draft - tspace repository: home · 2019-01-11 · draft article type: original article melatonin...

Draft

Melatonin attenuates caspase-dependent apoptosis in the thoracic aorta by regulating element balance and oxidative

stress in pinealectomized rats

Journal: Applied Physiology, Nutrition, and Metabolism

Manuscript ID apnm-2018-0205.R1

Manuscript Type: Article

Date Submitted by the Author: 06-Jun-2018

Complete List of Authors: Doğanlar, Zeynep Banu; Trakya Universitesi Tip Fakultesi, Uzun, Metehan; Canakkale Onsekiz Mart Universitesi Tip FakultesiOvalı, Mehmet ; Canakkale Onsekiz Mart Universitesi Tip FakultesiDogan, Ayten; Trakya Universitesi Tip FakultesiOngoren, Gulin; Trakya Universitesi Tip FakultesiDoğanlar, Oğuzhan; Trakya Universitesi Tip Fakultesi

Keyword: Oxidative stress, Intrinsic and extrinsic apoptosis signalling, Caspases, Melatonin

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

https://mc06.manuscriptcentral.com/apnm-pubs

Applied Physiology, Nutrition, and Metabolism

Draft

Article Type: Original Article

Melatonin attenuates caspase-dependent apoptosis in the thoracic aorta by regulating

element balance and oxidative stress in pinealectomized rats

Zeynep Banu Doğanlar1*, Metehan Uzun2, Mehmet Akif Ovali2, Ayten Dogan1, Gulin

Ongoren1 and Oğuzhan Doğanlar 1

1 Department of Medical Biology, Faculty of Medicine, Trakya University, 22030 Edirne,

Turkey

2 Department of Physiology, Faculty of Medicine, Çanakkale Onsekiz Mart University,

Çanakkale, Turkey

Full names of authors with e-mail addresses

Zeynep Banu Doğanlar, [email protected]

Metehan Uzun, [email protected]

Mehmet Akif Ovalı, [email protected]

Ayten Dogan, [email protected]

Gulin Ongoren, [email protected]

Oğuzhan Doğanlar, [email protected]

Corresponding Author

*Assoc.Prof. Dr. Zeynep Banu DOĞANLAR

Trakya University, Faculty of Medicine, Department of Medical Biology,

Edirne, Turkey. [email protected]

Tel: +90 284 2357653

Fax: +90 284 2357653

Page 1 of 35



Draft

Abstract

The aim of this study is to explain the possible mechanisms by which melatonin deficiency

results in cardiovascular injury and to investigate the effects of melatonin administration on

important signalling pathways and element equilibrium in the thoracic aorta (TA). For this

purpose, we analysed the cellular and molecular effects of melatonin deficiency or

administration on the oxidative stress, DNA damage, molecular chaperone response and

apoptosis induction in TA tissues of pinealectomised rats using ELISA, RAPD, qRT-PCR and

Western blot assays. The results showed that melatonin deficiency led to an imbalance in

essential element levels, unfolded/misfolded proteins, increased lipid peroxidation, and

selectively induced caspase-dependent apoptosis in thoracic aorta tissues without significantly

affecting the BCL2/BAX ratio (PNX:2.28, PNX+M:2.73). In this condition, the genomic

template stability (80.22%) was disrupted by the significantly increased oxidative stress, and

stress-specific HSP70 (20.96-fold), TNF-α (1.73-fold), caspase 8 (2.03-fold), and caspase 3

(2.87-fold) were markedly overexpressed compared to SHAM group. Melatonin treatment

played a protective role in cell apoptosis and inhibited oxidative damage. In addition,

melatonin increased the survivin level and the regulation of element equilibrium in the TA

tissues. The results of the study indicate that melatonin deficiency induces TNF-α-related

extrinsic apoptosis signals and that the administration of pharmacological doses of melatonin

attenuates cardiovascular toxicity by regulating the increase in the rate of oxidative stress-

related cellular and molecular damage-induced apoptosis caused by melatonin deficiency in

the TA tissue of Sprague-Dawley rats.

Keywords: Oxidative stress, Intrinsic and extrinsic apoptosis signalling, Caspases, Melatonin

Page 2 of 35



Draft

Introduction

Atherosclerosis and atherosclerotic vascular diseases are key components of cardiovascular

diseases, which affect the quality of life, and are known to be the most prevalent major causes

of death (Favero et al. 2014). Recent studies have demonstrated that apoptosis, lipid

deposition, vascular reactive oxygen species (ROS), inflammation, endothelial damage and

vascular muscle cell migration are the major causative factors of the progression of

atherosclerosis (Son et al. 2007; Tengattini et al. 2008). In the development of atheromatous

diseases, vascular calcification occurs in the intima layer of vessels (Wexler et al. 1996).

Molecules such as survivin (Blanc-Brude et al. 2007), heat-shock proteins (Madden et al.

2010), TNF-α, Bax, caspases, oxidized low-density lipoprotein, advanced glycation end

products (Luu et al. 2007; Kim et al. 2014; Qin et al. 2015), Cu/Zn superoxide dismutase

(SOD) and calcium are related to atherosclerosis or vascular calcification (Tang et al. 2007;

Wei et al. 2013).

Melatonin is a hormone synthesized and secreted as a major product of the pineal gland and it

has different physiological effects on many tissues and organs, including the cardiovascular

system, in a receptor-dependent or receptor-independent manner (Reiter et al. 2010; Ovali

and Uzun 2017). Melatonin has a protective effect on the cardiovascular system against

oxidative damage, endothelial dysfunction, vascular inflammation and systemic hypertension

(Hung et al. 2013), which are all triggered by increases in both the tissue and plasma levels of

ROS, pro-inflammatory factors and leukocyte adhesion molecules (Paulis and Šimko 2007;

Reiter et al. 2009). Stress, hypertension, cancer, obesity, lifestyle and several other factors

cause melatonin deficiency in either a chronic or a transient form. Melatonin deficiency

affects a broad range of individuals, including the large sector of the population that uses

electronic devices such as phones, tablets and computers until morning, shift workers, jet

travellers, and older people living in the modern digital world (Turek and Gillette 2004).

Page 3 of 35



Draft

Therefore, melatonin use for melatonin deficiency-related stress and disorders has increased

significantly in recent years. However, whether that exogenously taken melatonin can reverse

the negative micro-environmental conditions that occur in the absence of melatonin has not

yet been clearly demonstrated. Recent studies conducted using several cell and animal models

reported that the administration of melatonin provides great defence against oxidative stress

(Reiter et al. 2005; Galano et al. 2011). Moreover, melatonin is known to induce the

expression of antioxidant genes, such as CuZn-SOD, manganese superoxide dismutase (Mn-

SOD), glutathione peroxidase and catalase (CAT) and anti-inflammatory pathways

(Rodriguez et al. 2004; Mauris et al. 2013). Melatonin prevents mitochondrial membrane

disruption and inhibits the release of cytochrome- c to reduce caspase activation and

apoptosis. Moreover, melatonin markedly decreases caspase 3 expression, suppresses DNA

damage (Zhang et al. 2013; Yang et al. 2014) and reduces cardiomyocyte apoptosis

(Asghari et al. 2016).

The effects of melatonin administration on the cardiovascular system have been extensively

investigated, but the effects of melatonin deficiency or external melatonin administration on

specific cell defence systems, essential element equilibrium and the underlying molecular

mechanisms of vascular toxicity and caspase-dependent apoptosis in the thoracic aorta (TA)

tissues still need to be determined. This study aims to explain the possible mechanisms by

which melatonin deficiency results in vascular injury and to investigate the role of melatonin

administration in alleviating TA apoptosis with a specific focus on oxidative stress markers,

DNA damage, heat-shock protein families, element equilibrium and both intrinsic and

extrinsic apoptosis pathways in pinealectomized rats.

Page 4 of 35



Draft

Material and Methods

Experimental study

The experimental study was performed in the laboratories of Canakkale Onsekiz Mart

University Experimental Research Center (COMUDAM). Experimental animals obtained

from COMUDAM were licensed by the approval of the Canakkale Onsekiz Mart University

Animal Care and Use Ethical Committee (Protocol number: 2014/11-10).

Animal material and study design

Fifteen adult male Sprague-Dawley rats, weighing 200–250 g, were used as animal subjects

The animals were housed in standard cages with food and water ad libitum, under a 12:00 L-

12:00 D cycle (8:00 am to 8:00 pm) and controlled temperature of 22 ± 2 °C, and were

randomly divided into three groups: Control (SHAM; n=5), pinealectomy (PNX; n=5), and

pinealectomy+melatonin (PNX+M; n=5). After one week of adaptation, ten animals were

subjected to a pinealectomy according to Canpolat et al. (2001), and the remaining animals

received a sham operation. After three days of recovery, vehicle solution (physiological saline

containing 5% ethanol) was injected into the animals of the SHAM and PNX groups, and

melatonin (absolute GR for analysis, Merck, Germany) was injected into the animals of the

PNX+M group (5 mg/kg, subcutaneously). Melatonin was dissolved in physiological saline

containing 5% ethanol and freshly prepared and applied every day to the PNX+M group at

10:00-10:30 a.m for 21 days (Ovali and Uzun 2017). Experimental procedures were

performed in all groups at the same time and under the same conditions. Thoracic aorta (TA)

tissue was harvested from euthanised rats on the last day of the experiment (day 21) at 10:00

a.m. and was washed with sterile physiological saline solution before being placed into

Page 5 of 35



Draft

cryotubes. The operation was performed under sterile conditions to minimise any

contamination risk. The cryotubes were frozen in liquid nitrogen and then stored at -80 °C

until experimental analysis was performed.

