draft · 2018. 5. 11. · draft coagonist of glp-1 and glucagon receptors ameliorates non-alcoholic...

Draft

Coagonist of GLP-1 and glucagon receptors ameliorates

non-alcoholic fatty liver disease

Journal: Canadian Journal of Physiology and Pharmacology

Manuscript ID cjpp-2017-0683.R1

Manuscript Type: Article

Date Submitted by the Author: 06-Nov-2017

Complete List of Authors: Patel, Vishal; Zydus Research Centre, Pharmacology&Toxicology Joharapurkar, Amit; Zydus Research Centre, Pharmacology&Toxicology Kshirsagar, Samadhan; Zydus Research Centre, Pharmacology&Toxicology Patel, Maulik; Zydus Research Centre, Pharmacology&Toxicology Sutariya, Brijesh; Zydus Research Centre, Pharmacology&Toxicology Patel, Hiren; Zydus Research Centre, Pharmacology&Toxicology

Pandey, Dheerendra; Zydus Research Centre, Pharmacology&Toxicology Patel, Dipam; Zydus Research Centre, Pharmacology&Toxicology Ranvir, Ramchandra ; Zydus Research Centre, Pharmacology&Toxicology Kadam, Shekhar; Zydus Research Centre, Pharmacology&Toxicology Bahekar, Rajesh; Zydus Research Centre, Medicinal Chemistry Jain, Mukul; Zydus Research Centre,

Keyword: Coagonist of GLP-1 and glucagon receptors, GLP-1, Glucagon, Inflammation, NAFLD

Is the invited manuscript for consideration in a Special

Issue?: N/A

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

1

Coagonist of GLP-1 and glucagon receptors ameliorates non-alcoholic fatty liver

disease

Vishal Patel, Amit Joharapurkar, Samadhan Kshirsagar, Maulik Patel, Brijesh Sutariya,

Hiren Patel, Dheerendra Pandey, Dipam Patel, Ramchandra Ranvir, Shekhar Kadam,

Rajesh Bahekar, and Mukul Jain

Zydus Research Centre, Cadila Healthcare Limited, Sarkhej-Bavla N.H.No.8A, Moraiya,

Ahmedabad, 382210, INDIA

Corresponding Author:

Amit Joharapurkar

Department of Pharmacology & Toxicology, Zydus Research Centre, Cadila Healthcare

Limited, Sarkhej-Bavla N.H.No.8A, Moraiya, Ahmedabad

Email address: [email protected]

Tel: +91 2717665555; Fax: +91 2717665155

Page 1 of 37



Draft

2

Abstract

Nonalcoholic fatty liver disease (NAFLD) is often associated with obesity and type 2

diabetes. Coagonist of glucagon-like peptide-1 receptor (GLP-1R) and glucagon receptor

(GCGR) are under clinical investigation for the treatment of obesity and type 2 diabetes. In

this study, we have demonstrated the effect of a balanced coagonist in the treatment of

NAFLD using mice models. GLP-1R agonist exendin-4, glucagon, and coagonist (Aib2

C24 Chimera2) were administered to C57BL6/J mice, in which NAFLD was induced by

carbon tetrachloride (CCl4) treatment after in high fat diet (HFD) feeding, and CDAHFD

(choline-deficient, L-amino acid-defined, HFD). Repeated dose administration of coagonist

significantly attenuated liver inflammation and steatosis induced by acute and long-term

treatment with CCl4 in HFD-fed mice. Coagonist markedly attenuated the CDAHFD-

induced expression of TIMP-1, MMP-9, TNF-α, MCP-1, COL1A1 and α-SMA. It also

inhibited progression of hepatic steatosis and fibrosis in mice. Exendin-4 was better than

glucagon, but coagonist was most effective in reduction of hepatic inflammation as well as

steatosis. Coagonist of GLP-1R and GCGR improved NAFLD in C57BL6/J mice. This

effect is mediated by reduction in lipotoxicity and inflammation in liver.

Key words: Coagonist of GLP-1 and glucagon receptors, GLP-1, Glucagon, Inflammation,

NAFLD.

Page 2 of 37



Draft

3

Introduction

Nonalcoholic fatty liver disease (NAFLD) is caused by deposition of lipids in liver (Brea

and Puzo 2013). NAFLD may start from only steatosis, and can worsen to nonalcoholic

steatohepatitis (NASH), fibrosis, and cirrhosis. If left untreated, NAFLD can lead to total

liver dysfunction and carcinoma (Bellentani et al. 2010). NAFLD is closely associated with

obesity and insulin resistance, and the mortality due to NAFLD is mainly ascribed to

cardiovascular complications (Younossi et al. 2016; Dyson et al. 2015). NAFLD is mainly

treated with lifestyle changes, followed by pharmacotherapy that targets different aspects of

metabolic syndrome like obesity, dyslipidemia and insulin resistance. Despite these

multiple approaches, the efficacy of pharmacotherapy for NAFLD is minimal (Del et al.

2014; Schwenger and Allard 2014; Filozof et al. 2015).

Glucagon-like peptide-1receptor agonists (GLP-1RA) are used for the treatment of type 2

diabetes. In addition, they demonstrate a significant weight loss in overweight and obese

adults (Patel et al 2014). GLP-1RA, liraglutide treatment showed histological resolution of

liver abnormality in NASH patients (Armstrong et al. 2016). Another proglucagon derived

hormone, glucagon is a functional antagonist of insulin. It increases thermogenesis,

lipolysis and fatty acid oxidation (Habegger 2010). Development of coagonist of GLP-1R

and GCGR is a recent therapeutic strategy for achieving optimum control of type 2 diabetes

associated with obesity. Indeed, studies using Aib2 C24 chimera2, a balanced Glucagon-

like peptide-1 receptor (GLP-1R)/Glucagon receptor (GCGR) coagonist have demonstrated

that, balancing the opposing effects of GLP-1R and GCGR activation reduce diabetes and

obesity in animal models (Day et al. 2009). Oxyntomodulin endogenous coagonist of GLP-

Page 3 of 37



Draft

4

1R and GCGR showed weight loss, and increased energy expenditure in humans (Cohen et

al. 2003).

Hepatic lipogenesis and insulin resistance cause lipotoxicity, oxidative stress and induce

proliferative and apoptotic changes typically observed in NAFLD (Bechmann et al. 2012).

Earlier, we have observed that GLP-1R and GCGR coagonist treatment improved insulin

sensitivity, and reduced hepatic and circulating lipids in HFD fed C57BL6/J mice (Patel et

al. 2013). This effect was partially independent of food intake or body weight lowering

effect of the coagonist (Patel et al. 2013). It suggests that a direct hepatic effect of coagonist

that can be exploited for treatment of NAFLD. Hence, in this study we investigated the

effect of coagonist, exendin-4 (a GLP-1RA), and glucagon in NAFLD induced by carbon

tetrachloride (CCl4) and high fat diet (HFD), and choline-deficient, L-amino acid-defined

high fat diet (CDAHFD).

