downregulation of rad17 in head and neck cancer

ORIGINAL ARTICLE

DOWNREGULATION OF RAD17 IN HEAD AND NECK CANCER

Ming Zhao, MD,1 Shahnaz Begum, MD,2 Patrick K. Ha, MD,1 William Westra, MD,2

Joseph Califano, MD1

1 Department of Otolaryngology-Head and Neck Surgery, Head and Neck Cancer Research Division,Johns Hopkins Medical Institutions, Baltimore, Maryland 21287. E-mail: [email protected] Department of Pathology, Johns Hopkins Medical Institutions, Baltimore, Maryland

Accepted 28 February 2007Published online 26 July 2007 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/hed.20660

Abstract: Background. DNA repair genes play a critical role

in maintaining genome stability and have been implicated in tu-

morigenesis. Head and neck squamous cell carcinoma

(HNSCC) often shows chromosomal instability. We examined

the expression of human RAD17, a DNA damage cell cycle

checkpoint gene, in primary head and neck cancer tissue.

Methods. Significance analysis of microarrays was applied

to expression array results examining more than 12,000 genes in

7 samples of primary HNSCC and 6 samples of normal control

oral epithelial tissue. Additional confirmation was performed by

quantitative reverse transcription-polymerase chain reaction

(RT-PCR) in these samples and western blot with an additional

12 primary HNSCC and 7 normal samples, followed by loss of

heterozygosity (LOH) analysis and quantitative PCR at the

RAD17 locus.

Results. Multiple checkpoint and DNA repair genes were

downregulated in primary head and neck tumor tissue com-

pared with normal control epithelial tissue, including hRAD17. Its

Z-score and fold change were �2.5 and 0.39, respectively. The

results of normalized, quantitative RT-PCR showed decreased

expression of hRAD17 mRNA in tumor tissue (mean value

0.2166) when compared with normal tissue (mean value 0.3957,

p < .05). Western blot demonstrated undetectable expression of

hRAD17 protein in primary tumor tissue (0/12), while there was

strong expression of hRAD17 protein in normal oral mucosal tis-

sue (6/7). To determine possible mechanisms of inactivation, the

hRAD17 locus at 5q13 was analyzed using microsatellite

markers, showing 70% LOH in 30 primary HNSCCs. Quantitative

PCR showed that RAD17 DNA copy number was decreased in

the majority of head and neck tumor tissue samples.

Conclusion. Loss of hRAD17 expression occurs frequently in

HNSCC, is often due to genomic deletion, and may facilitate

genomic instability in HNSCC. VVC 2007 Wiley Periodicals, Inc.

Head Neck 30: 35–42, 2008

Keywords: head and neck cancer; LOH; chromosomal instabil-

ity; downregulation; hrad17

Cells respond to DNA damage by activating ahighly coordinated DNA damage response. Fail-ure to monitor and to signal DNA damage leads togenomic instability, which can ultimately lead tocancer formation due to dysregulation of criticalgenes that maintain cellular homeostasis. DNAdamage and checkpoint genes help maintaingenomic stability and prevent tumorigenesis byactivating pathways that result in DNA repair,cell cycle arrest, other transcriptional responses,and apoptosis. Loss of checkpoint gene functionmay result in genetic injury that in turn affectsother genes that regulate tumor growth and accel-erate tumorigenesis. Most head and neck cancers

Correspondence to: J. Califano

Contract grant sponsor: Flight Attendant Medical Research Institute;contract grant sponsor: Damon Runyon Cancer Research Foundation;contract grant number: CI-9; contract grant sponsor: NIDCR; contractgrant number:1R01DE015939-01.

VVC 2007 Wiley Periodicals, Inc.

