1

Antibacterial activity and mechanism of zinc oxide nanoparticles on Campylobacter jejuni 1

2

Yanping Xie1, Yiping He

2*, Peter L. Irwin

2, Tony Jin

3 and Xianming Shi

1* 3

4

1Joint Sino-US Food Safety Research Center & Bor Luh Food Safety Center, School of 5

Agriculture & Biology, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai, China 6

200240 7

2Joint US-Sino Food Safety Research Center & Molecular Characterization of Foodborne 8

Pathogens Research Unit, 3Residue Chemistry and Predictive Microbiology Research Unit, US 9

Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center 10

(USDA-ARS-ERRC), 600 East Mermaid Lane, Wyndmoor, PA, USA 19038 11

12

13

*Corresponding authors: 14

Yiping He 15

USDA-ARS-ERRC, 600 East Mermaid Lane, Wyndmoor, PA, USA 19038 16

Phone: (215) 233-6422, FAX: (215) 836-3742, E-mail: yiping.he@ars.usda.gov 17

Xianming Shi 18

Mail Box 49#, School of Agriculture & Biology, Shanghai Jiao Tong University, 800 19

Dongchuan Road, Shanghai, China 200240 20

Phone & Fax: 86-21-3420-6616, E-mail: xmshi@sjtu.edu.cn 21

22

Running title: Antimicrobial mechanism of ZnO nanoparticles 23

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02149-10 AEM Accepts, published online ahead of print on 4 February 2011

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

2

Abstract 24

The antibacterial effect of ZnO nanoparticles on Campylobacter jejuni was investigated for cell 25

growth inhibition and inactivation. The results showed that C. jejuni was extremely sensitive to 26

the treatment with ZnO nanoparticles. The minimal inhibitory concentration (MIC) of ZnO 27

nanoparticles for C. jejuni was determined to be 0.05-0.025 mg/ml, which is 8-16 fold lower than 28

that of Salmonella enterica Entertidis and Escherichia coli O157:H7 (0.4 mg/ml). The action of 29

ZnO nanoparticles on C. jejuni was determined to be bactericidal, not bacteriostatic. Scanning 30

electron microscopic examination revealed that the majority of the cells transformed from spiral 31

shapes into coccoid forms after exposure to 0.5 mg/ml ZnO nanoparticles for 16 hrs, which is 32

consistent with the morphological changes of C. jejuni under other stressed conditions. These 33

coccoid cells were found to have a certain level of membrane leakage by ethidium monoazide-34

quantitative PCR (EMA-qPCR) assay. To address the molecular basis of ZnO nanoparticle 35

action, a large set of genes involved in cell stress response, motility, pathogenesis, and toxin 36

productions were selected for a gene expression study. Reverse transcription-quantitative PCR 37

(RT-qPCR) analysis showed that in response to the treatment of ZnO nanoparticles, the 38

expression levels of two oxidative stress genes (katA and ahpC) and a general stress response 39

gene (dnaK) were increased 52-, 7-, and 17-fold, respectively. These results suggest that the 40

antibacterial mechanism of ZnO nanoparticles is most likely due to the disruption of the cell 41

membrane and the oxidative stress in Campylobacter. 42

43

44

Keywords: ZnO nanoparticles, Campylobacter jejuni, antibacterial mechanism, oxidative stress, 45

gene expression. 46

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

3

Introduction 47

To control microbial contaminants in food and extend the shelf life of fresh produce and meat, 48

directly adding antimicrobial agents to food or into packaging materials during food processing 49

is considered an effective means. In recent years, inorganic antimicrobial agents, such as metal 50

oxides, have received increasing attention in food applications because not only are they stable 51

under high temperatures and pressures which may occur in harsh food processing conditions, but 52

they are also generally regarded as safe to human beings and animals relative to organic 53

substances (6, 24). 54

Zinc Oxide (ZnO) is listed as “Generally Recognized as Safe” (GRAS) by the U.S. Food and 55

Drug Administration (21CFR182.8991). As a food additive, it is the most commonly used zinc 56

source in the fortification of cereal-based foods. Because of its antimicrobial properties, ZnO has 57

been incorporated into the linings of food cans in packages for meat, fish, corn and peas to 58

preserve colors and to prevent spoilage. Nano-sized particles of ZnO have more pronounced 59

antimicrobial activities than large size particles, since the small size (less than 100 nm) and high 60

surface-to-volume ratio of nanoparticles allow for better interaction with bacteria. Recent studies 61

have shown that these nanoparticles have selective toxicity to bacteria but exhibit minimal 62

effects on human cells (21). ZnO nanoparticles were shown to have a wide range of antibacterial 63

activities on both Gram-positive and Gram-negative bacteria, including major foodborne 64

pathogens like E. coli O157:H7, Salmonella, Listeria monocytogenes, and Staphylococcus 65

aureus (13, 14), but currently there is no information available on its antibacterial effect with 66

species of Campylobacter. Campylobacter jejuni is a leading cause of microbial foodborne 67

illness in the world. In fact it has been recently shown that approximately 80% of poultry 68

products are contaminated with this pathogen (11). Consumption of Campylobacter-69

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

4

contaminated food and water usually causes a mild to severe gastrointestinal infection in humans 70

which sometimes can develop into a life-threatening disease called Guillain-Barré syndrome 71