Materials and methods

Chemicals and Reagents

Aib2 C24 Chimera2 (H1SQGT

5FTSDY

10SKYLD

15EQAAK

20EFIAW

25LMNT-NH

2) the

coagonist of GCGR and GLP-1R, exendin-4 and glucagon were synthesized at Zydus

Research Centre, Ahmedabad, India. All other chemicals and reagents were purchased from

Sigma- Aldrich chemicals, USA, unless stated otherwise. Coagonist, exendin-4 and

glucagon were dissolved in normal saline. CCl4 was formulated in corn oil (5%v/v).

Page 4 of 37



Draft

5

Animals

Male C57BL6/J mice (6-8 weeks old) were obtained from the Animal Research Facility of

Zydus Research Centre, Ahmedabad, India. They had free access to food and water and

were kept on a 12 h light–dark cycle. The procedures for animal use and experimentation

were reviewed and approved by Institutional Animal Ethics Committee (as per CPCSEA,

Committee for the Purpose of Control and Supervision of Experiments on Animals,

Government of India) of Zydus Research Centre, which is an AAALAC accredited facility.

All the procedures were done in accordance with the Guidelines for the Care and Use of

Laboratory Animals from the National Institutes of Health, USA. Chow-fed control animals

were maintained on chow diet. All the animals were anesthetized using 2% isoflurane.

Animals were bled by retro-orbital puncture under anesthesia. Animals were sacrificed

under 5% isoflurane anesthesia.

Induction of hepatic inflammation after carbon tetrachloride administration in high

fat diet-fed mice

Animals were fed with a HFD (60% fat by kcal, D12492; Research Diets, Inc., New

Brunswick, NJ) for 20 weeks. We have used CCl4 induced hepatic inflammation in DIO

mice as it resembles key distinguishing characters of human liver fibrosis, i.e.

inflammation, regeneration, fibre-formation and potentially fibrosis regression (Liedtke et

al. 2013; Allman et al. 2010). Owing to this similarity, carbon tetrachloride induced liver

inflammation is most commonly used approach to induce experimental liver fibrosis in

preclinical models.

Page 5 of 37



Draft

6

In acute experiment, HFD-fed mice were randomized based on body weight. Hepatic

inflammation was induced by a single dose of CCl4 (0.5 mL.kg-1

, i.p.). Treatment of either

exendin-4 (50 µg.kg-1

, s.c.) or glucagon (150 µg.kg-1

, s.c.) or coagonist Aib2 C24 chimera 2

(150 µg.kg-1

, s.c.) was given twice a day starting two days prior to the administration of

CCl4, and continued for next three days after CCl4 dose. The doses of exendin-4, glucagon,

and coagonist selected using pilot studies based on literature reports (Day et al. 2009; Wang

et al. 2014; Patel et al. 2017b). All animals were bled through retro-orbital puncture under

isoflurane anesthesia 72 h after CCl4 administration and plasma samples were separated for

estimation of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and

triglycerides (RCFL, Delhi, INDIA).

In chronic experiment, HFD–fed mice for 20 weeks were randomized based on body

weight. Chronic hepatic inflammation was induced by twice a week intraperitoneal

administration of CCl4 (0.5 mL.kg-1

, i.p.) in corn oil for six weeks. Treatment of either

vehicle or exendin-4 (50 µg.kg-1


, s.c.) or coagonist Aib2 C24

chimera 2 (150 µg.kg-1

, s.c.) was given twice a day for six weeks. Animals were bled and

sacrificed 72 h after last dose of CCl4. Plasma samples were separated for estimation of

AST, ALT, glucose and triglycerides (RCFL, Delhi, INDIA). Thereafter, mice were

sacrificed and liver samples were isolated and stored at -70ºC for further analysis.

Choline-deficient, amino acid-defined, high-fat diet (CDAHFD) -induced NASH

Animals were fed with CDAHFD (0.1% methionine without choline and 60% fat,

A06071302, Research Diet, New Brunswick, NJ, USA) for 8 weeks. Following which, they

were randomized based on plasma AST and ALT and assigned to either vehicle or exendin-

Page 6 of 37



Draft

7

4 (50 µg.kg-1


, s.c.) or coagonist Aib2 C24 chimera 2 (150

µg.kg-1

, s.c.) treatment twice a day for next 8 weeks. We use this model because it is

presented with steatosis and inflammation caused due to lipid accumulation, and not due to

inflammation per se, as observed with CCl4-induced toxic insult (Matsumoto et al. 2013).

Hence, CCl4-induced and CDAHFD-induced models were complimentary to each other,

encompassing the pathology of clinically observed NAFLD. At the end of treatment,

animals were bled and plasma samples were separated for estimation of AST, ALT, glucose

and triglycerides (RCFL, Delhi, INDIA). Thereafter, mice were sacrificed and liver

samples were isolated and stored at -70ºC for further analysis.

Hepatic lipid estimation

Liver samples were homogenized using a Polytron PT3100 tissue homogenizer

(Kinematica, Bohemia, NY, USA) in heptane-isopropanol-Tween mixture (3: 2: 0.01 v/v/v)

and centrifuged at 1,500 × g for 15 min at 4°C. The supernatant (the upper phase contained

extracted triglycerides) was collected and evaporated using a nitrogen evaporator. The

residue was solubilized in tritonX100:t-butyl alcohol (1:1). The triglyceride content was

determined using a triglyceride kit.

Hepatic hydroxyproline estimation

Hydroxyproline content in the liver was measured using a modified colorimetric method

(Reddy and Enwemeka 1996). Briefly, 50 mg of liver tissue was homogenized in 500 µL of

phosphate buffered saline (PBS), and centrifuged (10000 r.p.m., 10 min at 4 °C).

Supernatant (200 µL) was hydrolyzed in 200 µL of 4N NaOH and incubated for 30 min at

37 ºC. Methyl red solution (5 µL) was added to each tube, and pH was adjusted to 7.0 using

Page 7 of 37



Draft

8

2N HCl. Samples (400 µL) were diluted in PBS and oxidized with 200 µL chloramine-T at

room temperature for 20 min. Ehrlich’s aldehyde reagent (200 µL) was added to and tubes

were incubated at 60 °C for 30 min. Absorbance was measured at 550 nm. The

concentration of hydroxyproline was determined using a standard curve prepared from

known concentrations of hydroxyproline.

Histological Examination

Hepatic fibrosis and macrophages infiltration were examined in 10% formaldehyde-fixed

paraffin embedded tissue sections. Hepatic fibrosis was assessed by Masson’s trichome

staining method. Activated macrophages in liver i.e. kupffer cells, were visualized in liver

sections stained with periodic acid–schiff–diastase (PAS-D). Fat deposition, was assessed

using oil red O (ORO) staining technique in frozen tissue samples. NASH scoring was

applied to the severity of hepatocellular steatosis, ballooning, inflammation and fibrosis in

liver sectioned stained using hematoxylin and eosin (H&E) stain (Klener et al. 2005). The

scoring for Masson’s trichome, ORO and PAS-D stain were graded as 0-4 (0: No

abnormalities detected, 1: Minimal abnormality, 2: Mild abnormality, 3: Moderate

abnormality and 4: Severe abnormality).