Downregulation of RAD17 in Head and Neck Cancer HEAD & NECK—DOI 10.1002/hed January 2008 35

are related to chronic exposure to tobacco andalcohol; these exogenous DNA damaging agentsmay accelerate the rate of genomic alteration, par-ticularly in the context of impaired DNA repairfunction.1–6

RAD17 is a DNA damage checkpoint gene. Itwas first identified in Schizosaccharomyces pombeand Saccharomyces cerevisiae as rad24, and acti-vates an S-phase and S/M checkpoint in responseto DNA damage and incomplete DNA replication.Loss ofRAD17 function in fission yeast resulted infailure to arrest cell cycle progression and conse-quently led to hypersensitivity to genotoxic andDNA synthesis blocking agents.1,7 In both humanand mouse models, its homolog is RAD17 gene,hRAD17 andmRAD17, respectively, and has beenidentified and characterized.8–10

Recent studies have established a frameworkof the signal transduction process of DNA damagepathway in mammalian cells.11,12 Two protein ki-nases, ATM and ATR, are key components of thedamage response pathway. ATM is primarilyinvolved in the response to double-strand DNAbreaks (DSBs), whereas ATR responds to bothDSBs and other damage during replicationstress.13 Current evidence suggests that ATM andATR are signal-initiating kinases for the check-point kinase cascade that leads to activation ofdownstream targets. HRAD17 is 1 of the sub-strates for these key signal transducers duringcheckpoint activation.14 HRAD17 forms a complexwith a replication factor C (RFC)-like proteinalong with 5 other proteins,15,16 which function asclamp loaders. These proteins serve to recruitRad9, Rad1, and the Hus1 complex (also called 9-1-1 complex), a DNA sliding clamp of the DNAreplication machinery17–21 to damaged DNA. The9-1-1 complex recruited by hRAD17 upon DNAdamage induction enables ATR to recognize itssubstrates on the chromatin and thereby com-bines 2 independent sensory pathways to fullyactivate the DNA-damage response.22

As a checkpoint factor, the hRAD17 gene maybe a potential tumor suppressor. Loss of hRAD17function or aberrant expression patterns may beinvolved in tumor development. During anattempt to identify hRAD17 expression in pri-mary head and neck cancer samples, we founddecreased hRAD17 expression as well as absent ordecreased hRAD17 protein levels. We were alsoable to demonstrate a high rate of loss of hetero-zygosity (LOH) at the hRAD17 locus, along withdecreased hRAD17 copy number consistent withhomozygous deletion.HRAD17, therefore, is inac-

tivated in head and neck squamous cell carcinoma(HNSCC) and may play a significant role ingenomic instability in HNSCC development.

MATERIALS AND METHODS

Gene Identification. Affymetrix Gene expressionChip (Affymetrix, Santa Clara, CA) was applied toperform gene screening as previously described.23

Six normal oral mucosal cDNA samples and 7invasive head and neck tumor cDNA sampleswere hybridized to chips containing more than12,000 genes. A logarithmic transformation wasthen performed using SNOMAD software. Finalvalues for each sample, expressed as a Z-score,were analyzed for significance using significanceanalysis of microarray (SAM). We identified thathRAD17 was 1 of the downregulated genes in thisdataset.

QuantitativeReverseTranscription–PolymeraseChain

Reaction. To confirm the microarray results, weused RNA samples from the same patients ana-lyzed earlier to perform quantitative reverse tran-scription–polymerase chain reaction (RT-PCR) todetect hRAD17 expression levels. Tissues wereobtained from patients consented under JohnsHopkins Institutional Review Board approval (pro-tocols 00-11-14-01 and 92-07-21-01). Tumor sitesincluded pharynx (2/7), oral cavity (4/7), and lar-ynx (1/7). Tumors were snap frozen in liquid nitro-gen and maintained at �808C. Primers and probeswere designed by Probe Express Software (AppliedBiosystems, CA). The hRAD17 (isoform 1) forwardprimer was 50-AGCGAGAAAAAGAGGAAATC-30,and the reverse primer was 50-TGCCTTTCT-AAAACTTGAGC-30, synthesized by Invitrogen(Carlsbad, CA). The taqman probe sequence was 50-6FAM TCAGCATGAACTTGCTGTGCA TAMRA-30,synthesized by Applied Biosystems (Foster City,CA). The b-actin forward primer sequence was50-TCACCCACACTGTGCCCATCTACGA-30, thereverse primer was 50-TCGGTGAGGATCTTCAT-GAGGTA-30, and the probe was 50-6FAM ATG-CCCTCCCCCATGCCATCCTGCGT TAMRA-30.

