draft...draft 1 combined effects of rhizo-competitive rhizosphere and non-rhizosphere bacillus in...

Draft

Combined effects of Rhizo-competitive Rhizosphere and Non-rhizosphere Bacillus in Plant Growth Promotion and

Yield Improvement of Eleusine coracana (Ragi)

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2019-0103.R2

Manuscript Type: Article

Date Submitted by the Author: 27-Sep-2019

Complete List of Authors: Dheeman, Shrivardhan; Gurukula Kangri vishwavidyalaya, Department of Botany and MicrobiologyBaliyan, Nitin; Gurukula Kangri vishwavidyalaya, Department of Botany and MicrobiologyDubey, Ramesh Chandra; Gurukula Kangri vishwavidyalaya, Department of Botany and MicrobiologyMaheshwari, Dinesh Kumar; Gurukula Kangri vishwavidyalaya, Department of Botany and MicrobiologyKumar, Sandeep ; Gurukula Kangri vishwavidyalaya, Department of Botany and MicrobiologyChen, Lei; Fujian Agriculture and Forestry University, College of Food Science

Keyword: Bacillus, Sclerotium rolfsii, Root colonization, Bio-inoculant, PGPR

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

Combined effects of Rhizo-competitive Rhizosphere and Non-rhizosphere Bacillus in Plant

Growth Promotion and Yield Improvement of Eleusine coracana (Ragi)

Shrivardhan Dheeman1,2, Nitin Baliyan1, Ramesh Chandra Dubey1, Dinesh Kumar Maheshwari1, Sandeep Kumar1,

Lei Chen3

1Department of Botany and Microbiology, Gurukula Kangri Vishwavidyalaya, Haridwar – 249404, Uttarakhand,

India

2Department of Microbiology, School of Life Sciences, Sardar Bhagwan Singh University, Balawala, Dehradun –

248161, Uttarakhand, India

3College of Food Science, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China

Corresponding Author(s)

Prof. (Dr.) D. K. Maheshwari; E-mail: [email protected]

Dr. Shrivardhan Dheeman; E-mail: [email protected]

Co-corresponding Author

Dr. Lei Chen; E-mail: [email protected]

Page 1 of 38



mailto:[email protected]



Draft

2

ABSTRACT

This study emphasizes on the beneficial role of rhizo-competitive Bacillus spp. isolated from rhizospheric and non-

rhizospheric soil in plant growth promotion and yield improvement via nitrogen fixation and biocontrol of

Sclerotium rolfsii causing foot rot disease in Eleusine coracana (Ragi). The selection of potent rhizobacteria was

based on plant growth-promoting attributes using Venn Set Diagram (VSD) and Bonitur Scale (BS). Bacillus

pumilus MSTA8 and Bacillus amyloliquefaciens MSTD26 were obtained as persuasive in root colonization,

rhizosphere competence and biofilm formation using root exudates of E. coracana L. rich with carbohydrates,

proteins, and amino acids. The relative chemotaxis index (RCI) of the isolates understood invasive behavior to the

rhizosphere. During pot and field trials, the consortia of rhizobacteria in a vermiculite carrier increased the grain

yield by 37.87% with a significant Harvest Index (HI) 16.45. Soil analysis of the post-field trial revealed the soil

reclamation potentials so as to manage soil nutrition and fertility. Both indexes ensured crop protection and

production in eco-safe ways and herald commercialization of Bacillus bio-inoculant for improvement in crop

production and disease management of E. coracana.

Keywords: Bacillus; Sclerotium rolfsii; Root colonization; Bio-inoculant; PGPR

Page 2 of 38



Draft

3

1. Introduction

The rhizosphere is a zone of increased microbial activity having multitude of plant-microbe interactions that are

influenced by rhizo-secretions and resident micro-flora (el Zahar et al. 2014). The beneficial microbes of bulk soil

build a rhizospheric microbiome with their plant-root competitive and colonizing abilities (Steer and Harris 2000).

On the other hand, the number of different rhizobacteria decreases during rhizospheric inoculation (Bashan et al.

2014; Baliyan et al. 2018) due to competitive niche, inherent heterogeneity of the soil and density-dependent

competition for the substrate. Hence, it seems logical that microorganisms endeavor colonization during the

rhizospheric recruitment bear success whether it belongs to bulk soil. Bacteria of other ecological niche colonize to

support the concept of rhizospheric invasion similar to the autochthonous (indigenous) bacteria (Cui et al. 2014).

Moreover, few rhizobacteria having biocontrol ability viz-a-viz colonization and chemotaxis attributes; which is a

need to be explored. Interest in biological control of phytopathogens increased considerably over the past years due

to ecofriendly biocontrol potential as a scientific view, public concern and hazards resulted in using chemical

pesticides as general (Agarwal et al. 2017). Bacteria capable of lysing other organisms are widespread in natural

ecosystems. In our previous studies, lysis of fungal fruiting bodies in the soil observed a logically and satisfying

method for biological control (Agarwal et al. 2017). Other earlier research supports that plant growth-promoting

rhizobacteria (PGPR) are an ideal contender of crop protection and production (Maheshwari et al. 2012, 2014, 2015;

Aeron et al. 2017). Therefore, among the community of free-living rhizobacteria, aerobic endospore formers

appeared ideal PGPR. Bacillus is splendidly known as endospore-forming genera, Gram-positive with significant

traits viz., the formation of multi-layered stress-resistant endospores, secretion of extracellular enzymes, peptide

antibiotics and peptide signal molecules, etc. which facilitate them to survive even in a fragile ecosystem.

Harnessing of the beneficial gears of Bacillus as functional PGPR becomes very crucial, central and essential in

recent. Besides, low productivity of crops is a major hindrance to food security in India as indicated in the National

Food Security Bill (NFSB 2013).

Under this study, enhancement in production and productivity of food security crop Eleusine coracana L.

(commercial name: Ragi; Common/regional name: Mandua) is considered. E. coracana (family Poaceae) is widely

grown in the Himalayan region and Indian south peninsula. It is variably adaptable to the climatic conditions of

coastal land and higher elevations of Himalaya up to 2,300 meters above mean sea level (MSL). As this crop grows

Page 3 of 38



Draft

4

under varied agro-climatic conditions, it needs crop-specified PGPR for cultivation in the Himalayan region as well

as in the southern peninsula of India. Ragi is a significant food crop of diverse environments with its dual

importance as food grain and straw. Despite all these merits, this crop has low productivity in the Himalayan range

to cope up with the food demand in the sub-terrain of mountains and Indo-Gangetic population. The present research

emphasizes on allochthonous (non-indigenous) and autochthonous (indigenous) Bacillus spp. and their rhizospheric

competence bought by chemotactic and aggressive colonizing properties. Often, chemotaxis is effective in

colonization; however, in the case of PGPR motility and chemotaxis or chemo-attraction expedite crucial invasion

into the nutrient-rich rhizosphere (Chauhan et al. 2017). Further, root colonization is the ability of a microorganism

to develop occupancy and show rhizo-competence (Ladygina and Hedlund 2010). In this study, broad-spectrum

antagonistic activities of Bacillus spp. were executed by the secretion of the number of metabolites against

Sclerotium rolfsii. The allochthonous and autochthonous bacilli for plant growth promotion can be achieved only

when there is a better understanding of the factors controlling their ecology and establishment on roots (Singh et al.

2010). This research was envisioned to explore the effects of rhizocompetitive rhizospheric and non-rhizospheric

Bacillus in plant growth promotion and yield improvement of Eleusine coracana (Ragi)

2. Materials and Methods

2.1. Isolation, characterization, and identification of Bacilli

For isolation of Bacillus from rhizospheric and non-rhizospheric soil of E. coracana, samples were collected from

Kotdwar (29°52'45.08"N/78°30'37.23"E; 1175' MSL) district of Tehri (Uttarakhand) and bought to the laboratory

under low temperature. For rhizospheric soil, plants were gently uprooted with the shawl, loosely adhering soil was

removed and firmly attached soil particles to the plant root were collected. Bacillus from rhizospheric (strictly

adhered soil to the root system) and non-rhizospheric soil (bulk soil) were isolated following Dheeman et al. (2017).

Diverse colonies appearing on the surface of the medium were screened by streaking. Cultures were preserved in

Luria-Bertani (LB) broth containing 50% (w/v) glycerol and kept at −82°C. All the isolates were characterized

Page 4 of 38



Draft

5

based on morphological, physiological and biochemical traits and identified up to the genus level as per Bergey’s

Manual of Determinative Bacteriology (Hensyl 2000).