Quantification of mRNA expression by real-time polymerase chain reaction

Expressions of monocyte chemoattractant protein 1(MCP-1), matrix metallopeptidase-9

(MMP-9), tissue inhibitor of metalloproteinases-1 (TIMP-1), alpha-smooth muscle actin (α-

SMA), collagen type 1 α 1 (COL1A) and tumor necrosis factor-α (TNF-α) and β-actin

mRNA in liver tissue were assessed by RT-PCR at the end of the study. Total RNA was

extracted with TRIzol reagent (Applied Biosystem, USA) according to the manufacturer's

Page 8 of 37



Draft

9

instructions. Thereafter, first strand cDNA synthesis was performed using the High-

Capacity cDNA reverse transcription kit (Applied Biosystem, USA). The resulting cDNAs

were used for quantitative PCR using the QIAGEN Quanti Fast SYBR Green kit (Cat. No.

204052, Qiagen, Germantown, MD, USA). The qPCR was run in an ABIprism-7300

(Applied Biosystems, Foster City, CA, USA). Quantitation of the mRNAs was performed

using the 2−∆∆Ct method using β-actin as a housekeeping gene. All primers and sequence

details are given in Table 1.

Data analysis

Data are represented as mean ± SD. Statistical significance was determined by one-way

ANOVA for multiple comparisons with post hoc Dunnett’s test. P<0.05 was considered as

significant. Histological score was evaluated using Kruskal–Wallis test followed by Dunn’s

test for multiple comparisons. All data were analyzed by using GraphPad Prism version

7.03 (GraphPad Software, San Diego, CA, USA).

Results

Coagonist reversed CCl4-induced hepatic steatosis in mice

A significant increase in plasma triglycerides, AST and ALT was observed after HFD with

CCl4 treatment in C57BL6/J mice, when compared to chow-fed mice (Fig. 1). Treatment

with exendin-4 reduced plasma AST by 22.1±10.8% (Fig. 1B) and plasma ALT by

18.4±8.8 % (Fig. 1C). Glucagon treatment showed 12.6±15.3% reduction in AST and

10.9±12.4% reduction in ALT, against vehicle control (Fig. 1B, C). The coagonist

treatment reduced plasma AST by 62.1±6.2% and ALT by 34.3±7.2% against vehicle

control (Fig. 1 B,C).

Page 9 of 37



Draft

10

Since the short-term treatment of the coagonist improved AST and ALT after single dose of

CCl4, we evaluated the effect of coagonist for a longer duration. Exendin-4, glucagon and

coagonist reduced plasma triglycerides, and body weight against vehicle control (Fig. 2 A,

C). Exendin-4 and coagonist reduced plasma glucose by 11.8±11.0 % and 29.6±12.4%,

while glucagon did not alter glucose levels (Fig. 2B). Exendin-4, glucagon and coagonist

treatment reduced plasma AST by 21.4±5.5%, 11.1±8.4% and 48.9 ± 7.4%, respectively

and plasma ALT by 22.5±10.5%, 13.7±16.0% and 52.1± 8.4%, respectively, when

compared to vehicle control group (Fig. 2D,E). A marked increase in NASH score was

observed in vehicle control (6.3±1.2) against chow-fed controls (0 score). Treatment by

exendin-4, glucagon, and coagonist caused 27.4±9.3%, 14.7±19.4% and 54.4±11.7%

reduction in NASH score (Fig. 3A,D). Lipid accumulation (as observed using oil red O

stain) and triglyceride levels in liver were significantly increased in vehicle control group

when compared to chow-fed mice (Fig. 3B,E). Treatment with exendin-4, glucagon and

coagonist reduced the lipid accumulation scores by 50.0±15.1%, 24.0±22.5%, and

75.0±23.7% and hepatic triglyceride levels by 33.3±13.2%, 25.5±14.4%, and 50.0 ± 10.2%,

respectively, when compared with vehicle control group (Fig. 2 B,E). Exendin-4, glucagon,

and coagonist treatment reduced fibrosis score (as observed by Masson’s trichome stain) by

33.3±13.2%, 16.7±19.9%, and 50.0±15.1%, respectively, when compared to vehicle control

group (Fig. 3C,F).

Coagonist ameliorated CDAHFD-induced hepatic inflammation in mice

Sixteen weeks exposure to CDAHFD significantly reduced plasma triglycerides, while

increased plasma ALT and AST in C57BL6/J mice (Fig. 4A,C). Exendin-4 and glucagon

Page 10 of 37



Draft

11

treatment did not change body weight, while coagonist treatment reduced weight gain by

28.5±2.4% when compared to vehicle control (Fig. 4A). Exendin-4, glucagon and coagonist

did not alter plasma glucose (Fig. 4B). Exendin-4 and glucagon treatment reduced plasma

AST by 42.6±13.9% and 24.9±11.5%, and plasma ALT by 36.6±15.8% and 42.6±13.9%,

respectively (Fig. 4D,E). Coagonist treatment caused 53.2±6.1% decrease in plasma AST

and 44.3±12.2% decrease in plasma ALT, respectively against vehicle control (Fig. 4D,E).

Exendin-4, glucagon and coagonist did not change plasma triglycerides (Fig. 4C).

Hepatocellular steatosis, hepatocyte ballooning, inflammation and moderate peri-sinusoidal

or peri-portal fibrosis was observed in liver of CDAHFD-fed animals, after H&E staining

(Fig. 5A,E). Exendin-4 and glucagon treatment reduced inflammatory and fibrotic changes

by 17.9±17.3%, 9.0±7.4%, respectively, when compared to vehicle control group (Fig.

5A,E). Coagonist treatment showed 40.3±12.1% reduction in NASH score against vehicle

control (Fig. 5 A,E). Oil red O staining showed significant fat accumulation in liver of

CDAHFD-fed animals, which was reduced by exendin-4, glucagon, and coagonist by

21.9±14.1%, 14.1±12.2% and 41.4±9.3% respectively, against vehicle control (Fig. 5B,F).

CDAHFD-fed animals showed an increase in intrahepatic triglycerides by 6.0±0.96 fold

and cholesterol by 2.9±0.4 fold against chow-fed animals (Fig. 4F,G). Glucagon and

exendin-4 treatment reduced hepatic triglycerides by 16.5±11.1 and 30.5±9.1%,

respectively, and cholesterol by 13.5±10.9% and 27.0±11.8%, respectively (Fig. 4F,G).

Coagonist showed a stronger effect by reducing hepatic triglycerides by 45.0±11.7% and

cholesterol by 47.1±15.3%, when compared to vehicle control (Fig. 4F,G).

Page 11 of 37



Draft

12

CDAHFD-fed animals showed increased collagen deposition and presence of activated

macrophages, when examined using Masson’s trichome and PAS-D staining (Fig. 5

C,D,G,H). Glucagon treatment did not reduce the fibrosis score (Fig. 5C,G) or PAS-D

score (Fig. 5D,H). Exendin-4 and coagonist treatment reduced fibrosis score by 21.3±9.1%

and 45.7±13.2%, respectively (Fig. 5C,G), and PAS-D score by 20.0±15.1% and

35.5±11.8%, respectively (Fig. 5D,H), against vehicle control. Increased collagen

deposition in the liver of CDAHFD-fed animals was also confirmed by increase in

hydroxyproline content (Fig. 4I). Treatment with exendin-4 and coagonist reduced hepatic

hydroxyproline by 28.6±11.7% and 44.3±8.8% respectively, while glucagon treatment did

not alter it (Fig. 4I). CDAHFD control showed increase in hepatic expression of COL1A1

by 2.1±0.47 fold and α-SMA by 1.8±0.24 fold against chow-fed control (Fig. 6E,F).