The reaction was performed by a 1-step reac-tion: 508C, 35 minutes for cDNA synthesis, dena-turize at 958C for 5 minutes, and then PCR ampli-fication at 958C for 15 seconds, 558C for 1 minutewith 45 complete cycles. The quantitative RT-PCRwas performed on an ABI PRISM 7900HTsequence detection system. Each sample was runin triplicate.

36 Downregulation of RAD17 in Head and Neck Cancer HEAD & NECK—DOI 10.1002/hed January 2008

Microsatellite Analysis. Human RAD17 is locatedon chromosome 5q13. To identify LOH of 5q, 8microsatellite markers of chromosome 5q wereselected from the GDB data base: D5S1994,D5S634, D5S2107, D5S2072, D5S2036, D5S2019,and D5S2050. DNA samples were extracted from30 microdissected head and neck tumor tissuesamples from the Johns Hopkins Hospital andtheir paired peripheral blood lymphocytes as nor-mal DNA controls. All DNA samples were ampli-fied by PCR reactions: 5 minutes at 958C for 1cycle, followed by 958C for 30 seconds, 55 to 608Cfor 30 seconds, and 728C for 30 seconds with35 cycles, concluded by a 728C extension for10 minutes. Each forward primer was end-labeledwith g-32P dATP. Paired normal and tumor PCRproducts were then separated on a 6% denaturingacrylamide sequence gel and exposed to film for 24hours at �808C. LOH was defined by a reductionof band intensity of more than 50% by visualinspection compared with the intensity of theremaining allele in the tumor DNA and was con-firmed by 2 independent investigators (J.C. andM.Z).

Western Blot Analysis. We isolated proteins from12 frozen primary head and neck tumor tissuesand 7 frozen normal epithelial tissues to analyzeprotein expression of hRAD17. Tumor sitesincluded pharynx (3/12), larynx (3/12), and oralcavity (6/12). Tumors were snap frozen in liquidnitrogen and maintained at �808C. Proteins wereisolated from the phenol-ethanol supernatantobtained after precipitation of DNA and RNA byTRIzol extraction from the aforementioned sam-ples. Fifty micrograms of each protein sample wasloaded to a 10% sodium dodecyl sulfate-polyacryl-amide gel electrophoresis (SDS-PAGE) gel andrun at 120 V for 90 minutes, and protein bandswere transferred to a PROTRAN membrane for1 hour at 50 V. The membrane was blocked with5% nonfat milk by shaking at room temperaturefor 1 hour and incubated with 1:500 diluted mouseanti-RAD17 monoclonal IgG (Santa Cruz Biotech-nology’Santa Cruz, CA) at 48C overnight. Themembrane was then incubated with horseradishperoxidase linked anti-mouse immunoglobulin G(IgG) (Amersham Biosciences, UK), and washedwith phosphate-buffered saline 3 times. Antibodybinding was visualized by chemiluminescence(AmershamBiosciences, UK). The blots were thenwashed, incubated with mouse anti-b-actin anti-body diluted 1:3000 (Sigma, USA), and detectedas earlier.

Quantitative PCR. We selected a fragment from arandom hRAD17 intron sequence and designedforward and reverse primers (forward primer 50-CCAAATTGGGTAGAAGGTACA-30, reverse primer50-AACGGGAGAAGGCTATGC-30) and a Taqmanprobe (50-6FAM TACCTCATATCCCCTGCCCCA-ACACA TAMRA-30) to determine the DNA copynumbers. We also designed primer- probe sets ofGAPDH in order to normalize the copy numbers ofhRAD17 (forward primer 50-GGCCGCCATGTTG-CAA-30, reverse primer 50-CAGGAGCGCAGGGT-TAGTCA-30, Taqman probe 50-6FAM ATGAATG-GGCAGCCGTTAGGAAAGCC TAMRA-30). TheDNA samples were obtained from microdissectedgenomic tumor along with paired normal periph-eral lymphocyte DNA. PCR amplification was per-formed beginning with 958C for 2 minutes, then958C for 15 seconds, and 608C for 1 minute for 50cycles. All quantitative PCR was performed usingan ABI PRISM 7900HT sequence detection sys-tem (Applied Biosystems, Foster City, CA). Eachsample was run in triplicate.