Determination of the Melatonin Level in TA Tissue

For each group, five thoracic aorta samples, which were frozen in liquid nitrogen, were lysed

in cold conditions (4 °C) with a TissueLyser LT lysing system (TissueLyser LT, Qiagen,

USA) in a 2-mL extraction tube for 2 min. Afterwards, approximately 50 mg of powder,

which was crushed with tungsten carbide beads, was mixed with 500 µL of extraction solvent

(methanol/ultrapure water, 20:80 (v/v) with 0.2% formic acid) in an Eppendorf tube. This

mixture was vortexed immediately with cooling and shaking at 1250 rpm (Bioneer Mixing

Block MB-102) for 10 min under dark conditions. After centrifugation (15000 rpm for 10 min

at 4 °C), the supernatant was filtered through a 0.22-µm PTFE filter. Samples (100 µL) were

analysed by a MicroLC-ESI-triple quadrupole TOF system (API 4600 Q-TOF; ABI Sciex,

USA). During this analysis, melatonin standards (BML-NS520-000, Enzo Life Sciences) were

individually loaded into the Q-TOF system to determine the fragments and analysis

conditions. Afterwards, mixtures of the five amines were prepared with concentrations

ranging from 0.5 to 100 µg/kg to set up six points of calibration. All data files were opened

with PeakView (ABI-Sciex, USA) software, and the mass and fragment results were checked

with Master View (ABI-Sciex, USA) options. The mass and specific fragments were exported

to MultiQuant software (ABI-Sciex, USA) to generate calibration curves for each type of

biogenic amine. Samples (2 µL) were analysed by MicroLC-Q-TOF using an Eksigent

MicroLC 200 Plus system coupled to an Applied Biosystems 4600 Triple Quadrupole TOF

mass spectrometer. Chromatographic separation was carried out on an Eksigent 2.7 µ*3 cm

C18 halo column at 30 °C. The isocratic flow was as follows: 20% A (99.8% UPW:0.2%

formic acid) to 80% B (99.8% acetonitrile:0.2% formic acid) over 3 min. Biogenic amine

Page 6 of 35



Draft

analyses were performed with a DuoSpray source and electrospray ionization (ESI) probe. An

IDA method with a TOF-MS survey of 70 ms and up to 20 dependent TOF-MS/MS scans of

25 ms accumulation time was used, the mass range was set to 100-960 Da for MS, and the

product ion mass range was set to 30-960 Da for MSN. The curtain gas was set at 20 a.u., the

source temperature was 400 °C, and ion source gases 1 and 2 were both 30 a.u. The

declustering potential was set at 100 V. The source voltage was 5500 V. A collision energy

(CE) of 20 V and collision energy spread (CES) of 15 V were used. The main and precursor

ion and calibration curve of melatonin were 232 [174] and y=92.13602x+1302.73990,

R2=0.9966, respectively.

Determination of elements

The 20 mg of powder obtained from the previous method used for the thoracic aorta samples

from each group was digested with 5+1 mL Suprapur 65% nitric acid solution and ultrapure

99% H2O2 with a CEM Mars 6 (CEM Corporation, USA) microwave digestion system

(power: 1600 W; time: 15 min; temp: 180°C; pressure: 200 bar; animal tissue procedure,

CEM application method). Digested solutions were diluted with ultrapure water, and the final

volume of the solution was adjusted to 100 mL. A calibration curve was generated in eight

points between 0.100 and 800 µg/kg using Agilent ICP-MS certified mixture standards (part

number: 5183-4688). The amounts of Li, Mg, Ca, Mn, Cu and Zn were determined by

inductively coupled plasma mass spectrometry (ICP-MS, 7700 xx, Agilent Technologies,

USA)

Determination of Malondialdehyde (MDA)

The MDA level of TA tissues was determined by the thiobarbituric acid (TBA)/trichloroacetic

acid (TCA) reactive substance assay, as described by Kheradmand et al. (2009). The

absorbance of the final supernatant was read at 532 nm after subtraction of the non-specific

Page 7 of 35



Draft

absorption at 600 nm, and the MDA concentration was calculated using 155 mM-1 cm-1 as the

extinction coefficient. The MDA levels were given as nmol per gram of TA tissue.

DNA extraction procedures and RAPD assay

Genomic and mitochondrial DNA were extracted using a DNeasy Tissue Blood Kit (Qiagen,

Hilden, Germany) according to the manufacturer's instructions. The total genomic DNA was

diluted with nuclease-free water to a concentration of 25 ng/µL, and the diluted DNA was

used as the template DNA for the PCR reaction. Standard 50 µL PCR reactions were

performed using 2 µL (50±10 ng) of template DNA, 1 µL of each primer, 25 µL of DreamTaq

Master Mix (Thermo, K1071) and nuclease-free water (Sigma, W4502). The primer names

and sequences and the PCR conditions are given in Table 1. After amplification of the DNA,

15 µL of product with 3 µL of loading dye (R0611, Fermentas) was loaded onto a 2% agarose

gel with ethidium bromide in 2 × TAE (Tris 1.6 M, acetic acid 0.8 M, and EDTA 40 mM)

buffer. The molecular weight standard Gene Ruler 100 bp plus DNA (Thermo, SM0241) was

used according to the manufacturer's instructions. The DNA bands were visualised with a UV

transilluminator (Vilber Lourmat, Quantum, France), and the sizes of all of the bands were

calculated with the BIO-PROFIL, BIO-1D++ programme. Genomic template stability (GTS

(%)) was calculated using the following equation: GTS % =100-(100a/n), where n is the

number of bands detected in control DNA profiles and a is the average number of changes in

the DNA profiles.

Isolation of total RNA, cDNA synthesis and Quantitative real-time PCR (qRT-PCR)

analysis

Total RNA was extracted using a PureLink® RNA Mini Kit (Life Technologies, USA)

according to the manufacturer's instructions. The extracted RNA concentrations were

measured by the Qubit® Fluorometer (Life Technologies, USA). The concentration of total

Page 8 of 35



Draft

RNA was adjusted to 100 ng/µL for the synthesis of the first strand of cDNA using a High-

Capacity cDNA Reverse Transcription Kit (Life Technologies, USA). cDNA synthesis was

performed using an Applied Biosystems® Veriti® thermal cycler (Step 1: 25°C, 10 min; Step

2: 37°C, 120 min; Step 3: 85°C, 5 min). The cDNA was stored at -20°C for subsequent steps

of the analysis procedure.

Expression levels of the antioxidant system components [CuZn-superoxide dismutase (CuZn-

SOD), Mn-superoxide dismutase (Mn-SOD), catalase (CAT) and glutathione synthetase

(GS)], heat-shock proteins (HSP27, HSP60, HSP72 and HSP90) and apoptosis pathway

components [tumour necrosis factor alpha (TNF-α), B-cell lymphoma 2 (BCL2), BCL2-

associated X (BAX), apoptotic protease-activating factor 1 (APAF 1), cytochrome complex

(Cyt-C), caspase 3 and caspase 8] in thoracic aorta tissues of control (SHAM), pinealectomy

(PNX) and pinealectomy plus melatonin (PNX+M) rats were analysed by qRT-PCR using

SYBR® Select Master Mix (Life Technologies, USA) on an ABI Step One Plus Real-Time

PCR system with the primer pairs and PCR conditions shown in Table 1. Gene expression

levels were determined as the relative fold change compared to the control and normalised to

the GADPH mRNA expression. The comparative cycle threshold (2-∆∆Ct) method (User

Bulletin 2, Applied Biosystems, CA) was performed to analyse the expression levels of

mRNAs.

Protein extraction procedure and Western blot assay

Three 30-40 mg thoracic aorta pieces, which were frozen in liquid nitrogen, from each group

were used in cold conditions (4 °C) with the TissueLyser LT lysing system (Qiagen,

TissueLyser LT, USA) in a 2-mL extraction tube for 2 min. Afterwards, approximately 20 mg

of powder, which was crushed with tungsten carbide beads, was mixed with 500 µL of RIPA

(25 mM Tris/HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1%

SDS) lysis buffer containing a protease inhibitor cocktail (Santa Cruz Biotechnology, Santa

Page 9 of 35



Draft

Cruz, CA). The lysates were centrifuged at 14,000 rpm for 30 min at 4°C. Fifty-microgram

protein samples, which were measured at A280 using a nanodrop spectrometer (Optisen Nano

Q, Mecasys, Korea), were loaded on a NuPAGE® Bis-Tris polyacrylamide gel (10%),

electrophoresed, and transferred to PVDF membranes (Life Technologies, USA) after

denaturation. The membranes were incubated in 5% milk in TBS buffer. Primary antibodies,

including antibodies against HSP70, TNF-α, caspase 8, caspase 3 and β-actin (Santa Cruz

Biotechnology, Santa Cruz, CA), were diluted to 1:100-1:1000 in antibody binding buffer

overnight in a dark room and then incubated in a secondary antibody solution containing goat

anti-mouse IgG-HRP and goat anti-rabbit IgG-HRP for 1 h. The washed and enhanced protein

bands of immunoblots were observed with a chemiluminescence gel imaging system (Bio-

Rad ChemiDoc MP System, USA).

