EC

GMa

b

c

a

ARR2A

KZVGO1C

1

tebs

E

CA

0d

Aquatic Toxicology 101 (2011) 175–185

Contents lists available at ScienceDirect

Aquatic Toxicology

journa l homepage: www.e lsev ier .com/ locate /aquatox

arly expression of zona pellucida proteins under octylphenol exposure inichlasoma dimerus (Perciformes, Cichlidae)

riselda Genovesea,b,c,∗, Rodrigo Da Cunaa,b, David W. Towlec,aría C. Maggesea,b, Fabiana Lo Nostroa,b

Laboratorio de Embriología Animal. DBBE, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires C1428EHA, ArgentinaConsejo Nacional de Investigaciones Científicas y Tecnológicas (CONICET), Rivadavia 1917, Buenos Aires C1033AAJ, ArgentinaMount Desert Island Biological Laboratory, Salisbury Cove 04672, ME, USA

r t i c l e i n f o

rticle history:eceived 17 May 2010eceived in revised form1 September 2010ccepted 25 September 2010

eywords:ona pellucida proteinsitellogeninene expressionctylphenol7�-Estradiolichlid fish

a b s t r a c t

An increasing number of widely used industrial and agricultural chemicals are being found to causeendocrine disruption. In fishes, xenoestrogens can induce female proteins, and in some cases, the devel-opment of testis-ova, demonstrating feminization of males. In this study we analyzed the effect of anacute exposure of adult male Cichlasoma dimerus fish to estradiol (E2) and octylphenol (OP). E2 and OPwere injected at 10 and 50 �g/g body weight doses, respectively. After a single OP dose, liver was pro-cessed for RNA extraction at 1, 3, 12, 24, and 72 h. PCR was performed using cDNA and primers for egg coator zona pellucida proteins (ZP). Genes encoding ZPB and ZPC isoforms were sequenced. E2-induced fishwere sacrificed at 72 h. Using multiple OP or E2 injections, blood and surface mucus were sampled on days0, 3, 6, 9, and 13. On day 13 fish were sacrificed for liver and testis dissection. Histological examination ofE2 and OP-treated fish livers showed cellular disarray and intense cytoplasmatic basophilia within hep-atocytes, probably due to increased mRNA synthesis, as well as hypertrophied euchromatic nuclei, andconspicuous nucleoli, indicative of augmented cell activity. An abnormal amount of sperm and immaturegerm cells within the testis lumen were seen in treated fish, suggesting reproductive impairment. Bothplasma and mucus revealed the presence of ZP (and vitellogenin) at day 3 and thereafter with E2 treat-ment, using Western and Dot blot techniques; OP effects were delayed in time. These results validatethe analysis of mucus by Dot blot as an easy and rapid technique to address endocrine disruption caused

by OP. Quantitative gene expression showed induction of liver ZPB and ZPC upon OP injection; muscle,brain, and intestine did not express any ZP. Both ZPs were induced at 1 h post injection, but only ZPBexpression was statistically significant. At 12 h, both ZPs increased significantly, reaching the same levelsof E2-challenged males after 72 h. Therefore, OP mimicked the action of E2 with a prompt and strongxenoestrogenic effect, evidenced by the early response through mRNA and protein expression of ZP and

ical li

the concomitant histolog

. Introduction

Numerous industrial and agricultural chemicals concentrate in

he aquatic biota and have been found to elicit a host of adverseffects in humans and wildlife. Some of these chemicals haveeen reported to modulate, mimic or antagonize the action of sexteroid hormones. In this respect, the decreasing trend in male

Abbreviations: ZP, zona pellucida proteins; VTG, vitellogenin; OP, octylphenol;2, 17�-estradiol; ER, estrogen receptor.∗ Corresponding author at: Laboratorio de Embriología Animal. DBBE, Facultad deiencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires C1428EHA,rgentina. Tel.: +54 11 4576 3348; fax: +54 11 4576 3384.

E-mail address: genovese@bg.fcen.uba.ar (G. Genovese).

166-445X/$ – see front matter © 2010 Elsevier B.V. All rights reserved.oi:10.1016/j.aquatox.2010.09.017

ver and testis alterations.© 2010 Elsevier B.V. All rights reserved.

fertility, including congenital malformations and testicular cancerin humans, augments concern (Saradha and Mathur, 2006). Thepollutants that exhibit estrogenic activity include organochlorineinsecticides, some phthalate plasticizers, and industrial chemicalssuch as nonylphenol, bisphenol A, and polychlorinated biphenyls(PCBs) (Sonnenschein and Soto, 1998; Arukwe et al., 2000; vander Oost et al., 2003). Certain structural features, such as an over-all ring structure, are important for binding to estrogen receptors(ER) (Blair et al., 2000), though some of these chemically diverseagents differ from steroidal estrogens and still can mimic or coun-

teract estrogenic actions by their ability to bind to and successfullycompete with estradiol for the estrogen binding sites (Danielian etal., 1993; White et al., 1994; Tollefsen et al., 2002). The reproduc-tive disorders caused in wildlife by these estrogen-like substances,known as xenoestrogens, include egg shell thinning, developmen-

1 Toxic

ts(IectsltM

rpftrieiSohmir

h2lHtltdrtp

tgcirnAstprspptZatbV(aiadao

76 G. Genovese et al. / Aquatic

al alterations, altered hormone concentration in adults, changes inocio-sexual behavior, impaired viability of offspring, among othersJobling and Sumpter, 1993; Ahel et al., 1993; Jobling et al., 1996;guchi et al., 2001; Fox, 2001; Arukwe and Goksøyr, 2003; Robinsont al., 2004). These effects lead to reduced reproductive success,onsequently affecting population growth and biodiversity. In par-icular, in fish, 17�-estradiol and 17�-ethinylestradiol (present inewage effluents) have been reported to affect sex differentiationeading to the development of testis-ova and complete feminiza-ion (Kang et al., 2002; Andersen et al., 2003; Jobling et al., 2006;

ilnes et al., 2006).Alkylphenols such as nonylphenol (NP), octylphenol (OP) and

elated compounds are biodegradation products of alkylphenololyethoxylates, a group of non-ionic surfactants used in the manu-acture of detergents, paints, pesticides and cosmetics. NP is used inhe production of plastics such as polystyrene and polyvinyl chlo-ide (PVC). They have been detected in surface waters and effluentsn high concentrations but due to their chemical properties, they areasily adsorbed onto sediments (Ying et al., 2002). There is scarcenformation about the levels of APs in the aquatic environment inouth America. Even though Fiedler et al. (2006) reported low levelsf APs in a rural area of Brazil, OP was the dominant one and muchigher values can be expected in densely populated urban environ-ents. In Argentina up to 5 �g/g and 20 �g/L of NP were detected

n sediments and water creeks of the Buenos Aires conurbation,espectively (Meijide, 2007).

Concentrations of APs detected in aquatic animals were asigh as 1.4 �g/g bodyweight (Ferrara et al., 2005; David et al.,009). It has been reported that OP has a half-life of 1.7 days in

iver of fish and does not accumulate in that organ (Pedersen andill, 2002; Pedersen et al., 2003). OP and NP have been shown

o be estrogenic, capable of inducing the expression of vitel-ogenin (VTG) and egg coat proteins, though to a lesser extenthan estradiol (White et al., 1994; Arukwe et al., 2002), hence highoses (above 40 �g/g) are necessary to elicit an acute estrogenicesponse. Additionally, Sundt et al. (2009) demonstrated elimina-ion of alkylphenols in fish through the liver-bile-faeces excretionathway.