2.2. Determination of plant growth-promoting (PGP) traits

All the isolates were examined for direct and indirect plant growth-promoting attributes viz., phosphate

solubilization, hydrogen cyanide (HCN), 1-aminocyclopropane-1-carboxylate (ACC), chitinolytic activity and

siderophore production as described by Kumar et al. (2011). IAA production was determined by following Bric et

al. (1991). IAA was quantitatively estimated by harvesting the bacterial culture grown in LB broth after 72 h of

growth and centrifuging at 10,000 rpm for 15 min at 4°C. Two drops of ortho-phosphoric acid were added in 2 mL

of supernatant and mixed with 4 mL of Salkowski’s reagent. The intensity of pink color was read at 530 nm on a

spectrophotometer (UV-VIS 1601, Shimadzu) and quantity was determined by extrapolating readings over the

standard curve. Further, the quantitative estimation of soluble inorganic P (Pi) was carried out by centrifuging 72 h

old bacterial culture in Pikovskya’s broth. 5 mL culture was filtered through millipore filter paper (0.2µ) and

centrifuged by adding 1 g activated charcoal. P(Pi) in the cell-free culture filtrate (CFCF) was determined by

dissolving 1 mL of CFCF into 2.5 mL of Barton’s reagent and volume make-up up to 50 mL with MilliQ water

(Direct®-Q3). After 10 min, the intensity of yellow color was read on a spectrophotometer (UV-VIS 1601,

Shimadzu) at 430 nm and readings were extrapolated over the standard curve for quantitative estimation. For the

quantitative estimation of siderophore, bacterial cultures were grown for 50 h and centrifuged at 3000 rpm for 15

min. Culture supernatants (0.5 mL) were harvested and 0.5 mL CAS solution was added with 10 μl shuttling

solution (sulfosalicylic acid). The color obtained was estimated at 630 λ nm using a spectrophotometer (UV-VIS

1601, Shimadzu) against necessary blank (minimal medium) and reference solution (minimal medium + CAS dye +

shuttle solution) to determine siderophore production.

2.3. Antifungal studies

Page 5 of 38



Draft

6

Antagonistic behavior of all the Bacillus isolates was evaluated against Sclerotium rolfsii using dual culture

technique (Skidmore and Dickinson, 1976). Zones of fungal inhibition were measured (48 h) by using the following

formula:

Growth Inhibition (GI) = radial growth in control (C) – radial growth in dual culture (T) / radial growth in control

(C) × 100

Cell-free culture supernatants (CFCS) were obtained by filtration technique using 0.45 µm membrane

filters. CFCF was treated (dialyzed, proteolysis and heated) following Arora et al. (2007). The fungal discs of equal

size (5mm) were cut from pre-grown (4 days) culture of Sclerotium roffsii and incubated separately with treated and

non-treated CFCF at 28˚C for 6 days in order to determine CFCF mediated antagonism. Post-antagonistic effects

were evaluated by obtaining mycelia from the zone of inhibition and observing under scanning electron microscopic

(SEM) and light microscope (Gupta et al. 2001).

2.4. Venn’s analysis and Bonitur scaling

A logical and set relationship was established using Bioinformatics & Evolutionary Genomics Venn diagram tool

(http://bioinformatics.psb.ugent.be/webtools/Venn) to generate a textual output indicating which elements are in

each intersection or are unique to a certain list. A commonness of strains showing multi-PGP traits was evaluated

using the Venn diagram. From that collection, simply closed circles were drawn on a plane to establish a

relationship of overlaps. A 5-way Venn generator is used for indole acetic acid (IAA), hydrogen cyanic acid (HCN),

ACC-deaminase (ACC), siderophore (SID) and phosphate solubilization (PS) group of PGPRs. The best isolates

were selected from the screened biocontrol agent (BCA) with high plant growth-promoting potential. A Bonitur

Scale was generated and used to assess the PGPR traits. On this scale, the maximum Bonitur Point was 16. For plant

growth-promoting traits, it is possible to obtain three points each for growth inhibition, IAA production, phosphate

Page 6 of 38



Draft

7

solubilization, siderophore production and one point each for chitinase, β-1,4 glucanase, HCN and ACC-deaminase

(total 16 points).

2.5. 16S rDNA sequencing, phylogenetic and evolutionary analysis

The genomic DNA of each isolate was prepared as described by Green and Sambrook (2012). Two universal

primers derived from the highly conserved region of 16S rRNA gene FD1 5' CCGAATTCGTCGACA

ACAGAGTTTGATCCTGGCTCAG 3' and RD1 5' CCCGGGATC CAAGCTTAAGGAGGTGATCCAGCC 3'

were used to amplify 16S rRNA gene using MJ Research PTC-100 Peltier Thermal Cycler (PCR). DNA amplicons

were purified and sequenced by Sanger-Dedoxy Sequencing in AB System Gene Sequencer at the Institute of

Microbial Technology, Chandigarh, India. All the sequences were compared with 16S rRNA gene sequences

available in the GenBank databases accessed by the EZ-taxon server (Chun et al. 2007). Phylogenetic analyses were

done by using MEGA 10 (Kumar et al. 2018). The 16S rRNA gene sequences from this study have been submitted

to the NCBI GenBank database under accession numbers KT379991 and KT379992.

2.6. Invasive and inhabitant behavior in rhizosphere

2.6.1. Antibiotic resistance-tagging

For intrinsic antibiotic resistance of bacteria, a bacterial lawn was prepared by spreading 0.5 mL of the 1.0 OD

culture on Muller Hinton Agar (MHA) containing Petri-plate. After 10 min, antibiotic discs (HiMedia, Mumbai)

were placed over the surface of the plate and incubated at 28±10°C for 72 h. The sensitivity and resistance were

recorded as per the manufacture’s instruction.

Page 7 of 38



Draft

8

2.6.2. Rhizospheric colonization

Root colonization of MSTA8S+A+ and MSTD26M+P+ was carried out by developing antibiotic-resistant marker strains

for the assessment of the population in the rhizosphere of the plants, respectively. E. coracana, bacterized with both

strains were sampled at 30, 60, 90, 120 days after incubation (DAI) and bacterial population on roots were

measured. Plants were carefully removed with a shovel and soil particles adhering to the roots were gently removed.

Care was taken not to remove soil particles tightly adhered to the roots. The roots were cut into 1 cm long segments

and 1 g of root segments were dipped into 5 mL of sterile distilled water (SDW) and vortex 4-5 times to release the

rhizosphere bacteria in water. Dilutions of the bacterial suspensions were poured onto Bacillus Agar Medium

(BAM) amended with Streptomycin (100 µg mL-1), Ampicillin (25 µg mL-1), Methicillin (30 µg mL-1), Penicillin

(10 units mL-1), separately for enumerating the introduced strains MSTA8S+A+ and MSTD26M+P+ and to evaluate

their population. After 24 h of incubation at 28±1ºC, cfu per g root segments were counted.

2.6.3. Root exudates

Extraction of root exudates of E. coracana from the uniform shape and healthy seeds was carried out after surface

sterilization with 0.5% sodium hypochlorite (NaOCl) for 5 min, soaking in 0.75% H2O2 for 3 min and washing

thrice in SDW. Seeds were allowed to germinate on sterile moist lined blotting paper (90 mm dia; 14.5mm × 86.5

mm) in the darkness. Germinated seeds with radicle about 5 - 6 mm long were transferred aseptically in sterilized

glass tubes (170 mm length) containing 20 mL of sterile half-strength Knop’s solution (Hewitt, 1966) with sterile

Teflon tape support. Plants were grown for 10 d in a growth chamber and microbial contaminations were examined.

Root exudates were used for quantitative estimation of proteins, carbohydrates and amino acids following the

Lowry’s method (LM) (Bramhall et al. 1969), phenol-sulfuric acid method (PSM) (Masuko et al. 2005) and

ninhydrin methods (NM) (Fisher et al. 1963).

2.6.4. Chemotaxis

Page 8 of 38



Draft

9

The bacterial cells were collected after centrifugation, washed twice with chemotaxis buffer following Liu and

Parales (2008) and re-suspended in the same buffer to obtain turbidity equivalent to McFarland Solution (OD600=

0.55). Standard 0.2 mm one-end sealed capillary tube was loaded with 1-μL crude root exudates by repetitive flame

exposure, cooled and placed in a U-shaped chamber filled with 0.2 mL bacterial suspension. The chemotaxis buffer

consisting of 100 mM potassium phosphate buffer (pH 7.2) and 20 μM EDTA acted as the negative control.

Aspartic acid (200 μM) acted as positive control. After 30 min of static incubation at room temperature, the contents

in the capillary were transferred into a sterilized Eppendorf tube by syringe and the cells in the capillaries were

plated on nutrient agar medium. Plates were incubated for 24 - 48 h and the total numbers of colonies were counted.