Statistical analyses

The differences in the melatonin, element, and MDA levels, the relative protein density and

the relative fold change in gene expression due to melatonin deficiency were compared using

the t-test and analysis of variance (ANOVA) with Duncan's separation of means test using

SPSS 20 (IBM, USA) software with significance set at the level of P≤ 0.05. Correlations

between melatonin-gen expressions and melatonin-tissue element contents were analysed by

bivariate correlation test with Pearson correlation coefficient and a two-tailed test of

significance at significance levels of P≤0.05 and 0.001. The array analyses were performed

with Array Mining software (Glaab et al. 2009) to compare the relative fold change of both

physiological and molecular data to the respective control (Control=1) with normalisation to

Log10(x+1), and the eBayes and Pearson correlation options were used for hierarchical

clustering and correlation analysis, respectively

Results

Page 10 of 35



Draft

Effects of pinealectomy and melatonin treatment on the tissue melatonin level of TA

In this study, we determined the TA melatonin level in the control and experiment groups

using a MicroLC-ESI-triple quadrupole TOF system (MicroLC-Q-TOF). The melatonin level

significantly decreased in the PNX group (0.44±0.60 ng mg-1), compared with the SHAM

group. Compared with that in the PNX group, melatonin administration (PNX+M) increased

the melatonin level in the TA tissue by threefold (1.40±0.16 ng mg-1), but the amount of this

melatonin was less than the level in the SHAM group (6.28±0.74 ng mg-1) (Table 2).

Effects of pinealectomy and melatonin treatment on the element contents of TA

Inductively coupled plasma mass spectrometry (ICP-MS) analysis showed that both PNX and

melatonin treatment induced important and variable changes at the tissue element levels.

Whereas Mg, Ca, Cu, Zn and Mn concentrations were significantly increased by

pinealectomy, melatonin treatment to PNX animals resulted in a significant decrease at the

tissue level of elements compared with the SHAM (P<0.05) (Table 2). However, the

melatonin treatment (PNX+M) could only stabilise the Zn and Ca element levels compared

with the SHAM in the TA tissues (Table 2). The values of all the element contents of

PNX+M animals receiving melatonin were significantly low in the PNX (t-test;P<0.05).

Nevertheless, no significant correlation was found between the tissue element contents and

the melatonin levels.

Effects of PNX and melatonin treatment on the oxidative stress parameters in the TA

tissue

The MDA level in the rat TA tissue is shown in Figure 1. Melatonin deficiency had a

significant effect on the MDA content. The mean level of MDA in the TA was approximately

two-fold higher in the PNX group (12.14±1.63 nmol g-1) than in both the SHAM and PNX+M

Page 11 of 35



Draft

groups. In the TA tissues, PNX caused a significant increase in the expression of CuZn-SOD,

GS, Mn-SOD and HSP70 (5.94-, 1.99- and 5.82- and 20.96-fold, respectively) in comparision

with the SHAM group. Although, a significant reduction was observed in the relative

expression of Mn-SOD and HSP 70 in the melatonin-treated (PNX+M) groups compared with

the PNX animals, these expressions were still higher than those in the SHAM.

No significant differences in the relative expression of small HSPs were detected between the

SHAM and treatment groups in the TA tissues of rats. Both applications caused a significant

decrease in the expression level of other HSPs at 60 kD and 90 kD (Figure 2, Table 2). The

Pearson correlation analysis showed that a significant negative correlation was found between

the melatonin and expressions of CuZn-SOD (-0.738, P=0.004), CAT (-0.593, P=0.004), Mn-

SOD (-0.815, P=0.001), HSP70 (-0.644, P=0.018), and that a positive correlation was

observed only in HSP60 (0.732, P=0.004) and HSP90 (0.583, P=0.036).

Effects of pinealectomy and melatonin treatment on the genomic template stability in

the TA tissue In this study, the effects of PNX and PNX+M on DNA profiles were

determined by RAPD analysis. In addition, the appearance/disappearance of bands and the

decrease/increase in the intensities of the bands compared with those in the SHAM group

were investigated. Of the 20 oligonucleotide primers evaluated to screen the genomic DNA

isolated from both TA and rats for polymorphism, 2 primers yielded no band, 6 primers

produced inconsistent results, and 12 primers generated consistently positive results. Among

the 12 primers, 8 informative and stress-specific primers were selected for use in the analyses

of RAPD profiles (Figure 3, Table 3). In total, 47 bands belonging to the control group and 1

new band were observed, and 16 losses of bands belonging to the treated group, ranging in

molecular size from 185 (SP1) to 1398 (RAPD6) were amplified by 8 primers in the TA

tissue. The highest number of band changes was detected in the PNX animals in the TA

Page 12 of 35



Draft

tissues, and the band patterns observed in the RAPD-PCR exhibited significant differences

between the PNX and PNX+M animals, with changes in the band intensity, the loss of normal

bands and the appearance of new bands. Genomic template stability (GTS) was used as an

indicator to detect the changes in the RAPD band profiles, providing a rapid response under

the pressure of stress factors stemming from DNA repair and replication mechanisms in

tissues. The GTS (%) of the total DNA of the TA tissue was calculated from the band changes

in the eight primers tested. In the TA tissue, pinealectomy operation affected the band

profiles, and GTS decreased to 80.22%. In this study, the GTS values were regulated by

melatonin treatment in PNX animals, , and the value was 96.61% in the TA tissues (Figure

3).

PNX induces TNF-α-related extrinsic apoptosis and melatonin treatment regulates

apoptotic cell death

Western blotting and quantitative real-time polymerase chain reaction (qRT-PCR)

amplification were employed to measure the expression of intrinsic and extrinsic apoptosis

genes and proteins. The qRT-PCR results revealed no signs of Apaf1 and Cyt-c expression

during the study. Furthermore, a significantly lower BAX/BCL2 ratio revealed the decrease in

mitochondrial apoptosis in the PNX and PNX+M animals in comparision with the SHAM

group. Pinealectomy triggered significant changes in the TNF-α (1.73-fold)/caspase 8 (2.03-

fold)/caspase 3 (2.87-fold) apoptosis signalling in comparision with their respective controls

(Table 2). The apoptosis inhibitor survivin gene was significantly downregulated in PNX in

comparision with the SHAM group. Our result demonstrated that the melatonin treatment

after PNX could suppress the overexpression of both caspase 3 and caspase 8 in PNX

animals. Moreover, the survivin (1.12-fold) gene expression level was the same as that of the

SHAM in the PNX+M group (Figure 2, Table 2).

Page 13 of 35



Draft

Following gene expression studies, we intended to determine whether some proteins involved

in the extrinsic apoptosis signalling were released. Western blot analysis was used to monitor

the release of TNF-α, caspase 3, caspase 8 and the stress-specific molecular chaperon HSP70

isolated from the TA tissues. The results indicated that PNX directly caused the upregulation

of both caspase 3 and caspase 8 in comparision with that in the SHAM animals. These results

provided insight into the mechanism of melatonin action, in which TNF-α/caspase 8/caspase 3

extrinsic apoptosis signalling appeared to be a direct target of melatonin for the induction of

caspase-dependent apoptosis (Figure 4).

Discussion

Element equilibrium in cells plays an important role in a wide variety of biological pathways

in living systems. However, many studies reported an adverse effect of essential or xenobiotic

metals at high or inadequate concentrations. These metals could interact with special

biological membranous organelles and molecules, thus causing oxidative damage and

disrupting the maintenance of several pathways, membrane permeability and redox

homeostasis.

The interaction between elements and physiological and genetic systems is well documented,

although the molecular mechanisms are not completely understood (Bal and Kasprzak 2002;

Chen et al. 2003; Leonard et al. 2004). Metal-melatonin interactions were observed in

several cell lines and in rodent and human tissues, generally in neuronal cells. These studies

indicated that melatonin plays a protective role against the ROS-mediated neuronal

degeneration observed on the serotoninergic and dopaminergic sides of neuron cells (Antolı́n

et al. 2002; Jiménez-Ortega et al. 2010; Lin et al. 2008). The effect of melatonin on redox

mechanisms is mainly exerted through the regulation of the gene expression of signalling

molecules and enzymes (Jiménez-Ortega et al. 2010). In addition, in vitro studies of cell

lines demonstrated that melatonin has a regulatory effect on the production of ROS. This

Page 14 of 35



Draft

effect was mainly observed in the presence of specific elements, with effects varying in the

order of Fe > Cu > Zn > Mn > Al (Zatta et al. 2003). Researchers reported that melatonin

supplements act protectively against Mn-induced hypokinesis and neuronal loss by inhibiting

ROS (Deng et al. 2015). Although Cu, an essential element, contributes to several

physiological functions (e.g., redox reactions) by binding to specific proteins, an excess

concentration of this metal causes the oxidative damage caused by a redox imbalance.

Melatonin administration helps to scavenge free radicals or chelate excessive Cu, thus

protecting cellular systems from its toxicity (Chen et al. 2003; Galano et al. 2015). Owing to

the Cu-chelating function, melatonin inhibits oxidative stress induced by both Cu(II)-

ascorbate mixtures and highly toxic hydroxyl anion (˙OH) production. Furthermore, the

oxidative stress-inhibiting effect of melatonin is also exerted by its metabolites (cyclic 3-

hydroxymelatonin, N1-acetyl-N2-formyl-5-methoxykynuramine and N1-acetyl-5-

methoxykynuramine). Therefore Galano et al. (2015) reported that melatonin is an extremely

efficient antioxidant because of the continuation of oxidative stress inhibitory properties even

after their metabolization.

