effect of a synbiotic yogurt on levels of fecal bifidobacteria ... · 8 amrita palaria , ivy...

Effect Of A Synbiotic Yogurt On Levels Of Fecal Bifidobacteria, 1

Clostridia And Enterobacteria 2

3

4

Running title: Synbiotic yogurt feeding study 5

6

7

Amrita Palaria†, Ivy Johnson-Kanda and Daniel J. O’Sullivan* 8

9

Department of Food Science and Nutrition, Center for Microbial and Plant Genomics, 10

University of Minnesota, 1500 Gortner Ave., St. Paul, MN 55108, USA. 11

12

13

* Corresponding author. Mailing address: Department of Food Science 14

and Nutrition, Microbial and Plant Genomics Institute, University of Minnesota, 1500 15

Gortner Ave., St. Paul, MN 55108. Phone: (612) 624-5335. Fax: (612) 625-5272. E-mail: 16

[email protected] 17

18

† Present address: Kerry Ingredients Inc., Beloit, WI 53511, USA 19

20

21

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.05848-11 AEM Accepts, published online ahead of print on 18 November 2011

on March 4, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Abstract 22 23

While ingestion of synbiotic yogurts containing Bifidobacterium animalis subsp. lactis 24

and inulin are increasing, their effect on certain microbial groups in the human intestine 25

is unclear. To further investigate this, a large-scale, cross-over design, placebo controlled 26

study was utilized to evaluate the effect of a synbiotic yogurt containing B. animalis 27

subsp. lactis Bb-12 and inulin on the human intestinal bifidobacteria, clostridia, and 28

enterobacteria. Fecal samples were collected at 14 timepoints from 46 volunteers that 29

completed the study and changes in the intestinal bacteria were monitored using real-time 30

PCR. Strain Bb-12 could not be detected in feces after two weeks of washout. A 31

live/dead PCR procedure indicated that the strain Bb-12 detected in the fecal samples was 32

alive. A significant increase (P < 0.001) in the total bifidobacterial numbers was seen in 33

both groups of subjects during the final washout period compared to the prefeeding 34

period. This increase in total bifidobacteria corresponded with a significant decrease (P < 35

0.05) in clostridia, but not in enterobacteria. No significant differences in bifidobacteria, 36

clostridia or enterobacteria were observed between the probiotic and placebo groups 37

during any of the feeding periods. However, subgrouping subjects based on lower initial 38

bifidobacteria numbers or higher initial clostridia numbers did show corresponding 39

significant differences between synbiotic yogurt and placebo groups. This was not 40

observed for a subgroup with higher initial enterobacteria numbers. While this synbiotic 41

yogurt can increase bifidobacteria and decrease clostridia (but not enterobacteria) in some 42

individuals, it cannot modulate these microbial groups in the majority of individuals. 43

44


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

INTRODUCTION 45

46

The human large intestine is host to a wide variety of bacteria, with bifidobacteria 47

being prominent members of this complex ecosystem. These are rod shaped (often 48

irregular) gram positive, anaerobic, non-spore formers that utilize glucose via a pathway 49

that involves a diagnostic enzyme, fructose-6-phosphate phospho ketolase (F6PPK). As 50

bifidobacteria are generally believed to contribute to good intestinal health, attempts have 51

been made to increase their numbers in the intestine by including them in certain foods as 52

probiotics. Frequently they are included in yogurts together with prebiotics, such as inulin 53

or fructooligosaccharides, the combination of which can be referred to as a synbiotic 54

yogurt. Bifidobacteria are implicated in the prevention and treatment of diarrhea, 55

development and maintenance of a healthy microbiota in low weight preterm infants and 56

stimulation of certain immune responses (25, 28). It is believed that counts of 57

bifidobacteria begin to decline during old age coinciding with a proliferation of other 58

bacterial groups, including clostridia and members of the Enterobacteriaceae family (11, 59

25, 43). Consequently, increasing bifidobacteria counts may be advantageous to 60

controlling the proliferation of certain undesirable bacteria. 61

62

Clostridia are toxin producers and have been implicated in many intestinal 63

ailments such as nosocomial diarrhea, antibiotic associated diarrhea, necrotizing 64

enterocolitis, and gastrointestinal infections (5). The genus Clostridium substantially 65

consists of about 140 different species. It has been divided into 19 clusters based on the 66

phylogenetic analysis of the 16S rRNA gene. Cluster I is the largest cluster consisting of 67


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

most of the pathogenic species of Clostridium, including C. tetani, C. botulinum, and C. 68

perfringens (41). Gastrointestinal diseases caused by clostridia are mostly a result of an 69

imbalanced gut microbiota, which disrupts the protective effects of the GI flora (21). This 70

imbalance can be precipitated by antibiotic treatment, stress, immuno-compromization 71

and old age (reviewed in references 6 and 10). 72

73

Escherichia species such as E. coli belong to the family Enterobacteriaceae and 74

are normal inhabitants of human and animal guts. They are gram-negative, rod-shaped, 75

facultative anaerobes with excellant survival ouside the gut and they are frequently 76

utilized as indicators of fecal comtamination. While most E. coli strains are non-77

pathogenic, commensal bacteria, certain strains, are harmful and opportunistic due to the 78

presence of virulence factors which support their ability to induce infection (15, 16). The 79

most recognized of these strains are the enterohemorrhagic E. coli (EHEC) due to the 80

prevalence of E. coli O157:H7 in food borne disease outbreaks (16, 27). While it has 81

been proposed that a low level of comensal strains may be beneficial (35), their role is 82

undefined thus there is an increasing interest in the role of the intestinal microbiota in 83

maintaining overall and GI health (8, 9). 84

85

While there is no legal definition for probiotics in the US, they are generally 86

referred to as live microbial feed supplements which when ingested in sufficient amounts 87

can affect the host beneficially (29). Bifidobacteria are widely used as probiotics in 88

foods. B. animalis is the most common species used in foods as it has the highest 89

tolerance to oxygen and acids. The continued adaptation of this species to the fermented 90