The chemotaxis index (C.I.) was determined as the ratio of the number of bacterial cells accumulated in the test

capillaries containing root exudates to that of control (Lopez-de-Victoria and Lovell, 1993). The relative chemotaxis

index (RCI) was calculated by the chemotaxis index of treatment/chemotaxis in positive control × 100.

2.6.5. Biofilm formation

Each Bacillus sp. MSTA8 and MSTD26 were separately grown in 10 mL MSGG Media and incubated at 32°C for

24 h. Biofilm formation assay was carried out in the root exudates of E. coracana. Overnight grown cultures in

MSGG (10 µL) were transferred to 10 mL root exudate and mixed by the vortex. Further, 100 µL of vortex solution

was transferred into a pre-sterilized microtiter plate (MTP). MTP having only exudate and broth acted as medium

and exudate control, respectively. After 48 h incubation, the medium was removed from MTP and washed five times

with sterile distilled water to remove loosely associated bacteria. MTP was air-dried for 45 min and stained with 100

µL of 1% crystal violet solution. After staining, each MTP well was washed five times with sterile distilled water

that allows the appearance of purple rings formed in each well. The cell turbidity was monitored MTP reader

(BioRed) at 595 nm and recorded by eluting with 1% acetic acid.

2.7. Assessment of productivity enhancement

Page 9 of 38



Draft

10

2.7.2. Development of microbial consortium

Both strains were selected to raise consortium. The in vitro compatibility between both the strains was evaluated.

Both strains were tested for their antagonistic behavior against each other for consortium development following the

method of Pandey and Maheshwari (2007). Bacillus pumilus MSTA8 and B. amyloliquefaciens MSTD26 were

inoculated in yeast extract mannitol agar broth. All strains were incubated at 28°C on an orbital shaker at 74 rpm.

After incubation for 24 h, 5 mL of each culture was spotted separately on NAM plates (1.5 cm from the edge). After

24 h of incubation, plates were sprayed with a 24-h old culture of a single strain using chromatography sprayer and

incubated at 28 °C for 24 h. The zone of inhibition was measured around each test strain, if present. Each treatment

was replicated thrice and the entire experiment was performed twice.

2.7.3. Seed bacterization and bioinoculant formulation

Healthy seeds of E. coracana (procured from farmers of Bhattgaon, Poukhal, Kotdwara, Uttarakhand) were

handpicked and soaked in lukewarm water for overnight. Further, the method of Aeron et al. (2012) was adopted for

seed biopriming. Bacterial strains B. pumilus MSTA8, B. amyloliquefaciens MSTD26 and their rhizobacterial

consortia were grown in LB broth medium separately at 28±1 °C for 48 h in a fermenter (BIO FARM-L Scigenics

India Pvt. Ltd.). Both the cultures were centrifuged at 7000 x g at 4°C for 15 min. The culture supernatants were

discarded and the pellets were washed and re-suspended in sterile distilled water (SDW) to get the final bacterial

population density of 1 x 108 cells mL-1. The cell suspensions of the bacterial strains were mixed with 1%

carboxymethylcellulose (CMC) solution in a ratio of 1:0.5 separately to form a slurry and coated on the surface of

seeds. Seeds of ragi (Var. Local) were coated with 1% CMC slurry, biopriming only CMC without bacterial strains

served as control. Bioprimed seeds were placed in a Petri plate consisting of sterilized Whatman' No. 1 Paper (20 in

each) in triplicate. Petri plates were irrigated with sterile water routinely up to 15 DAS. For bioinoculant formulation

in vermiculite, the overnight grown cultures (10,000 rpm, 20 min, and 4±1°C) having pellets with an initial count to

obtain 108 cfu/g as per bureau of Indian standards (BIS) were added to sterilized vermiculite carriers separately for

inoculant preparations (BIS 2000). Bioformulation (using vermiculite carrier) and shelf-life assessment were carried

out following our earlier research (Maheshwari et al. 2015).

Page 10 of 38



Draft

11

2.7.4. Field-trial

For field trial, the experiments were conducted at Paukhal (9°50'11.37"N/78°41'20.04"E; 3552 MSL), Kotdwar

(Uttarakhand) using a randomize block design (RBD) with three replicates of each treatment [T1 = MSTA8

bacterized seed; T2 = MSTD26 bacterized seed; T3 = MSTA8 + MSTD26 bacterized seed; T4 = bioinoculant of

MSTA8; T5 = bioinoculant of MSTD26; T6 = bioinoculant of consortia of MSTA8 and MSTD26; C = Control

(non-bacterized seed)] using lottery method. Bio-primed seeds were sown in 1 m2 area (in 6 rows, 20 cm apart,

having the 11 seeds, each with 10 cm apart) in total field size of 14.2 m × 7 m using random plot design with five

replicates of above bacterial treatments. The buffer areas between plots were maintained by bunds of 0.5 meters.

The plots were naturally irrigated by rainwater. Five plants from each plot were randomly selected for record of

plant growth parameters on every 30 days of intervals. The plants were irrigated at different time intervals

throughout the growth period of the crop. Early as well as late vegetative and reproductive growth parameters were

recorded after every 30 d of intervals from sowing till harvest of the crop (120 DAS).

2.8. Soil analysis

Soil samples (10 g) were taken from field trials of E. coracana. Distinct treated and control plot (bulk) soil samples

were procured from different depths viz., upper (0-10 cm), middle (11-20 cm) and lower 21-30 cm), sieved through

0.25 mm sieve and composited for soil analysis. Soil samples of each plot were analyzed visually for texture and

color. Physicochemical parameters like pH, conductivity (E0), total organic carbon (TOC), total nitrogen (N),

available phosphorus (P), extractable potassium (K), etc. were determined (Walkley and Black, 1934; Jackson,

1958; Gairola et al. 2012). The total micro-flora was evaluated following Michael (1984).

2.9. Statistical analysis

Page 11 of 38



Draft

12

For each treatment, plant samples were obtained from three replicate plots in the completely randomized block

design. Bacterial counts (cfu g-1) in broth cultures and soil were analyzed after logarithmic transformation. The data

were analyzed by one-way ANOVA and considered to be significantly different at CD 0.5-5.0 (Gomez and Gomez,

1948).

3. Results

3.1. Isolation, characterization, and identification of Bacilli

A total of 96 isolates of Bacillus were screened from bulk soil samples and rhizospheric soil of E. coracana. These

were diverse morph-types based on colony appearance on nutrient agar medium (NAM) and Bacillus agar medium

(BAM). Out of the total, 70 Bacillus isolates from rhizospheric soil and 26 from bulk soil were recovered and named

as MSTA1-A70 and MSTD1-D26. Based on morphological, physiological and biochemical characteristics, all the

isolates were a-priori found similar to that of Bacillus spp.

3.2. Determination of plant growth-promoting (PGP) traits

Among 96 Bacillus, 70% isolates were capable to produce plant growth hormone, indole acetic acid (IAA) as

evidenced by the production of pink to intense red color. Significantly, 93.62% Bacillus solubilized phosphate (P)

which was evidenced by clear halos invariably formed around the bacterial colonies. Interestingly, Bacillus isolates

MSTA8 and MSTD26 were excellent to solubilize the insoluble phosphate into a maximum soluble form.

Cyanogenesis [formation of hydrocyanic acid (HCN)] shown by 59.57% Bacillus isolates which were detected by

Page 12 of 38



Draft

13

the brown to red color development on the picric acid and sodium-bi-carbonate imbibed filter-paper placed in the

upper half of Petri-dish. The dark edges of the filter paper evidenced the higher amount of HCN production that was

observed in both MSTA8 and MSTD26 isolates. Overall, 42% bacilli produced siderophore as confirmed by the

formation of clear halos around the spot inoculation of bacteria on Chrome Azurol Succinate (CAS) agar medium.

On the other hand, more significantly MSTA8 and MSTD26 isolates were most pragmatic and showed halos of

wider diameter around the bacterial colonies. It was interesting to note that hydroxamate and the catecholate type of

siderophore were found in succinate broth when treated with CAS reagent. About half of the population of Bacillus

spp. exhibited ACC-deaminase activity. Only 35.11% bacilli showed chitinase activity including MSTA8 and

MSTD26, which grew best on colloidal chitin amended medium with wider halo-zone formation. The same

proportion of bacilli utilized cellulose in minimal medium indicating β-1,4-glucanase activity with wider halo-zones

(Supplementary Table S1).