Despite the rich literature on the relation between melatonin and tissue element levels, to the

best of our knowledge, research on the connection between melatonin and TA element levels

is lacking. In the present study, the TA Mg, Ca, Cu, Zn and Mn concentrations significantly

increased in PNX rats, which had a lower melatonin level than did the rats in the SHAM

group. In contrast to the Ca and Zn levels, the Li, Mg, Cu and Mn levels in TA were

significantly lower in PNX+M than in the SHAM group (Figure 2, Table 2). According to

Cunanne et al. (1979), the TA Zn content was increased, whereas serum, pituitary, adrenal,

lung and hair Zn contents were decreased in rats eight weeks after pinealectomy. Similarly, a

decreased Zn level and an increased Mg level were reported in the serum of pinealectomized

chicks (Turgut et al. 2006). Furthermore, the exogenous melatonin (100 µg/mouse for one

Page 15 of 35



Draft

month) treatment restored the plasma Zn levels, which were strongly reduced in

pinealectomized mice, and Zn deficiency reoccurred when exogenous melatonin was

interrupted for one month (Mocchegiani et al. 1996). In another study, pinealectomy caused

increases in the element levels of kidney (Mn, Cu, Fe and Zn), liver (Ca, Na, Ni and Mn),

heart (Mg, Fe and Zn) and lung (Cr, Mn, Mg, Na, Ca, Fe, Cu and Se) tissues in rats (Koykun,

2012). This researcher also reported that although the melatonin treatment (3 mg/kg/day for

four weeks) caused some elements to return to the control levels, others did not return

depending on the element and tissue types (Koykun, 2012). Our results demonstrated that the

external melatonin dose administered in our experiment was inadequate to regulate the

imbalance of ions other than Ca and Zn in the TA tissues of PNX animals. According to the

literature and the result of our study, the element content in the serum and tissue was

significantly affected by pinealectomy, and the exogenous melatonin could restore the

element levels depending on the concentration, treatment time and tissue type (Cunanne et

al. 1979; Mocchegiani et al. 1996; Turgut et al. 2006).

Melatonin deficiency causes blood pressure elevation, which is considered to be related to

melatonin–nitric oxide association. Another critical mechanism in this relation involves

calcium. Calcium is an important molecule that regulates the vascular tone related to

vasoactive agents, such as endothelium-derived hyperpolarizing factor, nitric oxide,

endothelin and superoxide anion (Calver et al. 1993). The mobilization of Ca from internal

and external sources depends on several mechanisms and can be related to the effect of

melatonin on the endothelium Ca signalling machinery under physiological and pathological

conditions. Moreover, melatonin was found to play a role in the Ca response of vascular

endothelial cells and to have the capacity to reverse the inhibitory effect of free radicals on the

internal release of Ca (Pogan et al. 2002). Our results showed that increased levels of Ca in

the TA due to PNX could be regulated by melatonin treatment. The melatonin concentration

Page 16 of 35



Draft

of 6.78 pg/mg in the TA of SHAM-operated animals was higher than the values of 0.44 and

1.40 pg/mg in the PNX and PNX+M animals, respectively. This outcome suggests that

external melatonin administration may be inadequate but partly effective in replacing the

original pineal melatonin secretion in the present study. Sallinen et al. (2008) administered

melatonin subcutaneously, and their results in the left ventricle (LV) were similar to those in

our study. In a different study, the same research group found that the melatonin

concentration was surprisingly high in the LV, contradicting our results (Sallinen et al. 2007).

In several organisms, melatonin deficiency causes oxidative stress. Increased oxidative stress

levels due to an inadequate antioxidant system can lead to toxic effects, such as lipid

peroxidation, DNA polymorphisms and gene induction/repression (Ochsendorf 1999).

Recent studies have shown that during stressful conditions, differential regulation occurred

for genes that encode antioxidant enzymes (SOD, CAT and GS) and HSPs (Doganlar et al.

2014). Glutathione mechanisms depollute toxic xenobiotic and endobiotic electrophiles to

metabolize and excrete secondary products (Circu and Aw 2010). HSPs are called cellular

stress proteins, and they are important for the stress responses of all types of living organisms.

Recent studies have attempted to characterize the gene expression profiles of HSPs during

stress responses, such as heat and oxidative stress, as well as heavy metal and pesticide

toxicity (Doganlar and Doganlar 2015; Doganlar et al. 2016). However, the HSP species of

different sizes exhibit different responses to biotic and abiotic stressors depending on the

duration and severity of the stress. In the current study, a significant increase in the relative

expression levels of antioxidant enzymes genes (CuZn-SOD, Mn-SOD and GS) was detected

in the TA tissues of pinealectomized rats compared with SHAM rats. A recent study has

demonstrated that high expression levels of antioxidant genes are biomarkers of cell oxidative

cellular oxidative stress (Silins and Högberg 2011). Therefore, we suggest that the melatonin

deficiency present in different tissues causes oxidative stress in the TA, supporting the

Page 17 of 35



Draft

previous results. Melatonin is a strong antioxidant that acts as a ROS scavenger (Reiter et al.

2000; Galano et al. 2011; Reiter et al. 2017), and melatonin metabolites also have a similar

action (Galano et al. 2013; Janjetovic et al. 2017). Melatonin can stimulate both the content

of non-enzymatic antioxidants, such as glutathione and ascorbic acid, and the activity and

transcript levels of several important antioxidant enzymes, including peroxidase group

enzymes, SOD, glutathione reductase, glutathione-S-transferase and CAT (Banerjee et al.

2017; Sruthi et al. 2017; Dutta et al. 2018, Guclu et al. 2018). However, intraperitoneal

melatonin administration downregulates lipid peroxidation in the particular region of the

nucleus and prevents apoptosis (Chen et al. 2003). In our study, melatonin deficiency

significantly induced the HSP70 expression in the PNX group. The increased expression of

HSP70 revealed that cytoprotective mechanisms were involved in the degradation of

misfolded proteins. As ROS attacks vital proteins and causes their oxidation or aggregation,

low-level melatonin-induced oxidative stress can lead to an augmentation of the expression of

antioxidant genes and HSP70. In addition, we propose that the HSP70 synthesis that occurs

during oxidative stress may be initiated to prevent the protein damage caused by oxidative

stress and to correct and/or degrade misfolded proteins. The modulatory activity of melatonin

against oxidative stress is evidenced in our study. In the PNX+M group, the regulator effect

of melatonin was able to sufficiently modify the expression of CuZn SOD and Mn-SOD and

the tissue MDA level in comparision with the PNX. Moreover, the melatonin treatment could

have partially reversed the DNA damage and protein disruption-induced alterations in the

HSP70 expression (Table 2, Figure 3).

Electrophoretic DNA profiling through the RAPD-PCR technique is used to determine the

molecular response of several model organisms to several stress conditions. The constant

pattern in the electrophoretic RAPD band profiles using arbitrarily primed PCR reactions

provides useful and viewable data on the observable DNA alterations produced by biotic and

Page 18 of 35



Draft

abiotic stressors in several cell lines and tissues (Rocco et al. 2014). RAPD band

polymorphism may be due to changes in the priming sites of oligonucleotides caused by

genome rearrangement. Newly occurring bands may also be caused by the DNA damage

induced by stressors (Doganlar and Doganlar 2015). Moreover, new bands may be the result

of genomic template instability. Genetic stability is related to the level of DNA damage and

the efficiency of DNA repair and replication mechanisms in the cell. Liu et al. (2005) and

Lee et al. (2007) reported that the disappearance of PCR products mainly affected the high-

molecular-weight bands because the probability of sustaining DNA damage increased with

the length of the amplified fragment. In our study, we observed a decrease in the intensity of

nine bands in the TA tissues in pinealectomized rats. However, a decrease in the intensity of

four specific bands was found in the TA samples of the PNX+M group (Figure 3, Table 3).

The changes in band intensity mainly depend on the genome rearrangement caused by the

reactions of enzymes, such as Taq polymerase, and the efficiency of DNA repair mechanisms,

particularly single 8-oxo-7’,8’-dihydro-2’-deoxyadenosine lesions. We suggest that the

differences in band intensity related to insufficient genome repair mechanisms may be due to

the altered molecular composition that is induced by oxidative stress and to the irregular

changes in element balance and redox potential sources resulting from melatonin deficiency

in cells.