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

dairy environment resulted in the evolution of a newly adapted bacterium that was 91

initially classified as a new species, B. lactis (24). However, owing to very close genetic 92

similarities with B. animalis, it was accepted as a subspecies of B. animalis (4). B. 93

animalis subsp lactis strain Bb-12 is a common commercial probiotic used in foods and is 94

exclusively supplied by Chr Hansen Inc., a worldwide supplier of fermentation cultures. 95

Studies on Bb-12 ingestion have shown it to have many potential health benefits. These 96

include maintaining the intestinal microbial balance (reviewed in reference 32), diarrhea 97

prevention (37), stimulation of the phagocytic activity in peripheral blood samples (38) 98

and treatment of atopic eczema in infants (14). However, given small subject numbers 99

and limitations of culturing methods, further studies are needed to evaluate the effect of 100

this widely used probiotic culture on the intestinal microbiota. The purpose of this study 101

was to examine the effects of a yogurt supplemented with inulin and ~ 109 – 1010 102

cfu/serving of strain Bb-12 consumed daily by a large number of healthy subjects on the 103

intestinal bifidobacteria, clostridia and enterobacteria numbers using a probe based real-104

time PCR approach. 105


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

MATERIALS AND METHODS 106

107

Bacteria and culture conditions. Bifidobacterium animalis subsp. lactis Bb-12 108

(Chr. Hansen Inc., Horsholm, Denmark), B. longum strain DJO10A (13, 19), Clostridium 109

perfringens (Diez laboratory, University of Minneosta) and E. coli (Invitrogen, Carlsbad, 110

California) were used in this study. E. coli and B. longum strain DJO10A were used as 111

negative controls for strain Bb-12 specific Taqman real-time PCR. All cultures were 112

streaked on agar plates: Strains Bb-12 and DJO10A on BIM-25 (26); C. perfringens on 113

RCM (Reinforced Clostridial Medium) (2); and E. coli on LB. Strains Bb-12 and 114

DJO10A were cultured anaerobically in broth cultures using BLIM + Fe (13) at 37ºC for 115

48 hrs, C. perfringens was cultured anaerobically in RCM at 37ºC for 24 hrs anaerobic 116

jars and E. coli was cultured aerobically in LB medium at 37ºC overnight. 117

118

Human subjects, study design and sample collection. Prior to initiating the 119

study, approval for the study design was obtained from the Institutional Review Board 120

(IRB) of the University of Minnesota. Fifty-two healthy volunteers participated in this 121

study, with 46 of them completing it. The average age, height and weight of these 46 122

subjects was 31, 5’6’’ and 155 lbs respectively. The detailed demographic data are 123

presented in Table 1. The inclusion criteria for this study were that subjects were adults 124

with no known allergies or intolerance to dairy foods and had not consumed foods 125

containing bifidobacteria for at least 2 months prior to the start of the study. To determine 126

this latter criterium, subjects were specifically asked if they had consumed any dairy 127

products that had the term ‘bifidus’, ‘bifidobacteria’, or any word beginning with ‘bifid’ 128


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

on its label.. Subjects were asked to maintain their usual diet during the study with no 129

intake of products containing bifidobacteria with the exception of what was given to 130

them. The subjects were randomly assigned to two groups A and B with 26 subjects in 131

each. However, only 46 of the total subjects completed the study. Consequently, group A 132

finished with 24 subjects and group B with 22 subjects. 133

134

The study was a double blind, crossover, placebo-controlled, randomized feeding 135

trial. It was divided into five consecutive periods: a prefeeding period (1 week), followed 136

by a feeding period (3 weeks), a washout period (4 weeks), a second feeding period (3 137

weeks) and a final washout period (4 weeks). The prefeeding period was a control period 138

and the subjects were not given any yogurt drink. Fecal samples were collected at the 139

start and at the end of the week. During the first feeding period, the subjects consumed 140

daily either 94 g of placebo, which consisted of milk acidified to pH 4.2 with lactic acid, 141

or 94 g of a drinkable yogurt containing 109 – 1010 cfu of strain Bb-12 and 1 g of inulin 142

per serving. The yogurt was prepared with skim milk and a standard yogurt starter blend 143

consisting of Streptococcus thermophilus and Lactobacillus bulgaricus, together with the 144

B. animalis subsp. lactis Bb-12 culture and had a final pH of 4.2. Both products were 145

flavored with sucrose and strawberry. The shelf life of the yogurt was set as the lower 146

level (109 cfu/serving) of strain BB-12, which was 50 days at 4°C. Fecal samples were 147

collected at the end of each of the three weeks. The subjects consumed neither the yogurt 148

nor the placebo during the subsequent washout period. Single fecal samples were 149

collected at the end of every two weeks. Participants were given 50ml Falcon tubes 150

containing 10 ml of sterile PBS buffer and a sterile plastic spoon and were asked to fill 151


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

the tube up to the 40 ml mark with feces from the midstream defecation period. The tubes 152

were mixed thoroughly and centrifuged to collect a fixed amount of pelleted stool. 153

