downloaded from on april 4, 2020 by guest · 6 120 catecholamines were normalized with 16 s rrna...

1

Catecholamine modulated novel surface exposed adhesin LIC20035 of Leptospira binds 1

host extracellular matrix components and is recognized by host during infection 2

Karukriti Kaushik Ghosh1, Aman Prakash

1, Vinayagamurthy Balamurugan

2, Manish Kumar

1# 3

4

1Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, 5

Guwahati -781039, Assam, India 6

2Indian Council of Agricultural Research - National Institute of Veterinary Epidemiology and 7

Disease Informatics (ICAR-NIVEDI), Bengaluru, India 8

9

#Corresponding author: 10

Manish Kumar 11

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, 12

Guwahati-781039, Assam, India 13

Email: [email protected] 14

Phone: +91-361-258-2230 15

Fax: +91-361-258-2249 16

17

Keywords: Leptospira, catecholamines, qRT-PCR, differential transcription, stress 18

19

Running Title: Catecholamines as chemical messenger for host-Leptospira interaction 20

AEM Accepted Manuscript Posted Online 21 December 2017Appl. Environ. Microbiol. doi:10.1128/AEM.02360-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.

on August 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Abstract 21

In this study, the effect of host-stress hormone catecholamine on Leptospira gene transcripts 22

encoding outer membrane proteins was investigated. There was no impact of catecholamine 23

supplementation on the in vitro growth pattern of Leptospira interrogans, however, 7 genes 24

out of 41 were differentially transcribed and the effect of which was reversed to basal level in 25

the presence of its antagonist propranolol. Comprehensive analysis of one of the differentially 26

regulated protein LIC20035/LB047 due to catecholamine supplementation exhibited 27

immunogenic and adhesin property to host extracellular matrices. Protease-accessibility assay 28

and phase-partition of integral membrane proteins of Leptospira describes LIC20035/LB047 29

to be outer membrane surface-exposed protein. The recombinant-LIC20035 protein can be 30

serologically detected using human/bovine sera positive for leptospirosis. Moreover, the 31

recombinant-LIC20035 can bind to diverse host extracellular matrices and with a higher 32

affinity towards collagen and chondroitin sulfate. 33

Importance 34

Leptospirosis is a neglected tropical disease of global importance. This study aims at 35

identification of outer membrane proteins of pathogenic Leptospira responding to host 36

chemical signals like catecholamines with the potential to serve as virulence factors, new 37

serodiagnostic antigens, and vaccine candidates. This study mimics the plausible means by 38

which Leptospira during infection and hormonal stress intercepts host catecholamines to 39

disseminate in host tissues. 40

41

42

43

44

45


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

Introduction 46

Leptospira is classified as spirochetes of pathogenic and non-pathogenic form with a variety 47

of different habitats in nature (23). However, the pathogenic Leptospira is maintained in a 48

complex enzootic cycle involving multiple host species and the variable environmental niche. 49

The host specificity of bacterial pathogens is determined by interactions between the 50

pathogens and their host factors (45). Host stress hormones is one of these host factors which 51

leads to adaptation of various pathogenic microbes in the human or animal body upon 52

infection (2, 10, 35, 63). The primary hormones synthesized under stress conditions in 53

animals and humans are the catecholamines. These are a large group of amine hormones 54

derived from tyrosine and include primarily Epinephrine (Epi) and Norepinephrine (NE). 55

Catecholamines are identified as the sympathetic neuroendocrine mediators of fight or flight 56

(acute stress) response of the host (47). The pathogenic and non-pathogenic microbes 57

intercepts host catecholamines and use it as an environmental cue to alter its growth and 58

virulence (47). In the last few years, numerous studies have been done in regard to the effect 59

catecholamines on the differential expression of outer membrane proteins (OMPs) of 60

infectious agents. In Escherichia coli, catecholamines can induce genes associated with 61

adhesion to host cells (10, 26, 36, 62), affect chemotaxis, colonization to Hela cells (2) and 62

can even enhance toxin production in them (37, 63). In the same way, in response to 63

catecholamine, Actinobacillus pleuropneumoniae (31) and Borrelia burgdorferi (54) actively 64

regulate virulence genes. Such studies have proved that the pathogens take advantage of the 65

host response on causing infection and illustrate the way in which pathogens can intercept 66

host hormonal signals to its advantage. Substantial evidence from aforementioned studies 67

conveys that bacteria have catecholamine response system(s) that possess(s) pharmacological 68

similarity to the mammalian adrenoceptors and dopamine receptors. 69


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

Outer membrane proteins of Leptospira are core components by which pathogenic Leptospira 70

interact with the host and play an essential role as adhesins (51), receptors for various host 71

molecules (44), and key mediators for adaptation to change in the environment (49). There 72

are three classes of outer membrane protein of Leptospira identified till date viz. outer 73

membrane lipoprotein, transmembrane protein, and the peripheral membrane protein (13). 74