VTG, a complex phospholipoglycoprotein, is synthesized inhe liver of non-mammalian vertebrates in response to estro-en and transferred to the ovaries through the bloodstream. Thisomplex precursor is taken up by growing oocytes and enzymat-cally cleaved into yolk proteins, which are stored as nutrienteserves once oogenesis is completed. These proteins provideutrients to the developing embryo and buoyancy to the eggs.s stated by Spargo and Hope (2003), a glycoprotein coat withimilar gross structure and function surrounds all ovulated ver-ebrate oocytes. The egg coat proteins, known as zona pellucidaroteins (ZP), choriogenin, vitelline envelope proteins and zonaadiata proteins, mediate sperm-oocyte binding, induction of acro-ome reaction, sperm penetration and eggshell hardening, andrevent polyspermy in vertebrates (Modig et al., 2007). In theresent study, we use the term ZP, following the unified nomencla-ure proposed by Spargo and Hope (2003). ZP subfamilies includePA, ZPB (including alpha and beta isoforms), ZPC (also knowns gamma), and ZPX, and a phylogenetic tree has been proposedo show relatedness among vertebrates; new subfamilies are stilleing identified (Benson et al., 2009; Izquierdo-Rico et al., 2009).ertebrate ZP is mainly composed of three to six glycoproteins

Modig et al., 2006; Izquierdo-Rico et al., 2009), which are depositedround the oocytes during zonagenesis. In fish, the egg envelope

s thicker than in mammals providing also physical protectiongainst mechanical disturbances from the environment for theeveloping embryo during the first fragile period (Yamagami etl., 1992). In many fishes, synthesis of ZP is carried out in the liverf adult females, under estrogenic control (Arukwe and Goksøyr,

ology 101 (2011) 175–185

2003). Zonagenesis precedes vitellogenesis, since the initial forma-tion of the eggshell occurs before the active uptake of vitellogenin(Hyllner et al., 1994; Celius and Walther, 1998). In most species,juveniles and male fish normally do not produce ZP or VTG, butestrogens or xenoestrogens can induce their expression requiringonly basal ER concentrations. When this basal ER concentration isdepleted, ER gene transcription may begin, resulting in continuedtranscription of ZP and VTG genes (Yadetie et al., 1999; Arukweet al., 2001; Bowman et al., 2002). In other fish species, includingmany salmonids, ER gene expression peaked before VTG induction(Bowman et al., 2002).

The family Cichlidae is one of the largest perciform families(Nelson, 2006), an important group of relatively large and oftencolorful aquarium fishes. Cichlasoma dimerus inhabits inland waters(Parana and Paraguay Rivers’ basins) of Brazil and Argentina. Thisspecies adapts easily to captivity, has notable reproductive features(complex social and breeding behavior, parental care, a high spawn-ing frequency) and acceptable survival rates, proving a good modelfor laboratory studies (Meijide and Guerrero, 2000; reviewed inPandolfi et al., 2009). It has been used for ecotoxicological testingin previous studies (Moncaut et al., 2003; Rey Vázquez et al., 2009),and is included as a suitable native species for the determination ofthe lethal acute toxicity of xenobiotics by the Argentinean Instituteof Standarization and Certification (IRAM, 2008).

Few studies have dealt with induction of ZP after a short-exposure to octylphenol in fish (Knudsen et al., 1998; Rhee et al.,2009), and since ZP has been proved to be more sensitive thanVTG (Arukwe et al., 1997, Celius et al., 2000), it can be used as anearly biomarker of xenoestrogenicity. The aim of this study was toanalyze the early expression of zona pellucida proteins and vitel-logenin and the concomitant histological alterations due to theacute exposure of specimens of C. dimerus to 4-tert-octylphenol, tobetter understand the underlying mechanisms behind the action ofxenoestrogens.

2. Materials and methods

2.1. Animals

Adult fish were captured in Esteros del Riachuelo, CorrientesProvince, Argentina (27◦25′S, 58◦15′W). Prior to experimentation,animals (44 ± 3 g body weight, 12.6 ± 0.3 cm total length) wereacclimated to laboratory conditions for a month in 100 L glassaquaria, with external filtration, constant aeration and tempera-ture of 26 ± 1 ◦C, pH 7.3 and a 12:12 h photoperiod. Fish were feddaily with pellet food (Tetra® food sticks).

2.2. Protein detection

2.2.1. Experimental designIn a first series of experiments, male fish (N = 5 per treatment)

were intraperitoneally (i.p.) injected with 10 �g/g of body weight(bw) 17�-estradiol (E2; Sigma–Aldrich, USA), to generate a strongestrogenic response according to a previous study (Moncaut etal., 2003), or 50 �g/g bw octylphenol (OP, 4-tert-octylphenol >97%purity; Sigma–Aldrich, USA) to elicit an acute response accordingto Pedersen et al. (2003). Injections were administered on days 0,3, 6, and 9; on day 13 fish were sacrificed by decapitation (Cana-dian Council on Animal Care, 2005). Both chemicals were dissolvedin ethanol and resuspended in 0.9% saline solution; corn oil was

added as a vehicle before injecting sedated fish (dose: 6 drops/2 L;active ingredients: acetone, dimethylketone alpha methyl quino-line; Fish Sedate, USA). Control males were injected with salinesolution and corn oil. Mature females were used as positive con-trols. For the duration of the experiment fish were kept individually

Toxic

it

2

wfntw22msw(

2

fpnsMBsP1BfUa

ToAm

m8vw(ew(13a

pws

pt

2

cPhM

G. Genovese et al. / Aquatic

n 20 L aquaria in the same conditions mentioned for acclima-ion.

.2.2. Sample collectionBefore each injection and at the end of the experiment, body

eight was measured, blood and mucus samples were collectedrom the caudal vein (heparin-coated syringe, 27 gauge × 1/2 in.eedle) and scraped from the body surface (metal spatula), respec-ively. 10 �L of protease inhibitor cocktail (Sigma–Aldrich, USA)ere added to all samples. Mucus samples were also mixed with

00 �L of PBST (phosphate buffer saline, 0.1 M, pH 7.4, 0.5% Tween0). After centrifugation at 3000 rpm for 15 min at 4 ◦C, plasma anducus free of debris and scales were stored at −20 ◦C, until analy-

is by SDS-PAGE Western blot and Dot blot. Protein concentrationsere measured by Lowry‘s method using bovine serum albumin

BSA) as a standard (Lowry et al., 1951).

.2.3. SDS-PAGE, Western and Dot blotsSamples with equal amounts of protein (40 �g for plasma; 50 �g

or mucus) were mixed with loading buffer (120 mM Tris–HCl,H 6.8, 3% sodium dodecyl sulfate, 10% glycerol, 2% bromophe-ol blue and 1% �-mercaptoethanol, boiled for 5 min and brieflypun down before loading them into polyacrylamide gel wells.olecular weight standard was loaded in a separate well (See-

lue Plus2 Pre-Stained Standard, Invitrogen Corporation, USA). Aodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-AGE), as described by Laemmli (1970), was performed at constant00 V using 4% stacking and 8% separating gel (Mini-Protean III,io-Rad, USA) and 124 mM Tris–HCl, pH 8.8 running buffer. Trans-

erence to nitrocellulose membranes (ECL Amersham Biosciences,K) was done at 100 V for 90 min, in 25 mM Tris, 187 mM glycinend 20% methanol.

Subsequently, membranes were soaked with TTBS (100 mMris–HCl, 0.9% NaCl, 0.1% Tween 20, pH 7.5), and endogenous per-xidases were blocked with 2% 30 vol H2O2 in TTBS for 5 min.fterwards, unspecific binding sites were blocked with 3% skimmedilk and 3% BSA in TTBS overnight at 4 ◦C.Zona pellucida proteins (ZP) were immunodetected using

ouse anti-salmon ZP monoclonal antibody (Salmo salar; MN-C4, Biosense Laboratories, Norway) 1:500 overnight at 4 ◦C. Foritellogenin (VTG) immunodetection, membranes were incubatedith rabbit anti-perch VTG antiserum 1:2000 for 90 min at RT

Perca fluviatilis; donated by Dr. B. Allner, Germany; see Henniest al., 2003). After three 5-min washes with TTBS, membranesere incubated with biotinylated anti-mouse secondary antibody

for ZP) or biotinylated anti-rabbit secondary antibody (for VTG):1000 for 1 h at RT, ABC (Dako, USA) 1:3000 for 1 h, and 0.1%,3′-diaminobenzidine in Tris–HCl buffer (Dako, USA) for 5 min, formplification and detection of the signal.

For both proteins, omission of the primary antibody was alsoerformed (not shown). Membranes were scanned and moleculareights were estimated using SigmaGel software (Jandel Scientific

oftware 1.0, USA).Dot blot analysis was performed adding a fixed amount of

rotein to a nitrocellulose membrane and following the aforemen-ioned protocol for Western blots.

.3. Histological analysis

Liver and testis were fixed in Bouin’s solution for histologi-al processing. Subsamples were dehydrated and embedded inaraplast (Oxford, USA). 7 �m thick sections were stained withematoxylin-eosin. Photomicrographs were taken with a Nikon-icrophot FX microscope.

ology 101 (2011) 175–185 177

2.4. Gene expression

2.4.1. Experimental designFor gene expression analysis, in a second series of experiments,

male fish (N = 4) were i.p. injected with a single dose of OP (50 �g/gbw) or saline solution and corn oil, and were sacrificed at 0, 1, 3, 12,24, and 72 h. In parallel, male and female fish were i.p. injected witha single dose of E2 (10 �g/g bw) and sacrificed at 72 h. Liver, muscle,intestine, and brain samples were immersed in 2 mL cold RNAlater(Ambion, USA) for 24 h and then frozen at −20 ◦C until processing(according to product specifications for short term storage).