During the second feeding period, there was a cross over of the feeding design. Again, 154

fecal samples were collected at the end of each of the three weeks. The final washout 155

period lasted for four weeks. Neither placebo nor probiotic yogurt was consumed. Fecal 156

samples were collected at the end of each week. In all 14 fecal samples were collected 157

from each subject. For every collection, ~ 5 g of feces was collected in 10 ml of 158

phosphate buffer (pH 7) and immediately frozen at - 20ºC. The study design and sample 159

collection strategy is depicted in Fig. 1. 160

161

DNA extraction. DNA was extracted from pure cultures using the Qiagen 162

MiniPrep DNA Extraction kit protocol with slight modifications. A 1 ml aliquot of 163

culture was centrifuged (1,350 rpm for 10 min in a Hermle Labnet Z 233 MK centrifuge 164

with rotor model C-0230-2A) to pellet down cells. The cells were resuspended in 340 μl 165

of ASL buffer and subjected to 95ºC for 5 min. Proteinase K and buffer AL were 166

subsequently added directly to the heat-treated cells in ASL buffer. The rest of the 167

Qiagen protocol was followed according to the manufacturer’s instructions. DNA was 168

extracted from feces using the Qiagen MiniPrep DNA extraction kit according to the 169

manufacturer’s instructions. The DNA was then quantified using a Nanodrop 170

Spectrophotometer and stored at - 20ºC. 171

172

Quantification of B. animalis subsp. lactis Bb-12 and total bifidobacteria in 173

feces using TaqMan real time PCR. Specific primers and TaqMan probes used for 174


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

amplification in TaqMan real time PCR are listed in Table 2. Probes were labeled with 175

the fluorescent dye, FAM and the quencher, TAMRA. Seven 10-fold dilutions with 176

known cell numbers (ranging from 102 to 109 cfu/ml) of strain Bb-12 were used to spike 177

fecal samples that were free of strain Bb-12 and the DNA extracted was used in real time 178

PCR to generate a standard curve for quantification of strain Bb-12. DNA from a pure 179

culture of bifidobacteria diluted to seven 10-fold dilutions with known cell numbers 180

(ranging from 102 to 109 cfu/ml) was also used as template in TaqMan real-time PCR to 181

generate standard curves for quantification of total bifidobacteria. 182

183

Quantification of clostridia and enterobacteria in feces using TaqMan real 184

time PCR. Specific primers and probes for Clostridium Cluster I and enterobacteria used 185

for amplification in real time PCR are given in Table 2. Probes were labeled with the 186

fluorescent dye, FAM and the quencher, BHQ. Seven 10-fold dilutions with known cell 187

numbers (ranging from 102 to 109 cfu/ml) of C. perfringens and E. coli were used to 188

extract DNA. These DNAs were then used as template in real time PCR to generate 189

standard curves for quantification of clostridia cluster I and enterobacteria. 190

191

Real time PCR. Real-time PCR amplifications were performed on an ABI 7500 192

real time PCR machine. Each reaction was carried out in duplicate in a volume of 25 μl 193

using 96-well optical grade ABI plates. The temperature settings for the different bacteria 194

were one cycle of 95ºC (10 min), 40 cycles of [95ºC (15 sec), 60ºC (1 min)] for strain 195

Bb-12; one cycle of 95ºC (10 min), 40 cycles of [95ºC (15 sec), 58ºC (1 min)] for total 196

bifidobacteria; one cycle of 95ºC (10 min), 45 cycles of [95ºC (15 sec), 63ºC (30 sec), 197


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

72ºC (45 sec)] for clostridia; and one cycle at 95°C (10 min), 45 cycles of [95°C (15 sec), 198

60°C (1 min)] for enterobacteria. The Ct (cycle at which the signal crosses a threshold) 199

values were plotted as a linear function of the base 10 logarithm of the number of 200

respective bacterial cells in the culture as determined by plate counts. These standard 201

curves were then used to quantify the fecal samples with unknown cell concentrations 202

collected during the study. Three negative controls consisting of no template and two non 203

target bacteria were used to validate the specificity of each real time PCR procedure. 204

205

Determination of live B. animalis subsp. lactis Bb-12 cells in feces. Ethidium 206

monoazide bromide (EMA) binds covalently to DNA upon exposure to light and has 207

been validated to differentiate between live and dead cells using PCR (36, 39). To 208

validate this procedure for strain Bb-12 in feces, a 1 ml aliquot of a fully grown culture 209

(8.3 x 108 cfu/ml) of strain Bb-12 was heat-killed at 100ºC for 10 min and incubated 210

overnight at 4ºC. Two 250 mg aliquots of feces with no detectable B. animalis subsp. 211

lactis were spiked with either 1 ml of dead or live cells. EMA (100 µg/ml) was added to 212

these samples and incubated in the dark at 4ºC for 1 hour. After incubation, the fecal 213

samples were placed on ice and exposed to 600 W of halogen light located at a distance 214

of 20 cm for 1 hour. The samples were then used to extract DNA for real time PCR. To 215

differentiate between live and dead cells in fecal samples collected during the study, 100 216

µg/ml of EMA was added to them and the fecal DNA isolation procedure outlined above 217

was repeated. 218

219


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

Statistical analysis. For statistical analysis SPSS software was used. Independent 220

sample T-tests were used for between-subject analysis. Paired-sample T-tests were used 221

for within-subject analysis. 222

223

224

225


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

RESULTS 226

227

Enumeration of Bifidobacterium animalis subsp. lactis Bb-12, total 228

bifidobacteria, clostridia and enterobacteria in feces. Standard curves were generated 229

by plotting real-time PCR Ct values obtained for each bacterial group against the initial 230

number of cells in the culture (Fig. 2). The curves were found to be linear, with R2 231

values > 0.98, over the range of 105 – 109 cfu/ml for total bifidobacteria (105 was 232

therefore taken as the limit of detection); 104 – 109 cfu/ml for strain Bb-12 (104 was taken 233

as the limit of detection); 102 – 107 cfu/ml for clostridia (102 was taken as the limit of 234

detection); 103 - 108 cfu/ml for enterobacteria (103 was taken as the limit of detection). 235