(28). Therefore, it is important to focus on the use of ZnO particles as a potential food safety 72

intervention technology to effectively control Campylobacter and other microbial contaminants 73

in food. 74

To make better use of ZnO nanoparticles in food products and assist in the development of 75

powerful, but nontoxic, antimicrobial derivatives, it is necessary to understand the mechanism of 76

action of ZnO nanoparticles in bacteria; but, to date, the process underlying their antibacterial 77

effect is not clear. However, a few studies have suggested that the primary cause of the 78

antibacterial function might be from the disruption of cell membrane activity (4). Another 79

possibility could be the induction of intercellular reactive oxygen species including hydrogen 80

peroxide (H2O2), a strong oxidizing agent harmful to bacterial cells (13, 22). Also, it has been 81

reported that ZnO can be activated by UV and visible light to generate highly reactive oxygen 82

species such as OH-, H2O2, and O2

2-. The negatively charged hydroxyl radicals and superoxides 83

cannot penetrate into cell membrane, and are likely to remain on cell surface, whereas H2O2 can 84

penetrate into bacterial cells (18). To better understand the nature of the inhibitory and lethal 85

effects of ZnO nanoparticles on bacteria, we used C. jejuni as a model organism to investigate 86

this mechanism. C. jejuni is a Gram-negative, spiral-shaped, highly motile, thermophilic and 87

microaerophilic bacterium, growing optimally in a neutral pH and microaerobic environment at 88

42oC. Unlike other major foodborne pathogens such as E. coli O157:H7, Salmonella and L. 89

monocytogenes, C. jejuni has a low tolerance to oxygen but does require some for growth (i.e., 90

microaerophilic). Due to the lack of some important oxidative stress response genes (soxRS and 91

oxyR) and a global stationary-phase stress response gene (rpoS), C. jejuni is extremely sensitive 92

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

5

to oxidative stress as well as other environmental stresses. Exposure of this organism to different 93

stresses results in a remarkable morphological shift from spiral-shaped cells to coccoid forms, 94

which is associated with the loss of culturability (10, 25). Due to these distinguishing 95

characteristics and sensitive stress responses, C. jejuni is highly suitable for studying ZnO 96

nanoparticle modes of action on bacterial cells, especially in the assessment of cell membrane 97

integrity and reactive oxygen species-induced stress response. 98

The purpose of this research was to evaluate the antibacterial effects and investigate the 99

mechanism of ZnO nanoparticle action on C. jejuni by examining cell morphology, membrane 100

permeability, and gene expression through the utilization of scanning electron microscopy as 101

well as advanced molecular methods. Results are compared to other foodborne pathogens 102

including E. coli O157:H7 and Salmonella. 103

104

Materials and Methods 105

ZnO nanoparticles 106

ZnO nanoparticles (99.7+ %) with average size of ~30 nm and Brunauer-Emmett-Teller (BET) 107

specific surface area of ~35m2/g were purchased from Inframat Advanced Materials LLC 108

(Manchester, CT). A stock suspension was prepared by resuspending the nanoparticles into 109

ddH2O to yield a final concentration of 100 mg/ml and kept at 4oC. Immediately after vigorous 110

vortex mixing, aliquots of the suspension were added into Mueller-Hinton medium (MH; Becton 111

Dickinson Co., Sparks, MD) for the following experiments. 112

113

Bacterial culture conditions and antibacterial test 114

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

6

C. jejuni strain 81-176, ATCC 35918, and ATCC 49943 were grown at 42oC in MH broth in a 115

microaerobic workstation (Don Whitley Scientific, Ltd., Shipley, UK) maintaining 5% O2, 10% 116

CO2, 85% N2, and 82% relative humidity. A mixed culture of the three C. jejuni strains was 117

prepared by combining equal volume (1/3) of each pure culture growing at the late-log phase. 118

Salmonella enterica Enteritidis ATCC 13076 and E. coli O157:H7 ATCC 43889 were 119

aerobically grown at 37oC in Luria-Bertani medium (Becton Dickinson). Bacterial growth 120

inhibition was tested by inoculating ca.104 CFU of C. jejuni cells on each MH agar plate or into 121

20 ml of MH broth containing various concentrations of ZnO nanoparticles (0, 0.025, 0.03, 0.04, 122

0.05, and 0.10 mg/ml). After a 16 hr incubation, the inhibition of cell growth was determined by 123

counting the number of colony forming units (CFU) on the plates or the turbidity of the cell 124

culture. The inoculations that showed no cell growth were further verified for cell culturability 125

by spreading 1 ml aliquots of the culture onto drug-free MH agar plates to determine the 126

bactericidal (bacteria-killing) or bacteriostatic (bacteria-inhibiting) effect of ZnO nanoparticles. 127

The minimal inhibitory concentration (MIC) of ZnO nanoparticles for C. jejuni, E. coli 128

O157:H7, and Salmonella and was determined using a broth microdilution method reported 129

previously (19). Briefly, serial two-fold dilutions of the nanoparticles ranging from 0.00625 to 130