2.4.2. RNA extraction, sequencing, and quantitative mRNAexpression

RNA was extracted and purified following thephenol–chloroform–isoamyl alcohol protocol (RNAgent totalRNA isolation system, Promega Corporation, USA). Quantificationand quality of RNA were analyzed with RNA 6000 Nano ChipKit and Agilent 2100 Bioanalyzer. Poly-A mRNA was reversetranscribed using SuperScript III First-Strand Synthesis System forRT-PCR (Invitrogen, USA).

Degenerate primers for ZPB and ZPC were designed basedon sequences of different fish species available in the Gen-Bank database at NCBI (http://www.ncbi.nlm.nih.gov). For ZPBthe forward and reverse primers were 5′GYNACNGTNCART-GYACNAARGA3′ and 5′RTCRTCNKSRTANGGRCANCC3′, respec-tively. For ZPC 5′GCNGYNGTNATHGTNGARTGYCAYTA3′, and5′RAANCKRAANGCYTCNARYTGRAA3′. Conventional PCR was per-formed at an annealing temperature of 55 ◦C using RedTaqpolymerase (Sigma REDTaq® ReadyMixTM PCR Reaction Mix),and amplification products were isolated electrophoreticallyon 0.8% agarose gels (Promega Corporation, USA). Follow-ing gel extraction with a MinElute Gel Extraction Kit (Qia-gen, USA), amplification products were sequenced, analyzed,trimmed (Chromas 2.33, http://www.technelysium.com.au), andsubmitted to BLASTX analysis for tentative functional iden-tification at NCBI. Alignment of sequences between differentfish species and cladograms were performed with Clustal W2(http://www.ebi.ac.uk/Tools/clustalw2/index.html).

Species-specific primers were designed for quantitative mRNAexpression. For ZPB the forward and reverse primers were5′ CAGAAACGCCACTCTACCCAACA 3′ and 5′ TCCTCCTCTTCAATG-CAACCCT 3′, respectively; and for ZPC, 5′ AGTTCCTCTATTTCAC-CCTGAC 3′ and 5′ TCTACTATCAATCATACACCCTTG 3′. cDNA wasamplified in the presence of SYBRGreen dye using Qiagen Quanti-tect chemistry and the Stratagene MX4000 Multiplex QuantitativePCR System. Liver RNA from estrogenized females was used for thestandard curve to normalize data. A dilution series demonstrateda linear relationship between threshold cycle (Ct) and log 10 oftemplate availability.

2.5. Statistical analysis

Repeated measures one-way ANOVA test followed by Dun-nett’s multiple comparisons was performed for body weight. Forgene expression comparison, non-parametric test was done usingKruskal–Wallis test followed by Dunn’s multiple comparison test.In both cases, a free version of Graph Pad Prism 4 software(http://www.graphpad.com) was used.

3. Results

3.1. Survival and growth

No mortality was registered in any of the experiments. In thefirst series, fish body weight remained constant during the exper-

178 G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

Fig. 1. Western (A, B, E, F, i) and Dot blot (C, D, G, H, J) analysis of zona pellucida proteins (ZP) from plasma and mucus samples of 17�-estradiol and octylphenol-injectedm salar;r f ZP bat e prims

i6cit

3

pp5(fcb

bmiue1aw

asim

ales of Cichlasoma dimerus. A mouse anti-salmon ZP monoclonal antibody (Salmoesults parallel those of Western blots, except for OP treatment. A normal pattern ohe left of each sub-figure represent molecular weight in kilodaltons. Omission of thhown).

ment in the control group (p > 0.05); it significantly decreased% after day 9 in E2-injected animals, and 8% on day 13 in OP-hallenged fish (p < 0.05). No difference in feeding behavior (foodngestion) was seen in any of the treatments during the experimen-al period.

.2. ZP and VTG immunodetection

SDS-PAGE followed by Western blot analysis of plasma sam-les of control vitellogenic C. dimerus females revealed a normalattern of four ZP bands: 71.0 ± 0.6, 66.2 ± 0.4, 56.5 ± 0.4 and4.3 ± 0.2 kDa (Fig. 1i, female lane), and four VTG bands: 121.5 ± 0.6the broader band), 111 ± 1, 106.4 ± 0.6 and 74.0 ± 0.9 kDa (Fig. 2i,emale lane). In spawning females an additional band of 190 kDaould be detected. Control males did not exhibit any ZP or VTGands (Figs. 1 and 2A–B and E–F, lanes marked with 0).

At day 3 of 17�-estradiol (E2) injection, plasma of male fishecame ZP- and VTG-immunoreactive (Figs. 1A and 2A, lanesarked with 3). For both proteins, in addition to the bands observed

n mature females, several extra bands of higher and lower molec-lar weights were detected. Induction continued till the end of thexperiment (day 13) (Figs. 1 and 2A, lanes marked with 3, 6, 9, and3). Similarly, OP induced VTG and ZP in plasma of treated male fisht day 3 and 6, respectively. No additional ZP bands were detectedith OP injection (Figs. 1 and 2E).

Neither control males nor control females showed immunore-ctivity of ZP and VTG in mucus scraped from body surface. Mucusamples evidenced ZP and VTG bands on day 3 with a single E2njection (Figs. 1 and 2B, lane marked with 3). Under OP treat-

ent, ZP and VTG were first detected on days 6 and 9, respectively

MN-8C4, Biosense Laboratories, Norway), was used for immunodetection. Dot blotnds in a mature female is shown (i). No ZP was found in control males. Numbers atary antibody was performed and no bands were detected in any sample (data not

(Figs. 1 and 2F). For both treatments, the predominant ZP bandsdetected in males’ mucus were the two higher MW bands found inplasma of mature females.

Immunodetection of ZP and VTG by Dot blot of plasma of amature female is represented by Figs. 1J and 2J, respectively. Detec-tion of ZP and VTG of plasma and mucus samples of E2-injectedmales occurred on the same days of treatment as Western blots(Figs. 1C and D and 2C and D). Under OP treatment, plasma ZP andVTG were detected later in time in Dot blots than in Western blots(Figs. 1 and 2G). In contrast, mucus immunoreaction preceded theones obtained in Western blots (Figs. 1 and 2H).

Comparing the obtained results from WB and Dot blot tech-niques provides useful validation of the latter, since Dot blotrepresents an easy and rapid method for evaluating estrogeniceffects in the field, as it does not require the use of lab equipment.

3.3. Histological analysis

Liver of C. dimerus is composed of hepatocytes arranged aroundblood sinusoids and dispersed pancreatic tissue. In control ani-mals, hepatocytes possessed an eccentric nucleus, occasionally onenucleolus was seen, and the cytoplasm appeared vacuolated andweakly eosinophilic in hematoxylin-eosin sections (Fig. 3A). On thecontrary, the liver of E2-injected males showed signs of cellulardisarray since rows of hepatocytes were hardly identified. These

cells had hypertrophic and euchromatic nuclei with conspicuousnucleoli and an intense cytoplasmic basophilia. A reduction in vac-uolization of the cytoplasm was also evident (Fig. 3C). OP treatmentcaused similar alterations, though they were less pronounced (Fig. 3E).

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185 179

F G) froC y Dr. Bo ure fes body w

msictln

3

ofssttpiE

dOtmavl

ig. 2. Western (A, B, E, F, i) and Dot blot (C, D, G, H, J) analysis of vitellogenin (VTichlasoma dimerus. A rabbit anti-perch VTG antiserum (Perca fluviatilis; donated bf Western blots, except for OP treatment. A normal pattern of VTG bands in a matub-figure represent molecular weight in kilodaltons. Omission of the primary anti

C. dimerus possesses a lobular unrestricted testis type. Controlales showed the typical cytoarchitecture in this species, with all

permatogenic stages present within the spermatocysts and spermn the lobular lumen (Fig. 3B). After E2 injection, immature germells and an abnormal predominance of sperm were seen withinhe lumen, and spermatogonia were the only cell type lining theobule wall (Fig. 3D). Treatment with OP showed the same but lessoticeable modifications (Fig. 3 F).

.4. Zona pellucida (ZP) partial sequence and gene expression

Conventional PCR was performed with different combinationsf degenerated primers and cDNA from liver of induced male andemale fish. Only the amplification products showing a clear andingle band for each ZP were purified and sent for nucleotideequencing. Based on similarities to ZP from other fish species,he obtained sequences were identified as ZPB and ZPC. Par-ial sequences of 404 and 227 bp obtained using species-specificrimers for ZPB and ZPC, respectively were sent for publication

n the GenBank database (Accession Nos.: EU081905 for ZPB andU081906 for ZPC).