These curves were then applied to quantify the total intestinal bifidobacteria, clostridia 236

cluster I, enterobacteria and strain Bb-12 in the fecal samples collected from subjects 237

during the study. This revealed the variations in cell numbers of strain Bb-12, total 238

bifidobacteria, clostridia and enterobacteria in each subject over the study period. 239

240

Detection and viability of strain Bb-12 in feces. The Bb-12 primers did not 241

detect any B. animalis subsp. lactis in fecal samples collected during the prefeeding 242

period except for the first sample of one subject. As the second fecal sample was not 243

positive the subject was allowed to continue in the study. Strain Bb-12 was detected in 244

the feces of 70% of subjects while ingesting the supplemented yogurt, but in only 2 out of 245

22 subjects (9%) after one week of washout and none after two weeks. To evaluate 246

viability using a live/dead PCR approach, a control experiment with fecal samples spiked 247

with live or dead cells of strain Bb-12 validated the procedure. This procedure was 248


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

applied to 10 fecal samples that had tested positive for strain Bb-12 from 10 different 249

subjects and revealed that strain Bb-12 was alive in 8 out of the 10 samples, 250

substantiating its ability to survive gastric transit (Table 3). 251

252

Total bifidobacterial counts in fecal samples. Prior to the feeding trial, the total 253

bifidobacteria counts (as estimated by real time PCR) in individual stool samples ranged 254

from the detection limit of 5.0 log10 cfu/g to 9.0 log10 cfu/g, the mean bifidobacteria count 255

being 7.2 log10 cfu/g. During the two feeding periods, no statistically significant 256

difference was seen between the placebo and the probiotic groups. However, there was a 257

fluctuating increase in the bifidobacteria numbers within the two groups (Fig. 3). The 258

final washout period was marked with a significant increase in the bifidobacteria 259

population in both groups as compared to the prefeeding period (p < 0.001). However, a 260

subgroup of subjects who had bifidobacteria counts < 108 cfu/g in their feces during the 261

prefeeding period, harbored a significant increase (p < 0.001 for groupA and p = 0.06) 262

when injesting the synbiotic yogurt (Fig. 4). 263

264

Clostridial counts in fecal samples. The initial clostridial counts in fecal samples 265

were found to be 3.36 log10 cfu/g (the values ranged from the limit of detection, 2.0 log10 266

cfu/g to 5.0 log10 cfu/g). The only statistically significant difference in clostridia numbers 267

between the placebo and yogurt group occurred during the second feeding period (p < 268

0.05) (Fig. 5). However, within a group there was no reduction in comparison to the 269

prefeeding periods. There was a decrease in the clostridial numbers in the final washout 270

period when compared with the prefeeding levels in both groups. This reduction was not 271


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

statistically significant for the whole washout period but was significant for the final fecal 272

sample (p < 0.001 in group A and p < 0.05 in group B). This reduction was significant (p 273

< 0.05) for the whole final washout period when subjects were subgrouped on the basis 274

of high clostridia counts (> 3.5 log10 cfu/g) in the prefeeding period (Fig. 6). This 275

subgroup also exhibited a significant decrease in clostridia (p < 0.05) when injesting the 276

supplemented yogurt compared to their prefeeding levels, which was consistent with the 277

contamitant increase in total bifidobacteria numbers. 278

279

Enterobacteria counts in fecal samples. The initial Enterobacteria counts in 280

fecal samples were found to be 5.68 log10 cfu/g (the values ranged from 3.5 log10 cfu/g to 281

8.2 log10 cfu/g). There was no statistically significant decrease in Enterobacteria numbers 282

between the synbiotic yogurt and placebo groups, or between any group period and the 283

corresponding prefeeding period (Fig. 7). However, subjects with initial Enterobacteria 284

counts > 5.5 log10 cfu/g feces showed a decrease in mean Enterobacteria counts during 285

the feeding study and this decrease was statistically significant (p<0.001) for both groups 286

(Fig. 8). However, there were no significant differences between synbiotic yogurt and 287

placebo feeding periods even for this sub-grouping. 288

289

290


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

DISCUSSION 291

292

The impact of the intestinal microbial community on human health is currently an 293

expanding field of research. There is currently insufficient evidence to evaluate if 294

commonly used bifidobacteria, such as strains of B. animalis subsp. lactis, have a 295

modulatory impact on the intestinal microbiota. In this study, we evaluated the effect of 296

B. animalis subsp. lactis Bb-12 and inulin in a drinkable yogurt on the numbers of 297

intestinal bifidobacteria, clostridia and enterobacteria in 46 human volunteers. 298

299

As subjects were selected based on not having consumed yogurt type foods for 300

two months, their initial fecal samples were negative for any B. animalis subsp. lactis. 301

One subject’s initial fecal sample tested positive suggesting they unknowingly ingested it, 302

which has also been found in other studies (23, 30) and is plausible given the vast variety 303

of foods available harboring this culture. The percentage of subjects who tested positive 304

for strain Bb-12 during probiotic yogurt consumption in this study was consistent with 305

studies that used comparable levels of this strain (7). This is consistent with the 306

correlation between between dosage and subsequent recovery of this probiotic from fecal 307

samples (18). The rapid disappearance of Bb-12 from fecal samples following cessation 308

of feeding is consistent with other published clinical studies (7, 22). Some studies have 309

seen persistence in one or two subjects for a week or two longer (42). However, this may 310

be due to subject reliability, or inadvertently consuming other foods containing 311

bifidobacteria, rather than persistence. 312

313


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

While the use of real-time PCR to monitor the intestinal flora facilitates the use of 314

larger number of subjects, it is usually limited by lack of data on the viability of the 315

ingested culture. Some studies have included viable plate counts with real-time PCR (3). 316