Exendin-4, glucagon and coagonist treatment reduced COL1A1 expression by 45.4±5.5%,

25.8±8.4% and 66.9±14.6%, respectively, against vehicle control (Fig. 6E). Expression of

α-SMA was also reduced by treatment with exendin-4, glucagon and coagonist in liver by

40.5±5.5%, 21.3±9.4% and 61.8±17.8%, respectively, against vehicle control (Fig. 6F).

CDAHFD exposure caused as increase in expression of pro-inflammatory genes, namely

TIMP-1, MMP-9, TNF-α, and MCP-1 in liver (Fig. 6A-D). Exendin-4 treatment decreased

expression of all these four pro-inflammatory genes, and glucagon treatment was only half-

way effective as that of exendin-4 treatment (Fig. 6 A-D). Coagonist treatment

demonstrated a significant reduction in the expression of TIMP-1, MMP-9, and MCP-1 by

more than 50% and reduced TNF-α by 48.0±11.0%, when compared to vehicle control (Fig.

6A-D). The inflammatory and fibrotic changes were associated with increased liver weight

Page 12 of 37



Draft

13

in CDAHFD-fed animals. Exendin-4, glucagon and coagonist treatment reduced liver

weight (Fig. 4H).

Discussion

In this study, we investigated the effect of GLP-1R and GCGR coagonist on hepatic

steatosis and fibrosis in mice models of NAFLD. Carbon tetrachloride causes hepatic injury

by inducing oxidative stress. Fibrosis induced by CCl4 is a reversible process, similar to the

symptoms of inflammation-induced hepatic fibrosis in clinic (Lassailly et al. 2015;

Neuschwander-Tetri et al. 2015). HFD prolongs the inflammatory and necrotic phase of

NAFLD induced by CCl4 (Allman et al. 2010; Wang et al. 2011). However, HFD feeding

in mice induced obesity, insulin resistance, hyperlipidemia which mimics NAFLD in

humans (Nakamura and Terauchi 2013). HFD feeding creates calorie overload in mice and

leads to development of obesity and insulin resistance involving multiple factors such as

mammalian target of rapamycin (mTOR). Hence, HFD was used in combination with CCl4

in the current work.

CDAHFD prevents secretion of hepatic lipids in circulation due to defective incorporation

of triglycerides into Apo B100. As a result, lipids get accumulated in hepatocytes, causing

steatosis, inflammation, oxidative stress, and fibrosis (Rinella et al. 2008). CDAHFD shuts

down the hepatic β-oxidation and triglyceride production, which leads to increase in liver

and causes subsequent cellular damage resulting in fibrosis (Matsumoto et al. 2013). This

model shows rapid onset and progression of hepatic fibrosis due to excess accumulation of

ectopic fat in the liver. Further, CDAHFD mouse model is useful for investigating multiple

hits leading to the treatment of NAFLD (Matsumoto et al. 2013).

Page 13 of 37



Draft

14

Acute and long-term treatment of exendin-4 caused decrease in liver inflammation,

accompanied by a reduction in hepatic lipids and inflammation in NAFLD mice models.

Our results are in line with previous studies, which reported a reduction in plasma

triglycerides by exendin-4 treatment (Varanasi et al. 2010; Lee et al. 2012). The effect of

exendin-4 on hepatic steatosis in ob/ob mice or HFD-induced obese mice is reported in

literature (Lee et al. 2012; Ding et al. 2006). Exendin-4 reduces food intake by its action on

ventromedial hypothalamus and arcuate nucleus (Yang et al. 2014; Burmeister et al. 2017).

GLP-1 receptors in brain cause anorexia by activating AMP-activated protein kinase

(AMPK) and mTOR (Burmeister et al. 2017). We have reported earlier that lipid lowering

effect of GLP-1 was also mediated by activation of central GLP-1R, which was partially

independent of anorexia (Patel V et al. 2015). Exendin-4 has protective role in cardiac

hypertrophy which is mediated by activation of mTOR signaling (Zhou et al. 2015).

Though we have not measured either mTOR or AMPK signalling after exendin-4 treatment

in these models, their involvement cannot be ruled out. In the current study, we have

observed the effect of exendin-4 in CCl4- or CDAHFD-induced hepatic injury, in a chronic

dosing regimen. It is interesting to note that acute and long-term treatment with exendin-4

caused a substantial reduction in plasma AST and ALT in CCl4-treated animals. This data

supports the anti-inflammatory properties of exendin-4, which was demonstrated in other

mice models of lipotoxicity (Ceriello et al. 2014). We have observed that the anti-

inflammatory effect of exendin-4 is mediated by a reduction in pro-inflammatory genes,

namely TIMP-1, MCP-1, MMP-9 and TNF-α. A potential role of exendin-4 in the treatment

Page 14 of 37



Draft

15

of hepatic steatosis and fibrosis is thus indicated by demonstration of its efficacy in animal

models for NAFLD employed in current study.

We have observed that glucagon reduces plasma ALT and AST in CCl4 -treated mice, an

effect that was inferior to that of exendin-4. Glucagon’s effect in CCl4-induced hepatic

injury model was associated with reduction in body weight, hepatic lipids and hepatic

inflammation. Reduction in hyperlipidemia is a known effect of glucagon (Jaya and Kurup

1987; Patel et al. 2017a). Hence, it can be concluded that glucagon has a weak anti-

inflammatory effect that can be utilized in the treatment of hepatic inflammation and

fibrosis.

The balanced coagonist of GLP-1 and glucagon used in the current work is reported to have

significant anti-obesity, anti-diabetic, hypolipidemic effect that is partially independent of

anorexia (Day et al. 2009; Patel et al. 2013). It has already been reported that the coagonist

used in the current work has optimally balanced agonistic activity on GLP-1 and glucagon

receptors (Day et al. 2009). Previously, we and others have observed that coagonist

activates both GLP-1R and GCGR, by which the pharmacological effect in glycemic and

lipid metabolism control is observed (Patel et al. 2013; Valdecantos et al. 2017; Pocai et al.

2009). Since these properties of coagonist can be used to alleviate NAFLD and related

disorders, we investigated the effect of the coagonist of GLP-1R and GCGR in the two

mice models of NAFLD. G49, a dual agonist of GLP-1 and glucagon receptors has been

reported to reduce inflammation, steatosis, oxidative stress, and apoptosis in NAFLD

induced by partial hepatectomy with methionine and choline-deficient (MCD) diet in mice

(Valdecantos et al. 2017). Treatment with another dual agonist of GLP-1 and glucagon

Page 15 of 37



Draft

16

receptors has also been reported to reduce lipid accumulation in liver of DIO mice (Zhou et

al. 2017). The models used in these studies are intended to induce obesity and not NAFLD.