Alignment of the partial sequence of the ZPB isoform of C.imerus was compared to teleost sequences from rainbow troutncorhynchus mykiss ZP1a (AF231706) and ZP1b (AF231707), arc-

ic char Salvelinus alpinus ZP beta mRNA, (AY426716), Japaneseedaka Oryzias latipes ZP1b (D89609), gilthead seabream Sparus

urata ZP1a (AY928800), and sheepshead minnow Cyprinodonariegatus zona radiata-2 (AY598615). Amino-acid sequence simi-arities include >70% homology between ZPB of C. dimerus, S. aurata

m plasma and mucus samples of 17�-estradiol and octylphenol-injected males of. Allner, Germany) was used for immunodetection. Dot blot results parallel those

male is shown (i). No VTG was found in control males. Numbers at the left of eachas performed and no bands were detected in any sample (data not shown).

and C. variegatus, and 55–61% homology between C. dimerus, O.mykiss, S. alpinus and O. latipes. Sequence homology was also foundwith those of tetrapods (data not shown). Five cysteines with con-served location between the compared species are shown in Fig. 4.

Alignment of the partial sequence of the ZPC isoform of C.dimerus was compared to teleost sequences from rainbow trout O.mykiss ZP3 (AF231708), gilthead seabream S. aurata ZP3 (X93306),Oreochromis mossambicus ZPC1 (AY737027.1) and Danio rerio zonapellucida glycoprotein 3b (BC067692.1). Amino-acid sequence sim-ilarities showed 77% homology between ZPC of C. dimerus andS. aurata, and 50–60% homology with O. mykiss and D. rerio.O. mossambicus ZPC showed the least homology with the rest(30–34%). Two cysteines with conserved location among the com-pared species are shown in Fig. 5.

Quantitative gene expression showed up-regulation of ZPB andZPC upon OP injection in the liver of males (Fig. 6). ZPB was signifi-cantly induced after 1 h of injection (Fig. 6A). At 12 h post injection,mRNA levels of both ZP were significantly greater than those of con-trol fish (0 h). At 72 h post injection, gene expression levels weresimilar to those found in E2-injected males (p > 0.5) (Fig. 6A and B).Muscle, brain, and intestine did not exhibit changes in gene expres-sion, since mRNA levels of induced fish never differed from controlmales (data not shown).

4. Discussion

Terms such as environmental estrogens, endocrine disruptors,environmental hormones and xenoestrogens, describe chemicalsthat may affect the endocrine system of various organisms. Many

180 G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

Fig. 3. Liver and testis cross sections of Cichlasoma dimerus males. Control males (N = 5) showed the normal structure of liver (A) and testis (B). In estradiol treated males( lasmic tions* lei; S,

odaclipaTsa

pa

N = 5), the liver (C) displays cellular disarray, euchromatic nuclei, and intense cytopells within the lobular lumen. In octylphenol-treated males (N = 5), the same altera, immature germ cells; Cy, spermatocyst; H, hepatocyte; Lo, lobular lumen; N, nuc

f the effects caused by these substances have been associated withevelopmental, reproductive and other health problems in wildlifend laboratory animals (Arukwe and Goksøyr, 2003). Among thesehemicals are octylphenol ethoxylates and nonylphenol ethoxy-ates, two of the most common alkylphenol polyethoxylates (APEs)n the marketplace. Degradation of APEs in wastewater treatmentlants or in the environment generates more persistent APEs andlkylphenols (APs) such as nonylphenol (NP) and octylphenol (OP).hese chemicals can act as xenoestrogens, inducing the expres-

ion of female-specific proteins (Andersen et al., 1999; Chikae etl., 2003).

In the present study, though not environmentally relevant, arotocol of repeated injections of high OP doses was designed tochieve a maximum induction of the contaminant, since the estro-

c basophilia; the testis (D) showed abnormal amount of sperm and immature germwere seen, even though they were less evident (E and F). Hematoxylin-eosin, 600×.sinusoid; SPC; spermatocyte; SPG, spermatogonia; SPZ, sperm.

genic capacity of OP increases with exposure time (Andreassen etal., 2005). Protein induction and early gene expression of females-specific proteins (involved in zonagenesis and vitellogenesis) inmale fish were used to elucidate the time-course of OP effects.

A significant decrease in body weight in E2 and OP-injected fishwas registered at the end of the experiment. This body weightloss could be the result of metabolic stress due to the presenceof the contaminant, since no differences in food ingestion wereobserved during the experiment. Growth effects in fish exposed

to synthetic estrogens have been associated with increased energyrequirements for female-specific protein synthesis and xenobioticmetabolism; a reduction of hepatic glycogen and lipid stores in suchconditions is consistent with such energetic changes (Schwaiger etal., 2000; Van den Belt et al., 2003; Zha et al., 2007, 2008).

G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185 181

F erus as obic pi en obsC ed in

esVlcoreetdAo2

fii(Zr

ig. 4. (A) Sequence alignment of the zona pellucida B isoform of Cichlasoma dimequences. The cysteine residues are highlighted in grey and the internal hydrophn all sequences in the alignment. (:) means that conserved substitutions have beladogram showing estimated phylogenetic relationship of ZPB between species us

In the present investigation, histological observations providedvidence on the condition of organs following exposure to OP. Aseen in several fish exposed to xenoestrogens (Folmar et al., 2001;an den Belt et al., 2002; Islinger et al., 2003; Zha et al., 2008), the

iver of C. dimerus treated with E2 or OP showed active hepato-ytes. The nuclear hypertrophy and intense cytoplasmic basophiliaf hepatocytes could be due to increased mRNA translation in theER of estrogen-inducible proteins such as ZP and VTG (Yadetiet al., 1999; Arukwe et al., 2002; Bowman et al., 2002; Tollefsent al., 2002; Woods et al., 2009). In treated animals, vacuoliza-ion of hepatocyte cytoplasm was no longer evident, probablyue to depletion of energetic reserves (Schwaiger et al., 2000).ll the features observed in liver of treated male fish are typicalf vitellogenic females (Arukwe and Goksøyr, 2003; Ribeiro et al.,006).

The abnormal production of female-specific proteins in male

sh leads to protein accumulation not only in liver but also

n gonads and kidney, which can cause histological alterationsFolmar et al., 2001; Zaroogian et al., 2001; Moncaut et al., 2003;ha et al., 2008; Rey Vázquez et al., 2009, present work). Previousesults of our group demonstrated that, after E2 or OP treatment,

nd other teleost sequences. Blanks (-) are inserted to optimize alignment of theatch is indicated by IHP. (*) means that amino-acids in that column are identicalerved, according to amino-acid type. (.) means semi-conserved substitutions. (B)(A).

VTG accumulates within the cytoplasm of hepatocytes and in thevascular system in the liver of male C. dimerus (Moncaut et al., 2003;Rey Vázquez et al., 2009). We also found that the liver of this speciesis the only source of egg proteins (ZP and VTG) (Genovese et al.,2006, 2007), so large amounts of these proteins must exit the liverthrough the bloodstream after xenoestrogen induction.

Some evidence suggests that male fish synthesize smallamounts of estrogen, which in turn regulate the production of maleandrogens, explaining why ER transcripts are detected in germ andsomatic cells within testis (Woods et al., 2009). Estrogenic com-pounds may affect the testis directly via inhibition of androgensynthesis or may inhibit gonadotropin-releasing hormone synthe-sis in the hypothalamus or gonadotropin synthesis in the pituitarythrough feedback mechanisms. They may also exert a direct effecton Sertoli cells, which are believed to have important functionsin spermatogenesis (Jobling et al., 1996; Khan and Thomas, 1998).

After 13 days of OP or E2 treatment, testis of C. dimerus showed anabnormal amount of sperm and release of immature germ cells intothe lobular lumen. In other fish species the effects of xenoestrogensinclude: decrease in the number of cysts, hypertrophy of Sertolicells, predominance of early spermatogenic stages, increase in the

182 G. Genovese et al. / Aquatic Toxicology 101 (2011) 175–185

Fig. 5. (A) Sequence alignment of the zona pellucida C isoform of Cichlasoma dimerus and other teleost sequences. Blanks (-) are inserted to optimize alignment of thesequences. The cysteine residues are highlighted in grey and the internal hydrophobic patch is indicated by IHP. (*) means that amino-acids in that column are identicali en obsC ed ins

ngetttao

daddfitoCpTrMisoosehssa

ia

n all sequences in the alignment. (:) means that conserved substitutions have beladogram showing estimated phylogenetic relationship of ZPC between species uspecies used in (A), the former was not included in the cladogram.

umber of sperm cells in the ejaculates, and inhibition of testicularrowth (Kinnberg et al., 2000; Toft and Baatrup, 2001; Van den Beltt al., 2002). Even though gonadal dysfunction leads to reproduc-ive impairment, recovery of exposed fish has been reported afterransference to clean water (Van den Belt et al., 2002). We foundhat complete recovery of C. dimerus is achieved but only if malesre exposed to clean water for an equivalent period of time as thatf exposure to octylphenol (Genovese et al., 2007; Regueira, 2008).