To address this limitation without including viable plate counts, which would limit the 317

number of subjects that could be used as fresh feces would be needed for this, we utilized 318

a live/dead cell differentiation procedure to show that strain Bb-12 cells detected in feces 319

retained their viability. As this procedure was demonstrated in this study to differentiate 320

between live and dead cells of strain Bb-12 directly in feces, it indicated that the strain 321

Bb-12 cells were viable in the majority of subjects at the time of freezing the samples. 322

323

The average number of bifidobacteria in human feces in adults has been reported 324

to be ~ 7.5 log10 cfu/g (23, 38). This was consistent with the total bifidobacteria counts in 325

this study. Bifidobacteria numbers have been found to vary with age, with infants 326

normally harboring larger numbers (~ 1010 cfu/g of feces) (17, 31). Elderly people and 327

those suffering from bowel diseases such as cancer have been reported to have lower 328

numbers of bifidobacteria in their feces (33). In this study, older subjects (age > 50) were 329

found to have lower numbers of bifidobacteria in their pre-feeding fecal samples and 330

while the sample size is small it is consistent with this trend. Some studies have reported 331

an increase in bifidobacteria numbers during probiotic intake (23, 38). In our study, no 332

significant differences were observed between the synbiotic and the placebo groups 333

during yogurt consumption. This differs from another study using Bb-12, which did find 334

a difference (1). However, this study had a subject group of just 10 compared to 46 335

subjects in our study indicating the probability of greater inter-individual variability 336


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

between subjects in this study. When subjects were subdivided based on initial lower 337

bifidobacteria numbers, an increase in total bifidobacteria during probiotic yogurt 338

consumption became evident during yogurt feeding (Fig. 4). The increase of total 339

bifidobacteria in subjects with low starting numbers of bifidobacteria has been observed 340

previously (20, 22). Given the total numbers of fecal microbes were not estimated in any 341

of these studies, it cannot be ruled out if this is linked to the fluctuations observed. 342

343

A significant increase in bifidobacteria for all groups in the final washout period 344

was very evident and has not been seen in other studies. This significant increase in the 345

final washout period was not due to irregularities with the real time PCR quantification, 346

as subject participation was staggered and quantification of samples was conducted 347

randomly rather than sequentially. This may suggest that in a long probiotic feeding 348

study, such as this 15 week study, some subjects may be changing their overall eating 349

habits, given they are constantly cognizant of the association of fermented foods and a 350

favorable intestinal environment. This increase in bifidobacteria numbers corresponded 351

with a significant decrease in clostridia, but not in enterobacteria. The inverse correlation 352

between bifidobacteria and clostridia numbers has been observed previously in 353

bifidobacteria feeding studies (23, 33). 354

355

The overall conclusions that can be drawn from the study are that strain Bb-12 356

survived passage through the gastrointestinal tract, but did not persist in the gut. Total 357

bifidobacteria increased and clostridia (but not enterobacteria) decreased at the end of the 358

study for all subjects irrespective of when they consumed the synbiotic yogurt or placebo 359


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

(acifidied milk). This novel finding may reflect a general change of eating habits in 360

subjects over the course of a long probiotic feeding study. It was also evident that 361

subjects that had lower starting bifidobacteria levels or higher starting clostridia levels 362

benefited the most (by increasing total bifidobacteria or decreasing clostridia) from 363

injesting the supplemented yogurt. However, there were no significant differences in 364

enterobacteria numbers between synbiotic yogurt and placebo feeding periods even in the 365

subgroup of subjects that had higher initial levels of enterobacteria. These data would 366

therefore support that ingestion of this supplemented yogurt does not statistically 367

modulate enterobacteria numbers, but may modulate total bifidobacteria and clostridia in 368

people with either below average levels of bifidobacteria or above average levels of 369

clostridia. 370

371

372


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

ACKNOWLEDGEMENTS 373

This study was funded by General Mills Inc. We thank Ravi Menon and Maeve Murphy 374

for suggestions throughout the study. 375

376

377

378

379

380

381

382


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

REFERENCES 383

384

1. Alander, M., J. Matto, W. Kneifel, M. Johansson, B. Kogler, R. Crittenden, T. 385

Mattila-Sandholm, and M. Saarela. 2001. Effect of galacto-oligosaccharide 386

supplementation on human faecal microflora and on survival and persistence of 387

Bifidobacterium lactis Bb-12 in the gastrointestinal tract. Int. Dairy J. 11:817-825. 388

389

2. Barnes, E. M., and M. Ingram. 1956. The effect of redox potential on the grown 390

Clostridium welchii strain isolated from horse muscle. J. Appl. Bacteriol. 19:177-391

178. 392

393

3. Bartosch, S., E. J. Woodmansey, J. C. M. Paterson, M. E. T. McMurdo, and G. 394

T. Macfarlane. 2005. Microbiological effects of consuming a synbiotic containing 395

Bifidobacterium bifidum, Bifidobacterium lactis, and oligofructose in elderly 396

persons, determined by real time polymerase chain reaction and counting of viable 397

bacteria. Clin. Infect. Dis. 40:28-37. 398

399

4. Cai, Y. M., M. Matsumoto, and Y. Benno. 2000. Bifidobacterium lactis Meile et 400

al., 1997 is a subjective synonym of Bifidobacterium animalis (Mitsuoka 1969) 401