1.6 mg/ml were prepared in a 96-well microtiter plate using MH or LB broth. Freshly grown 131

bacterial cells were inoculated into each well to give a final concentration of 104 CFU/ml. After 132

microaerobic incubation for 24 hrs at 42 oC for C. jejuni or aerobic incubation for 16 hrs at 37

oC 133

for E. coli O157:H7 and Salmonella, cell growth in each well was monitored and compared with 134

the positive control in which no ZnO nanoparticles were added. MIC was recorded as the lowest 135

concentration of ZnO nanoparticles that completely inhibited cell growth. 136

137

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

7

Examination of cell morphology by scanning electron microscope (SEM) 138

Mid-log phase C. jejuni cultures were treated with 0.5 mg/ml ZnO nanoparticles for 12 hrs under 139

the microaerobic conditions. Aliquots of 200 µl treated and untreated cell suspensions were 140

deposited on glass coverslips. After air drying for 1 hr, the coverslips were fixed with a primary 141

fixative solution containing 2.5% glutaraldehyde and 0.1 M imidazole buffer solution (pH 7.2) 142

for 2 hours. Subsequently, the fixative solution was exchanged with 0.1M imidazole buffer, 143

followed by dehydration with a series of ethanol solutions (50%, 80% and 100%) with three 144

ethanol changes at each concentration. Finally the coverslips were dried with liquid CO2-ethanol 145

exchange in a DCP-1 Critical Point Dryer (Denton Vacuum, Inc., Cherry Hill, NJ). The 146

coverslips were mounted on SEM stubs with carbon adhesive tabs, then sputter-coated with a 147

thin layer of gold using a Scancoat Six Sputter Coater (BOC Edwards, Wilmington, MA). Digital 148

images of the treated and untreated C. jejuni cells were acquired using a Quanta 200 FEG 149

scanning electron microscope (FEI Inc., Hillsboro, OR) at an accelerating voltage of 10 kV and 150

instrumental magnifications of 25,000x. 151

152

EMA treatment, DNA isolation, and EMA-qPCR assay 153

Ethidium monoazide (EMA) treatment of C. jejuni cells and a follow-up qPCR assay were 154

carried out as described before (10). Briefly, 1 ml of freshly grown cells was treated with 20 155

mg/ml EMA in the dark for 5 min and subsequently exposed to a 600 W halogen light for 1 min. 156

Cells were then immediately washed with Phosphate-Buffered Saline and subjected to DNA 157

extraction using the DNAeasy Tissue kit (Qiagen, Valencia, CA) following the manufacturer’s 158

instruction. In the qPCR analysis, the hipO gene was selected as a target for detection because of 159

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

8

the uniqueness of the DNA sequence to C. jejuni. The primers and TaqMan probe of hipO used 160

in this experiment were reported in previous work (9). 161

162

RNA preparation and RT-qPCR analysis of gene expression 163

To prepare total cellular RNA, 80 ml of the C. jejuni 81-176 culture in the late-log phase of 164

growth were treated or not treated with ZnO nanoparticles at 0.1 mg/ml for 30 min. The ZnO 165

concentration used herein was determined from the cell killing results shown in Figure 1A. After 166

the treatment, cells were harvested by centrifugation at 4000 x g for 10 min at 4 oC. RNA 167

isolation was carried out using the TRI-Reagent following the manufacturer’s instructions 168

(Molecular Research Center, Inc. Cincinnati, OH). DNase I treatment and reverse transcription 169

of the RNA samples were processed as described before (8). Quantification of the cDNA was 170

performed on a 7500 Real-time PCR system (Applied Biosystems, Foster City, CA). For PCR, 171

all the listed primers were designed using the Primer 3 software (http://frodo.wi.mit.edu/cgi-172

bin/primer3/primer3_www.cgi). Each 20 µl PCR mixture contained 0.25x Evagreen dye 173

(Biotium, Hayward, CA), 0.25 µM of each primer, 2 µl of cDNA template, 5 Units of Platinum 174

Taq DNA polymerase, and buffer (Invitrogen, Inc., Carlsbad, CA). The amplification program 175

was 50oC for 2 min, 95

oC for 10 min, followed by 40 cycles of 95

oC for 15 sec and 60

oC for 1 176

min. The gyrA gene was used as a reference for data normalization. Housekeeping genes tsf and 177

16s rRNA were also included as controls to ensure data reliability. All the samples, including no-178

RT and no-template controls, were analyzed in triplicate. Data analysis was performed using 2-

179

∆∆Ct method, where ∆∆Ct = ∆Ct (treated sample) - ∆Ct (untreated sample), ∆Ct = Ct (target 180

gene) - Ct (gyrA), and Ct is the threshold cycle value for amplified gene (15). 181

182

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

9

Results 183

Growth inhibition of C. jejuni by ZnO nanoparticles 184

Growth inhibition of C. jejuni 81-176 was examined both on agar plates and in broth containing 185

a range of concentrations (0, 0.025, 0.03, 0.04, 0.05, and 0.10 mg/ml) of ZnO nanoparticles. On 186

the plates spread with 104 CFU/plate and in the broth inoculated with the equivalent number of 187

the cells, bacterial growth was completely inhibited at ≥0.03 mg/ml of ZnO nanoparticles. 188

However, at a concentration of 0.025 mg/ml, ZnO nanoparticles had a modest effect on cell 189

growth resulting in the recovery of fewer viable cells than the untreated controls. To determine if 190

the growth inhibition was caused by an inhibitory or lethal effect of ZnO nanoparticles, 100 µl 191

aliquots of the treated cell suspension were spread onto drug-free MH plates. The results showed 192

that the cells treated with ≥ 0.03 mg/ml of the nanoparticles for 16 hrs were no longer culturable, 193

suggesting a lethal effect of ZnO nanoparticles on C. jejuni. In addition, the MIC of ZnO 194

nanoparticles for all three C. jeuni strains was determined to be between 0.05 and 0.025 mg/ml, 195

which was 8-16 fold lower than that (0.4 mg/ml) for E. coli O157:H7 and S. Enteritidis, clearly 196

indicating a higher susceptibility of C. jejuni to ZnO nanoparticles. 197

198

Lethal effect of ZnO nanoparticles on C. jejuni 199

The lethal effect of ZnO nanoparticles on C. jejuni was further investigated using ca. 108 200