Apoptosis is programmed cell death, and it occurs in several physiological and pathological

conditions (Hengartner 2000). The primary mechanisms for the beginning of an apoptosis

response upon melatonin deficiency may depend on a distinct stimulus, and these mechanisms

have not been clearly identified. Excessive ROS, insufficient antioxidant scavenging,

impaired genomic stability, and changes to other vital molecules are accepted as the main

initial factors in apoptosis (Rich et al. 2000). Our results revealed that melatonin deficiency

causes DNA damage, significantly increases the levels of MDA and both cytosolic and

Page 19 of 35



Draft

mitochondrial SOD, serves as a biomonitor of oxidative stress, affects the stress-specific

HSP70 gene expression and activates the gene and protein expression of caspase 3 and

caspase 8 (Figure 2, 4). The activation of caspases in response to several stressors triggers the

activation of both extrinsic and intrinsic apoptosis signalling pathways in mitochondria

(Fulda and Debatin 2006). In our study, melatonin deficiency markedly induced the

expressions of TNF-α, caspase 8 and caspase 3, downregulated the anti-apoptotic survivin but

did not significantly change the ratio of BCL2 to BAX, which are components of the intrinsic

apoptosis pathway, in the TA tissues of the pinealectomy group. For this reason, we

considered that melatonin deficiency could induce apoptosis through the signalling involving

TNF-α/caspase 8/caspase 3, which are the principal components of the extrinsic pathway. The

present findings are consistent with those of recent studies reporting that caspase-dependent

apoptosis can be initiated through the Fas ligand or TNF-α receptors. The molecules linked to

the extrinsic pathway include FADD/TNF-α-connected death domain protein and caspase 8,

which activates caspase 3 and induces apoptosis (Sheen et al. 2016). Previous studies

demonstrated that melatonin exerts marked anti-apoptotic effects (Govender et al. 2014;

Radogna et al. 2015) by preventing the release of cytochrome c from the mitochondria to

inhibit caspase 3 activation and DNA damage. Melatonin also acts as an antioxidant and

reduces reactive oxygen and nitrogen species, thus alleviating the damage to cell components

that triggers apoptosis (Asghari et al. 2016). Our study demonstrated a significant decrease in

the levels of TNF-α and the apoptotic genes caspase 3 and caspase 8 in the TA tissues of

PNX+M animals compared with those in the PNX group. These gene expression results are

supported by the protein expression with a marked correlation coefficient (gene/protein

correlations: Tnf-α: 0.842, P=0.04; HSP70: 0.861, P=0.003; Casp8: 0.707, P=0.033; Casp3:

0.927, P<0.001). In addition, the anti-apoptotic gene survivin was significantly regulated by

melatonin. This finding is consistent with previous data, which indicate that exogenous

Page 20 of 35



Draft

melatonin may be an effective anti-apoptotic agent in cardiovascular cells (Zhang et al.

2013).

Melatonin administration is known to have beneficial effects on the cardiovascular system

through oxidative stress inhibition, free radical scavenging, increased antioxidant activities

and the prevention of ischemia/reperfusion injury, hypertension and atherosclerosis

(Tengattini et al. 2008; Semercioz et al. 2017). In addition, melatonin supplements regulate

jet lag, daytime fatigue and insomnia-induced cardiovascular disease (Girish et al. 2013). In

the modern world, various factors connected to changes in lifestyle and living conditions may

cause melatonin deficiency. Melatonin deficiency causes a number of cellular and molecular

damage signals that are initially triggered by increased reactive oxygen species levels in

tissues and organs. Oxidative damage to nuclear and cellular nucleic acid molecules and

proteins through the overproduction of ROS in cardiovascular cells, such as endothelium,

smooth muscle, and adventitia cells, often results in apoptosis. Both oxidative stress and

ROS-mediated apoptosis have been directly associated with several cardiovascular diseases,

particularly atherosclerosis, ischemia/reperfusion injury, calcification of blood vessels,

formation of atherosclerotic plaques, heart failure and hypertension (Reiter et al. 2000;

Rodriguez et al. 2004; Dominguez-Rodriguez et al. 2012). In conclusion, our results

indicated that melatonin deficiency triggered the extrinsic TNF-α/caspase 8/caspase 3

apoptosis signalling induced by excessive oxidative stress, DNA and protein damage and

elemental imbalances. Melatonin administration exhibited significant therapeutic effects on

the TA tissues by regulating elemental balance, decreasing oxidative stress, DNA and protein

damage, and preventing apoptotic cell death in pinealectomized rats.

Conflict of interest

The authors declare no conflict of interest.

Page 21 of 35



Draft

Acknowledgements

This study was supported by the Trakya University Scientific Research Fund (TUBAP

2015/45).

References

Antolı́n, I., Mayo, J.C., Sainz, R.M., del Brı́o Madl, A., Herrera, F., Martı́n, V., et al. 2002. Protective effect of melatonin in a chronic experimental model of Parkinson’s disease. Brain Res. 943:163-173. doi.org/10.1016/S0006-8993(02)02551-9

Asghari, M.H., Abdollahi, M., Oliveira, M.R., Nabavi, S.M. 2016. A review of the protective role of melatonin during phosphine‐induced cardiotoxicity: focus on mitochondrial dysfunction, oxidative stress and apoptosis. J. Pharm. Pharmacol. 69(3): 236-243. doi: 10.1111/jphp.12682.

Banerjee, S., Joshi, N., Mukherjee, R., Singh, P. K., Baxi, D., and Ramachandran, A. V. 2017. Melatonin protects against chromium (VI) induced hepatic oxidative stress and toxicity: Duration dependent study with realistic dosage. Interdiscip. Toxicol. 10(1): 20-29. doi.org/10.1515/intox-2017-0003

Bal, W., and Kasprzak, K.S. 2002. Induction of oxidative DNA damage by carcinogenic metals. Toxicol. Lett. 127:55-62. doi.org/10.1016/S0378-4274(01)00483-0

Blanc-Brude, O. P., Teissier, E., Castier, Y., Leseche, G., Bijnens, A. P., Daemen, M. et al. 2007. IAP survivin regulates atherosclerotic macrophage survival. Arterioscler. Thromb. Vasc. Biol. 27:901-907. doi: 10.1161/01.atv.0000258794.57872.3f

Calver, A., Collier, J., and Vallance, P. 1993 Nitric oxide and cardiovascular control. Exp. Physiol. 78:303-326. doi 10.1113/expphysiol.1993.sp003687

Canpolat, S., Sandal, S., Yilmaz, B., Yasar, A., Kutlu, S., Baydas, G. et al. 2001. Effects of pinealectomy and exogenous melatonin on serum leptin levels in male rat. Eur. J. Pharmacol. 428:145-148. doi.org/10.1016/S0014-2999(01)01230-4

Chen, K.B., Lin, A.M.Y., and Chiu, T.H. 2003. Oxidative injury to the locus coeruleus of rat brain: neuroprotection by melatonin. J. Pineal Res. 35:109-117. doi.org/10.1034/j.1600-079X.2003.00063.x

Circu, M.L., and Aw, T.Y. 2010. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med. 48:749-762. doi: 10.1016/j.freeradbiomed.2009.12.022.

Cunnane, S. C., Horrobin, D. F., Manku, M. S., and Oka, M. 1979. Alteration of tissue zinc distribution and biochemical analysis of serum following pinealectomy in the rat. Endocr. Res. Comm. 6(4): 311-319. doi.org/10.1080/07435807909061110

Deng, Y., Jiao, C., Mi, C., Xu, B., Li, Y., Wang, F et al. 2015. Melatonin inhibits manganese-induced motor dysfunction and neuronal loss in mice: involvement of oxidative stress and dopaminergic neurodegeneration. Mol. Neurobiol. 51:68-88. doi: 10.1007/s12035-014-8789-3.

Page 22 of 35



Draft

Doganlar, O., and Doganlar, Z.B. 2015. Effects of a mixture of volatile organic compounds on total DNA and gene expression of heat shock proteins in Drosophila melanogaster. Arch. Environ. Contam. Toxicol. 68:395-404. doi: 10.1007/s00244-014-0089-4

Doganlar, O., Doganlar, Z.B., Muranlı, F.D.G., and Guner, U. 2016. Genotoxic Effect and Carcinogenic Potential of a Mixture of As and Cd in Zebrafish at Permissible Maximum Contamination Levels for Drinking Water. Water Air Soil Pollut. 227:87

DOI 10.1007/s11270-016-2779-1. Doganlar, Z.B., Doganlar, O., and Tabakçıoğlu, K. 2014. Genotoxic effects of heavy metal

mixture in Drosophila melanogaster: expressions of heat shock proteins, RAPD profiles and mitochondrial DNA sequence. Water Air Soil Pollut. 225:2104. doi: 10.1007/s11270-014-2104-9.

Dominguez-Rodriguez, A., Abreu-Gonzalez, P., and Reiter R.J. 2012. Melatonin and cardiovascular disease: myth or reality? Rev. Esp. Cardiol. 65:215-218. doi: 10.1016/j.recesp.2011.10.009

Dutta, S., Saha, S., Mahalanobish, S., Sadhukhan, P., and Sil, P. C. 2018. Melatonin attenuates arsenic induced nephropathy via the regulation of oxidative stress and inflammatory signaling cascades in mice. Food Chem. Toxicol. doi: 10.1016/j.fct.2018.05.032.