In our attempt to identify different egg coat proteins in C.imerus, we were able to partially sequence two ZPs, identifieds ZPB and ZPC after NCBI blast analysis. No ZPA was found in C.imerus probably because it is assumed that fish lost this isoformuring evolution (Spargo and Hope, 2003; Modig et al., 2006). Nosh ZPX sequence was published in GenBank by the time this studyook place. The highest homology (70–77%) was found between ZPf perciform species, C. dimerus and S. aurata. Comparison between. dimerus and O. mykiss or S. alpinus did not exceed 61% homology,robably because these salmonids are considered basal species.he percentage of identity coincides with relatedness previouslyeported for estrogen responsive genes (Karels and Brouwer, 2003;odig et al., 2006; Finn and Kristoffersen, 2007). Sequence sim-

larities between vertebrate ZPs suggest a conserved function astructural components of the egg coat. In mammals, sperm rec-gnizes glycosylated serines in ZPC, however several oviparousrganisms lack these serines, so the involvement of teleost ZPC inperm recognition is uncertain (Hyllner et al., 2001; Wassarmant al., 2004). Cysteines – involved in protein cross-linking– andydrophobic patches – involved in secondary and tertiary proteintructure–, are conserved in ZPs of C. dimerus as well as in other

pecies (Del Giacco et al., 2000; Wassarman et al., 2004; Modig etl., 2006).

ZP transcripts in treated C. dimerus were detected 1 h after OPnjection, inferring transcription of ZP genes using already avail-ble estrogen receptors (ER). White et al. (1994) demonstrated that

erved, according to amino-acid type. (.) means semi-conserved substitutions. (B)(A). Note that due to the low homology between Oreochromis mossambicus and the

the estrogenic action of OP is mediated by ER, binding to a similarregion of the hormone-binding domain as E2. In C. dimerus, mRNAexpression of both forms of ZP increased markedly between 12 and24 h after a single dose of OP. This exponential induction could beexplained by de novo synthesis of ER molecules (Yadetie et al., 1999;Bowman et al., 2002; Islinger et al., 2003), since a palindromic DNAsequence named estrogen-responsive element (ERE), which per-mits recruitment of transcription cofactors, is also present in the ERpromoter (Krauss, 2001; Menuet et al., 2004). In C. dimerus two ERisoforms (ER� and �2) were partially sequenced (GenBank Acces-sion No. EU158258-9). ER� isoform of male C. dimerus can be easilyinduced in liver after OP exposure (Genovese et al., 2008). Hence,up-regulation of ER in C. dimerus exposed to OP could explain thestrong estrogenic effect evidenced in this work.

Seventy-two hours post injection, levels of ZP transcripts in OP-treated fish reached those of E2-induced fish, indicating that bothchemicals are capable of eliciting the same response. By this time,ZP proteins were hardly detected in plasma of OP-treated fish, butwere clearly evident with E2 treatment. This difference might beexplained by the estrogenic potencies of both chemicals (White etal., 1994). Even though we measured the gene expression of ZPin E2-treated fish at 72 h, it is likely that a high level of induc-tion was achieved before that time, resulting in accumulation oftranscripts and, hence, protein. In OP-challenged fish, high levelsof ZP transcripts at 72 h did not parallel with protein detection atthat time, suggesting that synthesis of mRNA precedes that of pro-tein. Four ZP immunoreactive bands were detected in Western blotseven though only two ZP isoforms were partially sequenced in C.dimerus. As noted by Izquierdo-Rico et al. (2009), the presence of

different glycoforms for each protein could partially explain differ-ent migration behaviors in SDS-PAGE, and it is also possible thatdifferent ZP proteins co-migrate in the electrophoresis. So it can-not be assumed that other subfamilies, besides ZPB and ZPC, arepresent in C. dimerus.

G. Genovese et al. / Aquatic Toxic

Fig. 6. Relative expression of ZPB (A) and ZPC (B) in livers of male Cichlasoma dimerusinjected with a single dose of octylphenol (OP) normalized to mean liver expressionicl

deovf(aaBtfnslg(w1CVpa

Arukwe, A., Knudsen, F.R., Goksøyr, A., 1997. Fish zona radiata (eggshell) protein: a

n estrogeneized females. Error bars represent standard error of the mean. Signifi-ant values (p < 0.01), after comparisons with control value, are indicated by *. Dottedine represents the expression of induced males after 72 h of E2 injection.

We found marked plasma VTG and ZP immunoreactivity 3 and 6ays after injection of OP, respectively. OP proved to be less potentliciting an estrogenic response in mucus, since ZP and VTG werenly detected on days 6 and 9 of treatment, respectively. As pre-iously proposed, the skin could serve as an excretory pathwayor excess proteins, considering that they lack a depositional siteovary) in males (Folmar et al., 2001; Moncaut et al., 2003; Meuccind Arukwe, 2005). Recent studies demonstrated that VTG is actu-lly expressed in skin of estrogeneized fish (Wang et al., 2005;ulukin et al., 2007; Jin et al., 2008). It is not surprising for skino be a target for estrogens, since different isoforms of ER wereound to be expressed in this organ (Arukwe and Røe, 2008). Thisovel localization of VTG or ZP in skin validates surface mucus as aensitive biomarker for estrogenic compounds. Fry of some cich-ids (Symphysodon spp., Amphilophus citrinellus, O. mossambicus)et nutritional (vitellogenin) and biologically active non-nutrientshormones) by biting mucus from both parents during the firsteeks of parental care (Keenleyside, 1991; Kishida and Specker,

994; Schütz and Barlow, 1997; Buckley et al., 2009). Even though

. dimerus does not exhibit this nipping behavior, the presence ofTG in mucus could be evolutionarily significant for nutritionalurposes. However, to our knowledge, this explanation would notpply to ZP. To elucidate whether excretion or synthesis are respon-

ology 101 (2011) 175–185 183

sible for the presence of ZP in mucus it would be interesting tostudy the skin of C. dimerus as a target organ for estrogens. Thedetection of VTG in mucus has been used in recent years as a nonin-vasive assay to monitor endocrine disrupting chemicals (Moncautet al., 2003; Meucci and Arukwe, 2005; Bulukin et al., 2007; Arukweand Røe, 2008; Maltais and Roy, 2009; Rey Vázquez et al., 2009).We found that detection of ZP in mucus precedes that of VTG, sothe former protein could be used as a more sensitive biomarker.Even though Dot blot results did not exactly match those obtainedin Western blots, probably due to a difference in sensitivity, thismethod represents an easy, rapid, and noninvasive technique toaddress endocrine disruption in the field.

The aforementioned results support quantitative gene expres-sion as one of the most sensitive methods for the detection ofestrogenic responses in fish (Andreassen et al., 2005). Inductionof ZPB and ZPC transcripts in C. dimerus following OP injection wasevidenced much earlier than protein detection. Gene expressionalso showed a differential response between ZPs, being ZPB moresensitive than ZPC (Arukwe et al., 1997; Lee et al., 2002). Therefore,ZPB gene expression results in an assertive biomarker for endocrinedisruption by exposure to xenoestrogens in males of C. dimerus,since in this species males do not normally express ZP. However,this is not valid for all fish since in other species males typicallyexpress ZP (Zoarces viviparus, Larsson et al., 2002; Oncorhynchusmykiss, Hyllner et al., 2001; Ackerman et al., 2002). It is yet unknownwhether ZPs serve a novel function or if it is a nonfunctional evo-lutionary by-product in males of these species.

Nowadays, different government and non-government organi-zations are setting up directives and legal frameworks to protectand improve the quality of fresh water resources and promisingremoval processes are emerging (Chen et al., 2007; Esplugas et al.,2007). When monitoring endocrine disrupting chemicals it shouldbe essential to include biomarkers that can serve as early warningsigns of environmental pollution (Schlenk, 1999) such as the onesused in the present study.

Acknowledgements

The present work was supported by University of Buenos Aires(UBACyT x118 and x620) and Agencia Nacional de Promoción Cien-tífica y Tecnológica (PICT 14271). Sequencing and gene expressionstudies were performed at MDIBL with a new investigator awardto G. Genovese.

