: Dietary supplementation with a Quillaja saponin mixture improves growthperfromance and metabolic efficiency in common carp (Cyprinus carpio L.). Aquaculture 203, 311-320

Francis G, Makkar HPS and Becker K; 2002c: Effects of cyclic and regular feeding of a Quillaja saponin supplementeddiet on growth and metabolism of common carp (Cyprinus carpio L.). Fish Physiology and Biochemistry 24, 343-350


Literature

Francis G, Levavi-Sivan B, Avitan A and Becker K; 2002d: Effects of long term feeding of Quillaja saponins on sex ratio,muscle and serum cholesterol and LH levels in Nile tilapia (Oreochromis niloticus (L.)). Comparative Biochemistry andPhysiology C 133, 593-603

Greene M.W. and Chen T.T., 1999. Characterization of teleost insulin receptor family members. II. Developmentalexpression of insulin-like growth factor type I receptor messenger RNAs in rainbow trout. General andComparative Endocrinology 115, 270-281

Hosny M., Khalifa T., Çaliş İ., Wright A.D. and Sticher O., 1992. Balanitoside, a furostanol glycoside, and6-methyl-diosgenin from Balanites aegyptiaca. Phytochemistry 31 (10), 3565-3569

Hwang G.L., Azizur Rahman M., Abdul Razak S., Sohm F., Farahmand H., Smith A., Brooks C. and Maclean N., 2003.Isolation and characterisation of tilapia beta-actin promoter and comparison of its activity with carp beta-actinpromoter. Biochim Biophys Acta 1625, 11-18

Jiao B., Huang X., Chan C.B., Zhang L., Wang D. and Cheng C.H. 2006. The co-existence of two growthhormone receptors in teleost fish and their differential signal transduction, tissue distribution and hormonalregulation of expression in seabream. Journal of Molecular Endocrinology 36, 23-40

Kajimura S., Kawaguchi N., Kaneko T., Kawazoe I., Hirano T., Visitacion N., Grau E.G. and Aida K., 2004. Identificationof the growth hormone receptor in an advanced teleost, the tilapia (Oreochromis mossambicus) with specialreference to its distinct expression pattern in the ovary. Journal of Endocrinology 181, 65-76

Kamel M.S., 1998. A furostanol saponin from fruits of Balanites aegyptiaca. Phytochemistry 48 (4), 755-757


Literature

Krogdahl A, Roem A and Baeverfjord G, 1995. Effects of soybean saponins, raffinose and soybean alcohol extracton nutrient digestibilities, growth and intestinal morphology in Atlantic salmon. In: Svennevig N, Krogdahl A (eds.),Quality in aquaculture. Proc. Intl. Conf. Aquaculture ’95 and the satellite meeting Nutrition and Feeding of Cold WaterSpecies, Trondheim, Norway, August 9-12, 1995. Eur. Aquacult. Soc. Spec. Publ. No. 23, Gent, Belgium, pp 118-119

Marker R.E., Wagner R.B., Ulshafer P.R., Wittbecker E.L., Goldsmith D.P.J. and Ruof C.H., 1947. New sources forsapogenins. Journal of the American Chemical Society 69 (9), 2242

Murakami T., Hishi A., Matsuda H., Yoshikawa M., 2000. Medicinal Foodstuffs XVII. Fenugreek Seed. (3): Structuresof new furostanol-type steroid saponins, Trigoneosides Xa, Xb, Xib, XII a, XIIb and XIIIa from the seeds of EgyptianTrigonella foenum-graecum L. Chemical & Pharmaceutical Bulletin 48 (7), 994-1000

Naylor, R. L., Hardy, R.W., Bureau, D.P., Chiu, A., Elliott, M., Farrell, A.P., Forster, I., Gatlin, D.M., Goldburg, R.J., Hua,K. & Nichols, P.D., 2009. Feeding aquaculture in an era of finite resources. P. Natl. Acad. Sci. USA, 106, 15103-15110

Roy PK and Munshi JD, 1989. Effect of saponin extracts on oxygen uptake and haematology of an air-breathingClimbing üerch, Anabas testudineus (Bloch). Journal of Freshwater Biology 1, 167-172

Roy PK, Munshi JD and Dutta HM, 1990. Effect of saponin extracts on morpho-history and respiratory physiologyof an air-breathing fish, Heteropneustes fossilis (Bloch). Journal of Freshwater Biology 2, 135-145

Schmid, A.C., Lutz, I., Kloas, W., Reinecke, M., 2003. Thyroid hormone stimulates hepatic IGF-I mRNA expressionin a bony fish, the tilapia Oreochromis mossambicus, in vitro and in vivo. General and Comparative Endocrinology130, 129-134

Steinbronn S, Hossain A, Francis G, Focken U and Becker K, 2004. Presented at the 7th Asian Fisheries Forum, Penang,Malaysia November 2004

Vincken, J.-P., Heng, L., de Groot, A. & Gruppen, H., 2007. Saponins, classification and occurrence in the plant kingdom.Phytochemistry 68, 275-297

effects of saponin fractions from fenugreek (trigonella ...s/stadtlander.pdfeffects of saponin...

Documents