RESULTS

We screened more than 12,000 genes by using theHu95A.v2 GeneChip (Affymetrix, Rockville, MD),7 primary head and neck tumor tissue cDNAsamples, and 6 normal tissue cDNA samples.SNOMAD and SAM software were applied to per-form statistical analysis. Our analysis revealeddecreased expression of many genes in head andneck tumor tissue compared with normal epithe-lial tissue.23 Downregulated genes included DNAdamage checkpoint and repair genes, includinghRAD17. Its Z-score and fold change were �2.5and 0.39, respectively, in the primary head andneck tumors. Figure 1 shows the expression ofhRAD17 in tumor tissue and normal epithelial tis-sue by microarray analysis. Therefore, weselected hRAD17 for further analysis.

To validate the microarray results, we appliedreal-time RT-PCR to detect the expression ofhRAD17 mRNA levels by using the identical pri-mary HNSCC and normal epithelial tissue.Expression of hRAD17 in each sample was nor-malized by the expression of b-actin. The ratio ofhRAD17 to b-actin was regarded as the relativequantitative mRNA expression of hRAD17. Theseresults were generally consistent with microarrayresults. The mRNA expression of normal epithe-lial tissues was higher than that of head and necktumor tissues, with a median value of 0.396 and0.2166, respectively. Figure 2 shows the mRNA


expression for these samples using quantitativeRT-PCR.

To determine the protein expression ofhRAD17 in head and neck tumor and normal epi-thelial tissues, we selected additional 12 tumorsamples and 7 normal samples. Western blot anal-ysis results showed that all tumor samples dem-onstrated no detectable or very faint signals. Onthe contrary, all normal epithelial tissues except 1sample (N2805) demonstrated a strong hRAD17band (Figure 3). Of note, the normal sample with-out hRAD17 protein expression also had a lowlevel of b-actin expression.

We then explored the possible mechanism ofthe decreased expression of hRAD17 in head andneck tumor tissues. Human RAD17 is located in

chromosome 5q12-13. 5q is frequently found toshow loss in head and neck cancer from LOH andCGH data.24,25 We thus selected 8 microsatellitemarkers located in chromosome 5q and performedLOH analysis using 30 paired tumor–normalDNA samples. HRAD17 is located betweenD5S2019 and D5S2036. We found a rate of LOH of70% (21/30) at 5q. D5S2019 and D5S2036 werethe 2 closest microsatellite markers of hRAD17.The rates of LOH at D5S2019 and D5S2036 for in-formative samples were approximately 45% (10/22) and 47% (9/19). Table 1 shows the 5q mappingin 30 paired tumor and normal DNA, and repre-sentative examples of LOH at D5S2019 andD5S2036markers are shown in Figure 4.

We further examined hrad17 DNA copy num-bers in primary head and neck tumor tissues. Weselected 9 head and neck tumor DNA samplesthat had displayed hRAD17 underexpression atthe protein level. Quantitative PCR was appliedto amplify a randomly selected hRAD17 intronsequence. Nine tumor samples and paired normalDNAwere analyzed and all samples were normal-ized by the GAPDH gene. The ratio of hRAD17 toGAPDH amplification quantity was regarded as arelative quantitative hRAD17 DNA copy number(Figure 5). We found only 2 cases with a ratiogreater than 1 (1.46 and 1.27) indicating possiblegain of hRAD17 copy number. However, all otherratios of hRAD17/GAPDH were below 1, and 4 ofthese samples had a hRAD17/GAPDH of less than

FIGURE 1. HRAD17 mRNA expression in head and neck can-

cer tissue and normal epithelial tissue by microarray analysis.

Black columns represent normal tissues, gray columns repre-

sent tumor tissues. All normal tissues had higher hrad17 mRNA

expression level (Z scores >0) except 1 sample 2796. All tumor

samples had lower hrad17 mRNA expression level (Z score

<0) except 2 samples 2291 and 2700, 2291’s Z score was

nearly 0.

FIGURE 2. HRAD17 mRNA expression in head and neck tu-

mor tissues and normal tissues by reverse transcription-poly-

merase chain reaction (RT-PCR). We selected the same sam-

ples used in microarray analysis to confirm its result. Each

result was normalized by b-actin. In normal group (black color),

the median value of hRAD17 expression was 0.396. In tumor

group (gray color), the median value of hRAD17 expression

was 0.2166. The hRAD17 expression of tumor tissue was half

of normal tissue.