References

Ackerman, G.E., Schwaiger, J., Negele, R.D., Fent, K., 2002. Effects of long-termnonylphenol exposure on gonadal development and biomarkers of estrogenicityin juvenile rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 60, 203–221.

Ahel, M., McEvoy, J., Giger, W., 1993. Bioaccumulation of the lipophilic metabolitesof nonionic surfactants in freshwater organisms. Environ. Pollut. 79, 243–248.

Andersen, H.R., Andersson, A.M., Arnold, S.F., Autrup, H., Barfoed, M., Beresford, N.A.,Bjerregaard, P., Christiansen, L.B., Gissel, B., Hummel, R., Jørgensen, E.B., Kors-gaard, B., Le Guevel, R., Leffers, H., McLachlan, J., Møller, A., Nielsen, J.B., Olea, N.,Oles-Karasko, A., Pakdel, F., Pedersen, K.L., Perez, P., Skakkebcek, N.E., Sonnen-schein, C., Soto, A.M., Sumpter, J.P., Thorpe, S.M., Grandjean, P., 1999. Comparisonof short-term estrogenicity tests for identification of hormone-disrupting chem-ical. Environ. Health Perspect. 107, 89–108.

Andersen, L., Holbech, H., Gessbo, A., Norrgren, L., Petersen, G.I., 2003. Effects ofexposure to 17�-ethinylestradiol during early development on sexual differen-tiation and induction of vitellogenin in zebrafish (Danio rerio). Comp. Biochem.Physiol. C 134, 365–374.

Andreassen, T.K., Skjoedt, K., Korsgaard, B., 2005. Upregulation of estrogen receptor� and vitellogenin in eelpout (Zoarces viviparous) by waterborne exposure to4-tert-octylphenol and 17�-estradiol. Comp. Biochem. Physiol. C 140, 340–346.

sensitive biomarker for environmental estrogens. Environ. Health Perspect. 105,418–422.

Arukwe, A., Celius, T., Walter, B.T., Goksoyr, A., 2000. Effects of xenoestrogens treat-ment on zona radiata protein and vitellogenin expression in Atlantic salmon(Salmo salar). Aquat. Toxicol. 49, 159–170.

1 Toxic

A

A

A

A

B

B

B

B

B

C

C

C

C

D

D

D

E

F

F

F

F

F

G

G

G

H

84 G. Genovese et al. / Aquatic

rukwe, A., Kullman, S.W., Hinton, D.E., 2001. Differential biomarker gene and pro-tein expressions in nonylphenol and estradiol-17� treated juvenile rainbowtrout (Oncorhynchus mykiss). Comp. Biochem. Physiol. C 129, 1–10.

rukwe, A., Kullman, S.W., Berg, K., Goksøyr, A., Hinton, D.E., 2002. Molecular cloningof rainbow trout (Oncorhynchus mykiss) eggshell zona radiata protein comple-mentary DNA: mRNA expression in 17�-estradiol- and nonylphenol-treatedfish. Comp. Biochem. Physiol. B 132, 315–326.

rukwe, A., Goksøyr, A., 2003. Eggshell and egg yolk proteins in fish: hepatic proteinsfor the next generation: oogenetic, population, and evolutionary implications ofendocrine disruption. Comp. Hepatol. 2, 4.

rukwe, A., Røe, K., 2008. Molecular and cellular detection of expression of vitel-logenin and zona radiata protein in liver and skin of juvenile salmon (Salmosalar) exposed to nonylphenol. Cell Tissue Res. 331, 701–712.

enson, A.P., Christensen, V.L., Fairchild, B.D., Davis, A.J., 2009. The mRNA for zonapellucida proteins B1 C and D in two genetic lines of turkey hens that differ infertility. Anim. Reprod. Sci. 111, 149–159.

lair, R.M., Fang, H., Branham, W.S., Hass, B.S., Dial, S.L., Moland, C.L., Tong, W., Shi, L.,Perkins, R., Sheehan, D.M., 2000. The estrogen receptor relative binding affinitiesof 188 natural and xenochemicals: structural diversity of ligands. Toxicol. Sci.54, 138–153.

owman, C.J., Kroll, K.J., Gross, T.G., Denslow, N.D., 2002. Estradiol-induced geneexpression in largemouth bass (Micropterus salmoides). Mol. Cell. Endocrinol.196, 67–77.

uckley, J., Maunder, R., Foey, A.D., Pearce, J., Sloman, K., 2009. Bi-parental mucusfeeding: a unique example of parental care in an Amazonin cichlid. Comp.Biochem. Physiol. A 153, S94.

ulukin, E., Meucci, V., Minunni, M., Pretti, C., Intorre, L., Soldani, G., Mascini, M.,2007. An optical immunosensor for rapid vitellogenin detection in plasma fromcarp (Cyprinus carpio). Talanta 72, 785–790.

elius, T., Walther, B.T., 1998. Oogenesis in Atlantic salmon (Salmo salar L.) occursby zonagenesis preceding vitellogenesis in vivo and in vitro. J. Endocrinol. 158,259–266.

elius, T., Matthews, J.B., Giesy, J.P., Zacharewski, T.R., 2000. Quantification of rain-bow trout (Oncorhynchus mykiss) zona radiata and vitellogenin mRNA levelsusing real-time PCR after in vivo treatment with estradiol-17b or a-zearalenol.J. Steroid Biochem. Mol. Biol. 75, 109–119.

hen, C.Y., Wen, T.Y., Wang, G.S., Cheng, H.W., Lin, Y.H., Lien, G.W., 2007. Determin-ing estrogenic steroids in Tapei waters and removal in drinking water treatmentusing high-flow solid-phase extraction and liquid chromatography/tandemmass spectrometry. Sci. Total Environ. 378, 352–365.

hikae, M., Ikeda, R., Hasan, Q., Morita, Y., Tamiya, E., 2003. Effect of alkylphenols onadult male medaka: plasma vitellogenin goes up to the level of estrous female.Environ. Toxicol. Pharmacol. 15, 33–36.

anielian, P.S., White, R., Hoare, S.A., Fawell, S.E., Parker, M.G., 1993. Identification ofresidues in the estrogen receptor that confer differential sensitivity to estrogenand hydroxytamoxifen. Mol. Endocrinol. 7, 232–240.

avid, A., Fenet, H., Gomez, E., 2009. Alkylphenols in marine environments: distri-bution monitoring strategies and detection considerations. Mar. Pollut. Bull. 58,953–960.

el Giacco, L., Diani, S., Cotelli, F., 2000. Identification and spatial distribution of themRNA encoding and egg envelope component of the cyprinid zebrafish Daniorerio, homologous to the mammalian ZP3 (ZPC). Dev. Genes Evol. 210, 41–46.

splugas, S., Bila, D.M., Krause, L.G.T., Dezotti, M., 2007. Ozonation and advancedoxidation technologies to remove endocrine disrupting chemicals (EDCs) andpharmaceuticals and personal care products (PPCPs) in water effluents. J. Haz-ard. Mater. 149, 631–642.

errara, F., Fabietti, F., Delise, M., Funari, E., 2005. Alkylphenols and alkylphenolethoxylates contamination of crustaceans and fishes from the Adriatic Sea(Italy). Chemosphere 59, 1145–1150.

iedler, S., Foerster, M., Glaser, B., Zech, W., 2006. Alkylphenols in sedimentsof the Atlantic rainforest south-west of Sao Paulo, Brazil. Chemosphere 66,212–218.

inn, R.N., Kristoffersen, B.A., 2007. Vertebrate vitellogenin gene duplication in rela-tion to the “3 R hypothesis”: correlation to the pelagic egg and the oceanicradiation of teleosts. PLoS One 24, 169.

olmar, L.C., Gardner, G.R., Schreibman, M.P., Magliulo-Cepriano, L., Mills, L.J.,Zaroogian, G., Gutjahr-Gobell, R., Haebler, R., Horowitz, D.B., Denslow, N.D.,2001. Vitellogenin-induced pathology in male summer flounder (Paralichthysdentatus). Aquat. Toxicol. 51, 431–441.

ox, G.A., 2001. Wildlife as sentinels of human health effects in the Great Lakes–St.Lawrence basin. Environ. Health Perspect. 109, 853–861.

enovese, G., Regueira, M., Lo Nostro, F., Da Cuna, R., Maggese, C., Luquet, C., Towle,D., 2006. cDNA sequencing of vitelline envelope protein and gene expression inCichlasoma dimerus (Teleostei, Perciformes) induced by xenoestrogens. Bull. Mt.Desert Isl. Biol. Lab. Salisb. Cove Maine 45, 127–128.

enovese, G., Regueira, M., Lo Nostro, F., Maggese, C., Towle, D., 2007. Vitelline enve-lope proteins and vitellogenin gene expression in Cichlasoma dimerus (Teleostei,Perciformes) exposed to octylphenol. Bull. Mt. Desert Isl. Biol. Lab. Salisb. CoveMaine 46, 161–162.

enovese, G., Maggesse, M.C., Towle, D., 2008. Differential induction of estrogen

receptors in Cichlasoma dimerus (Teleostei Perciformes) exposed to octylphenol.Bull. Mt. Desert Isl. Biol. Lab. Salisb. Cove Maine 47, 56–57.

ennies, M., Wiesmann, M., Allner, B., Sauerwein, H., 2003. Vitellogenin in carp(Cyprinus carpio) and perch (Perca fluviatilis): purification, characterization anddevelopment of an ELISA for the detection of estrogenic effects. Sci. Total Envi-ron. 309, 93–103.

ology 101 (2011) 175–185

Hyllner, S.J., Silversand, C., Haux, C., 1994. Formation of the vitelline envelopeprecedes the active uptake of vitellogenin during oocyte development in therainbow trout, Oncorhynchus mykiss. Mol. Reprod. Dev. 39, 166–175.