Scardovi and Trovatelli 1974. Microbiol. Immunol. 44:815-820. 402

403

5. Fallani, M., L. Rigotter-Gois, M. Auilera, C. Bridonneau, A. Collignon, C. A. 404

Edwards, G. Corthier, and J. Dore. 2006. Clostridium difficile and Clostridium 405


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

perfringens species detected in infant faecal microbiota using 16s rRNA targeted 406

probes. J. Microbiol. Methods. 67:150-161. 407

408

6. Fooks, L. J., and G. R. Gibson. 2002. Probiotics as modulators of the gut flora. 409

Br. J. Nutr. 88:S39-S49. 410

411

7. Fukushima, Y., Y. Kawata, H. Hara, A. Terada, and T. Mitsuoka. 1998. Effect 412

of a probiotic formula on intestinal immunoglobulin A production in healthy 413

children. Int. J. Food Micrbiol. 42:239-244. 414

415

8. Gibson, G. R., H. M. Probert, J. V. Loo, R. A. Rastall, and M. B. Roberfroid. 416

2004. Dietary modulation of the human colonic microbiota: updating the concept of 417

prebiotics. Nutr. Res. Rev. 17:259-275. 418

419

9. Gibson, G. R., and M. B. Roberfroid. 1995. Dietary modulation of the human 420

colonic microbiota: introducing the concept of prebiotics. J. Nutr. 125:1401-1412. 421

422

10. Hebuterne, X. 2003. Gut changes attributed to ageing: effects on intestinal 423

microflora. Curr. Opin. Clin. Nutr. Metab. Care. 6:49-54. 424

425

11. Hopkins, M. J., and G. T. MacFarlane. 2002. Changes in predominant bacterial 426

populations in human feces with age and with Clostridium difficile infection. J. 427

Med. Microbiol. 51:448-454. 428


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

429

12. Huijsdens, X. W., R. K. Linskens, M. T. Mak, S. G. M. Meuwissen, C. M. J. E. 430

Vandenbroucke-Grauls, and P. H. M. Savelkoul. 2002. Quantification of bacteria 431

adherent to gastrointestinal mucosa by real-time PCR. J. Clin. Microbiol. 40:4423-432

4427. 433

434

13. Islam, A. 2005. Iron reversible inhibition by bifidobacteria and microbial diversity 435

of the human intestine. p. 40 – 42. MS Thesis. University of Minnesota. 436

437

14. Isolauri, E., T. Arvola, Y. Sutas, E. Moilanen, and S. Salminen. 2000. Probiotics 438

in the management of atopic eczema. Clin. Exp. Allergy. 30:1604-1610. 439

440

15. Kaper, J. B., and M. A. Karmali. 2008. The continuing evolution of a bacterial 441

pathogen. Proceedings of the National Academy of Sciences of the United States of 442

America 105:4535-4536. 443

444

16. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichia coli. 445

Nat. Rev. Microbiol. 2:123-40. 446

447

17. Kirjavainen, P. V., T. Arvola, S. J. Salminen, and E. Isolauri. 2002. Aberrant 448

composition of gut microbiota of allergic infants: A target of bifidobacterial therapy 449

at weaning? Gut. 51:51-55. 450

451


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

18. Larsen, C. N., S. Nielsen, P. Kaestel, E. Brockmann, M. Bennedsen, H. R. 452

Christensen, D. C. Eskesen, B. L. Jacobsen, and K. F. Michaelsen. 2006. Dose-453

response study of probiotic bacteria Bifidobacterium animalis subsp lactis BB-12 454

and Lactobacillus paracasei subsp paracasei CRL-341 in healthy young adults. 455

Eur. J. Clin. Nutr. 60:1284-1293. 456

457

19. Lee, J. H., V. N. Karamychev, S. A. Kozyavkin, D. Mills, A. R. Pavlov, N. V. 458

Pavlova, N. N. Polouchine, P. M. Richardson, V. V. Shakhova, A. I. Slesarev, 459

B. Weimer, and D. J. O'Sullivan. 2008. Comparative genomic analysis of the gut 460

bacterium Bifidobacterium longum reveals loci susceptible to deletion during pure 461

culture growth. BMC Genomics 9:247-262. 462

463

20. Link-Amster, H., F. Rochat, K. Y. Saudan, O. Mignot, and J. M. Aeschlimann. 464

1994. Modulation of a specific humoral immune response and changes in intestinal 465

flora mediated through fermented milk intake. FEMS Immunol. Med. Microbiol. 466

10:55-63. 467

468

21. Lyerly, D. M., H. C. Krivan, and T. D. Wilkins. 1988. Clostridium difficile: Its 469

disease and toxins. Clin. Microbiol. Rev. 1:1-18. 470

471

22. Malinen, E., M. Jaana, S. Merja, A. Minna, S. Maria, and P. Airi. 2002. PCR-472

ELISA. II: Analysis of Bifidobacterium populations in human faecal samples from 473


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

a consumption trial with Bifidobacterium lactis Bb-12 and a galacto-474

oligosaccharide preparation. Syst. Appl. Microbiol. 25:249-258. 475

476

23. Matto, J., R. Fonden, T. Tolvanen, A. von Wright, T. Vilpponen-Salmela, R. 477

Satokari, and M. Saarela. 2006. Intestinal survival and persistence of probiotic 478

Lactobacillus and Bifidobacterium strains administered in triple-strain yoghurt. Int. 479

Dairy J. 16:1174-1180. 480

481

24. Meile, L., W. Ludwig, U. Rueger, C. Gut, P. Kaufmann, G. Dasen, S. Wenger, 482

and M. Teuber. 1997. Bifidobacterium lactis. sp. nov., a moderately oxygen 483

tolerant species isolated from fermented milk. Syst. Appl. Microbiol. 20:57–64. 484