FIGURE 3. HRAD17 protein expression in head and neck can-

cer tissues and normal epithelial tissues. We loaded 5 tumor

tissue protein and 7 normal tissue protein in parallel. All tumor

samples, which hybridized with hRAD17 antibody, showed no

detectable band or very weak band such as sample 2614. All

normal tissue showed detectable hRAD17 band except sample

2805, which had corresponding b-actin band much weaker than

other samples. [Color figure can be viewed in the online issue,

which is available at www.interscience.wiley.com.]


0.5, with 1 equal to 0.15. The median value of alltumor samples was 0.55, which indicates that pri-mary tumors lost almost half of hRAD17 DNAcopy numbers. Thus, heterozygous loss of thehRAD17 gene is associated with loss of expres-sion, and at least 1 tumor demonstrated a DNAcopy number consistent with homozygous loss ofhRAD17.

DISCUSSION

Organisms have evolved mechanisms that main-tain genomic integrity by inducing cell cyclearrest in response to DNA damage. Such check-point mechanisms allow the cell time to repair theDNA damage before normal cell cycle progressionis resumed. Defective cell cycle checkpoint andDNA repair pathways can result in genomic insta-

bility and lead to the transformation of normalcells into cancer cells. The increased genomicinstability apparent in cancer cells reflects thefact that the accumulation of genetic mutations asa result of defects in cell cycle checkpoints or DNArepair activity is an important cause of tumori-genesis. The activation of cell cycle checkpoints inresponse to DNA damage is essential for mainte-nance of genomic integrity and tumor suppres-sion.

Human RAD17 was identified as a humanhomologue of the S. pombe rad17 checkpointgene,26,27 which was identified as a DNA damagecheckpoint gene. Although a functional role forhRAD17 has not yet been established, its homol-ogy to yeast checkpoint proteins suggests it mayplay a part in cell cycle control. HRAD17 mayinteract with ATM and/or ATR as part of a human

Table 1. LOH data of chromosome 5q in 30 paired tumor and normal DNA.

Tumor

LOH data by marker

D5S1994 D5S634 D5S645 D5S2107 D5S2072 D5S2036 D5S2019 D5S2050

981 LOH LOH LOH N/A LOH

1151 NI LOH N/A LOH LOH

1719 NI LOH N/A NI LOH LOH

1977 N/A

2002 LOH N/A NI NI LOH

2076 LOH LOH N/A LOH NI NI

2089 NI NI NI NI N/A NI NI NI

2093 LOH NI N/A LOH NI NI

2125 LOH N/A LOH LOH

2142 NI LOH N/A NI NI

2243 LOH N/A NI LOH

2308 NI N/A NI

2325 NI NI NI N/A LOH

2396 NI LOH LOH LOH N/A LOH LOH NI

2397 N/A LOH NI LOH

2402 NI N/A NI NI

2406 NI NI N/A LOH LOH LOH

2414 LOH NI N/A LOH

2419 NI N/A

2458 NI NI N/A

2550 NI NI NI

2555 NI LOH NI

2694 NI NI

2700 NI LOH NI LOH LOH

2717 NI LOH LOH NI NI

2768 NI LOH NI LOH

2812 NI LOH

2813 NI LOH NI LOH LOH

2825 NI LOH LOH NI LOH LOH

2848 NI NI

LOH percentage 3.30 23.30 20 17 40 33 30 33.30

NI percentage 20 40 7 40 10 27 36.7 30

Total loss percentage 70

Abbreviations: LOH, loss of heterozygosity; blank represents retention; NI, no informative; N/A, not applicable.LOH data showed loss of chromosome 5q of approximately 70%. HRAD17 is located between D5S2036 and D5S2019. For all samples, their LOHwere 30% and 33%, respectively, and their total LOH was 53%. For informative samples, their LOH were 45% and 47%, respectively.


pathway analogous to the rad24/rad17/mec1 inbudding yeast.28 Arrest of the cell cycle in G2phase after DNA damage is believed to promotecell viability by allowing time for DNA repairbefore entry intomitosis.