CFU/ml of freshly grown pure and mixed cultures of C. jejuni strain 81-176, ATCC 35918, and 201

ATCC 49943. Cell culturability of all three C. jejuni strains was affected by ZnO nanoparticles 202

at all the concentrations tested (Fig. 1A-D). Most significantly, 0.5, 0.3 and 0.1 mg/ml of ZnO 203

nanoparticles resulted in a complete killing (100%) of 108 CFU/ml C. jejuni cells in 3 hrs or less. 204

The pure and mixed cultures of three C. jejuni strains showed a similar susceptibility to ZnO 205

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

10

nanoparticles. In contrast to the strong and rapid bactericidal action on C. jejuni, 20-100 fold 206

higher concentrations (10 mg/ml) of ZnO nanoparticles only caused a 1 or 2 log reduction of 207

viable E. coli O157:H7 and S. Enteritidis cells after an 8-hr exposure (Fig. 1E&F). These results 208

demonstrated that ZnO nanoparticles were effective at killing C. jejuni even at low 209

concentrations. 210

211

Morphological analysis of C. jejuni 212

Effects of ZnO nanoparticles on C. jejuni cell morphology were examined by scanning electron 213

microscopy. After a 12-hr treatment with 0.5 mg/ml ZnO nanoparticles in MH broth under 214

microaerobic conditions, spiral-shaped C. jejuni cells underwent a dramatic change from spiral to 215

coccoid morphological forms. The SEM image in Figure 2A illustrates the dominance of coccoid 216

forms in the treated cells as well as showing the formation of irregular cell surfaces and cell wall 217

blebs in greater detail. These coccoid cells remained intact and possessed sheathed polar flagella. 218

The image of the untreated cells clearly displayed spiral shapes (Fig. 2B). Moreover, this ZnO 219

nanoparticle-induced formation of coccoid cells was confirmed by confocal microscopic 220

visualization (data not shown). Not surprisingly, the similar morphology transformation was also 221

observed when C. jejuni was exposed to different environmental stresses including oxidative 222

stress (10, 25). To determine the bactericidal versus bacteriostatic effect of ZnO nanoparticles 223

cultures previously exposed to ZnO nanoparticles exhibiting a coccoid cell morphology were 224

spread plated. No growth of the coccoid cells was observed on drug-free MH plates, confirming 225

that they were no longer culturable. These results together suggested that ZnO nanoparticles 226

caused not only cell morphology changes but also lethal effect on C. jejuni. 227

228

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

11

EMA-PCR assessment of cell membrane integrity 229

Ethidium Monoazide (EMA) selectively enters into membrane compromised cells and binds to 230

cellular DNA, which subsequently inhibits PCR amplification of the DNA. The reduction of 231

PCR amplification has been used as an indicator of cell membrane leakage (17). To assess 232

membrane integrity of the coccoid cells, EMA-qPCR analysis was performed on the C. jejuni 233

cultures treated with 0, 0.1, 0.3 and 0.5 mg/ml of ZnO nanoparticles for 12 hrs. The results in 234

Figure 3 showed that the cells treated with 0.3 and 0.5 mg/ml of ZnO nanoparticles had more 235

than 10 fold (1 log) reduction of DNA amplification, indicating an increased EMA penetration in 236

the treated cells. This result demonstrated that the treatment of ZnO nanoparticles on C. jejuni 237

increased cell membrane permeability (i.e., damaged membrane integrity). 238

239

Gene expression profile of C. jejuni in response to ZnO nanoparticle treatment 240

To understand the molecular basis of the ZnO nanoparticle action on bacterial cells, a set of C. 241

jejuni genes involved in general and oxidative stress responses, motility, pathogenesis, and toxin 242

production were selected for a gene expression study (Table 1). After exposing late-log phase 243

cells to 0.1 mg/ml ZnO nanoparticles for 30 min, the transcripts of these genes were quantified 244

by RT-qPCR assay. Most significantly, two oxidative stress genes, katA (encoding catalase) and 245

ahpC (encoding alkyl hydroperoxide reductase), and one general stress gene, dnaK (encoding a 246

chaperone), were found to be up-regulated 52-, 7- and 17-fold, respectively, in response to the 247

treatment. The transcription levels of other stress response genes as well as the analyzed 248

virulence genes were not significantly up- or down- regulated (less than 3 fold) (Fig. 4). As 249

expected, the expression of three housekeeping genes (gyrA encoding gyrase subunit A, tsf 250

encoding elongation factor TS, and 16S ribosomal RNA) were not changed regardless of the 251

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

12

treatment (Fig. 4). Similar gene expression results were also obtained from those cells treated 252

with 0.05 mg/ml of ZnO nanoparticles for the same length of time (data not shown). All these 253

results suggest that the antibacterial mechanism of ZnO nanoparticles is likely due to the 254

oxidative stress in C. jejuni cells. 255

256

Discussion 257

ZnO nanoparticles have a broad spectrum of antibacterial activities. At concentrations higher 258

than 0.24 mg/ml, it inhibited the growth of E. coli O157:H7, L. monocytogenes, and S. Enteritidis 259

(12, 14). The inhibitory effect of ZnO nanoparticles on Bacillus subtilis, Staphylococcus aureus, 260

Staphylococcus epidermidis, Streptococcus pyogenes, and Enterococcus faecalis was reported as 261

well (13). In this study, the antibacterial properties of ZnO nanoparticles were first investigated 262

in C. jejuni, the most common foodborne pathogen. Our results showed that C. jejuni was 263

extremely sensitive to ZnO nanoparticles with a MIC 8-16 fold lower than E. coli O157:H7 and 264