Favero, G., Paganelli, C., Buffoli, B., Rodella, L. F., and Rezzani, R. 2014. Endothelium and its alterations in cardiovascular diseases: life style intervention. Biomed Res. Int. 2014:1-28. doi: 10.1155/2014/801896

Fulda, S., and Debatin, K. 2006. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 25:4798-4811. doi:10.1038/sj.onc.1209608

Galano, A., Tan, D.X., and Reiter, R.J. 2011. Melatonin as a natural ally against oxidative stress: a physicochemical examination. J. Pineal. Res. 51:1-16. doi: 10.1111/j.1600-079X.2011.00916.x

Galano, A., Tan, D.X., and Reiter, R.J. 2013. On the free radical scavenging activities of melatonin's metabolites, AFMK and AMK. J. Pineal. Res. 54:245-257. doi: 10.1111/jpi.12010

Galano, A., Medina, M. E., Tan, D. X., and Reiter, R. J. 2015. Melatonin and its metabolites as copper chelating agents and their role in inhibiting oxidative stress: a physicochemical analysis. J. Pineal. Res. 58(1): 107-116. doi: 10.1111/jpi.12196

Girish, K. S., Paul, M., Thushara, R. M., Hemshekhar, M., Sundaram, M. S., Rangappa, K. S., et al. 2013. Melatonin elevates apoptosis in human platelets via ROS mediated mitochondrial damage. Biochem. Biophys. Res. Commun. 438:198-204. doi: 10.1016/j.bbrc.2013.07.053

Glaab, E., Garibaldi, J.M., and Krasnogor, N. 2009. ArrayMining: a modular web-application for microarray analysis combining ensemble and consensus methods with cross-study normalization. BMC Bioinformatics 10:358. doi.org/10.1186/1471-2105-10-358

Govender, J., Loos, B., Marais, E., and Engelbrecht, A.M. 2014. Mitochondrial catastrophe during doxorubicin‐induced cardiotoxicity: a review of the protective role of melatonin. J. Pineal. Res. 57:367-380. doi: 10.1111/jpi.12176

Güçlü, H., Doganlar, Z. B., Gürlü, V. P., Özal, A., Dogan, A., Turhan, M. A., et al. 2018. Effects of cisplatin-5-fluorouracil combination therapy on oxidative stress, DNA

Page 23 of 35



Draft

damage, mitochondrial apoptosis, and death receptor signalling in retinal pigment epithelium cells. Cutan Ocul Toxicol, 1-14.Hengartner, M.O. 2000. The biochemistry of apoptosis. Nature 407:770-776. doi: 10.1080/15569527.2018.1456548

Hung, M. W., Kravtsov, G. M., Lau, C. F., Poon, A. M. S., Tipoe, G. L., and Fung, M. L. 2013. Melatonin ameliorates endothelial dysfunction, vascular inflammation, and systemic hypertension in rats with chronic intermittent hypoxia. J. Pineal. Res. 55:247-256. doi: 10.1111/jpi.12067

Janjetovic, Z., Jarrett, S. G., Lee, E. F., Duprey, C., Reiter, R. J. and Slominski, A. 2017. Melatonin and its metabolites protect human melanocytes against UVB-induced damage: involvement of Nrf2-mediated pathways. Sci. Rep. 7: 1274. DOI:10.1038/s41598-017-01305-2.

Jiménez-Ortega, V., Cardinali, D. P., Fernández-Mateos, M. P., Ríos-Lugo, M. J., Scacchi, P. A., and Esquifino, A. I. 2010. Effect of cadmium on 24-hour pattern in expression of redox enzyme and clock genes in rat medial basal hypothalamus. BioMetals 23:327-337. doi: 10.1007/s10534-010-9292-6.

Kheradmand, A., Alirezaei, M., Asadian, P., Rafiei Alavi, E., and Joorabi, S. 2009. Antioxidant enzyme activity and MDA level in the rat testis following chronic administration of ghrelin Andrologia 41:335-340. doi: 10.1111/j.1439-0272.2009.00932.x

Kim, J., Jang, S. W., Park, E., Oh, M., Park, S., and Ko, J. 2014. The role of heat shock protein 90 in migration and proliferation of vascular smooth muscle cells in the development of atherosclerosis. J. Mol. Cell. Cardiol. 72:157-167. doi: 10.1016/j.yjmcc.2014.03.008

Koykun, Z. 2012. The effect of pinealectomy and melatonin supplementation on various elements levels in blood and tissues of rats. PhD thesis. Department of Physiology, Selcuk University, Konya, Turkey.

Lee, Y.C., Yang, V.C., and Wang, T.S. 2007. Use of RAPD to detect sodium arsenite-induced DNA damage in human lymphoblastoid cells. Toxicology 239:108-115. doi: 10.1016/j.tox.2007.06.101

Leonard, S.S., Harris, G.K., and Shi, X. 2004. Metal-induced oxidative stress and signal transduction. Free Radic. Biol. Med. 37:1921-1942. doi: 10.1016/j.freeradbiomed. 2004.09.010

Lin, C.H., Huang, J.Y., Ching, C.H., and Chuang, J.I. 2008. Melatonin reduces the neuronal loss, downregulation of dopamine transporter, and upregulation of D2 receptor in rotenone‐induced parkinsonian rats. J. Pineal. Res. 44:205-213. doi: 10.1111/j.1600-079X.2007.00510.x

Liu, W., Li, P., Qi, X., Zhou, Q., Zheng, L., Sun, T., et al. 2005. DNA changes in barley (Hordeum vulgare) seedlings induced by cadmium pollution using RAPD analysis. Chemosphere 61:158-167. doi: 10.1016/j.chemosphere.2005.02.078

Luu, N. T., Madden, J., Calder, P. C., Grimble, R. F., Shearman, C. P., Chan, T. et al. 2007. Comparison of the pro-inflammatory potential of monocytes from healthy adults and those with peripheral arterial disease using an in vitro culture model. Atherosclerosis 193:259-268. doi.org/10.1016/j.atherosclerosis.2006.08.050

Page 24 of 35



Draft

Madden, J., Coward, J. C., Shearman, C. P., Grimble, R. F., and Calder, P. C. 2010. Hsp70 expression in monocytes from patients with peripheral arterial disease and healthy controls. Cell. Biol. Toxicol. 26:215-223. doi: 10.1007/s10565-009-9134-x

Mauriz, J. L., Collado, P. S., Veneroso, C., Reiter, R. J., and González‐Gallego, J. 2013. A review of the molecular aspects of melatonin’s anti‐inflammatory actions: recent insights and new perspectives. J. Pineal. Res. 54:1-14. doi: 10.1111/j.1600-079X.2012.01014.x

Mocchegiani, E., Bulian, D., Santarelli, L., Tibaldi, A., Muzzioli, M., Lesnikov, V. et al. 1996. The zinc pool is involved in the immune-reconstituting effect of melatonin in pinealectomized mice. J. Pharmacol. Exp. Ther. 277(3): 1200-1208.

Ochsendorf, F. 1999. Infections in the male genital tract and reactive oxygen species. Hum. Reprod. Update 5:399-420.

Ovali, M., and Uzun, M. 2017. The effects of melatonin administration on KCNQ and KCNH2 gene expressions and QTc interval in pinealectomised rats. Cell. Mol. Biol. 63(3):45-50. doi: 10.14715/cmb/2017.63.3.9

Paulis, L., and Šimko, F. 2007. Blood pressure modulation and cardiovascular protection by melatonin: potential mechanisms behind. Physiol. Res. 56(6): 671.

Pandi-Perumal, S. R., BaHammam, A. S., Ojike, N. I., Akinseye, O. A., Kendzerska, T., Buttoo, K., et al. 2017. Melatonin and human cardiovascular disease. J. Cardiovasc. Pharmacol. Ther. 22(2): 122-132. doi: 10.1177/1074248416660622.

Pogan, L., Bissonnette, P., Parent, L., and Sauve, R. 2002. The effects of melatonin on Ca2+ homeostasis in endothelial cells. J. Pineal. Res. 33:37-47. doi.org/10.1034/j.1600-079X.2002.01890.x

Qin, M., Luo, Y., Meng, X. B., Wang, M., Wang, H. W., Song, S. Y. et al. 2015. Myricitrin attenuates endothelial cell apoptosis to prevent atherosclerosis: An insight into PI3K/Akt activation and STAT3 signaling pathways. Vasc. Pharmacol. 70:23-34. doi: 10.1016/j.vph.2015.03.002

Radogna, F., Albertini, M. C., De Nicola, M., Diederich, M., Bejarano, I., and Ghibelli, L. 2015. Melatonin promotes Bax sequestration to mitochondria reducing cell susceptibility to apoptosis via the lipoxygenase metabolite 5-hydroxyeicosatetraenoic acid. Mitochondrion 21:113-121. doi: 10.1016/j.mito.2015.02.003

Reiter, R. J., Paredes, S. D., Manchester, L. C., and Tan, D. X. 2009. Reducing oxidative/ nitrosative stress: a newly-discovered genre for melatonin. Crit. Rev. Biochem. Mol. Biol. 44:175-200. doi: 10.1080/10409230903044914

Reiter, R. J., Tan, D. X., and Fuentes-Broto, L. 2010. Melatonin: a multitasking molecule. Prog Brain Res. 181:127-151. doi: 10.1016/S0079-6123(08)81008-4

Reiter, R. J., Tan, D. X., Osuna, C., and Gitto, E. 2000. Actions of melatonin in the reduction of oxidative stress. J. Biomed. Sci. 7:444-458

Reiter, R. J., Tan, D. X., and Maldonado, M. D. 2005. Melatonin as an antioxidant: physiology versus pharmacology. J. Pineal. Res. 39:215-216. doi.org/10.1111/j.1600-079X.2005.00261.x.