We have demonstrated that hRAD17 is down-regulated in primary head and neck tumor com-pared with normal epithelial tissue when weapplied quantitative RT-PCR analysis. We havealso shown that mRNA expression level of headand neck tumors is almost half of normal epithe-lial tissue. Of note, the tissues we used in thisanalysis underwent microdissection, such that upto 30% of the tissue analyzed consisted of normalstromal components. We would infer that theactual mRNA levels of hRAD17 in tumor tissuearemost likely lower thanwhat we have observed.Further analysis of protein expression of primaryhead and neck cancer tissues showed thathRAD17 protein levels were unobservable ordeleted, whereas normal tissues exhibited strongexpression.

HRAD17 is located on chromosome 5q12-13.1,27 and frequent deletion has been demon-strated in head and neck tumors and other tumortypes,8,24,25,29 implying the presence of tumor sup-pressor genes on this chromosome arm. We alsofound LOH in chromosome 5q in 70% of head andneck samples tested. The highest percentage ofLOH (45%) was identified in those sequencesflanking the hRAD17 gene.

Quantitative PCR was then performed onpart of the hRAD17 intron sequence to deter-mine the hRAD17 copy number relative to ahousekeeping gene. The majority of hRAD17DNA copy numbers were below 1, with a mediancopy number of 0.55. Tumors with likely homozy-gous deletion at the hRAD17 locus demonstratedcopy numbers below 0.2.

Taken together, these data show that hRAD17as inactivated in primary HNSCC. Although wefound evidence for LOH and data suggestive ofhomozygous deletion in a small number of tumors,these mechanisms alone would not account for thelack of protein expression we observed usingWestern blot analysis in primary tumors. Wewould assume that other alternate mechanisms ofinactivation, including posttranslational mecha-nisms and mechanisms that result in protein deg-radation, may result in lack of hRAD17 proteinexpression in primary tumors. Alternately, pro-moter hypermethylation may result in transcrip-tional silencing, although we did not find evidenceof promoter methylation in our tested samples(data not shown).

In addition, sequence alterations of hRAD17were detected in human tumor cell lines, such ascolon cancer cell lines, retinoblastoma cell lines,and lung cancer cell lines.30 It is possible thatmutational events may result in lack of hRAD17expression in HNSCC, although we did not per-form this analysis.

Although we have shown that hRAD17 hasabsent or decreased expression in head and necktumors and there are reports that hRAD17 haslower expression in testicular tumors, others havereported that hRAD17 was overexpressed in lung,colon, and breast cancer.31 This overexpression

FIGURE 4. Loss of heterozygosity (LOH) of 5q in head and

neck tumor. D5S2019 and D5S2036 were the nearest microsa-

tellite markers of hRAD17 gene in chromosome 5q. T repre-

sents head and neck tumor DNA, and N represent its paired

peripheral blood DNA, which was regarded as normal control.

FIGURE 5. HRAD17 DNA copy numbers of head and neck tu-

mor tissue after normalized with paired normal blood DNA. The

ratio 1 indicates normal and tumor DNA had equal hRAD17

copy numbers. Seven of 9 (78%) samples showed their

hRAD17 copy numbers were less than 1. The median value of

hRAD17 copy numbers was 0.55.


may be due to induction of hRAD17 in response toongoing DNA damage that often occurs in solidtumors. HNSCC is known to display a phenotypewith profound chromosomal instability,29 and thelack of hRAD17 expression would intuitively con-tribute to the development of this phenotype.

As a DNA damage checkpoint gene, hRAD17 isphosphorylated by its upstream ATM/ATR gene,which are sensors and transducers responding toDSBs. In vitro studies have shown that hRAD17-RFC as clamp loader recruits the 9-1-1 complex tothe location of DSBs.22,32–35 Phosphorylation ofhRAD17 by ATR upon DNA damage is necessaryfor the DNA damage checkpoint response.31,36

Therefore, hRAD17 may be involved in DNArepair synthesis andmediate cell cycle regulation.BecauseRAD17 andRAD24 are essential for post-DNA damage checkpoints in yeast, hRAD17 mayalso play a similar role in humans. If so, a loss ofhRAD17 could compromise checkpoint pathwaysresponsible for the appropriate response to dam-aged DNA. Cells lacking the hRAD17 gene notonly accumulate DSBs, but also replicate theirchromosomes at a high rate, underscoring the im-portance of hRAD17 in preventing chromosomalaberrations frequently displayed by cancer cells.37

Malfunctions in these pathways could constitute acritical turning point in the genesis of cancer; lossor mutation of a checkpoint gene would generatestill more mutations, leading to genomic instabil-ity. Combined with the data presented, loss ofhRAD17 gene expression may be a possible factorcontributing to genomic instability in head andneck cancer.