Salmonella. Antibacterial tests on agar plates and in broth both showed that 0.03 mg/ml of ZnO 265

nanoparticles was sufficient to inactivate C. jejuni, whereas the concentration of the 266

nanoparticles needed for 100% inhibition of E. coli O157:H7 growth was between 0.24-0.98 267

mg/ml (4, 14), approximately 8-32 times higher than the lethal dosage to C. jejuni. It has 268

previously been reported that the antibacterial activity of ZnO nanoparticles increases with the 269

reduction in particle size (16). The number of bacterial cells and growth media used could also 270

contribute to variation in results. For data consistency, we used the 30 nm (average size) ZnO 271

nanoparticles to test similar numbers of bacterial cells. 272

Previously, it was unclear whether ZnO nanoparticles function as a bactericidal or bacteriostatic 273

agent, except for a few reports on the inhibition of bacteria growth (13, 14). In this study, we 274

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

13

demonstrated that the action of ZnO nanoparticles on C. jejuni was bactericidal, not 275

bacteriostatic, by showing no recovery of the treated cells on drug-free MH plates as well as the 276

rapid killing of 108 CFU/ml freshly grown cells of three different C. jejuni strains. The 277

effectiveness of ZnO nanoparticles to inactivate C. jejuni was also compared with other major 278

foodborne pathogens. For E. coli O157:H7 and Salmonella, a 20-100 fold higher concentration 279

of ZnO nanoparticles was needed in order to reduce 1-2 log of viable cells (Fig. 1). Therefore, 280

the bactericidal action of ZnO nanoparticles on C. jejuni was extremely effective. 281

Although the antibacterial mechanism of ZnO nanoparticles is still unknown, the possibilities of 282

membrane damage caused by direct or electrostatic interaction between ZnO and cell surfaces, 283

cellular internalization of ZnO nanoparticles, and the production of active oxygen species such as 284

H2O2 in cells due to metal oxides were proposed in earlier studies (6, 24). The generation of 285

H2O2 in ZnO slurries was determined by oxygen electrode analysis and spectrophotofluorometry 286

(23, 27). In examining cell morphology, membrane integrity, and gene expression in C. jejuni, 287

we found that all of these aspects were affected ZnO nanoparticles. A dramatic change in C. 288

jejuni cell morphology was revealed by SEM analysis by showing the dominance of coccoid 289

forms in the treated cells whereas the untreated cells remained to be spiral. This considerable 290

alteration on cell morphology was not only observed in C. jejuni treated with ZnO nanoparticles 291

but also has been found in Campylobacter and the closely related genus Helicobacter exposed to 292

different stresses (1, 5, 10). It might be specific to spiral bacteria as no significant changes in cell 293

shape were found in E. coli O157:H7 after exposure to ZnO except that the nanoparticles 294

adhered to cell surface (29). In addition to changes in cell structure in C. jejuni, ZnO 295

nanoparticles also resulted in the formation of irregular cell surfaces and membrane blebbing, as 296

well as the increase in membrane permeability. This induced membrane leakage was also 297

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

14

consistently observed in E. coli O157:H7 by transmission electron microscopy and Raman 298

spectroscopy when the cells were treated with ZnO nanoparticles (14). 299

When extracellular environments change, bacteria adopt mechanisms that quickly regulate the 300

synthesis of defensive proteins in response to stress. In Campylobacter, a number of 301

genes/proteins playing critical roles in protecting cells from different stresses, especially 302

oxidative stress, have been identified (26). Most importantly, to eliminate reactive oxygen 303

species and assist the organism to defend against oxidative stress, superoxide dismutase (SodB) 304

breaks down O-

2 to H2O2 and O2; catalase (KatA) inactivates H2O2 and interrupts the formation of 305

toxic intermediates; alkyl hydroperoxide reductase (AhpC) can destroy toxic hydroperoxide 306

intermediates and repair damaged molecules caused by oxidation (3, 20). In addition to these 307

oxidative stress response proteins, general stress response proteins (DnaK, DnaJ, GroES, and 308

GroEL), which act as molecular chaperones play a critical role in preventing protein aggregation 309

and refolding, are also important for cell survival (2). The analysis of ZnO nanoparticle-310

modulated stress gene expression has shown that the transcription levels of two oxidative stress 311

genes (ahpC and katA) and one general stress response gene (dnaK) were significantly increased 312

up to 7-52 folds, whereas another 4 stress response genes (sodB, dps, groEL, and groES) were 313

also approximately 2-3 times higher. Expression of all other stress response genes was either 314

unchanged or down-regulated. Because KatA is a single catalase enzyme expressed higher upon 315

exposure to H2O2 in C. jejuni (7), the 52-fold induction of KatA expression suggests a high 316

probability that more intercellular H2O2 is produced in response to the ZnO nanoparticles. From 317

these experiments and the role of the oxidative stress regulatory system in Campylobacter, we 318

can conclude that the antibacterial mechanism of ZnO nanoparticles was very likely through the 319

increased levels of oxidative stress in bacterial cells. Furthermore, the expression of a number of 320

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

15

virulence factors related to cell motility, toxin production, and adhesion to host cells was also 321

examined in response to ZnO nanoparticles. All of the analyzed virulence genes were found to be 322

down-regulated, suggesting the decreased pathogenicity of the bacterium after the treatment. 323