Hence, in our work we have used carbon tetrachloride along with long term exposure of

high fat diet to induce overt NAFLD, as confirmed by histological markers (Allman et al.

2010; Nakamura and Terauchi 2013). Hence, ours is the first report in which a balanced

coagonist of GLP-1 and glucagon receptors has been shown to reduce hepatic inflammation

induced by carbon tetrachloride. This model of NAFLD is presented by inflammation,

insulin resistance and fibrosis, which resemble clinical NAFLD. Typically, for induction of

NAFLD, mice are fed with methionine- and choline-deficient diet. However, exposure to

this diet causes weight loss (Chiba et al. 2016). Since coagonist of GLP-1R and GCGR also

cause reduction in body weight, it can reinforce the weight loss inducing action of MCD,

causing undue toxicity. To avoid this complication, we have used choline-deficient amino

acid defined high fat diet, which induces NAFLD without body weight loss.

We have observed that acute and chronic treatment of coagonist prevented rise in plasma

AST and ALT in CCl4-induced hepatic inflammation in diet-induced obese mice. NAFLD

is a result of imbalance between lipogenesis and lipid disposal from liver (Kawano and

Cohen 2013). Coagonist reduced body weight and plasma triglycerides in CCl4-induced

hepatic steatosis in diet-induced obese mice. CDAHFD increased the hepatic macrophage

content in mice, which is a characteristic feature of advanced NAFLD in humans

(Vetelainen et al. 2007). Coagonist treatment suppressed liver weight and reduced signs of

inflammation, collagen and fibrosis. PAS-D staining of liver tissue indicated a significant

reduction in activated macrophage content by coagonist treatment in CDAHFD-fed

Page 16 of 37



Draft

17

C57BL6/J mice. NAFLD is associated with chronic inflammation in liver. The adipose

tissue is the primary source of inflammatory mediators, notably MCP-1 and TNF-α, in

obesity and dyslipidemia. NAFLD is associated with increased inflammatory mediators in

liver (Farrell et al. 2012), like TIMP-1 and MMP-9 and cause fibrosis (Okazaki et al. 2014).

Stellate cells are the principal collagen-producing cells, α-SMA is a marker for its

activation was upregulated in hepatic steatosis (Washington et al. 2000). Coagonist

treatment reduced expression of α-SMA and COL1A1 in liver. Coagonist treatment reduced

the liver lipid content, accompanied by a reduction in inflammatory markers and fat

accumulation in liver. We have observed that coagonist treatment has reduced expression

of TIMP-1, MMP-9, TNF-α and MCP-1 in liver. Earlier, we have observed that glucagon

enhances cholesterol excretion in bile (Patel et al. 2017a). These properties of glucagon

receptor agonism may also be responsible for the hepatoprotective effect of coagonist in

lipotoxicity conditions. Interestingly, no significant changes in plasma triglycerides were

observed after coagonist treatment in CDAHFD-fed mice. This indicates that the beneficial

effects of coagonist in CDAHFD-induced NAFLD cannot be attributed to hyperlipidemia,

but also to reduction ion inflammation in liver. Recently, we have observed that coagonist

improves FGF21 sensitivity, which might be involved in the hepatoprotective effect by

coagonist (Patel et al. 2017b). Signaling of mTOR is involved in the metabolic actions of

exendin-4, and glucagon activates mTOR signaling (Kimball et al. 2004; Burmeister et al.

2017). NAFLD is an independent risk factor for cardiovascular disease, in which mTOR

signalling has an important role (Tarantino and Capone 2013). Hence, in prospective,

involvement of mTOR/AMPK signaling in amelioration of NAFLD by coagonist is worth

Page 17 of 37



Draft

18

investigation. The balanced coagonist used in this study possesses potent GLP-1 agonist

activity, and weaker glucagon agonist effect (Day et al. 2009). This combination of dual

agonistic activity balances the opposing effects of GLP-1 and glucagon on glucose

metabolism, while reinforcing the effects on body weight and lipid metabolism. In

prospective, long term toxicity studies are required to understand the target-based and off-

target toxic effects of the coagonists, which were beyond the scope of the current work.

Taken together these results suggest that coagonist can be a therapeutic option for

ameliorating metabolic abnormality associated with NAFLD and can prevent NAFLD in

susceptible population.

Page 18 of 37



Draft

19

Acknowledgement

No funding received for this manuscript. This is a Zydus Research Centre (ZRC)

communication.

Disclosure

No author of this manuscript has any conflicting potential interest.

Page 19 of 37



Draft

20

References

Allman M, Gaskin L, Rivera CA. 2010. CCl4-induced hepatic injury in mice fed a Western

diet is associated with blunted healing. J Gastroenterol Hepatol. 25(3): 635-643.

PMID:20370733. DOI:10.1111/j.1440-1746.2009.06112.x

Armstrong, M.J., Hull, D., Guo, K., Barton, D., Hazlehurst, J.M., Gathercole, L.L., Nasiri,

M., Yu, J., Gough, S.C., Newsome, P.N. and Tomlinson, J.W. 2016. Glucagon-like peptide

1 decreases lipotoxicity in non-alcoholic steatohepatitis. J Hepatol. 64(2): 399-408.

PMID:26394161. DOI:10.1016/j.jhep.2015.08.03

Bechmann, L.P., Hannivoort, R.A., Gerken, G., Hotamisligil, G.S., Trauner, M. and

Canbay, A. 2012. The interaction of hepatic lipid and glucose metabolism in liver diseases.

J Hepatol. 56(4):952-964. PMID:22173168. DOI: 10.1016/j.jhep.2011.08.025

Bellentani, S., Scaglioni, F., Marino, M. and Bedogni, G., 2010. Epidemiology of non-

alcoholic fatty liver disease. Dig Dis. 28(1):155-161. PMID: 20460905. DOI:

10.1159/000282080

Brea, A., Puzo. J. 2013. Non-alcoholic fatty liver disease and cardiovascular risk. Int J

Cardiol. 167(4): 1109-17. PMID: 23141876. DOI:10.1016/j.ijcard.2012.09.085

Burmeister, M.A., Brown, J.D., Ayala, J.E., Stoffers, D.A., Sandoval, D.A., Seeley, R.J.

and Ayala, J.E. 2017. The Glucagon-Like Peptide-1 Receptor in the Ventromedial

Hypothalamus Reduces Short-Term Food Intake in Male Mice by Regulating Nutrient

Sensor Activity. American Journal of Physiology-Endocrinology and Metabolism. PMID:

28811293. DOI:10.1152/ajpendo.00113.2017

Page 20 of 37



Draft

21

Ceriello, A., Novials, A., Canivell, S., La Sala, L., Pujadas, G., Esposito, K., Testa, R.,

Bucciarelli, L., Rondinelli, M. and Genovese, S. 2014. Simultaneous GLP-1 and insulin

administration acutely enhances their vasodilatory, antiinflammatory, and antioxidant

action in type 2 diabetes. Diabetes Care. 37(7):1938-1943. PMID: 24667461. DOI:

10.2337/dc13-2618

Chiba, T., Suzuki, S., Sato, Y., Itoh, T. and Umegaki, K. 2016. Evaluation of Methionine

Content in a High-Fat and Choline-Deficient Diet on Body Weight Gain and the

Development of Non-Alcoholic Steatohepatitis in Mice. PloS one. 11(10):0164191. PMID:

27723801. DOI:10.1371/journal.pone.0164191

Cohen, M.A., Ellis, S.M., Le Roux, C.W., Batterham, R.L., Park, A., Patterson, M., Frost,

G.S., Ghatei, M.A. and Bloom, S.R. 2003. Oxyntomodulin suppresses appetite and reduces

food intake in humans. J Clin Endocrinol Metab. 88(10): 4696-4701. PMID: 14557443.