REFERENCES

1. Elledge SJ. Cell cycle checkpoints: preventing an iden-tity crisis. Science 1996;274:1664–1672.

2. Sancar A, Lindsey-Boltz LA, Unsal-Kaccmaz K, Linn S.Molecular mechanisms of mammalian DNA repair andthe DNA damage checkpoints. Annu Rev Biochem 2004;73:39–85.

3. Nyberg KA, Michelson RJ, Putnam CW, Weinert TA. To-ward maintaining the genome: DNA damage and repli-cation checkpoints. Annu Rev Genet 2002;36:617–656.

4. Pryor WA. Cigarette smoke radicals and the role of freeradicals in chemical carcinogenicity. Environ Health Per-spect 1997;105(Suppl 4):875–882.

5. Arora A, Willhite CA, Liebler DC. Interactions of b-caro-tene and cigarette smoke in human bronchial epithelialcells. Carcinogenesis 2001;22:1173–1178.

6. Brooks PJ. DNA damage, DNA repair, and alcohol toxic-ity—a review. Alcohol Clin Exp Res 1997;21:1073–1082.

7. Griffiths DJ, Barbet NC, McCready S, Lehmann AR,Carr AM. Fission yeast rad17: a homologue of buddingyeast RAD24 that shares regions of sequence similaritywith DNA polymerase accessory proteins. EMBO J1995;14:5812–5823.

8. von Deimling F, Scharf JM, Liehr T, et al. Human andmouse RAD17 genes: identification, localization, genomicstructure and histological expression pattern in normaltestis and seminoma. Hum Genet 1999;105:17–27.

9. Bluyssen HA, Naus NC, van Os RI, Jaspers I, Hoeij-makers JH, de Klein A. Human and mouse homologs ofthe Schizosaccharomyces pombe rad17þ cell cycle check-point control gene. Genomics 1999;55:219–228.

10. Enoch T, Carr AM, Nurse P. Fission yeast genes involvedin coupling mitosis to completion of DNA replication.Genes Dev 1992;6:2035–2046.

11. Zhou BB, Elledge SJ. The DNA damage response: puttingcheckpoints in perspective. Nature 2000;408:433–439.

12. Rouse J, Jackson SP. Interfaces between the detection,signaling, and repair of DNA damage. Science 2002;297:547–551.

13. Abraham RT. Cell cycle checkpoint signaling throughthe ATM and ATR kinases. Genes Dev 2001;15:2177–2196.

14. Kim ST, Lim DS, Canman CE, Kastan MB. Substratespecificities and identification of putative substrates ofATM kinase family members. J Biol Chem 1999;274:37538–37543.

15. Green CM, Erdjument-Bromage H, Tempst P, LowndesNF. A novel Rad24 checkpoint protein complex closelyrelated to replication factor C. Curr Biol 2000;10:39–42.

16. Lindsey-Boltz LA, Bermudez VP, Hurwitz J, Sancar A.Purification and characterization of human DNA damagecheckpoint Rad complexes. Proc Natl Acad Sci U S A2001;98:11236–11241.

17. Burtelow MA, Roos-Mattjus PM, Rauen M, Babendure JR,Karnitz LM. Reconstitution and molecular analysis of thehRad9-hHus1-hRad1 (9-1-1) DNA damage responsivecheckpoint complex. J Biol Chem 2001;276:25903–25909.

18. Kondo T, Matsumoto K, Sugimoto K. Role of a complexcontaining Rad17, Mec3, and Ddc1 in the yeast DNAdamage checkpoint pathway. Mol Cell Biol 1999;19:1136–1143.