Hyllner, S.J., Westerlund, L., Olsson, P.E., Schoppen, A., 2001. Cloning of rainbow troutegg envelope proteins: members of a unique group of structural proteins. Biol.Reprod. 64, 805–811.

Iguchi, T., Watanabe, H., Katsu, Y., 2001. Developmental effects of estrogenic agentson mice, fish, and frogs: a mini-review. Horm. Behav. 40, 248–251.

IRAM, 2008. Calidad ambiental, Calidad del agua. Determinación de la toxicidadletal aguda de sustancias en peces de agua dulce. Método semiestático. IRAM29112:2008.

Islinger, M., Willimski, D., Völkl, A., Braunbeck, T., 2003. Effects of 17a-ethinylestradiol on the expression of three estrogen-responsive genes andcellular ultrastructure of liver and testes in male zebrafish. Aquat. Toxicol. 62,85–103.

Izquierdo-Rico, M.J., Jiménez-Movilla, M., Llop, E., Pérez-Oliva, A.B., Ballesta, J.,Gutiérrez-Gallego, R., Jiménez-Cervantes, C., Avilés, M., 2009. Hamster zona pel-lucida is formed by tour glycoproteins: ZP1, ZP2, ZP3, and ZP4. J. Proteome Res.8, 926–941.

Jin, Y., Wang, W., Sheng, G.D., Liu, W., Fu, Z., 2008. Hepatic and extrahepatic expres-sion of estrogen-responsive genes in male adult zebrafish (Danio rerio) asbiomarkers of short-term exposure to 17�-estradiol. Environ. Monit. Assess.146, 105–111.

Jobling, S., Sumpter, J.P., 1993. Detergent components in sewage effluent are weaklyestrogenic in to fish: an in vitro study using rainbow trout (Oncorhynchus mykiss)hepatocytes. Aquat. Toxicol. 27, 361–372.

Jobling, S., Sheahan, D., Osborne, J.A., Matthiessen, P., Sumpter, J., 1996. Inhibition oftesticular growth in rainbow trout (Oncorhynchus mykiss) exposed to estrogenicalkylphenolic chemicals. Environ. Toxicol. Chem. 15, 194–202.

Jobling, S., Williams, R., Johnson, A., Taylor, A., Gross-Sorokin, M., Nolan, M., Tyler,C.R., van Aerle, R., Santos, E., Brighty, G., 2006. Predicted exposures to steroidestrogens in U.K. rivers correlate with widespread sexual disruption in wild fishpopulations. Environ. Health Perspect. 114, 32–39.

Kang, I.J., Yokota, H., Oshima, Y., Tsuruda, Y., Yamaguchi, T., Maeda, M., Imada,N., Tadokoro, H., Honjo, T., 2002. Effects of 17b-estradiol on reproduction ofJapanese medaka (Oryzias latipes). Chemosphere 47, 71–80.

Karels, A.A., Brouwer, M., 2003. Cloning, sequencing and phylogenetic classificationof an estrogen receptor alpha (�) subtype of sheepshead minnow (Cyprinodonvariegates). Comp. Biochem. Physiol. B 135, 263–272.

Keenleyside, M.H.A., 1991. Parental care. In: Keenley-side, M.H.A. (Ed.), CichlidFishes. Behaviour, Ecology and Evolution. Chapman and Hall, New York, pp.191–208.

Kinnberg, K., Korsgaard, B., Bjerregaard, P., Jespersen, ´A., 2000. Effects of nonylphe-nol and 17�-estradiol on vitellogenin synthesis and testis morphology in maleplatyfish Xiphophorus maculates. J. Exp. Biol. 203, 171–181.

Kishida, M., Specker, J.L., 1994. Vitellogenin in the surface mucus of tilapia (Ore-ochromis mossambicus): possibility for uptake by the free-swimming embryos.J. Exp. Zool. 268, 259–268.

Khan, I.A., Thomas, P., 1998. Estradiol-17� and o,p′-DDT stimulate gonadotropinrelease in Atlantic croaker. Mar. Environ. Res. 46, 149–152.

Knudsen, F.R., Arukwe, A., Pottinger, T.G., 1998. The in vivo effect of combinationsof octylphenol, butylbenzylphthalate and estradiol on liver estradiol receptormodulation and induction of zona radiate proteins in rainbow trout: no evidenceof synergy. Environ. Pollut. 103, 75–80.

Krauss, G., 2001. Biochemistry of Signal Transduction and Regulation. Wiley-VCHVerlag GmbH & Co, Weinheim.

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the headof bacteriophage T4. Nature 227, 680–685.

Larsson, D.G.J., Mayer, I., Hyllner, S.J., Forlin, L., 2002. Seasonal variations of vitellineenvelope proteins, vitellogenin, and sex steroids in male and female eelpout(Zoarces viviparus). Gen. Comp. Endocrinol. 125, 184–196.

Lee, C., Na, J.G., Lee, K., Park, K., 2002. Choriogenin mRNA induction in male medakaOryzias latipes as a biomarker of endocrine disruption. Aquat. Toxicol. 61,233–324.

Lowry, O.M., Rosenbrough, N.J., Farr, L., Randall, R.J., 1951. Protein measurementwith the phenol reagent. J. Biol. Chem. 193, 265–275.

Maltais, D., Roy, R.L., 2009. Purification and partial characterization of vitellogeninfrom shorthead redhorse (Moxostoma macrolepidotum) and copper redhorse(Moxostoma hubbsi) and detection in plasma and mucus with a heterologousantibody. Fish Physiol. Biochem. 35, 241–254.

Meijide, F.J., 2007. Desarrollo gonadal y diferenciación sexual en Cichlasoma dimerus(Teleostei, Perciformes). Efectos de la exposición a 4-tert-octilfenol y 17�- estra-diol. Doctoral Thesis in Biological Sciences, FCEyN, UBA, Buenos Aires, 180pp.

Meijide, F.J., Guerrero, G.A., 2000. Embryonic and larval development of asubstrate-brooding cichlid Cichlasoma dimerus (Heckel, 1840), under laboratoryconditions. J. Zool. 252, 481–493.

Menuet, A., Le Page, Y., Torres, O., Kern, L., Kah, O., Pakdel, F., 2004. Analysis ofthe estrogen regulation of the zebrafish estrogen receptor (ER) reveals distincteffects of ERalpha ERbeta1 and ERbeta2. J. Mol. Endocrinol. 32, 975–986.

Meucci, V., Arukwe, A., 2005. Detection of vitellogenin and zona radiate protein

expressions in surface mucus of immature juvenile Atlantic salmon (Salmo salar)exposed to waterborne nonylphenol. Aquat. Toxicol. 73, 1–10.

Milnes, M.R., Bermudez, D.S., Bryan, T.A., Edwards, T.M., Gunderson, M.P., Larkin,I.L.V., Moore, B.C., Guillette, L.J., 2006. Contaminant-induced feminization anddemasculinization of nonmammalian vertebrate males in aquatic environ-ments. Environ. Res. 100, 3–17.