DOI: 10.1210/jc.2003-030421

Day, J.W., Ottaway, N., Patterson, J.T., Gelfanov, V., Smiley, D., Gidda, J., Findeisen, H.,

Bruemmer, D., Drucker, D.J., Chaudhary, N., Holland, J., Hembree, J., Abplanalp, W.,

Grant, E., Ruehl, J., Wilson, H., Kirchner, H., Lockie, S.H., Hofmann, S., Woods, S.C.,

Nogueiras, R., Pfluger, P.T., Perez-Tilve, D., Dimarchi, R., and Tschop, M.H. 2009. A new

glucagon and GLP-1 co-agonist eliminates obesity in rodents. Nat.Chem.Biol. 5(10):749-

757. PMID:19597507. DOI: 10.1038/nchembio.209

Del Ben, M., Polimeni, L., Baratta, F., Pastori, D., Loffredo, L. and Angelico, F. 2014.

Modern approach to the clinical management of non-alcoholic fatty liver disease. World J

Gastroenterol. 20(26), 8341-8350. PMID:25024593. DOI: 10.3748/wjg.v20.i26.8341

Page 21 of 37



Draft

22

Ding, X., Saxena, N.K., Lin, S., Gupta, N. and Anania, F.A. 2006. Exendin‐4, a glucagon‐

like protein‐1 (GLP‐1) receptor agonist, reverses hepatic steatosis in ob/ob mice.

Hepatology. 43(1):173-181. PMID:16374859. DOI:10.1002/hep.21006

Dyson, J.K., Anstee, Q.M. and McPherson, S. 2015. Republished: Non-alcoholic fatty liver

disease: a practical approach to treatment. Postgrad Med J. 91(1072):92-101.

PMID:25655252. DOI:10.1136/postgradmedj-2013-100404rep

Farrell, G.C., Van Rooyen, D., Gan, L. and Chitturi, S. 2012. NASH is an inflammatory

disorder: pathogenic, prognostic and therapeutic implications. Gut liver. 6(2):149-171.

PMID:22570745. DOI:10.5009/gnl.2012.6.2.149

Filozof, C., Goldstein, B.J., Williams, R.N. and Sanyal, A. 2015. Non-alcoholic

steatohepatitis: limited available treatment options but promising drugs in development and

recent progress towards a regulatory approval pathway. Drugs.75(12):1373-1392.

PMID:26201461. DOI:10.1007/s40265-015-0437-3

Habegger, K.M., Heppner, K.M., Geary, N., Bartness, T.J., DiMarchi, R. and Tschöp, M.H.

2010. The metabolic actions of glucagon revisited. Nat Rev Endocrinol. 6(12):689-697.

PMID:20957001. DOI:10.1038/nrendo.2010.187

Jaya, P., Kurup, P.A.1987. Mechanism of hypocholesterolemic action of glucagon. J

Biosci. 12(2):111-114. DOI:10.1007/BF02702961

Kawano, Y. and Cohen, D.E. 2013. Mechanisms of hepatic triglyceride accumulation in

non-alcoholic fatty liver disease. J Gastroenterol. 48(4):434-441. PMID:23397118.

DOI:10.1007/s00535-013-0758-5

Page 22 of 37



Draft

23

Kimball, S.R., Siegfried, B.A. and Jefferson, L.S. 2004. Glucagon represses signaling

through the mammalian target of rapamycin in rat liver by activating AMP-activated

protein kinase. Journal of Biological Chemistry. 279(52):54103-54109. PMID:15494402.

DOI:10.1074/jbc.M410755200

Kleiner, D.E., Brunt, E.M., Van, N.M., Behling, C., Contos, M.J., Cummings, O.W.,

Ferrell, L.D., Liu, Y.C., Torbenson, M.S., Unalp-Arida, A., Yeh, M., McCullough, A.J., &

Sanyal, A.J. 2005. Design and validation of a histological scoring system for nonalcoholic

fatty liver disease. Hepatology. 41(6):1313-1321. PMID:15915461.

DOI:10.1002/hep.20701

Lassailly, G., Caiazzo, R., Buob, D., Pigeyre, M., Verkindt, H., Labreuche, J., Raverdy, V.,

Leteurtre, E., Dharancy, S., Louvet, A., Romon, M., Duhamel, A., Pattou, F., and Mathurin,

P. 2015. Bariatric Surgery Reduces Features of Nonalcoholic Steatohepatitis in Morbidly

Obese Patients. Gastroenterology. 149(2):379-388. PMID:25917783.

DOI:10.1053/j.gastro.2015.04.014

Lee, J., Hong, S.W., Chae, S.W., Kim, D.H., Choi, J.H., Bae, J.C., Park, S.E., Rhee, E.J.,

Park, C.Y., Oh, K.W., Park, S.W., Kim, S.W., and Lee, W.Y. 2012. Exendin-4 improves

steatohepatitis by increasing Sirt1 expression in high-fat diet-induced obese C57BL/6J

mice. PLoS.One. 7(2):e31394. PMID:22363635. DOI:10.1371/journal.pone.0031394

Liedtke, C., Luedde, T., Sauerbruch, T., Scholten, D., Streetz, K., Tacke, F., Tolba, R.,

Trautwein, C., Trebicka, J. and Weiskirchen, R. 2013. Experimental liver fibrosis research:

update on animal models, legal issues and translational aspects. Fibrogenesis & tissue

repair. 6(1):19. PMID: 24274743. DOI:10.1186/1755-1536-6-19

Page 23 of 37



Draft

24

Matsumoto, M., Hada, N., Sakamaki, Y., Uno, A., Shiga, T., Tanaka, C., Ito, T., Katsume,

A. and Sudoh, M. 2013. An improved mouse model that rapidly develops fibrosis in non‐

alcoholic steatohepatitis. Int J Exp Pathol. 94(2):93-103. PMID:23305254.

DOI:10.1111/iep.12008

Nakamura, A. and Terauchi, Y. 2013. Lessons from mouse models of high-fat diet-induced

NAFLD. International journal of molecular sciences. 14(11):21240-21257.

Neuschwander-Tetri, B.A., Loomba, R., Sanyal, A.J., Lavine, J.E., Van Natta, M.L.,

Abdelmalek, M.F., Chalasani, N., Dasarathy, S., Diehl, A.M., Hameed, B., Kowdley, K.V.,

McCullough, A., Terrault, N., Clark, J.M., Tonascia, J., Brunt, E.M., Kleiner, D.E., and

Doo, E. 2015. Farnesoid X nuclear receptor ligand obeticholic acid for non-cirrhotic, non-

alcoholic steatohepatitis (FLINT): a multicentre, randomised, placebo-controlled trial.