3.3. Antifungal studies

In the present study, all the isolates of non-rhizospheric and rhizospheric soil of E. coracana showed antagonistic

activity against S. rolfsii. About 72.34% of Bacillus isolates showed strong inhibitory action and found as potent

BCA. Growth inhibition of fungal colonies varied from 39.37 to 78.87%, while, the maximum inhibition was shown

by two isolates, viz. MSTA8 and MSTD26 (Fig. 1a). The protease-treated and heat-treated CFCS did not suppress

the growth of S. rolfsii. However, dialyzed CFCS of MSTA8 and MSTD26 significantly exhibited maximum

inhibition similar to that of non-treated supernatant (63 and 61%) which suggests the involvement of enzymes as a

factor of biocontrol. The other strains were unable to produced antifungal enzymes; their CFCF also exhibited

antifungal activity on protease-treatment, suggesting the involvement of non-protein, heat-labile substances. Further,

the fungal disc from the zone of interaction was studied by a compound light microscope and scanning electron

microscopy (SEM). SEM images from the zone of interaction revealed the loss of structural integrity of the fungal

mycelium. Mycelial shredding and shrinking were frequently observed; however, hyphal perforation and

Page 13 of 38



Draft

14

vacuolization were very common where breakage, fragmentation, and degradation etc. were rarely observed (Fig.

1b, Supplementary Fig. S1).

3.4. Venn’s set and Bonitur scaling analysis

The logical set relationship among the finite collection of different Bacillus strains on PGP potentials was observed

using the Venn diagram that displayed the overlaps in different plant growth mechanisms of bacilli. The Venn

diagram shows the number of strains in various PGPR traits such as IAA, HCN, siderophore (SID) and phosphate

solubilization (PS) expressed in vitro (Fig. 2) and core strain MSTA8 and MSTD26 were common in all trait circles.

The results of the Bonitur scale’s assessment revealed 7 strains scoring 10-16 points. The isolates MSTA8 and

MSTD26 were found the best which showed the highest Σ assessment value of 16 points (Table 1).

3.5. 16S rDNA sequencing and phylogenetic analysis

On the basis of phylogenetic analysis, the isolates MSTA8 and MSD26 were identified as Bacillus pumilus and

Bacillus amyloliquefaciens, respectively. The phylogeny of both the strains with the nearest phylogenetic and

evolutionary neighbor (Type strain) has been shown in Fig. 3.

3.6. Invasive and inhabitant behavior in rhizosphere

3.6.1. Antibiotic resistance-tagging and rhizospheric colonization

In intrinsic antibiotic resistance profiling, B. pumilus MSTA8 showed resistance to four antibiotics, namely

Streptomycin (S10), Piperacillin (Pc100), Ampicillin (A10) and Cephotaxime (Ce30). Similarly, B. amyloliquefaciens

Page 14 of 38



Draft

15

MSTD26 showed resistance to five antibiotics, namely Methicillin (M30), Penicillin G (P10), Piperacillin (Pc100),

Ampicillin (A10) and Cephotaxime (Ce30). Hence, B. pumilus MSTA8 was marked as MSTA8S+A+ and B.

amyloliquefaciens MSTD26 was marked as MSTD26M+P+. The establishment of the strains MSTA8S+A+ under

different sets of ex-situ conditions showed efficient and aggressive root colonization with 5.53, 6.25 and 6.37 log cfu

per g of root segment on 30, 60 and 120 DAI, respectively. But MSTD26M+P+ in the same conditions showed

rhizospheric colonization by 5.35, 6.12 and 6.18 log cfu per g of root on 30, 60 and 120 DAI, respectively. This

shows the steady increase and confirmed root colonization ability of Bacillus spp. up to 120 DAS.

3.6.2. Root exudates and chemotaxis studies

Root exudate of E. coracana has a significantly high amount of sugar than organic acids but low amino acid and

protein contents (Supplementary Fig. S2). Root exudates influenced chemotaxis and motility of bacteria. The

coherent behavior of colonization in rhizospheric soil as evidenced by the chemotaxis index (CI) was assessed by

capillary assay. This showed that B. amyloliquefaciens MSTD26 was more aggressive towards root exudate with

higher CI than that of B. pumilus MSTA8. In reference to aspartic acid with relative-CI, RCI was also high in B.

amyloliquefaciens MSTD26 (Fig. 4).

3.6.3. Biofilm formation

Biofilm production at 40 h of incubation showed great differences among B. pumilus MSTA8 and B.

amyloliquefaciens MSTD26. B. pumilus MSTA8 resulting in 0.124 optical density (OD) at the wavelength (λ) 595,

while B. amyloliquefaciens MSTD26 showed 0.621 OD at the same wavelength. Maximum (OD - 1.294) biofilm

production was observed in root exudates mediated consortia. Dark rings in microtiter wells determined consistency

in cell attachment to the PVC wells due to root exudates and assured the role of root exudates in biofilm formation

(Fig. 5).

3.7. Assessment of productivity enhancement

Page 15 of 38



Draft

16

3.7.1. Field-trial

Bio-primed seeds of E. coracana with Bacillus pumilus MSTA8, Bacillus amyloliquefaciens MSTD26 and consortia

(MSTA8+MSTD26) resulted in a significant enhancement in growth and yield of the plant such as plant length,

fresh weight and dry weight with respect to controls. After 120 DAS, all the vegetative and reproductive growth

parameters were maximally enhanced in the treatment 3 (consortia), followed by the other treatments in comparison

to control (Table 2). On the other hand, the effects of bioinoculant formulation on harvesting parameters and yield of

ragi were recorded higher than seed bacterization. Enhancement of the growth of ragi was observed in the

vermiculite-based bioinoculant of consortia as compared to control plants. There was an increase in seed yield by

37.87% with 16.45 harvest index over control at 120 DAS (Table 2)

3.8. Soil analysis of Post-field trial

Soil textures were found to be sandy-silt (77.3% sand, 13.6% silt, 8.7% clay, 0.397% Humus) and gray-black in

color. Physicochemical properties such as pH, conductivity (E0), total organic carbon (TOC), total nitrogen (N),

available phosphorus (P), and extractable potassium (K), of the soil samples, were maximally increased by isolate

MSTD26 over control. It was also observed that the consortium of both strains in T3 increased significantly two

times higher than the control (Table 3).

4. Discussion

By this study, it seems important to harness the reservoir of potential genera of free-living rhizobacteria for

sustainable agriculture particularly the most abundant bacilli which are capable to withstand in adverse climatic

conditions. Screening of such free-living bacteria, combat foot-rot disease caused by Sclerotium rolfsii and enhance

Page 16 of 38



Draft

17

crop yield with the ability to survive in adverse edaphic and environmental conditions was the purpose of this study.

The importance of bacilli in agriculture has already been documented by Kumar et al. (2011). E. coracana is a

native and routine crop of high altitudes and coastal regions of India but its productivity has been declined due to

overlooked farming. Hence, it is considered as a food security crop.

In present research, diverse aerobic endospore forming bacilli (AEFB) from rhizospheric (autochthonous)

and bulk soil (allochthonous) were isolated. Phenotypic characterization of Bacillus isolates were based on a-priori

identification as in our previous study (Dheeman et al. 2017). The capacity to synthesize IAA is widespread among

all the soil and plant-associated bacteria. About 80% of rhizobacteria can produce the plant growth regulator IAA

(Patten and Glick 2002). In our study, all the 70% bacilli were able to produce IAA, whereas the maximum amount

of IAA was produced by a few potential strains only including the most pragmatic strains MSTA8 and MSTD26.

Several workers have earlier reported IAA production by bacilli (Mehta et al. 2010; Wahyudi et al. 2011; Rani et al.

2011) which further supports our finding of IAA production by Bacillus. Phosphorus is another major essential

macronutrients for biological growth and development of plants (Rodrı́guez and Fraga, 1999). Microorganisms play

a key role in the phosphorus cycle. In this study, 93% bacilli solubilized phosphate with varying PSE. Quantitatively

MSTA8 and MSTD26 were most pragmatic to solubilize maximum [P(Pi)] phosphate which agrees with the studies

carried out by Trivedi et al. (2007). Several studies have also been showed that inoculation of bacilli to the seed and

soil can mineralize insoluble P into available Pi for crop nutrition, growth promotion and productivity (Canbolat et

al. 2006). Production of organic acids is recognized as a principal mechanism for phosphate mineralization. Further,

it could be assumed that the organic acid production conferring gene may be involved, was not ruled out.