Reiter, R. J., Rosales-Corral, S., Tan, D. X., Jou, M. J., Galano, A., and Xu, B. 2017. Melatonin as a mitochondria-targeted antioxidant: one of evolution’s best ideas. Cell Mole. Life Sci. 74:3863-3881. doi: 10.1007/s00018-017-2609-7

Page 25 of 35



Draft

Rich, T., Allen, R. L., and Wyllie, A. H. 2000. Defying death after DNA damage. Nature 407:777-783. doi.org/10.1038/35037717

Rocco, L., Valentino, I. V., Scapigliati, G., and Stingo, V. 2014. RAPD-PCR analysis for molecular characterization and genotoxic studies of a new marine fish cell line derived from Dicentrarchus labrax. Cytotechnology 66:383-393. doi: 10.1007/s10616-013-9586-y

Rodriguez, C., Mayo, J. C., Sainz, R. M., Antolin, I., Herrera, F., Martin, V., et al. 2004. Regulation of antioxidant enzymes: a significant role for melatonin. J. Pineal. Res. 36:1-9. oi.org/10.1046/j.1600-079X.2003.00092.x

Sallinen, P., Mänttäri, S., Leskinen, H., Ilves, M., Vakkuri, O., Ruskoaho, H., et al. 2007. The effect of myocardial infarction on the synthesis, concentration and receptor expression of endogenous melatonin. J. Pineal. Res. 42:254-260. doi.org/10.1111/j.1600-079X.2006.00413.x

Sallinen, P., Mänttäri, S., Leskinen, H., Vakkuri, O., Ruskoaho, H., and Saarela, S. 2008. Long‐term postinfarction melatonin administration alters the expression of DHPR, RyR2, SERCA2, and MT2 and elevates the ANP level in the rat left ventricle. J. Pineal. Res. 45:61-69. doi: 10.1111/j.1600-079X.2008.00556.x

Semercioz, A., Baltaci, A. K., Mogulkoc, R., and Avunduk, M. C. 2017. Effect of Zinc and Melatonin on Oxidative Stress and Serum Inhibin-B Levels in a Rat Testicular Torsion–Detorsion. Model Biochem. Genet. 55:395-409. doi: 10.1007/s10528-017-9826-5

Sheen, J. M., Chen, Y. C., Hsu, M. H., Tain, Y. L., Huang, Y. H., Tiao, M. M. et al. 2016. Melatonin Alleviates Liver Apoptosis in Bile Duct Ligation Young Rats. Int. J. Mol. Sci. 17:1365. doi: 10.3390/ijms17081365

Silins, I., and Högberg, J. 2011. Combined toxic exposures and human health: biomarkers of exposure and effect. Int. J. Env. Res. Pub. He. 8:629-647. doi: 10.3390/ijerph8030629

Son, B. K., Kozaki, K., Iijima, K., Eto, M., Nakano, T., Akishita, M., et al. 2007. Gas6/Axl-PI3K/Akt pathway plays a central role in the effect of statins on inorganic phosphate-induced calcification of vascular smooth muscle cells. Eur. J. Pharmacol. 556:1-8. doi: 10.1016/j.ejphar.2006.09.070

Sruthi, S., Millot, N., and Mohanan, P. V. 2017. Zinc oxide nanoparticles mediated cytotoxicity, mitochondrial membrane potential and level of antioxidants in presence of melatonin. Int. J. Biol. Macromol. 103: 808-818. doi: 10.1016/j.ijbiomac.2017.05.088

Tang, F., Wu, X., Wang, T., Wang, P., Li, R., Zhang, H. et al. 2007. Tanshinone II A attenuates atherosclerotic calcification in rat model by inhibition of oxidative stress. Vasc. Pharmacol. 46:427-438. doi: 10.1016/j.vph.2007.01.001

Tengattini, S., Reiter, R. J., Tan, D. X., Terron, M. P., Rodella, L. F., and Rezzani, R. 2008. Cardiovascular diseases: protective effects of melatonin. J. Pineal. Res. 44:16-25. doi: 10.1111/j.1600-079X.2007.00518.x

Turek, F.W., and Gillette, M.U. 2004. Melatonin, sleep, and circadian rhythms: rationale for development of specific melatonin agonists. Sleep. Med. 5:523-532. doi.org/10.1016/j.sleep.2004.07.009

Page 26 of 35



Draft

Turgut, M., Yenisey, C., Bozkurt, M., Ergin, F. A., and Biçakçi, T. 2006. Analysis of zinc and magnesium levels in pinealectomized chicks. Biol. Trace Elem. Res. 113(1): 67-75. doi: 10.1385/bter:113:1:67

Wei, Q., Ren, X., Jiang, Y., Jin, H., Liu, N., and Li, J. 2013. Advanced glycation end products accelerate rat vascular calcification through RAGE/oxidative stress. BMC Cardiovasc Disord. 13(1):13. doi: 10.1186/1471-2261-13-13

Wexler, L., Brundage, B., Crouse, J., Detrano, R., Fuster, V., Maddahi, J. et al. 1996. Coronary artery calcification: pathophysiology, epidemiology, imaging methods, and clinical implications. Circulation 94:1175-1192. doi.org/10.1161/01.CIR.94.5.1175

Yang, Y., Sun, Y., Yi, W., Li, Y., Fan, C., Xin, Z. et al. 2014. A review of melatonin as a suitable antioxidant against myocardial ischemia–reperfusion injury and clinical heart diseases. J. Pineal. Res. 57:357-366. doi: 10.1111/jpi.12175

Zatta, P., Tognon, G., and Carampin, P. 2003. Melatonin prevents free radical formation due to the interaction between β‐amyloid peptides and metal ions [Al (III), Zn (II), Cu (II), Mn (II), Fe (II)]. J. Pineal. Res. 35:98-103. doi: 10.1034/j.1600-079X.2003.00058.x

Zhang, H., Liu, D., Wang, X., Chen, X., Long, Y., Chai, W.et al. 2013. Melatonin improved rat cardiac mitochondria and survival rate in septic heart injury. J. Pineal. Res. 55:1-6. doi: 10.1111/jpi.12033

Page 27 of 35



Draft

Table 1. Genes, primer sequences and PCR conditions belong to antioxidant systems, HSPs and apoptosis pathway used in expressions studies (qRT-PCR) and RAPD assays

qRT-PCR Assay

Antioxidant System Apoptosis Pathway

Genes Primer Sequences Genes Primer Sequences PCR Conditions

CuZn-SOD F 5’ GTTCGGTGACAACACCAATG 3’ SURVIVIN F 5’ GACGACCCCATAGAGGAACA 3’

1 cycle of 2 min at 50 °C and 10

min at 95 °C followed by

48 cycles of denaturation at 95 °C

for 15 s, annealing and

extension at 60 °C for 1 min

R 5’ GGAGTCGGTGATGTTGACCT 3’ R 5’ GACAGAAAGGAAAGCGCAAC 3’

CAT F 5’ TACGAGCAGGCCAAGAAGTT 3’ TNF-α F 5’ AGGCGCTCCCCAAGAAGACA 3’

R 5’ ACCTTGTACGGGCAGTTCAC 3’ R 5’ TCCTTGGCAAAACTGCACCT 3’

GS F 5’ TGGGACCAGCAAGTAAAACC 3’ BCL2 F 5’ ATGTGTGTGGAGAGCGTCAA 3’

R 5’ TCGCGAATGTAGAACTCGTG 3’ R 5’ ACAGTTCCACAAAGGCATCC 3’

Mn-SOD F 5’ TCTGAAGAAGGCCATCGAGT 3’ BAX F 5’ TTCATCCAGGATCGAGCAGA 3’

R 5’ GCAGATAGTAGGCGTGCTCC 3’ R 5’ GCAAAGTAGAAGGCAACG 3’

Heatshock Protein Families APAF1 F 5’ GATATGGAATGTCTCAGATGGCC 3’

HSP27 F 5’ GCCCCGCAGCCCCATCTACGAG 3’ R 5’ GGTCTGTGAGGACTCCCCA 3’

R 5’ GAGCACGCCATCCGACGACAGC 3’ Cyt-C F 5’ AGTGGCTAGAGTGGTCATTCATTTACA 3’

HSP60 F 5’ GTCGCGCCCCGTTAGCAC 3’ R 5’ TCATGATCTGAATTCTGGTGTATGAGA 3’

R 5’ CATCGCGTCCCACCTTCTTCAT 3’ CASPASE 8 F 5’ AGAGTCTGTGCCCAAATCAAC 3’

HSP70 F 5’ CGAGETCGACGCATTGTTTG 3’ R 5’ GCTGCTTCTCTCTTTGCTGAA 3’

R 5’ GAGTGGATCCGCCGACGAGTA 3’ CASPASE 3 F 5’ GGTATTGAGACAGACAGTGG 3’

HSP90 F 5’ CCGGAGGCTCTTTCACAGTC 3’ R 5’ CATGGGATCTGTTTCTTTGC 3’

R 5’ CTTCTCGCGCTCCTTCTCTAC 3’

GAPDH F 5’ TTGGTATCGTGGAAGGACTCA 3’

R 5’ TGTCATCATATTTGGCAGGTTT 3’

RAPD-PCR Assay

Primer Names Primer Sequences Primer Names Primer Sequences PCR Conditions

D4 5’ CTGTAGCATC 3’ RAPD5 5’ GTCGTTCCTG 3’

40 cycles of 95 °C denaturation (30

s), 37 °C annealing (30 s)

and 72 °C elongation (90 s) with

an initial 95 °C

denaturation (3 min) and a final 72

°C extension (30 min)

P2 5’ ATGTAACGCC 3’ RAPD6 5’ CCCGTCAGCA 3’

AP5 5’ TCCCGCTGCG 3’ RAPD7 5’ TTCCGAACCC 3’

RF1 5’ GTAGCTGACG 3’ SP1 5’ CAGGCCTCCG 3’

1247 5’ AAGAGCCCGT 3’ OPA11 5’ CAATCGCCGT 3’

1253 5’ GTTCCGCCCC 3’ OPU16 5’ CTGCGCTGGA 3’

RAPD1 5’ CCGATATCCC 3’ OPI18 5’ TGCCCAGCCT 3’

RAPD2 5’ GTTTCGCTCC 3’ OPB5 5’ TGCGCCCTTC 3’

RAPD3 5’ CCAGCGTATT 3’ OPB10 5’ CTGCTGGGAC 3’

RAPD4 5’ CTACTGCGCT 3’ B18 5’ CCACAGCAGT 3’

Page 28 of 35



Draft

Table 2. Quantitative real time PCR (qRT-PCR) analysis of antioxidant enzymes, heat shock proteins (HSPs), and apoptosis pathway genes and the detected levels of Melatonin, Li, Mg, Ca, Cu, Zn, Mn elements in thoracic aorta tissues of SHAM, Pinealectomy (PNX) and Pinealectomy plus melatonin (PNX+M) treated rats. All transcriptomic data normalized with GAPDH expression and given as relative to control (control=1). mean ± S.E, n:5. Physiological data represent ng mg-1 tissue, mean ± S.E., n:5). ** Green and red colours indicate significantly different values compared to SHAM, analysed by one-way ANOVA, Duncan test (p≤0.05). ** indicate significantly differences values compared to other experiment groups (T-test: p≤0.05).