Lancet. 385(9972):956-965. PMID:25468160. DOI: 10.1016/S0140-6736(14)61933-4

Okazaki, I., Noro, T., Tsutsui, N., Yamanouchi, E., Kuroda, H., Nakano, M., Yokomori, H.

and Inagaki, Y. 2014. Fibrogenesis and carcinogenesis in nonalcoholic steatohepatitis

(NASH): involvement of matrix metalloproteinases (MMPs) and tissue inhibitors of

metalloproteinase (TIMPs). Cancers (Basel). 6(3):1220-1255. PMID:24978432.

DOI:10.3390/cancers6031220

Patel, V., Joharapurkar, A., Dhanesha, N., Kshirsagar, S., Patel, K., Bahekar, R., Shah, G.,

and Jain, M. 2013. Co-agonist of glucagon and GLP-1 reduces cholesterol and improves

insulin sensitivity independent of its effect on appetite and body weight in diet-induced

obese C57 mice. Can.J Physiol Pharmacol.91(12):1009-1015. PMID:24289070.

DOI:10.1139/cjpp-2013-0189

Page 24 of 37



Draft

25

Patel, V.J., Joharapurkar, A.A., Shah, G.B., and Jain, M.R. 2014. Effect of GLP-1 based

therapies on diabetic dyslipidemia. Curr Diabetes Rev. 10(4):238-250. PMID:24998439.

DOI:10.2174/1573399810666140707092506

Patel, V., Joharapurkar, A.A., Kshirsagar, S.G., Patel, K.N., Bahekar, R., Shah, G. and Jain,

M.R. 2015. Central GLP-1 receptor activation improves cholesterol metabolism partially

independent of its effect on food intake. Canadian journal of physiology and pharmacology.

94(2):161-167. PMID:26629909. DOI:10.1139/cjpp-2014-0457

Patel, V., Joharapurkar, A., Kshirsagar, S., Patel, H.M., Pandey, D., Patel, D., Shah, K.,

Bahekar, R., Shah, G.B., and Jain, M.R. 2017a. Central and Peripheral Glucagon Reduces

Hyperlipidemia in Rats and Hamsters. Drug Res.(Stuttg). 67(6)318-326. PMID:28445900.

DOI:10.1055/s-0043-102405

Patel, V., Joharapurkar, A., Kshirsagar, S., Patel, H.M., Pandey, D., Patel, D., Sutariya, B.,

Patel, M., Bahekar, R., and Jain, M.R. 2017b. Balanced Coagonist of GLP-1 and Glucagon

Receptors Corrects Dyslipidemia by Improving FGF21 Sensitivity in Hamster Model. Drug

Res.(Stuttg). PMID:28898910. DOI:10.1055/s-0043-118808

Pocai, A., Carrington, P.E., Adams, J.R., Wright, M., Eiermann, G., Zhu, L., Du, X.,

Petrov, A., Lassman, M.E., Jiang, G., Liu, F., Miller, C., Tota, L.M., Zhou, G., Zhang, X.,

Sountis, M.M., Santoprete, A., Capito', E., Chicchi, G.G., Thornberry, N., Bianchi, E.,

Pessi, A., Marsh, D.J., and SinhaRoy, R. 2009. Glucagon-like peptide 1/glucagon receptor

dual agonism reverses obesity in mice. Diabetes.58(10):2258-2266. PMID:19602537. DOI:

10.2337/db09-0278

Page 25 of 37



Draft

26

Pugazhenthi, U., Velmurugan, K., Tran, A., Mahaffey, G. and Pugazhenthi, S. 2010. Anti-

inflammatory action of exendin-4 in human islets is enhanced by phosphodiesterase

inhibitors: potential therapeutic benefits in diabetic patients. Diabetologia.53(11):2357-

2368. PMID:20635178. DOI:10.1007/s00125-010-1849-y

Reddy, G.K. and Enwemeka, C.S. 1996. A simplified method for the analysis of

hydroxyproline in biological tissues. Clin Biochem. 29(3):225-229. PMID:8740508.

DOI:10.1016/0009-9120(96)00003-6

Rinella, M.E., Elias, M.S., Smolak, R.R., Fu, T., Borensztajn, J. and Green, R.M. 2008.

Mechanisms of hepatic steatosis in mice fed a lipogenic methionine choline-deficient diet. J

Lipid Res. 49(5):1068-1076. PMID:18227531. DOI:10.1194/jlr.M800042-JLR200

Schwenger, K.J. and Allard, J.P. 2014. Clinical approaches to non-alcoholic fatty liver

disease. World journal of gastroenterology: World J Gastroenterol. 20(7):1712-1723.

PMID:24587650. DOI:10.3748/wjg.v20.i7.1712

Tarantino, G. and Capone, D. 2013. Inhibition of the mTOR pathway: a possible protective

role in coronary artery disease. Annals of medicine. 45(4):348-356. PMID:23668688.

DOI:10.3109/07853890.2013.770333

Valdecantos, M.P., Pardo, V., Ruiz, L., Castro-Sanchez, L., Lanzon, B., Fernandez-Millan,

E., Garcia-Monzon, C., Arroba, A.I., Gonzalez-Rodriguez, A., Escriva, F., Alvarez, C.,

Ruperez, F.J., Barbas, C., Konkar, A., Naylor, J., Hornigold, D., Santos, A.D., Bednarek,

M., Grimsby, J., Rondinone, C.M., and Valverde, A.M. 2017. A novel glucagon-like

peptide 1/glucagon receptor dual agonist improves steatohepatitis and liver regeneration in

mice. Hepatology. 65(3):950-968. PMID:27880981. DOI:10.1002/hep.28962

Page 26 of 37



Draft

27

Varanasi, A., Chaudhuri, A., Dhindsa, S., Arora, A., Lohano, T., Vora, M. and Dandona, P.

2010. Durability of effects of exenatide treatment on glycemic control, body weight,

systolic blood pressure, C-reactive protein, and triglyceride concentrations. Endocr Pract.

17(2):192-200. PMID:20841306 DOI:10.4158/EP10199.OR

Veteläinen, R., Van Vliet, A. and Van Gulik, T.M. 2007. Essential pathogenic and

metabolic differences in steatosis induced by choline or methione‐choline deficient diets in

a rat model. J Gastroenterol Hepatol. 22(9):1526-1533. PMID:17716355.

DOI:10.1111/j.1440-1746.2006.04701.x

Wang, X., Cao, Y., Fu, Y., Guo, G. and Zhang, X. 2011. Liver fatty acid composition in

mice with or without nonalcoholic fatty liver disease. Lipids Health Dis. 10(1):234-240.

PMID:22165986. DOI: 10.1186/1476-511X-10-234

Wang, Y., Parlevliet, E.T., Geerling, J.J., Tuin, S.J.L., Zhang, H., Bieghs, V., Jawad,

A.H.M., Shiri‐Sverdlov, R., Bot, I., Jager, S.C.A. and Havekes, L.M. 2014. Exendin‐4

decreases liver inflammation and atherosclerosis development simultaneously by reducing

macrophage infiltration. Br J Pharmacol.171(3):723-734. PMID:24490861.