Several leptospiral OMPs have been reported to have adhesion capacity with extracellular 75

matrix component of host and is an essential requisite for tissue invasion. 76

Taking consideration of above points, this study aimed at understanding modulation of OMPs 77

gene transcription in L. interrogans on exposure to catecholamines under in vitro condition. 78

We report transcript analyses using the real-time reverse transcription-PCR (qRT-PCR) 79

technique of selective genes encoding OMP of serovars Lai and Copenhageni in response to 80

Epi/NE and its antagonist propranolol (PO). It is anticipated that this approach will facilitate 81

the identification of OMPs responding to host chemical signals with the potential to serve as 82

virulence factors, new serodiagnostic antigens, and vaccine candidates. As an initial step 83

towards the comprehensive understanding of the effect of catecholamines on the transcription 84

of membrane proteins of L. interrogans, one out of seven genes viz. LIC20035/LB047 85

showing a response to catecholamines was further characterized. The coding sequence (CDS) 86

LIC20035/LB047 is a hypothetical membrane protein (50 kDa) of pathogenic Leptospira and 87

was found to be repressed in the presence of Epi, the effect of which was blocked in the 88

presence of its antagonist. Additionally, recombinant-LIC20035 (r-LIC20035) shows higher 89

affinity for host extracellular matrices like collagen and chondroitin sulfate. 90

91

92

93

94


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

Results 95

Effect of catecholamine supplementation on the growth of Leptospira 96

Human adrenergic agonists can affect growth of several medically important bacteria due to 97

its ability to act as siderophores providing elemental iron essential for metabolic activity (43). 98

A growth rate analysis of L. interrogans serovar Lai was performed in the presence and 99

absence of Epi/NE (500 μM) and its antagonist PO (500 μM) to examine any effect on the 100

growth of spirochetes in Ellinghausen-McCullough-Johnson-Harris (EMJH) medium under in 101

vitro culture condition (IVCL) at 29 ºC. There was no statistical difference in the growth rate 102

of the spirochetes at any time point (0-120 hrs) in the presence of catecholamines or its 103

antagonist (Fig 1). These results show that the working concentration of catecholamines (500 104

μM) used for the experiments was not affecting the growth of the bacterium under IVCL. 105

Since, the catecholamines have also been shown to be involved in modulating bacterial 106

virulence (31, 54), it evoked interest to study their effects on the selective transcriptome of 107

the spirochetes. 108

109

Effect of catecholamines on spirochetes selective gene transcripts 110

A total of 41 genes of L. interrogans serovar Lai were chosen, which are predicted to be 111

membrane protein using program PSORT. Few genes with assigned function e.g. those 112

involved in an iron uptake were also included for analyzing the in vitro transcription pattern 113

in the presence of Epi/NE and its antagonist through qRT-PCR. Two constitutive genes flaB 114

and 16S rRNA (rrs2) of Leptospira was included in the study to select for the best gene that 115

can be implemented for normalizing gene transcription data obtained through qRT-PCR. 116

There was no significant change in the transcription of 16S rRNA (threshold cycle, Ct values) 117

in comparison to flaB in all the experimental samples analyzed by qRT-PCR. Therefore, the 118

transcripts of target genes of Leptospira grown under IVCL supplemented with 119


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

catecholamines were normalized with 16S rRNA transcripts using 2-∆∆Ct

method and the 120

transcripts of each normalized gene are represented as the number of gene transcripts per 121

1000 copies of 16S rRNA. It is to be noted that there are two 16S rRNA genes in Leptospira 122

and in this study rrs2 was opted as it gave higher Ct values than rrs1. 123

On statistical analyses, there were 7 genes (LB047, LB186, LB191, LA0616, LA3263, 124

LA3307, and LA3961) out of 41, that showed significant (P-value < 0.05) differential 125

transcription in the presence of Epi/NE and the effect of which was restored to the basal level 126