Toxic

M

M

M

NP

P

P

R

R

R

R

R

S

S

S

S

S

G. Genovese et al. / Aquatic

odig, C., Modesto, T., Canario, A., Cerdà, J., von Hofsten, J., Olsson, P.-E., 2006.Molecular characterization and expression pattern of zona pellucida proteinsin gilthead seabream (Sparus aurata). Biol. Reprod. 75, 717–725.

odig, C., Westerlund, L., Olsson, P.E., 2007. Oocyte zona pellucida proteins. In:Babin, P.J., Cerdà, J., Lubzens, E. (Eds.), The Fish Oocyte, from Basic Studies toBiotechnological Applications. Springer, Dordrecht, pp. 113–140.

oncaut, N., Lo Nostro, F.L., Maggese, M.C., 2003. Vitellogenin detection in sur-face mucus of the South American cichlid fish Cichlasoma dimerus (Heckel,1840) induced by estradiol-17�. Effects on liver and gonads. Aquat. Toxicol. 63,127–137.

elson, J.S., 2006. Fishes of the World, 4th ed. Wiley & Sons Inc., NJ, USA, p. 622.andolfi, M., Canepa, M., Meijide, F.J., Alonso, F., Rey Vazquez, G., Maggese, M.C.,

Vissio, P.G., 2009. Studies on the reproductive and developmental biology ofCichlasoma dimerus (Perciformes, Cichlidae). Biocell 33 (1), 1–18.

edersen, R.T., Hill, E.M., 2002. Tissue distribution and depuration of 4-tert-octylphenol residues in the cyprinid fish, Scardinius erythrophthalmus. Environ.Sci. Technol. 36, 3275–3283.

edersen, K.H., Pedersen, S.N., Pedersen, K.L., Korsgaard, B., Bjerregaard, P., 2003.Estrogenic effect of dietary 4-tert-octylphenol in rainbow trout (Oncorhynchusmykiss). Aquat. Toxicol. 62, 295–303.

egueira, M., 2008. Efectos de la exposición a 4-tert-octifenol sobre la vitelogeninay proteínas de envoltura vitelina en machos de Cichlasoma dimerus (Teleostei,Perciformes). Undergraduate Thesis in Biological Sciences, FCEyN, UBA, BuenosAires, 91pp.

ey Vázquez, G., Meijide, F.J., Da Cuna, R.H., Lo Nostro, F.L., Piazza, Y.G., Babay, P.A.,Trudeau, V.L., Maggese, M.C., Guerrero, G.A., 2009. Exposure to waterborne 4-tert-octylphenol induces vitellogenin synthesis and disrupts testis morphologyin the South American freshwater fish Cichlasoma dimerus (Teleostei, Perci-formes). Comp. Biochem. Physiol. C 150, 298–306.

hee, J.S., Kang, H.S., Raisuddin, S., Hwang, D.S., Han, J., Kim, R.O., Seo, J.S., Lee,Y.M., Park, G.S., Lee, J.S., 2009. Endocrine disruptors modulate expression ofhepatic choriogenin in the hermaphroditic fish, Kryptolebias marmoratus. Comp.Biochem. Physiol. C 150, 170–178.

ibeiro, V.M.A., Bazzoli, N., Maria, T.A., Santos, G.B., 2006. Ultrastructural changesin female hepatocytes during ovarian maturation of Steindachnerina insculpta(Pisces: Curimatidae). Braz. J. Biol. 66, 957–962.

obinson, C.D., Brown, E., Craft, J.A., Davies, I.M., Moffat, C.F., 2004. Effects of pro-longed exposure to 4-tert-octylphenol on toxicity and indices of oestrogenicexposure in the sand goby (Pomatoschistus minutes, Pallas). Mar. Environ. Res.58, 19–38.

aradha, B., Mathur, P.P., 2006. Effect of environmental contaminants on male repro-duction. Environ. Toxicol. Pharmacol. 22, 90–96.

chlenk, D., 1999. Necessity of defining biomarkers for use in ecological risk assess-ments. Mar. Pollut. Bull. 39, 48–53.

chütz, M., Barlow, G.W., 1997. Young of the Midas cichlid get biologically activenonnutrients by eating mucus from the surface of their parents. Fish Physiol.Biochem. 16, 11–18.

chwaiger, J., Spieser, O.H., Bauer, C., Ferling, H., Mallow, U., Kalbfus, W., Negele,R.D., 2000. Chronic toxicity of nonylphenol and ethinylestradiol: haematologicaland histopathological effects in juvenile Common carp (Cyprinus carpio). Aquat.Toxicol. 51, 69–78.

onnenschein, C., Soto, A.M., 1998. An updated review of environmental estrogenand androgen mimics and antagonists. J. Steroid Biochem. Mol. Biol. 65, 143–150.

ology 101 (2011) 175–185 185

Spargo, S.C., Hope, R.M., 2003. Evolution and nomenclature of the zona pellucidagene family. Biol. Reprod. 68, 358–362.

Sundt, R.C., Baussant, T., Beyer, J., 2009. Uptake and tissue distribution of C4–C7

alkylphenols in Atlantic cod (Gadus morhua): relevance for biomonitoring ofproduced water discharges from oil production. Mar. Pollut. Bull. 58, 72–79.

Toft, G., Baatrup, E., 2001. Sexual characteristics are altered by 4-tert-octylphenoland 17beta-estradiol in the adult male guppy (Poecilia reticulata). Ecotoxicol.Environ. Safety 48, 76–84.

Tollefsen, F.E., Mathisen, R., Stenersen, J., 2002. Estrogen mimics bind with similaraffinity and specificity to the hepatic estrogen receptor in Atlantic salmon (Salmosalar) and rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 126,14–22.

Van den Belt, K., Wester, P.W., van der Ven, L.T., Verheyen, R., Witters, H.,2002. Effects of ethynylestradiol on the reproductive physiology in zebrafish(Danio rerio): time dependency and reversibility. Environ. Toxicol. Chem. 21,767–775.

Van den Belt, K., Verheyen, R., Witters, H., 2003. Effects of 17�-ethynylestradiol in apartial life-cycle test with zebrafish (Danio rerio): effects on growth, gonads andfemale reproductive success. Sci. Total Environ. 309, 127–137.

van der Oost, R., Beyer, J., Vermeulen, N.P.E., 2003. Fish bioaccumulation andbiomarkers in environmental risk assessment: a review. Environ. Toxicol. Phar-macol. 13, 57–149.

Wang, H., Tan, J.T.T., Emelyanov, A., Korzh, V., Gong, Z., 2005. Hepatic and extra-hepatic expression of vitellogenin genes in the zebrafish Danio rerio. Gene 356,91–100.

Wassarman, P.M., Jovine, L., Litscher, E.S., Qi, H., Williams, Z., 2004. Egg-sperm inter-actions at fertilization in mammals. Eur. J. Obstet. Gynecol. Reprod. Biol. 115,S57–S60.

White, R., Jobling, S., Hoare, S.A., Sumpter, J.P., Parker, M.G., 1994. Environmen-tally persistent alkylphenolic compounds are estrogenic. Endocrinology 135,175–182.

Woods, M., Kumar, A., Barton, M., Woods, A., Kookana, R., 2009. Localisation of estro-gen responsive genes in the liver and testis of Murray rainbowfish Melanotaeniafluviatilis exposed to 17�-estradiol. Mol. Cell. Endocrinol. 303, 57–66.

Yadetie, F., Arukwe, A., Goksøyr, A., Male, R., 1999. Induction of hepatic estrogenreceptor in juvenil Atlantic salmon in vivo by the environmental estrogen, 4-nonylphenol. Sci. Total Environ. 233, 201–210.

Yamagami, K., Hamazaki, T.S., Yasumasu, S., Masuda, K., Iuchi, I., 1992. Molecularand cellular basis of formation, hardening and breakdown of the egg envelopein fish. Int. Rev. Cytol. 136, 51–92.

Ying, G.G., Williams, B., Kookana, R., 2002. Environmental fate of alkylphenols andalkylphenol ethoxylates – a review. Environ. Int. 28, 215–226.

Zaroogian, G., Gardner, G., Borsay Horowitz, D., Gutjahr-Gobell, R., Haebler, R., Mills,L., 2001. Effect of 17�-estradiol, o,p′-DDT, octylphenol and p,p′-DDE on gonadaldevelopment and liver and kidney pathology in juvenile male summer flounder(Paralichthys dentatus). Aquat. Toxicol. 54, 101–112.

Zha, J., Wang, Z., Wang, N., Ingersoll, C., 2007. Histological alteration and vitel-

logenin induction in adult rare minnow (Gobiocypris rarus) after exposure toethynylestradiol and nonylphenol. Chemosphere 66, 488–495.

Zha, J., Sun, L., Zhou, Y., Spear, P.A., Ma, M., Wang, Z., 2008. Assessment of17a-ethinylestradiol effects and underlying mechanisms in a continuous, multi-generation exposure of the Chinese rare minnow (Gobiocypris rarus). Toxicol.Appl. Pharmacol. 226, 298–308.