DOI:10.1111/bph.12490

Washington, K., Wright, K., Shyr, Y., Hunter, E.B., Olson, S. and Raiford, D.S. 2000.

Hepatic stellate cell activation in nonalcoholic steatohepatitis and fatty liver. Hum

Pathol.31(7): 822-828. PMID:10923919. DOI:10.1053/hupa.2000.8440

Yang, Y., Moghadam, A.A., Cordner, Z.A., Liang, N.C. and Moran, T.H. 2014. Long term

exendin-4 treatment reduces food intake and body weight and alters expression of brain

Page 27 of 37



Draft

28

homeostatic and reward markers. Endocrinology.155(9):3473-3483. PMID: 24949661.

DOI:10.1210/en.2014-1052

Younossi, Z.M., Koenig, A.B., Abdelatif, D., Fazel, Y., Henry, L. and Wymer, M. 2016.

Global epidemiology of nonalcoholic fatty liver disease—Meta‐analytic assessment of

prevalence, incidence, and outcomes. Hepatology. 64(1):73-84. PMID:26707365

DOI:10.1002/hep.28431

Zhou, Y., He, X., Chen, Y., Huang, Y., Wu, L. and He, J. 2015. Exendin-4 attenuates

cardiac hypertrophy via AMPK/mTOR signaling pathway activation. Biochemical and

biophysical research communications. 468(1):394-399. PMID:26519882.

DOI:10.1016/j.bbrc.2015.09.179

Zhou, J., Cai, X., Huang, X., Dai, Y., Sun, L., Zhang, B., Yang, B., Lin, H., Huang, W. and

Qian, H. 2017. A novel glucagon-like peptide-1/glucagon receptor dual agonist exhibits

weight-lowering and diabetes-protective effects. European Journal of Medicinal Chemistry.

138:1158-1169. PMID:28772236. DOI:10.1016/j.ejmech.2017.07.046

Page 28 of 37



Draft

29

Table

Table 1. Primer sequences used for real time PCR reactions.

Hepatic gene primer Sequence 5'to3'

MCP1 Forward ACACTCCCGTCCTTACATGG

MCP1 Reverse ATGAGCTCCAAGGGTGACAG

MMP-9 Forward CGTCATTCGCGTGGATAAGG

MMP-9 Reverse TTTGGAAACTCACACGCCAG

TIMP1 Forward GTGCACAGTGTTTCCCTGTT

TIMP1 Reverse AAGTGACGGCTCTGGTAGTC

TNF-α Forward GGATTATGGCTCAGGGTCCA

TNF-α Reverse AGGCTCCAGTGAATTCGGAA

α-SMA Forward AGCATCCGACACTGCTGAC

α-SMA Reverse GGGACAGCACAGCCTGAAT

COL1A1 Forward TGATGGGGAAGCTGGCAAG

COL1A1 Reverse GAAGCCTCGGTGTCCCTTC

Page 29 of 37



Draft

30

Figure legands

Figure 1. Effect of acute treatment of exendin-4, glucagon and coagonist in carbon

tetrachloride-induced hepatotoxicity in diet-induced obese mice. A. Triglycerides, B.

Aspartate Aminotransferase (AST) and C. Alanine Aminotransferase (ALT). Data in graph

are presented as mean ± SD, n=6. *P<0.05 when compared with vehicle control.

Figure 2. Effect of chronic treatment of exendin-4, glucagon and coagonist in carbon

tetrachloride-induced hepatotoxicity in diet-induced obese mice. A. Body weight, B.

Plasma glucose, C. Plasma triglycerides, D. Plasma AST, E. Plasma ALT, F. Hepatic

triglycerides. Data in graph are presented as mean ± SD, n=6. *P<0.05 when compared

with vehicle control. TG, Triglycerides, AST, Aspartate transaminase, ALT, Alanine

transaminase.

Figure 3. Effect of chronic treatment of exendin-4, glucagon and coagonist in carbon

tetrachloride-induced hepatotoxicity in diet-induced obese mice. A. NASH score (H&E

score), B. Fat accumulation score (oil red O stain), C. Fibrosis score (Masson’s trichome

stain), D. Liver sections stained with H&E, E. Liver sections stained with oil red O, F.

Liver sections stained with Masson’s trichome, Data in graph are presented as mean ± SD,

n=6. *P<0.05 when compared with vehicle control. Liver histology slides are representative

of each group. H&E, hematoxylin and Eosin.

Figure.4 Effect of exendin-4, glucagon and coagonist in CDAHFD-induced NASH in mice.

A. Body weight, B. Plasma glucose, C. Plasma triglycerides, D. Plasma AST, E. Plasma

ALT, F. Hepatic cholesterol, G. Hepatic triglycerides, H. Relative liver weight, I Hepatic

Page 30 of 37



Draft

31

hydroxyproline, Data in graph are presented as mean ± SD, n=6. *P<0.05 when compared

with vehicle control. AST, Aspartate transaminase, ALT, Alanine transaminase.

Figure.5 Effect of exendin-4, glucagon and coagonist on hepatic gene expression in

CDAHFD-induced NAFLD in mice. A. TIMP-1, B. MMP-9, C. TNF-α, D. MCP-1, E.

COL1A1 and F. α-SMA Data in graph are presented as mean ± SD, n=6. *P<0.05 when

compared with vehicle control. TIMP-1, tissue inhibitor of metalloproteinases-1, MMP-9,

Matrix metallopeptidase-9, MCP-1, Monocyte chemoattractant protein-1, TNF-α, Tumour

Necrosis Factor alpha, α-SMA, alpha-smooth muscle actin; COL1A, collagen type 1 α 1.

Figure.6 Effect of exendin-4, glucagon and coagonist in CDAHFD-induced NAFLD in

mice. A. NASH score (H&E stain), B. Fat accumulation score (oil red O stain), C. Fibrosis

score (Masson’s trichome stain), and D.PAS-D score (PAS-D stain), E. Liver sections

stained with H&E, F. Liver sections stained with oil red O, G. Liver sections stained with

Masson’s trichome stain, H. Liver section stained with PAS-D stain, Data in graph are

presented as mean ± SD, n=6. *P<0.05 when compared with vehicle control. Liver

histology slides are representative of each group.

Page 31 of 37



Draft

Figure 1

258x78mm (300 x 300 DPI)

Page 32 of 37



Draft

Figure 2

156x97mm (300 x 300 DPI)

Page 33 of 37



Draft

Figure 3

248x213mm (300 x 300 DPI)

Page 34 of 37



Draft

Figure 4

176x154mm (300 x 300 DPI)

Page 35 of 37



Draft

Figure 5

184x121mm (300 x 300 DPI)

Page 36 of 37



Draft

Figure 6

195x276mm (300 x 300 DPI)

Page 37 of 37



draft · 2018. 5. 11. · draft coagonist of glp-1 and glucagon receptors ameliorates non-alcoholic...

Documents