(control) in the presence of its antagonist (Fig 2A). Encouraged by this finding, it was 127

interesting to evaluate if the effect of catecholamine was universal to other pathogenic 128

serovars of Leptospira. A nucleotide BLAST to determine the sequence identity of the genes 129

in pathogenic serovars Lai and Copenhageni from KEGG GENES database were performed 130

(29). The genes which were significantly upregulated in serovar Lai were found to be present 131

in serovar Copenhageni with 99% gene sequence identity as shown in Table 1. Therefore, 132

under similar experimental conditions, responses of catecholamines on L. interrogans serovar 133

Copenhageni gene transcripts were analyzed. As expected, gene transcripts of these selective 134

7 genes in serovar Copenhageni also showed a similar trend of differential transcription in the 135

presence of catecholamines or its antagonist (Fig 2B). The fold changes of transcripts of 136

these 7 genes in the presence of Epi/NE were calculated with respect to basal level expression 137

(control) for both the serovars of Leptospira (Fig 2C and 2D). It was observed that the two 138

genes (Lai/Copenhageni: LB191/LIC20151, LA3307/LIC10841) differentially transcribed in 139

the presence of both Epi and NE whereas 5 genes responded either in presence of Epi 140

(LB047/LIC20035) or NE (LA0616/LIC12966, LA3961/LIC13166, LA3263/LIC10878, and 141

LB186/LIC20148). Additionally, three genes (LB047/LIC20035, LB186/LIC20148, and 142

LB191/LIC20151) in the presence of Epi/NE showed down regulation in its transcription and 143

four genes (LA0616/LIC12966, LA3961/LIC13166, LA3263/LIC10878, and 144


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

LA3307/LIC10841) were upregulated. The gene transcripts (normalized) data that showed 145

statistically insignificant differential transcription (32 genes) of the spirochetes were 146

segregated in three-independent clusters based on copies of gene transcripts (Fig S1A, 1B, 147

1C). Among the selected 41 genes, two genes (LB194 and LA3340) were excluded from the 148

study as they showed very high fluctuations in their Ct values. 149

The impact of gene transcription represented here was by growing spirochetes in the presence 150

of catecholamine at a concentration of 500 µM. In contrast, numerous studies on other 151

bacteria have been performed by supplementing catecholamine at physiological concentration 152

(50 µM) of host gastrointestinal tract stressful conditions (1, 20). Therefore, another 153

independent experiment was performed to analyze the effect of catecholamine at 50 µM on 154

the 7 differentially transcribed genes of spirochetes (Fig S2). The transcript results indicated a 155

similar response in L. interrogans serovar Lai, in the presence of catecholamine at 50 µM 156

concentration (Fig S2). 157

158

Molecular characterization of hypothetical protein LIC20035/LB047 159

Among the seven genes that were significantly differentially expressed in the presence of 160

catecholamine(s), LIC20035/LB047 encoding hypothetical outer membrane protein in 161

Leptospira was selected for further characterization. Protein BLAST was performed to 162

identify orthologs of LIC20035 in the pathogenic, intermediate and saprophytic strains of 163

Leptospira. As is evident from Table 2, LIC20035 is more well conserved (88 - 99 % amino 164

acid sequence identity) across pathogenic leptospires in comparison to intermediates (62 - 64 165

%) and saprophytic strains (39 - 40 %). Oligomers designed for LIC20035 was used to 166

analyze the existence of this gene by PCR in various available pathogenic (L. interrogans 167

serovars like Copenhageni, Lai, Canicola) and saprophytic (L. biflexa serovar Patoc) forms of 168

Leptospira. Using PCR, amplification of 1275 bp confirmed the existence of LIC20035 in 169


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

various pathogenic spirochete serovars viz. Copenhageni, Lai, and Canicola of Leptospira. 170

Interestingly no amplicon was detected in non-pathogenic serovar Patoc (Fig 3A). However, 171

amplification of flaB gene of 852 bp could be seen in all pathogenic and non-pathogenic 172

serovars of Leptospira (Fig 3A). 173

The CDS LIC20035 was cloned without its predicted signal peptide using genomic DNA of 174

L. interrogans serovar Copenhageni and over-expressed in E. coli BL21 (DE3) cells. The 175

over-expressed r-LIC20035 was purified using Ni-affinity column chromatography (Fig 3B). 176

Subsequently, the purified recombinant protein was used to generate antibodies in BALB/c 177

mice. The polyclonal antibodies generated against r-LIC20035 showed an end-point titer of 178