In summary, ZnO nanoparticles exhibited remarkable antibacterial activity and demonstrated a 324

lethal effect against C. jejuni, even at low concentrations. ZnO nanoparticles induced significant 325

morphological changes, measurable membrane leakage, and substantial increases (up to 52 fold) 326

of oxidative stress gene expression in C. jejuni. Based on these phenomena and cell responses, a 327

plausible mechanism of ZnO inactivation of bacteria involves the direct interaction between ZnO 328

nanoparticles and cell surfaces, which affects membrane permeability where nanoparticles enter 329

and induce oxidative stress in bacterial cells, subsequently resulting in the inhibition of cell 330

growth and eventually cell death. 331

332

Acknowledgments 333

This research was jointly supported by the Agriculture Research Service, U.S. Department of 334

Agriculture, the Ministry of Science and Technology of China (grant nos. 2009BADB9B01 and 335

2009BAK43B31), and the Science & Technology Commission of Shanghai Municipality (grant 336

number no. 09DZ0503300). The authors thank Ms. Guoping Bao in the Microscopy Imaging 337

Facility at the USDA, ARS, ERRC, for technical assistance in acquiring the SEM images, and 338

Dr. George Paoli in the Molecular Characterization of Foodborne Pathogens Research Unit at the 339

USDA, ARS, ERRC, for providing the C. jejuni ATCC strains. 340

341

References 342

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

16

1. Adams, B. L., T. C. Bates, and J. D. Oliver. 2003. Survival of Helicobacter pylori in a 343

natural freshwater environment. Appl. Environ. Microbiol. 69:7462-7466. 344

2. Arsene, F., T. Tomoyasu, and B. Bukau. 2000. The heat shock response of Escherichia coli. 345

Int. J. Food Microbiol. 55:3-9. 346

3. Baillon, M. L., A. H. van Vliet, J. M. Ketley, C. Constantinidou, and C. W. Penn. 1999. 347

An iron-regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative 348

stress resistance to the microaerophilic pathogen Campylobacter jejuni. J. Bacteriol. 349

181:4798-4804. 350

4. Brayner, R., R. Ferrari-Iliou, N. Brivois, S. Djediat, M. F. Benedetti, and F. Fievet. 2006. 351

Toxicological impact studies based on Escherichia coli bacteria in ultrafine ZnO 352

nanoparticles colloidal medium. Nano Lett. 6:866-870. 353

5. Catrenich, C. E., and K. M. Makin. 1991. Characterization of the morphologic conversion 354

of Helicobacter pylori from bacillary to coccoid forms. Scand. J. Gastroenterol. Suppl. 355

181:58-64. 356

6. Fu, G., P. S. Vary, and C. T. Lin. 2005. Anatase TiO2 nanocomposites for antimicrobial 357

coatings. J. Phys. Chem. B. 109:8889-8898. 358

7. Grant, K., and S. Park. 1995. Molecular characterization of katA from Campylobacter 359

jejuni and generation of a catalase-deficient mutant of Campylobacter coli by interspecific 360

allelic exchange. Microbiology 141:1369-1376. 361

8. He, Y., J. G. Frye, T. P. Strobaugh, and C. Y. Chen. 2008. Analysis of AI-2/LuxS-362

dependent transcription in Campylobacter jejuni strain 81-176. Foodborne Pathog. Dis. 363

5:399-415. 364

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

17

9. He, Y., X. Yao, N. Gunther, Y. Xie, S. Tu, and X. Shi. 2010. Simultaneous Detection and 365

Differentiation of Campylobacter jejuni, C. coli, and C. lari in Chickens Using a Multiplex 366

Real-Time PCR Assay. Food Anal. Methods, 137:168-174. 367

10. He, Y. P., and C. Y. Chen. 2010. Quantitative analysis of viable, stressed and dead cells of 368

Campylobacter jejuni strain 81-176. Food Microbiol. 27:439-446. 369

11. Jacobs -Reitsma, W. F., U. Lyhs, and J. Wagenaar. 2008. Campylobacter in the food 370

supply, p. 627-644. In I. Nachamkin, C. M. Szymanski, and M. J. Blaser (ed.), 371

Campylobacter, 3rd ed. ASM Press, Washington, DC. 372

12. Jin, T., D. Sun, J. Y. Su, H. Zhang, and H. J. Sue. 2009. Antimicrobial efficacy of zinc 373

oxide quantum dots against Listeria monocytogenes, Salmonella Enteritidis, and Escherichia 374

coli O157:H7. J. Food Sci. 74:M46-52. 375

13. Jones, N., B. Ray, K. T. Ranjit, and A. C. Manna. 2008. Antibacterial activity of ZnO 376

nanoparticle suspensions on a broad spectrum of microorganisms. FEMS Microbiol. Lett. 377

279:71-76. 378

14. Liu, Y., L. He, A. Mustapha, H. Li, Z. Q. Hu, and M. Lin. 2009. Antibacterial activities of 379

zinc oxide nanoparticles against Escherichia coli O157:H7. J. Appl. Microbiol. 107:1193-380

1201. 381

15. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using 382

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 383

16. Nair, S., A. Sasidharan, V. V. D. Rani, D. Menon, S. Nair, K. Manzoor, and S. Raina. 384

2009. Role of size scale of ZnO nanoparticles and microparticles on toxicity toward bacteria 385

and osteoblast cancer cells. J. Mater. Sci. Mater. Med. 20:235-241. 386

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

18

17. Nogva, H. K., S. M. Dromtorp, H. Nissen, and K. Rudi. 2003. Ethidium monoazide for 387

DNA-based differentiation of viable and dead bacteria by 5'-nuclease PCR. BioTechniques 388