HCN production is a common trait of Bacillus (50%) in the rhizospheric soil (Ahmad et al. 2008). HCN is a

secondary metabolite of bacteria employed in crop-protection. The action mechanism of HCN in the disease control

is partially understood (Hass and Défago 2005), however, it was also observed that cyanide ions derived from HCN

are the resilient inhibitor to different metal-enzymes, especially, copper (Cu) containing cytochrome C (CytC)

Oxidase (Blumer and Haas 2000) that makes criticality in respiration of fungi. Among 72% BCA, 46 strains

produced HCN that may be a biocontrol factor in these bacilli. Evaluation of PGP traits revealed that the 30 strains

among BCA were siderophore producers. Siderophore production was confirmed by the formation of a pink-colored

stable complex due to the chelation of insoluble iron as observed by Schwyn and Neilands (1987). About 50% of

Page 17 of 38



Draft

18

strains grew in ACC amended minimal medium, confirming their ability to synthesize ACC-deaminase. ACC

deaminase produced by PGPR also decreased the level of ethylene in the plant and managed its inhibitory effect on

root elongation and plant growth promotion (Glick et al. 2007; Saleem et al. 2007). Bacilli released extracellular

chitinase and β-1,4-glucanase enzymes, which are key enzymes required for the decomposition of fungal cell-wall.

The role of chitinase and its importance in biological control as well as in plant defense mechanisms has been

demonstrated by various workers (Broglie and Chet, 1991). The possibility of identification of enzyme produced by

the strains was not ruled out, besides conferring its involvement in the antifungal activity on dialysis (Arora et al.

2007).

Concerning Bacillus in the rhizosphere to pursuit plant growth-promoting (PGP) activities show varying

commonness on the principle of the Set-theory-based Venn diagram (Dheeman et al. 2017). In the five-set Venn

diagram, six strains were excelled in all five traits. Though, uniqueness in any set was not found in relation to the

lack of PGP trait in any strain. However, alone Venn diagram was found unable to evaluate the few potential strains

for further study with the limitation of set theory that it permits to decipher only quantitative traits on commonness

and uniqueness. Hence, to consider the few potential PGPR among the BCA Bacillus population, analysis of strains

on qualitative as well as quantitative estimation ranked them on Bonitur Scale. It was interesting finding that

individuals from the allochthonous and autochthonous population of Bacillus secured the top three ranks on Bonitur

Scale. B. pumilus MSTA8 and B. amyloliquefaciens MSTD26 were ranked 1st and 2nd progressively. Furthermore,

the selected isolates of Bacillus grew well on Ashby’s nitrogen-free medium up to successive seven generations

which signify the utilization of atmospheric nitrogen as a nitrogen source for growth (Aeron et al. 2014). Bacillus

was able to fix atmospheric nitrogen with PGP attributes in the benefits of agriculture.

In a phylogenetic tree using 16S rDNA homology, Bacillus pumilus MSTA8 has been placed in the clade

of Bacillus pumilus. Similarly, B. amyloliquefaciens MSTD26 was placed in a clade of Bacillus amyloliquefaciens.

Thus, the use of rDNA gene analysis enunciated its worth for the identification scheme following phenotypic

assessment. The molecular and microbiological characteristic meets the identification of the respective strains. PCR

amplification and DNA sequencing of the 16S ribosomal RNA gene sequencing allowed the identification of strain

supported by Kim et al. (2012). This is realized that 16S rRNA gene sequencing and phylogenetic study put a newly

characterized and identified bacterium to its phylogenetic tree. Plenty of literature also revealed biocontrol activities

Page 18 of 38



Draft

19

of bacilli against several deleterious phytopathogens. In this study, we found such biocontrol activity against S.

rolfsii. This fungus produces resting vegetative structures known as sclerotia, composed of a mass of mycelia.

Sclerotia are resistant to heat, drought and some fungicides also. They are the primary structures that remain viable

in soil for about eight years (Ayers and Adams, 1979) and germinate only inappropriate environmental conditions

(Soylu et al. 2007). However, it is clear with our finding that bacterial metabolites have a significant impact on its

biocontrol. In the presence of antagonists, the tender hyphae get lysed and destroyed due to enzyme production.

Microscopic abnormalities in fungal pathogens under the influence of B. amyloliquefaciens MSTD26 clearly

showed degeneration and degradation of the hyphae of S. rolfsii caused by metabolite secretion such as HCN,

siderophore and cell wall degrading enzymes. Beside, bacilli were motile bacteria with non-flagella motion. Chemo-

attraction or chemotaxis is a prime phenomenon involved in this motility. Hence, it has become essential to resolve

this characteristic chemotactic nature of bacilli to know its invading behavior in the rhizosphere. Antibiotic

resistance markers have been widely used in microbial ecology to monitor and re-isolated the introduced beneficial

bacteria from soil and rhizosphere (Xue et al. 2013; Bonaldi et al. 2015). The antibiotic resistance markers may

show high background activity but it is the first choice of workers due to simplicity, non-expensive and time-saving

measures and a number of workers have successfully used such markers (Spriggs and Dakora 2009). The antibiotic-

resistant marker strains of B. pumilus MSTA8 and B. amyloliquefaciens MSTD26 colonized rhizosphere for a

prolonged duration (up to 120 days). The positive root colonization ability of B. pumilus MSTA8 and B.

amyloliquefaciens MSTD26 as a consortium lies in its being the successful colonizer of the spermosphere, increased

seed emergence and its establishment in the rhizosphere of ragi, and in the protection of the plants from damage by

S. rolfsii resulting in enhanced yield.

In the field trial, twin rhizobacterial consortium effectively enhanced the vegetative and reproductive

growth of ragi resulting in increased grain yield by 34.74 % using a consortium of B. pumilus MSTA8 and B.

amyloliquefaciens MSTD26 as compared to other treatments. Besides, vermiculite-based bioinoculants of individual

and consortia showed much higher production than the seed bacterization. Consortia in vermiculite carrier showed a

37.87% grain yield with 16.45 HI. No such report on E. coracana has been published so far. It is the first report on

enhancement of crop yield of E. coracana using allochthonous and autochthonous PGPR Bacillus in seed bacterized

and vermiculite-based bioinoculant. The consortium of B. pumilus MSTA8 and B. amyloliquefaciens MSTD26 was

found the best in enhancing the crop yield however, B. amyloliquefaciens MSTD26 also showed a corresponding

Page 19 of 38



Draft

20

effect on crop yield enhancement. Observations of increasing the nutrition status of soil after field trial over control

were evidence reclamation of an essential nutrient in the soil profile and thus, boost the soil fertility index for better

crop production in the long term. Earlier long term effect of rhizobacteria inoculants was observed in our study

(Deshwal et al. 2006). Hence, we can discuss the effect of consortia of allochthonous and autochthonous bacilli for

the fortification of agricultural production.

As this study intended to explore new potential PGPR candidate excel to increase for crop productivity to

lead agricultural benefits, E. coracana was selected to explore rhizospheric soil harboring and non-rhizospheric soil

bacteria. Secondly, this plant draws attention because it is considered as a food security crop since back three years

due to the decline in its production with a rate of 2 hectares per year. It is interesting to learn that it is used to

prepare biscuits, porridges, puddings, etc. Since, it is the best source of natural dietary fibers, carbohydrates, and

antioxidants; it is extremely exploitable in food supplements.

5. Conclusions

It is interesting in the study that the best chosen potential N2-fixing autochthonous BCA Bacillus increased the

productivity of E. coracana and creates a new horizon of research in the near future to exploit commercial

bioinoculant formulation for routine farming practices. Further, agriculturally important germ-plasm can be secured

for future eco-friendly strain development in fortification of agricultural development in a sustainable manner. This

study signifies the importance of allochthonous and autochthonous bacilli for voracious invasive, root competent

and biocontrol mechanisms against foot rot disease in ragi, to be utilized further in bio-inoculant commercialization

for agricultural sustainability.

Acknowledgments: SD acknowledges the Uttarakhand Council for Science and Technology (UCOST), Dehradun

(India) and DKM (Project Investigator) for providing financial support in a regime of JRF. Soniya Dheeman is

acknowledged for English editing.

Page 20 of 38



Draft

21

Author’s Contributions: SD designed, conceived the experiment and prepared the manuscript with the assistance

of NB. SK and LC contributed to revising the manuscript with a scientific approach. RCD and DKM corrected and

finalized the manuscript before the submission.

Conflict of interest: Author(s) have no conflict of interest.

Appendix A. Supplementary data

References

Aeron, A., Chauhan, P.S., Dubey, R.C., Maheshwari, D.K., Bajpai, V.K. 2014. Root nodule bacteria from Clitoria

ternatea L. are putative invasive nonrhizobial endophytes. Canadian Journal of Microbiology, 61(2): 131-42. doi:

10.1139/cjm-2014-0483.