Gen Expression (Fold Change)

SHAM PNX PNX+M P value

CuZn-SOD 1,02±0.01 5,94±0,26 ▲* 2,24±0,21** ▲ <0.0001

CAT 0,94±0,14 1,25±0,46 ► 1,55±0,09** ▲ 0.005

GS 1,12±0,11 1,99±0,77 ▲ 1,33±0,58** ► 0.003

Mn-SOD 1,14±0,39 5,82±0,74 ▲ 3,82±0,21** ▲ 0.001

HSP27 1,13±0,53 0,74±0,21 ► 0,64±0,08 ► 0.462

HSP60 0,96±0,26 0,08±0,06 ▼ 0,16±0,03 ▼ 0.029

HSP70 1.13±0.07 20,96±4,90 ▲ 8,16±1,06** ▲ 0.008

HSP90 1,08±0.54 0,25±0,02 ▼ 0,58±0,08** ► 0.043

Survivin 1,18±0.24 0,41±0,04 ▼ 1,12±0,07** ► <0.0001

TNF-α 1,06±0.05 1,73±0,10 ▲ 1,31±0,09** ► 0.045

BCL2 1.12±0.36 0,57±0,04 ► 0,63±0,04 ► 0.111

BAX 1.04±0.54 0,25±0,03 ▼ 0,23±0,02 ▼ 0.054

Apaf1 1.08±0,03 1,34±0,08 ► 1,19±0,07 ► 0.720

Cyt-C 1,12±0.26 1,20±0,08 ► 1,14±0,08 ► 0.626

Caspase 8 0.96±0.26 2,03±0,11 ▲ 1,29±0,07** ► 0.034

Caspase 3 1,12±0.14 2,87±0,15 ▲ 1,40±0,09** ► 0.001

▲ Upregulated ▼ Downregulated ► Stable (no significant change)

Physiological Parameter (ng mg-1

)

SHAM PNX PNX+M P value

Melatonine 6,78±0,74 0,44±0,60 ▼ 1,40±0,16** ▼ <0.0001

Li 3,01±0,33 3,88±0,14 ► 2,13±0,34** ▼ 0.004

Mg 18,10±4,81 23,25±0,76 ▲ 8,28±0,45** ▼ <0.0001

Ca 6,25±0,32 13,07±0,19 ▲ 3,27±0,17** ► <0.0001

Cu 81,71±9,49 125,83±5,28 ▲ 44,10±1,77** ▼ 0.002

Zn 3,45±0,54 6,33±0,13 ▲ 2,44±0,15** ► <0.0001

Mn 0,39±0,10 0,44±0,02 ▲ 0,18±0,06** ▼ <0.0001

▲ Increased ▼ Decreased ► Stable (no significant change)

Page 29 of 35



Draft

Table 3. Changes in the RAPD profiles based on the appearance (A), disappearance (D) of bands and increase in band intensities (II), decrease in band intensities (DI) with specific molecular sizes (bp) using eight primers in the SHAM, pinealectomy (PNX) and pinealectomy plus melatonin (PNX+M) treated Sprague Dawley rats.

THORACIC AORTA

SHAM PNX PNX+M

A D II DI DI A D II DI

RAPD 6 1297; 1026; 788;

608; 446 1398 608 1297 0 0 0 0 0

RAPD 2 1264; 976; 731;

435; 296 0

976; 731;

435 0 1264 0 0 1264 0

SP1 1185; 964; 675;

514; 365; 185 0

1185;

675; 185 0 514; 185 0 0 0 0

OPU16 1314; 788; 495; 347 0 0 1341 788; 495;

347 0 0 0 0

RAPD 5 1169; 700; 521;

430; 339; 239; 171 0

521; 430;

339; 239;

171

0 1169; 700 0 0 0 0

B18 700; 446; 378; 210 0 700 446 378 0 0 0 378

OPI18 837; 747; 700; 591;

529; 449; 347; 297 0 347; 297 449 0 0 0 449 0

OPB10 820; 662; 564; 487;

388; 300; 237; 186 0 1061; 904

656; 564;

487 0 0 0 0

656;

564;

487

Page 30 of 35



Draft

Figure Legends

Figure 1. MDA level of thoracic aorta tissue in the sham operated control (SHAM), pinealectomy (PNX) and pinealectomy plus melatonin (PNX+M) treated Sprague dawley rats (n=5;mean±SE; nmol g-1). Ns: no significant change * indicates significantly different values compared to other treatment groups (t-test: p ≤ 0.05). ** indicates significantly different value compared to SHAM operated control: PMDA=0.005, (resulted by one-way ANOVA, separated by Duncan test)

Figure 2. Heat map analysis using fold change score of gene expressions and physiological parameters of TA tissues of Sprague Dawley rats for control (SHAM), pinealectomy (PNX) and pinealectomy plus melatonin (PNX+M) treatment. All data Log10 (x+1) transformed and eBayes and Pearson correlation options were used hierarchical clustering and correlation analysis, respectively

Figure 3. The random amplified polymorphic DNA (RAPD) assay band profiles and genomic template stability (GTS%) of total genomic DNA belongs to thoracic aorta (TA) of Sprague Dawley rats for sham operated control (SM), pinealectomy (PNX) and pinealectomy plus melatonin (PNX+M) treatment. Primers: RAPD6, RAPD2, SP1, OPU16, RAPD5, B18, OPI18, OPB 10. Ladder (L) Geneaid 100-bp DNA ladder (100-3.000 bp) .* indicate significantly different values (t-test: p ≤ 0.05)

Figure 4. Western blot analysis of Heat shock protein 70 kd (HSP70), Tumour necrosis factor alpha (TNF-α), Caspase 8 and Caspase 3 protein concentrations (n=3;mean±SE) *indicate significantly different values (t-test, p ≤ 0.05).Ns: no significant change, ** indicates significantly different value compared to sham operated control: PTNF-

α=0.05, PHSP70=0.002, PCasp8<0.0001, PCasp3= 0.006 (resulted by one-way ANOVA, separatedby Duncan test)

Page 31 of 35



Draft

Figure 1. MDA level of thoracic aorta tissue in the sham operated control (SHAM), pinealectomy (PNX) and pinealectomy plus melatonin (PNX+M) treated Sprague dawley rats (n=5;mean±SE; nmol g-1). Ns: no

significant change * indicates significantly different values compared to other treatment groups (t-test: p ≤ 0.05). ** indicates significantly different value compared to SHAM operated control: PMDA=0.005, (resulted

by one-way ANOVA, separated by Duncan test)

Page 32 of 35



Draft

Figure 2. Heat map analysis using fold change score of gene expressions and physiological parameters of TA tissues of Sprague Dawley rats for control (SHAM), pinealectomy (PNX) and pinealectomy plus melatonin (PNX+M) treatment. All data Log10 (x+1) transformed and eBayes and Pearson correlation options were

used hierarchical clustering and correlation analysis, respectively

Page 33 of 35



Draft

Figure 3. The random amplified polymorphic DNA (RAPD) assay band profiles and genomic template stability (GTS%) of total genomic DNA belongs to thoracic aorta (TA) of Sprague Dawley rats for sham operated

control (SM), pinealectomy (PNX) and pinealectomy plus melatonin (PNX+M) treatment. Primers: RAPD6, RAPD2, SP1, OPU16, RAPD5, B18, OPI18, OPB 10. Ladder (L) Geneaid 100-bp DNA ladder (100-3.000 bp) .*

indicate significantly different values (t-test: p ≤ 0.05)

Page 34 of 35



Draft

Figure 4. Western blot analysis of Heat shock protein 70 kd (HSP70), Tumour necrosis factor alpha (TNF-α), Caspase 8 and Caspase 3 protein concentrations (n=3;mean±SE) *indicate significantly different values (t-

test, p ≤ 0.05).Ns: no significant change, ** indicates significantly different value compared to sham operated control: PTNF-α=0.05, PHSP70=0.002, PCasp8<0.0001, PCasp3= 0.006 (resulted by one-way

ANOVA, separatedby Duncan test)

Page 35 of 35



draft - tspace repository: home · 2019-01-11 · draft article type: original article melatonin...

Documents