485

25. Mitsuoka, T. 1990. Bifidobacteria and their role in human health. J. Ind. Microbiol. 486

6:263-267. 487

488

26. Munoa, F. J., and R. Pares. 1988. Selective medium for isolation and enumeration 489

of Bifidobacterium spp. Appl. Environ. Microbiol. 54:1715-1718. 490

491

27. Olsvik, O., Y. Wasteson, A. Lund, and E. Hornes. 1991. Pathogenic Escherichia 492

coli found in food. Internat. J. Food Microbiol. 12:103-113. 493

494

28. O’Sullivan D. J. Screening of intestinal microflora for effective probiotic bacteria. 495

2001. J. Ag. Food Chem. 49:1751-1760. 496


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

497

29. O’Sullivan D. J. 2005. Primary sources of probiotic cultures. In: Gopteke I., V. 498

K.Juneja and M. Ahmedna (eds). Probiotics in food safety and human health. CRC 499

Press, Taylor & Francis Group, Boca Raton, FL pp 89-105. 500

501

30. Ouwehand, A. C., T. Kurvinen, and P. Rissanen. 2004. Use of a probiotic 502

Bifidobacterium in a dry food matrix, an in vivo study. Int. J. Food Microbiol. 503

95:103-106. 504

505

31. Penders, J, C. Vink, C. Driessen, N. London, C. Thijs, and E. E. Stobberingh. 506

2005. Quantification of Bifidobacterium spp., Eschirichia coli and Clostridium 507

difficile in faecal samples of breast-fed and formula-fed infants by real-time PCR. 508

FEMS Microbiol. Lett. 243:141-147. 509

510

32. Playne, M. J. 2002. The health benefits of probiotics. Food Australia. 54:71-74. 511

512

33. Rafter, J., M. Bennett, G. Caderni, Y. Clune, R. Hughes, P. C. Karlsson, A. 513

Klinder, M. O’Riordan, G. C. O’Sullivan, B. Pool-Zobel, G. Rechkemmer, M. 514

Roller, I. Rowland, M. Salvadori, H. Thijs, J. V. Loo, B. Watzl, and J. K. 515

Collins. 2007. Dietary synbiotics reduce cancer risk factors in polypectomized and 516

colon cancer patients. Am. J. Clin. Nutr. 85:488-496. 517

518


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

34. Requena, T., J. Burton, T. Matsuki, K. Munro, M. A. Simon, R. Tanaka, K. 519

Watanabe, and G. W. Tannock. 2002. Identification, detection, and enumeration 520

of human Bifidobacterium species by PCR targeting the transaldolase gene. Appl. 521

Environ. Microbiol. 68:2420-2427. 522

523

35. Roberfroid, M. B. 2005. Introducing inulin-type fructans. Br. J. Nutr. 93:Suppl 524

1:S13-25. 525

526

36. Rudi, K., B. Moen, S. M. Drømtorp, and A. L. Holck. 2005. Use of ethidium 527

monoazide and PCR in combination for quantification of viable and dead cells in 528

complex samples. Appl. Environ. Microbiol. 71:1018-1024. 529

37. Saavedra, J. M., N. A. Bauman, J. A. Perman, R. H. Yolken, J. M. Saavedra, 530

N. A. Bauman, and I. Oung. 1994. Feeding of Bifidobacterium bifidum and 531

Streptococcus thermophilus to infants in hospital for prevention of diarrhoea and 532

shedding of rotavirus. Lancet. 344:1046-1049. 533

38. Schiffrin, E. J., F. Rochat, H. Link-Amster, J. M. Aeschlimannp, and A. 534

Donnet-Hughes. 1995. lmmunomodulation of human blood cells following the 535

ingestion of lactic acid bacteria. J. Dairy Sci. 78:491-497. 536

537

39. Soejima, T., K. Iida, T. Qin, H. Taniai, M. Seki, A. Takade, and S. Yoshida. 538

2007. Photoactivated ethidium monoazide directly cleaves bacterial DNA and is 539


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

applied to PCR for discrimination of live and dead bacteria. Microbiol. Immunol. 540

51:763-775. 541

542

40. Song, Y., C. Liu, and S. M. Finegold. 2004. Real-Time PCR quantitation of 543

clostridia in feces of autistic children. Appl. Environ. Microbiol. 70:6459-6465. 544

545

41. Stackebrandt, E., I. Kramer, J. Swiderski, and H. Hippe. 1999. Phylogenetic 546

basis for a taxonomic dissection of the genus Clostridium. FEMS Immunol. Med. 547

Microbiol. 24:253-258. 548

549

42. Su, P., A. Henriksson, J. E. Tandianus, J. H. Park, F. Foong, N. W. Dunn. 550

2005. Detection and quantification of Bifidobacterium lactis LAFTI B94 in human 551

faecal samples from a consumption trial. FEMS Microbiol. Lett. 244:99-103. 552

553

43. Topping, D. L., and P. M. Clifton. 2001. Short-chain fatty acids and human 554

colonic function: roles of resistant starch and nonstarch polysaccharides. Physiol. 555

Rev. 81:1031-1064. 556

557


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

TABLE 1. Means of ages, weights and heights for study participants 558

Parameter Group A Group B P Value

Number of subjects 22 24 --

Mean of ages 30.3 +/- 9.7 30.9 +/- 13.8 0.87

Mean of weights (lbs) 166 +/- 46.4 145 +/- 26 0.06

Mean of heights (ft) 5.7 +/- 0.33 5.49 +/- 0.28 0.48

559

560 561 562 563 564 565 566


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

TABLE 2: Primers and probes used for quantitative real time PCR 567

1, These primers are specific for B. animalis subsp. lactis 568 569 570 571

Target Primer or Sequence (5' - 3') Conc. Reference

probe nM

Bb-121 F-Bal 23 GGT GGT CTG GTA GAG TAT ACC G 900 Chr. Hansen

R-Bal 23 GGC GAC TTG CGT CTT G 900 Inc.