34:804-813. 389

18. Padmavathy, N., and R. Vijayaraghavan. 2008. Enhanced bioactivity of ZnO 390

nanoparticles—an antimicrobial study. Sci. Technol. Adv. Mater. 9:1-7. 391

19. Petersdorf, R. G., and J. C. Sherris. 1965. Methods and significance of in vitro testing of 392

bacterial sensitivity to drugs. Am. J. Med. 39:766-779. 393

20. Purdy, D., S. Cawthraw, J. H. Dickinson, D. G. Newell, and S. F. Park. 1999. Generation 394

of a superoxide dismutase (SOD)-deficient mutant of Campylobacter coli: evidence for the 395

significance of SOD in Campylobacter survival and colonization. Appl. Environ. Microbiol. 396

65:2540-2546. 397

21. Reddy, K. M., K. Feris, J. Bell, D. G. Wingett, C. Hanley, and A. Punnoose. 2007. 398

Selective toxicity of zinc oxide nanoparticles to prokaryotic and eukaryotic systems. Appl. 399

Phys. Lett. 90:2139021-2139023. 400

22. Sawai, J. 2003. Quantitative evaluation of antibacterial activities of metallic oxide powders 401

(ZnO, MgO and CaO) by conductimetric assay. J. Microbiol. Methods 54:177-182. 402

23. Sawai, J., E. Kawada, F. Kanou, H. Igarashi, A. Hashimoto, T. Kokugan, and M. 403

Shimizu. 1996. Detection of active oxygen generated from ceramic powders having 404

antibacterial activity. J. Chem. Eng. Jpn. 29:627-633. 405

24. Stoimenov, P. K., R. L. Klinger, G. L. Marchin, and K. J. Klabunde. 2002. Metal oxide 406

nanoparticles as bactericidal agents. Langmuir 18:6679-6686. 407

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

19

25. Tangwatcharin, P., S. Chanthachum, P. Khopaibool, and M. W. Griffiths. 2006. 408

Morphological and physiological responses of Campylobacter jejuni to stress. J. Food. Prot. 409

69:2747-2753. 410

26. van Vliet, A. H., J. M. Ketley, S. F. Park, and C. W. Penn. 2002. The role of iron in 411

Campylobacter gene regulation, metabolism and oxidative stress defense. FEMS Microbiol. 412

Rev. 26:173-186. 413

27. Yamamoto, O., M. Komatsu, J. Sawai, and Z. E. Nakagawa. 2004. Effect of lattice 414

constant of zinc oxide on antibacterial characteristics. J Mater Sci Mater Med 15:847-51. 415

28. Yuki, N., and M. Koga. 2006. Bacterial infections in Guillain-Barré and Fisher syndromes. 416

Curr. Opin. Neurol. 19:451-457. 417

29. Zhang, L. L., Y. H. Jiang, Y. L. Ding, M. Povey, and D. York. 2007. Investigation into the 418

antibacterial behavior of suspensions of ZnO nanoparticles (ZnO nanofluids). J. Nanopart. 419

Res. 9:479-489. 420

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

20

Figure legends 421

Fig. 1. Antibacterial activities of ZnO nanoparticles on C. jejuni, S. enteric Enteritidis, and 422

E. coli O157:H7. Freshly grown bacterial cultures (108-9

CFU/ml) were treated with a range of 423

concentrations of ZnO nanoparticles. The culturable cell number was determined at certain time 424

intervals after the treatment. The values of CFU/ml are the means of 12 replicates. Error bars 425

indicate standard deviations of means. 426

Fig. 2. Scanning electron microscopic images of C. jejuni. (A) C. jejuni cells in the mid-log 427

phase growth were treated with 0.5 mg/ml ZnO nanoparticles for 12 hrs under the microaerobic 428

conditions; (B) The untreated cells from the same growth conditions were used as a control. 429

Fig. 3. EMA-qPCR of C. jejuni membrane integrity. Mid-log phase cells exposed to different 430

concentrations of ZnO nanoparticles were briefly treated with (black bars) and without (white 431

bars) EMA. The inhibition of DNA amplification was quantified by real-time PCR analysis of 432

hipO gene. Reduced DNA amplification in the cells exposed to 0.3 and 0.5 mg/ml ZnO 433

nanoparticles indicated a certain degree of membrane leakage in the treated cells. 434

Fig. 4. Relative gene expression levels between ZnO nanoparticle treated and untreated C. 435

jejuni. C. jejuni cells in the late-log phase of growth were treated with 0 or 0.1 mg/ml ZnO 436

nanoparticles for 30 min. Transcripts of the selected genes were quantified by RT-qPCR, and the 437

data was analyzed using the comparative critical threshold (∆∆Ct) method. Relative expression 438

ratio of each gene is presented in a log2 value in the histogram. The ratio greater than zero (>0) 439

indicates up-regulation and below zero (<0) indicates down-regulation of gene expression. The 440

error bars indicate the standard deviations of three replicates.441

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

21

Table 1. Genes and primers selected for reverse transcription qPCR analysis 442

Function/protein Gene Primer Sequence (5’→3’)