Aeron, A., Khare, E., Arora, N., Maheshwari, D.K. 2012. Practical use of CMC-amended rhizobial inoculant for

Mucuna pruriens cultivation to enhance the growth and protection against Macrophomina phaseolina. Journal of

General and Applied Microbiology, 58(2): 121-127.

Aeron, A., Maheshwari, D. K., Dheeman, S., Agarwal, M., Dubey, R. C., Bajpai, V. K. 2017. Plant growth

promotion and suppression of charcoal- rot fungus (Macrophomina phaseolina) in velvet bean (Mucuna pruriens L.)

by root nodule bacteria. Journal of Phytopathology, 165(7-8): 463-478. Doi: 10.1111/jph.12581.

Agarwal, M., Dheeman, S., Dubey, R.C., Kumar, P., Maheshwari, D.K., Bajpai, V.K. 2017. Differential antagonistic

responses of Bacillus pumilus MSUA3 against Rhizoctonia solani and Fusarium oxysporum causing fungal diseases

in Fagopyrum esculentum Moench. Microbiological Research, 205: 40-47. doi: 10.1016/j.micres.2017.08.012.

Ahmad, F., Ahmad, I., Khan, M.S. 2008. Screening of free-living rhizospheric bacteria for their multiple plant

growth promoting activities. Microbiological Research, 163(2): 173-181. doi: 10.1016/j.micres.2006.04.001.

Arora, N.K., Kim, M.J., Kang, S.C., Maheshwari, D.K. 2007. Role of chitinase and β-1,3-glucanase activities

produced by a fluorescent pseudomonad and in vitro inhibition of Phytophthora capsici and Rhizoctonia solani.

Canadian Journal of Microbiology, 53(2): 207-212. doi: 10.1139/w06-119.

Page 21 of 38



Draft

22

Ashby, S.F. 1907. Some observations on the assimilation of atmospheric nitrogen by a free living soil organism —

Azotobacter chroococcum of Beijerinck. The Journal of Agricultural Science, 2(01): 35-51. doi:

10.1017/S0021859600000988.

Ayers, W.A., Adams, P.B. 1979. Mycoparasitism of sclerotia of Sclerotinia and Sclerotium species by

Sporidesmium sclerotivorum. Canadian Journal of Microbiology, 25(1): 17-23. doi: 10.1139/m79-003.

Baliyan, N., Dheeman, S., Maheshwari, D.K., Dubey, R.C., Vishnoi, V.K. 2018. Rhizobacteria isolated under field

first strategy improved chickpea growth and productivity. Environmental Sustainability, 1(4): 461-469. doi:

10.1007/s42398-018-00042-0.

Bashan, Y., de-Bashan, L.E., Prabhu, S.R., Hernandez, J.P. 2014. Advances in plant growth-promoting bacterial

inoculant technology: formulations and practical perspectives (1998–2013). Plant and Soil, 378: 1–33. doi:

10.1007/s11104-013-1956-x.

Blumer, C., Haas, D. 2000. Mechanism, regulation and ecological role of bacterial cyanide biosynthesis. Archives of

Microbiology, 173: 170-177. doi: 10.1007/s002039900127.

Bonaldi, M., Chen, X., Kunova, A., Pizzatti, C., Saracchi, M., Cortesi, P. 2015. Colonization of lettuce rhizosphere

and roots by tagged Streptomyces. Frontiers in Microbiology, 6: 25. doi: 10.3389/fmicb.2015.00025.

Bramhall, S., Noack, N., Wu, M., Loewenberg, J.R. 1969. A simple colorimetric method for determination of

protein. Analytical Biochemistry, 31: 146-148. doi: 10.1016/0003-2697(69)90251-6.

Bric, J.M., Bostock, R.M., Silverstone, S.E. 1991. Rapid in situ assay for indole acetic acid production by bacteria

immobilized on a nitrocellulose membrane. Applied and Environmental Microbiology, 57(2): 535-538.

Broglie, K., Chet, I. 1991. Transgenic plants with enhanced resistance to the fungal pathogen Rhizoctonia solani.

Science, 254(5035): 1194-7. doi: 10.1126/science.254.5035.1194.

Canbolat, M.Y., Bilen, S., Çakmakçı, R., Şahin, F., Aydın, A. 2006. Effect of plant growth-promoting bacteria and

soil compaction on barley seedling growth, nutrient uptake, soil properties and rhizosphere microflora. Biology and

Fertility of Soils, 42(4): 350-357. doi: 10.1007/s00374-005-0034-9.

Page 22 of 38



Draft

23

Chauhan, A.K., Maheshwari, D.K., Dheeman, S., Bajpai, V.K. 2017. Termitarium-inhabiting Bacillus spp.

Enhanced plant growth and bioactive component in turmeric (Curcuma longa L.). Current Microbiology, 74(2):

184-192. doi: 10.1007/s00284-016-1172-z.

Chun, J., Lee, J.H., Jung, Y., Kim, M., Kim, S., Kim, B.K., Lim, Y.W. 2007. EzTaxon: a web-based tool for the

identification of prokaryotes based on 16S ribosomal RNA gene sequences. International Journal of Systemic and

Evolutionary Microbiology, 57(10): 2259-2261. doi: 10.1099/ijs.0.64915-0.

Cui, H., Yang, X., Lu, D., Jin, H., Yan, Z., Chen, J., Li, X., Qin, B. 2014. Isolation and characterization of bacteria

from the rhizosphere and bulk soil of Stellera chamaejasme L. Canadian Journal of Microbiology, 61(3): 171-81.

doi: 10.1139/cjm-2014-0543.

de Vrieze, J. 2015. The littlest farmhands. Science, 349(6249): 680-683. doi: 10.1126/science.349.6249.680.

Deshwal. V.K., Kumar, T., Dubey, R.C., Mahesheshwari, D.K. 2006. Long-term effect of Pseudomonas aeruginosa

GRC1 on yield of subsequent crops of paddy after mustard seed bacterization. Current Science, 91(4): 423-424.

Dheeman, S., Maheshwari, D.K., Agarwal, M., Dubey, R.C., Aeron, A., Kim, K., Bajpai, V.K. 2017. Polyphasic and

functional diversity of high altitude culturable Bacillus from rhizosphere of Eleusine coracana (L.) Gaertn. Applied

Soil Ecology 110:127-136. doi: 10.1016/j.apsoil.2016.10.005.

Rodrı́guez, H. and Fraga, R. 1999. Phosphate solubilizing bacteria and their role in plant growth promotion.

Biotechnology Advances, 17(4-5): 319-339. doi: 10.1016/S0734-9750(99)00014-2.

el Zahar, Haichar, F., Santaella, C., Heulin, T., Achouak, W. 2014. Root exudates mediated interactions

belowground. Soil Biology and Biochemistry, 77: 69-80. doi: 10.1016/j.soilbio.2014.06.017.

Fisher, L.J., Bunting, S.L., Rosenberg, L.E. 1963. A modified ninhydrin colorimetric method for the determination

of plasma alpha-amino nitrogen. Clinical Chemistry, 9(5): 573-581.

Gairola, S., Sharma, C.M., Ghildiyal, S.K., Suyal, S. 2012. Chemical properties of soils in relation to forest

composition in moist temperate valley slopes of Garhwal Himalaya, India. The Environmentalist, 32(4): 512-523.

doi: 10.1007/s10669-012-9420-7.

Page 23 of 38



Draft

24

Glick, B.R., Todorovic, B., Czarny, J., Cheng, Z., Duan, J., McConkey, B. 2007. Promotion of plant growth by

bacterial ACC deaminase. Critical Reviews in Plant Science, 26: 227–242. doi: 10.1080/07352680701572966.

Gomez, K.A., Gomez, A.A. 1984. Statistical procedures for agricultural research. John Wiley & Sons, Inc., p. 704.

Green, M.R., Sambrook, J. 2012. Molecular Cloning: a Laboratory Manual, 4ed. Cold Spring Harbor, N.Y.: Cold

Spring Harbor Laboratory Press.

Gupta, C.P., Sharma, A., Dubey, R.C., Maheshwari, D.K. 2001. Antobiosis-mediated necrotrophic effect of

Pseudomonas GRC2 against two fungal plant pathogens. Current Science, 81: 91-94.

https://www.jstor.org/stable/24105010.

Haas, D., Défago, G. 2005. Biological control of soil-borne pathogens by Fluorescent Pseudomonads. Nature

Reviews Microbiology, 3(4): 307-319. doi: 10.1038/nrmicro1129.