P-Bal 23 CGC CCA CGA CCC GCA AG 200

Enterobacteria F-En CATGCCGCGTGTATGAAGAA 900 12

R-En CGGGTAACGTCAATGAGCAAA 900

P-Bal 23 CGC CCA CGA CCC GCA AG 200

Bifidobacterium F-TAQ GCG TCC GCT GTG GGC 300 34

genus R-TAQ CTT CTC CGG CAT GGT GTT G 300

P-TAQ TCC ACC GGC ACC AAG AAC GC 200

Clostridium F-CI TAC CHR AGG AGG AAG CCA C 300 40

cluster I R-CI GTT CTT CCT AAT CTC TAC GCA T 300

P-CI GTG CCA GCA GCC GCG GTA ATA CG 200


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

TABLE 3: Quantitative real time PCR data for strain Bb-12 in the feces of 10 subjects 572 before and after EMA treatment 573

Sample Ct before

EMA

Log 10

CFU/g

before EMA

Ct after

EMA

Log 10 CFU/g

after EMA

% Viable

Bb12 in

feces

1 31.93 5.65 32.50 5.50 97.35

2 32.38 5.53 33.63 5.20 94.03

3 31.86 5.67 53.21 0.00 00.00

4 33.25 5.30 34.00 5.10 96.23

5 31.44 5.78 32.61 5.47 94.64

6 33.48 5.24 34.38 5.00 95.42

7 32.42 5.52 53.21 0.00 00.00

8 33.85 5.14 35.81 4.62 89.88

9 32.08 5.61 32.53 5.49 97.86

10 32.31 5.55 32.42 5.52 99.46

574


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

FIGURE LEGENDS 575

576

FIG. 1: Representation of the study design and fecal collection. The study was divided 577

into 5 periods: a prefeeding period, a feeding period, a washout period, a crossover 578

feeding period and a final washout period. Fecal samples are represented by the sterile 579

tubes containing buffer and collection spoon given to subjects. 580

581

FIG. 2: Ct standard curves for real time PCR quantitative analysis of B. animalis subsp. 582

lactis Bb-12, total bifidobacteria, clostridia and enterobacteria. 583

584

FIG. 3: Mean numbers of total bifidobacteria, for all group A subjects who consumed 585

probiotic first (blue line with blue diamonds) and all group B subjects who consumed 586

placebo first (the pink line with pink squares), at different timepoints during the study. 587

588

FIG. 4: Fecal bifidobacteria levels in subjects subgrouped on the basis of < 108 cfu/g in 589

the prefeeding period. Period 1, prefeeding period; period 2, first supplemented yogurt 590

feeding period; period 3, first washout period; period 4, crossover feeding period; period 591

5, final washout period. Group A is represented by the darker shading. P values represent 592

differences between the yogurt feeding and final washout periods compared to the 593

prefeeding period. 594

595

596


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

FIG. 5: Mean numbers of clostridia cluster I, for all group A subjects who consumed 597


placebo first (the pink line with pink squares), at different timepoints during the study. 599

Values below the level of detection (102 cfu/g) have been equated to the value of the limit 600

of detection of 102 cfu/g for mean calculations. The bars represent the standard errors. 601

602

FIG. 6: Fecal clostridia (cluster 1) levels in subjects subgrouped on the basis of > 3.5 603

log10 cfu/g in the prefeeding period. Period 1, prefeeding period; period 2, first 604

supplemented yogurt feeding period; period 3, first washout period; period 4, crossover 605

feeding period; period 5, final washout period. Group A is represented by the darker 606

shading. P values represent differences between the yogurt feeding and final washout 607

periods compared to the prefeeding period. 608

609

610 FIG. 7: Mean numbers of enterobacteria, for all group A subjects who consumed 611


placebo first (the green line with green triangles), at different timepoints during the study. 613

Values below the level of detection (103 cfu/g) have been equated to the value of the limit 614

of detection of 103 cfu/g for mean calculations. The bars represent the standard errors. 615

616 FIG. 8: Fecal enterobacteria levels in subjects subgrouped on the basis of > 5.5 log10 617

cfu/g in the prefeeding period. Period 1, prefeeding period; period 2, first supplemented 618

yogurt feeding period; period 3, first washout period; period 4, crossover feeding period; 619

period 5, final washout period. Group A is represented by the darker shading. P values 620


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

33

represent differences between the yogurt feeding and final washout periods compared to 621

the prefeeding period. 622

623


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

34

(2 samples on -14 and -7 days)

(3 samples/week ) (3 samples/ week) (4 samples/ week)

(2 samples / 2 weeks)

FEEDING FEEDING

624

625 FIG. 1 626

627

628

629

630

631 632


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

35

FIG. 2 633

634 635 on M

arch 4, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

36

FIG. 3 636 637 638

639

640

641


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

37

FIG. 4 642

643

644

645 646 647


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

38

FIG. 5 648

649

650

651

652


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

39

FIG. 6 653

654

655

656

657

658


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

40

FIG. 7 659 660 661

662 663


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

41

FIG. 8 664 665 666

667


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

effect of a synbiotic yogurt on levels of fecal bifidobacteria ... · 8 amrita palaria , ivy...

Documents