Oxidative stress response genes

Forward TTCAATCTCTTTAGCGACGG Peroxide-sensing regulator perR

Reverse CACATTTGGCGCAAACAACA

Forward TCCACCAAGACTAAGCCCTG Flavodoxin I fldA

Reverse CAGAAGGAGCGGCTAATACAA

Forward CCACTAATGTTAATATGCGTTCC Iron-binding protein dps

Reverse TGTGCTTGATAATCTTGCGACAA

Forward TGGCGGTTCATGTCAAAGTA Superoxide dismutase(Fe) sodB

Reverse ACCAAAACCATCCTGAACCA

Forward AGTTGCCCTTCGTGGTTCGT Alkyl hydroperoxide

reductase ahpC

Reverse ATCGCCCTTATTCCATCCTG

Forward ACCGTTCATGCTAAGGGAAG Catalase katA

Reverse CCTACCAAGTCCCAGTTTCC

Forward TTCTTCTTCGTGTTGTTCGC Nonheme iron-containing

ferritin cft

Reverse GCTGGAGCCTTCTTGTTTGC

Forward CCCCACTTCTCATATCAGCG Ferredoxin fdxA

Reverse ATGCGTTGAATGCGTAGGAC

Forward TGCAGCAGTTACTAGGTTTT Rubrerythrin rbr

Reverse AGACATTTTAGAGAAGCGGC

Forward CCATTTCTTTTGGTTCAGCAG Ferric uptake regulator fur

Reverse TGCAATCAAGGCTTGCTGTC

Forward TCAAAGTCGTTCAAACAGGG Carbon storage regulator csrA

Reverse TCATTCTGAACAACAGAATGC

General stress response genes

Forward GCCAGTTACAATGGTGCTGA Probable thiol peroxidase tpx

Reverse TTTGCCACAAAATCACTTGC

Forward AAACAACAGCCTCAGGCATAA Co-chaperonin groES

Reverse TTCTGTTCCACCGTATTTAGCA

Forward GCAGGCGATGGAACAACTAC Chaperonin groEL

Reverse TCCATACCGCGTTTTACCTC

Forward CGGTATGCCACAAATCGAAG Chaperone dnaK

Reverse GCTAAGTCCGCTTGAACCTG

Forward TTTAAAAGGCGGTGGATTTG Co-chaperone dnaJ

Reverse TTTTCTACGACGCGATGATG

Forward ACCCCAGGTTGTACTACAGAAG Bacterioferritin comigratory

protein homolog BCP

Reverse AGCAATCTTACCTGTTTCATCG

Forward GCCCCAATAGCCCATAGAC RelA/Spot family protein spoT

Reverse ACCCCAAGCAAATCAAGAAC

Forward GAGCCTTCTGTTGTGGCAGTT Rod shape-determining

protein mreB

Reverse AGCGGATCATTTTTTCAGTCAT

Forward TATTACGCCGCTAACTTGAG RND efflux system,

membrane fusion protein cmeA

Reverse CAGCAAAGAAGAAGCACCAA

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

22

Forward TAATCCAGGTATGGGAGGTA RND efflux system, inner

membrane transporter cmeB

Reverse GGAAAGATAGAAATGTAAGCG

Forward GGACGTTGAAGCAAGATGGT RND efflux system, outer

membrane lipoprotein cmeC

Reverse AGTTGGCGCTGTAGGTGAAT

Forward TTGATAGCGAACTTGATGAT Major outer membrane

protein porA

Reverse ATACGAAGTCAGCACCAACG

Forward CTATTTCCATACCCCACAGC Inner membrane protein yagU

Reverse CCTTTAATTGCAGAAGTTCC

Forward GTAGGAGCTGGAAGCACAGG ATP-dependent CLP protease

ATP-binding subunit clpA

Reverse ACGGCGACTTAGGGGTTTAT

Virulence factors and toxins

Forward TCCACATTTGTGCGTGATTG cdtA

Reverse GATTTGGCGATGCTAGAGTTT

Forward AAAGCATCATTTCCATTGCG cdtB

Reverse ACCAAGAACAGCCACTCCAA

Forward CCAAAAGGAAGTTCATCAGC

Cytolethal distending toxin

cluster

cdtC Reverse AGCCTTTGCAACTCCTACTG

Forward CTCATCATTTGGAACGACTTG Invasion antigen B ciaB

Reverse AATTATACTCATGCGGTGGC

Forward CCAATGTCGGCTCTGATTTG Flagellin A flaA

Reverse GCGCAGGAAGTGGATTTTC

Forward CCGTTTCCATCACCATCTTC Flagellin B flaB

Reverse ACACGCTTTGAAACAGGAGG

Forward TGCTTGTGGAGCTGGACGAG Outermembrane fibronectin-

binding protein cadF

Reverse TAAAAGCGGTGGATTTGGAC

Forward TGTTGAAGTGGGACTAAGCG N-acetylneuraminic acid

synthetase neuB

Reverse TCTAACTTGCCATCGCCTAA

Forward AAGGACGAGGTAGCATAGGT Vacuolating cytotoxins vacB

Reverse CAAACGGCGATAGTGTTGAT

Housekeeping genes

Forward TGCTAAAGTGCGTGAAATCG Gyrase subunit A gyrA

Reverse GCATTGGTGCGTTTTCCTAT

Forward GAACTCCGCGAAAGTACAGG Elongation factor TS tsf

Reverse TTGCCACAAAATCTGTTTCG

Forward GCTCGTGTCGTGAGATGTTG 16S ribosomal RNA 16S rRNA

Reverse TCACCGTAGCATGGCTGAT

443

444

445

446

447

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

23

448

Figure 1 449

Xie et al. 450

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

24

451

452

Figure 2 453

Xie et al. 454

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

25

455

456

Figure 3 457

Xie et al. 458

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from

26

Figure 4

Xie et al.

on April 13, 2020 by guest

http://aem.asm

.org/D

ownloaded from