Hewitt, E.J. 1966. Sand and water culture methods used in the study of plant nutrition. Farnham Royal, England:

Common wealth Agricultural Bureaux.

Hensyl, W.R. 2000. Bergey’s Manual of Determinative Microbiology. Lippincott Williams & Wilkins, 530 Walnut

st. Philadephia, PA 19106 USA.

Jackson, M.L. 1958. Soil chemistry analysis. Prentic-Hall Inc., Engelowood Cliffs.

Kim, O.S., Cho, Y.J., Lee, K., Yoon, S.H., Kim, M., Na, H., Park, S.C., Jeon, Y.S., Lee, J.H., Yi, H., Won, S. 2012.

Introducing EzTaxon-e: a prokaryotic 16S rRNA gene sequence database with phylotypes that represent uncultured

species. International Journal of Systemic and Evolutionary Microbiology, 62(3): 716-721. doi:

10.1099/ijs.0.038075-0.

Kumar, A., Prakash, A., Johri, B.N. 2011. Bacillus as PGPR in crop ecosystem. In Bacteria in Agrobiology: Crop

Ecosystems. Edited by D.K. Maheshwari. Springer Berlin Heidelberg, Germany.

Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K. 2018. MEGA X: Molecular Evolutionary Genetics Analysis

across Computing Platforms. Molecular Biology and Evolution, 35(6): 1547-1549. doi: 10.1093/molbev/msy096.

Page 24 of 38



Draft

25

Ladygina, N., Hedlund, K. 2010. Plant species influence microbial diversity and carbon allocation in the

rhizosphere. Soil Biology and Biochemistry 42(2): 162-8. doi: 10.1016/j.soilbio.2009.10.009.

Liu, X., Parales, R.E. 2008. Chemotaxis of Escherichia coli to pyrimidines: a new role for the signal transducer.

Tap. Journal of Bacteriology, 190(3): 972-979. doi: 10.1128/jb.01590-07.

Lopez-de-Victoria, G., Lovell, C.R. 1993. Chemotaxis of Azospirillum species to aromatic compounds. Applied and

Environmental Microbiology, 59(9): 2951-2955.

Maheshwari, D. K., Aeron, A., Dubey, R. C., Agarwal, M., Dheeman, S., Shukla, S. 2014. Multifaceted beneficial

associations with Pseudomonas and Rhizobia on growth promotion of Mucuna pruriens L. Journal of Pure Applied

Microbiology, 8(6): 4657-4667.

Maheshwari, D. K., Dubey, R. C., Aeron, A., Kumar, B., Kumar, S., Tewari, S., Arora, N. K. 2012. Integrated

approach for disease management and growth enhancement of Sesamum indicum L. utilizing Azotobacter

chroococcum TRA2 and chemical fertilizer. World Journal of Microbiology and Biotechnology, 28(10): 3015-3024.

doi: 10.1007/s11274-012-1112-4.

Maheshwari, D. K., Dubey, R. C., Agarwal, M., Dheeman, S., Aeron, A and Bajpai, V. K. 2015. Carrier based

formulations of biocoenotic consortia of disease suppressive Pseudomonas aeruginosa KRP1 and Bacillus

licheniformis KRB1. Ecolgical Engineering, 81: 272–277. doi: 10.1016/j.ecoleng.2015.04.066.

Masuko, T., Minami, A., Iwasaki, N., Majima, T., Nishimura, S.I., Lee, Y.C. 2005. Carbohydrate analysis by a

phenol–sulfuric acid method in microplate format. Analytical Biochemistry, 339(1): 69-72. doi:

10.1016/j.ab.2004.12.001.

Mehta, P., Chauhan, A., Mahajan, R., Mahajan, P.K., Shirko, C.K. 2010. Strain of Bacillus circulans isolated from

apple rhizosphere showing plant growth promoting potential. Current Science, 98(4): 538-542.

https://www.jstor.org/stable/24111705.

Michael, P. 1984. Ecological methods for field and laboratory investigations. Tata McGraw-Hill Publishing

Company Limited, New Delhi pp. 60-62.

Page 25 of 38



Draft

26

NFSB. 2013. National food security bill. The Gazette of India: extraordinary, New Delhi, the 10th September,

2013/Bhadra 19, 1935 (Saka) http://indiacode.nic.in/actsinpdf/202013.pdf [cited 18 October 2019].

Pandey, P., Maheshwari, D.K. 2007. Two-species microbial consortium for growth promotion of Cajanus cajan.

Current Science, 92(8): 1137-1142. https://www.jstor.org/stable/24097634.

Patten, C.L., Glick, B.R. 2002. Regulation of indole acetic acid production in Pseudomonas putida GR12- 2 by

tryptophan and the stationary-phase sigma factor RpoS. Canadian Journal of Microbiology, 48(7): 635-642. doi:

10.1139/w02-053.

Rani, M.U., Arundhathi, Reddy, G. 2011. Bacillus cereus and Enterobacter cancerogenus screened for their

efficient plant growth promoting traits rhizobacteria (PGPR) and antagonistic traits among sixteen bacterial isolates

from rhizospheric soils of Pigeon Pea. African Journal of Microbiology Research, 5(15): 2090-2094.

Saleem, M., Arshad, M., Hussain, S., Bhatti, A.S. 2007. Perspective of plant growth promoting rhizobacteria

(PGPR) containing ACC deaminase in stress agriculture. Journal of Industrial Microbiology & Biotechnology,

34(10): 635–648. Doi: 10.1007/s10295-007-0240-6.

Schwyn, B., Neilands, J. 1987. Universal chemical assay for the detection and determination of siderophores.

Analytical Biochemistry, 160(1): 47-56.

Singh, N., Kumar, S., Bajpai, V.K., Dubey, R.C., Maheshwari, D.K., Kang, S.C. 2010. Biological control of

Macrophomina phaseolina by chemotactic fluorescent Pseudomonas aeruginosa PN1 and its plant growth

promotory activity in chir-pine. Crop Protection, 29(10): 1142-1147. doi: 10.1016/j.cropro.2010.04.008.

Skidmore, A.M., Dickinson, C.H. 1976. Colony interaction and hyphal interference between Septoria nodorum and

phylloplane fungi. Transactions of the British Mycological Society, 66: 57-74. doi: 10.1016/S0007-1536(76)80092-

7.

Soylu, S., Yigitbas, H., Soylu, E.M., Kurt, Ş. 2007. Antifungal effects of essential oils from oregano and fennel on

Sclerotinia sclerotiorum. Journal of Applied Microbiology, 103(4): 1021-1030. doi: 10.1111/j.1365-

2672.2007.03310.x

Page 26 of 38



http://indiacode.nic.in/actsinpdf/202013.pdf

Draft

27

Spriggs, A.C., Dakora, F.D. 2009. Assessing the suitability of antibiotic resistance markers and the indirect ELISA

technique for studying the competitive ability of selected Cyclopia Vent rhizobia under glasshouse and field

conditions in South Africa. BMC Microbiology, 9(1): 142. doi: 10.1186/1471-2180-9-142.

Steer, J., Harris, J.A. 2000. Shifts in the microbial community in rhizosphere and non-rhizosphere soils during the

growth of Agrostis stolonifera. Soil Biolology and Biochemistry, 32(6): 869-878. doi: 10.1016/S0038-

0717(99)00219-9

Trivedi, P., Kumar, B., Pandey, A., Palni, L.M. 2007. Growth promotion of rice by phosphate solubilizing

bioinoculants in a Himalayan location. In First international meeting on microbial phosphate solubilization. Edited

by E. Velázquez. and C. Rodríguez-Barrueco. Springer Dordrecht

Wahyudi, A.T., Astuti, R.P., Widyawati, A., Mery, A., Nawangsih, A.A. 2011. Characterization of Bacillus sp.

strains isolated from rhizosphere of soybean plants for their use as potential plant growth for promoting

rhizobacteria. Journal of Microbiology and Antimicrobials, 3(2): 34-40.

Walkley, A., Black, I.A. 1934. An examination of the Degtjareff method for determining soil organic matter, and a

proposed modification of the chromic acid titration method. Soil Science, 37(1): 29-38.

Xue, L., Xue, Q., Chen, Q., Lin, C., Shen, G., Zhao, J. 2013. Isolation and evaluation of rhizosphere actinomycetes

with potential application for biocontrol of Verticillium wilt of cotton. Crop Protection, 43: 231-240. doi:

10.1016/j.cropro.2012.10.002

Page 27 of 38



Draft

28

Legends Figures:

Fig. 1 a) Antagonism of S. rolfsii in dual culture assay; (i)- Culture of S. rolfsii as a control; (ii)- Inhibition of radial

growth of S. rolfsii by Bacillus pumilus MSTA8 (above) and Bacillus amyloliquefaciens MSTD26 (below); b)

Scanning Electron Microscopic (SEM) images showing mycelial deformities in Sclerotium rolfsii on post-

interaction with BCA Bacillus amyloliquefaciens MSTD26; (i)- Healthy hyphae as control, (ii)- hyphal degeneration

at the tip, cytoplasmic leakage and vocalization/degradation.