19. St Onge RP, Udell CM, Casselman R, Davey S. Thehuman G2 checkpoint control protein hRAD9 is a nu-clear phosphoprotein that forms complexes with hRAD1and hHUS1. Mol Biol Cell 1999;10:1985–1995.

20. Thelen MP, Venclovas C, Fidelis K. A sliding clampmodel for the Rad1 family of cell cycle checkpoint pro-teins. Cell 1999;96:769–770.

21. Volkmer E, Karnitz LM. Human homologs of Schizosac-charomyces pombe rad1, hus1, and rad9 form a DNAdamage-responsive protein complex. J Biol Chem 1999;274:567–570.

22. Zou L, Cortez D, Elledge SJ. Regulation of ATR sub-strate selection by Rad17-dependent loading of Rad9complexes onto chromatin. Genes Dev 2002;16:198–208.

23. Ha PK, Benoit NE, Yochem R, et al. A transcriptionalprogression model for head and neck cancer. Clin CancerRes 2003;9:3058–3064.

24. Bockmuhl U, Wolf G, Schmidt S, et al. Genomic altera-tions associated with malignancy in head and neck can-cer. Head Neck 1998;20:145–151.

25. Masayesva BG, Ha P, Garrett-Mayer E, et al. Geneexpression alterations over large chromosomal regions incancers include multiple genes unrelated to malignantprogression. Proc Natl Acad Sci U S A 2004;101:8715–8720.

26. Parker AE, Van de Weyer I, Laus MC, Verhasselt P,Luyten WH. Identification of a human homologue of theSchizosaccharomyces pombe rad17þ checkpoint gene.J Biol Chem 1998;273:18340–18346.

27. Bao S, Chang MS, Auclair D, et al. HRad17, a humanhomologue of the Schizosaccharomyces pombe checkpointgene rad17, is overexpressed in colon carcinoma. CancerRes 1999;59:2023–2028.


28. Lydall D, Weinert T. G2/M checkpoint genes of Saccharo-myces cerevisiae: further evidence for roles in DNA repli-cation and/or repair. Mol Gen Genet 1997;256:638–651.

29. Minhas KM, Singh B, Jiang WW, Sidransky D, CalifanoJA. Spindle assembly checkpoint defects and chromo-somal instability in head and neck squamous cell carci-noma. Int J Cancer 2003;107:46–52.

30. Ejima Y, Yang L. Determination of the genotype of apanel of human tumor cell lines for the human homo-logues of yeast cell cycle checkpoint control genes: identi-fication of cell lines carrying homoallelic missense basesubstitutions. Somat Cell Mol Genet 1999;25:41–48.

31. Bao S, Tibbetts RS, Brumbaugh KM, et al. ATR/ATM-mediated phosphorylation of human Rad17 is requiredfor genotoxic stress responses. Nature 2001;411:969–974.

32. Majka J, Burgers PM. The PCNA-RFC families of DNAclamps and clamp loaders. Prog Nucleic Acid Res MolBiol 2004;78:227–260.

33. Bermudez VP, Lindsey-Boltz LA, Cesare AJ, et al. Load-ing of the human 9-1-1 checkpoint complex onto DNA bythe checkpoint clamp loader hRad17-replication factor Ccomplex in vitro. Proc Natl Acad Sci U S A 2003;100:1633–1638.

34. Majka J, Burgers PM. Yeast Rad17/Mec3/Ddc1: a slidingclamp for the DNA damage checkpoint. Proc Natl AcadSci U S A 2003;100:2249–2254.

35. Majka J, Chung BY, Burgers PM. Requirement for ATPby the DNA damage checkpoint clamp loader. J BiolChem 2004;279:20921–20926.

36. Post S, Weng YC, Cimprich K, Chen LB, Xu Y, Lee EY.Phosphorylation of serines 635 and 645 of human Rad17is cell cycle regulated and is required for G(1)/S check-point activation in response to DNA damage. Proc NatlAcad Sci U S A 2001;98:13102–13107.

37. Wang X, Zou L, Zheng H, Wei Q, Elledge SJ, Li L.Genomic instability and endoreduplication triggered byRAD17 deletion. Genes Dev 2003;17:965–970.


downregulation of rad17 in head and neck cancer

Documents