Fig. 2 Symmetrical 5 set Venn diagram by six traits of plant growth promotion showing the set commonness and

uniqueness with IAA, HCN, ACC-deaminase (ACC), siderophore producing (SID), Phosphate solubilizing (PS)

among strains of Bacillus spp. MSTA8 and MSTD26 observed sharing the most commonness in the traits.

Fig. 3 Phylogenetic and evolutionary relationships Bacillus pumilus MSTA8 and Bacillus amyloliquefaciens

MSTD26 with neighbor reference and out-group TYPE strains retrieved from NCBI GenBank.

Fig. 4 Chemotaxis index (CI) and relative chemotaxis index (RCI) of Bacillus spp. The bar at ±5% represents the

standard deviation (SD). Values are means of three replicative treatments. Statistically significant values (p<0.05)

represented by an asterisk (*) vs. aspartic acid as the control for chemotaxis.

Fig. 5 Assessment of biofilm formation by MSTA8 in well 1; MSTD26 in well 2; MSTA8 with root exudates in

well 3; MSTD26 with root exudates in well 4; consortium of MSTA8 and MSTD26 without root exudate in well 5;

consortium of MSTA8 and MSTD26 with root exudates in well 6; Media control will in well 7

Legends Tables:

Table 1 Bonitur scale based potential BCA Bacillus of allochthonous and autochthonous origin and their antifungal

activity, mechanisms in addition to their PGP traits and rank assessment to function as well PGPR

Table 2 Yield parameters of E. coracana at harvesting (120 DAS).

Table 3 Soil analysis after field experiments under differential treatments.

Page 28 of 38



Draft

29

1 Table 1. Bonitur scale based potential BCA Bacillus of allochthonous and autochthonous origin and their antifungal activity, mechanisms in addition to their

2 PGP traits and rank assessment to function as well PGPR

Antifungal mechanisms Plant growth-promoting (PGP) traits

Strain Identification

GI (%)

Sr C G HCN IAA PS ACC Sid

Total

Assessment

Points (16)n

Bonitur

Rank

MSTA8 B. Pumilus 3 1 1 1 3 3 1 3 16 I

MSTD26 B. amyloliquefaciens 3 0 1 1 3 3 1 3 15 II

MSTA3 B. cereus 3 1 0 1 3 3 1 2 14 III

MSTA7 B. thuringiensis 1 1 0 1 3 3 1 3 13 IV

MSTA9 B. subtilis 2 1 0 1 2 3 1 2 12 V

MSTA11 B. circulans 2 1 0 1 2 3 1 2 12 V

MSTD3 B. cereus 2 0 0 0 3 3 0 2 10 VI

MSTD8 B. amyloliquefaciens 2 0 0 1 2 2 1 1 9 VII

MSTA18 B. subtilis 1 0 1 0 3 3 0 0 8 VIII

MSTA32 B. licheniformis 1 1 0 1 2 1 1 1 8 VIII

Page 29 of 38



Draft

30

MSTD11 B. thuringiensis 1 1 0 1 2 1 0 2 8 VIII

MSTD4 B. mycoides 1 1 0 1 2 1 1 1 8 VIII

MSTA5 B. licheniformis 1 0 1 0 2 3 0 0 7 IX

MSTD12 B. mycoides 2 0 0 0 3 1 0 1 7 IX

MSTD2 B. circulans 2 0 1 0 2 1 0 0 6 X

MSTD6 B. licheniformis 2 0 0 0 2 2 0 0 6 X

MSTD17 B. cereus 1 0 0 0 1 1 0 1 4 XI

1 GI (%) Sr = Growth inhibition of Sclerotium rolfsii in Percentage (1 = 30-50, 2 = 50-70, 3 = 70-90); C = Chitinase (Absence- 0/Presence-1); G = β,1-4Glucanse

2 (Absence- 0/Presence-1); HCN = Hydrogen cyanic acid (Absence- 0/Presence-1); IAA = Indole acetic acid production (1 = 60-70, 2 = 70-80, 3 = 80-90); PS =

3 Phosphate solubilization (1 = 10-12, 2 = 12-14, 3 = 14-16); ACC = ACC-deaminase production (Absence- 0/Presence-1); Sid = Siderophore (1 = 10-25, 2 = 25-

4 40, 40-55); n = Total assessment point.

Page 30 of 38



Draft

31

1 Table 2. Yield parameters of E. coracana at harvesting (120 DAS).

Treatment 1000 seeds

weight

(gm.)

Shelling

percentage

Grain yield

(Kg/hectare)

Biological yield

(Kg/hectare)

Harvest Index (%) % grain yield rise

over control

T1 1.520ns 34.36 ns 1074 ns 8430 ns 12.74 ns 8.19 ns

T2 2.056** 49.55** 1481** 10740** 13.78** 33.42**

T3 2.096* 50.22* 1511* 9510* 15.88* 34.74*

T4 1.710* 35.22* 1083* 8540* 12.68* 8.95*

T5 2.124** 51.14** 1522** 10870** 14.00** 35.21**

T6 2.187* 52.35* 1587* 9646* 16.45* 37.87*

Control 1.300 37.82 986 7972 12.36

2 Abbreviations: T1 = MSTA8 bacterized seed; T2 = MSTD26 bacterized seed; T3 = MSTA8 + MSTD26 bacterized seed; T4 = bioinoculant of MSTA8; T5 =

3 bioinoculant of MSTD26; T6 = bioinoculant of consortia of MSTA8 and MSTD26; C = Control (non-bacterized seed); Values are mean of ten replicates; a =

4 significant at 0.01 level of analysis of variance (ANOVA). ** = Significant at 0.01 level of LSD as compared to control; * = Significant at 0.05 level of LSD as

5 compared to control; ns = Not Significant at 0.05 level of LSD as compared to control.

Page 31 of 38



Draft

32

1 Table 3. Soil analysis after field experiments under differential treatments.

Soil sampling Site Total Microbial

Count (TMC)

Log cfu mL-1

Nitrogen (%) Available

phosphorus (P)ppm

Extractable

potassium (K)ppm

Total organic carbon

(TOC)

Electro-

potential (E0)

pH

T1 7.61 a 0.028 a 937.5 c 667.12b 0.23 a 234 a 7.39 a

T2 8.50 a 0.159 a 973.5 c 1172.99 c 1.42 a 273 a 7.52 a

T3 9.83 a 0.123 a 1660.5 d 1280.2 d 1.79 a 266 a 6.71 a

C 6.57 a 0.014 a 717.4 b 672.05 b 2.04 a 265 a 7.47 a

2 Abbreviation: T1 = Bacillus pumilus MSTA8; T2 = Bacillus amyloliquefaciens MSTD26; T3 = MSTA8 + MSTD26; C = Control. Duncan‘s Multiple range test

3 (DMRT) grouped each column in four ranges a to d, where values with a similar alphabet in superscript show maximum significance with minimum variance.

4

5

6

Page 32 of 38



Draft

33

1

2

3 Fig. 1a

4

5

(i) (ii)

MSTD26

MSTA8

Page 33 of 38



Draft

34

1 Fig. 1b

2

3

(i) (ii)

Page 34 of 38



Draft

35

1

2

0

0

15

1

0

1

0

02

2

1

7

0

00

13

0

8

0

9

0

0

05

50

0

16

12

6

ACC

HCN

IAAPS

SID

MSTA8MSTD26

3 Fig. 2

4

5

6

7

8

9

Page 35 of 38



Draft

36

1

2 Fig. 3

Page 36 of 38



Draft

37

3

MSPA8CI

MSPD26 MSPA8RCI

MSPD260

5

10

15

20

25

30

16.35 17.95

69.7276.58

0

10

20

30

40

50

60

70

80

90Aspartic Acid

Chemotaxis Buffer

Root Exudates

Rela

tive

Chem

otax

is In

dex

(RCI

)

Chem

otax

is In

dex

(CI)

4 Fig. 4

5

6

*

*

Page 37 of 38



Draft

38

7

8

9

10 Fig. 5

11

12

1 2 3 4 5 6 7

Page 38 of 38



draft...draft 1 combined effects of rhizo-competitive rhizosphere and non-rhizosphere bacillus in...

Documents