1:5000 (Fig 3C). The immunoblot of the L. interrogans Lai grown in the presence of 179

catecholamines and its antagonist demonstrated that the generated polyclonal anti-LIC20035 180

were able to recognize LB047 at the expected size of 50 kDa. As expected, there was a 181

repression of the LB047 in the presence of Epi in comparison to the basal expression in 182

control (Fig 3D). Interestingly, the expression of LB047 in the spirochetes grown in the 183

presence Epi and its antagonist combined was considerable of the same magnitude to that of 184

control. The antigen LipL31 consistent expression in the host and under IVCL has been 185

previously described (7). Thus, the same nitrocellulose membrane probed with anti-LipL31 186

demonstrated equal loading of all the experimental samples (Fig 3D). In the same context, the 187

relative densitometry of LB047 expression obtained from immunoblot illustrated LB047 to 188

be repressed in the presence of Epi and its expression was restored to the basal level in the 189

presence of antagonist, PO (Fig 3E). Further, to understand the function of LIC20035, the 190

secondary structure of the purified r-LIC20035 was evaluated by circular dichroism (CD). 191

The CD spectroscopy data showed maxima at 215 nm and minima at 200 nm wavelengths 192

(Fig 3F). The spectroscopic data analysis using program K2D2 (46) revealed 2% α-helix and 193


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

52% β-sheet. This was in agreement to the theoretical secondary structure of the r-LIC20035 194

which predicted 0% α-helix and 66% β-sheet using program PSIPRED. 195

196

LIC20035 is a predominant outer membrane surface-exposed protein 197

Cellular localization of LIC20035 was assessed by Triton X-114 detergent solubilization and 198

phase partitioning. Solubilizing Leptospira in 1% Triton X-114 yields a detergent insoluble 199

fraction known as protoplasmic cylinder (PC) fraction and a detergent soluble fraction (24). 200

The Triton X-114 soluble fraction is resolved into two phases by heating above the cloud 201

point (37 ºC) of this detergent, resulting in separation of the detergent-hydrophobic phase (D) 202

from the detergent-poor aqueous phase (A) (21). Infact, previous cellular localization studies 203

of Leptospira (21, 24) show that the outer membrane lipoproteins separates in Triton X-114 204

detergent phase, while periplasmic proteins separate into the aqueous phase of the soluble 205

fraction. The immunoblot using polyclonal anti-LIC20035 detected the LIC20035 to be 206

predominantly present in the detergent phase of the Triton X-114; however, a small amount 207

of the protein could also be traced in the aqueous phase (Fig 4A). Additionally, to validate the 208

Triton X-114 phase separation experiment, anti-LipL32 was used as a positive control to 209

detect LipL32 which was reported to be present only in detergent phase (21). A conspicuous 210

band of LipL32 observed only in the detergent phase of the Leptospira lysates by 211

immunoblot underpins experimental procedures for separating the membrane bound proteins 212

(Fig 4B). 213

To validate LB047 is a surface-exposed membrane protein; a protease-accessibility assay was 214

performed for L. interrogans serovar Lai. The integrity of the spirochete cell wall during 215

Proteinase K treatment was confirmed by performing ELISA using antiserum against LipL31, 216

a previously described cytoplasmic protein (21). Similarly, an antibody against a known 217

surface-exposed protein OmpL54 (48) was used as a positive control. After 1 to 5 h treatment 218


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

with Proteinase K, LB047 showed a decrease in recognition with its antiserum, similar to the 219

positive control, OmpL54 (Fig 4C). Around 50% reduction in LB047 recognition was 220

observed after 5 h of protease assay. In contrast, no significant reduction in reactivity with 221

anti-LipL31 describes the integrity of spirochete membrane was not compromised during the 222

Proteinase K assay (Fig 4C). Taken together, the cellular localization using Triton X-114 and 223

Proteinase K assay suggest LB047/LIC20035 to be a surface-exposed membrane protein. 224

225

LIC20035 is detected by antibodies of human and bovine leptospirosis serum 226

As LIC20035 is localized in the outer membrane of spirochetes, it was interesting to evaluate 227

its serological recognition using immunoglobulins of Leptospira infected hosts. The 228

recombinant proteins (Loa22 and LIC20035) were coated on microtitre plates and were 229

probed with human or bovine serum tested positive for leptospirosis (n=50) through 230

microscopic agglutination test (MAT +ve). As a control, serum samples of human (n=15) and 231

bovine (n=10) tested negative for leptospirosis (MAT -ve) were included in the serological 232

assay. The average optical density (OD) for serological detection of LIC20035 antigen in 233

humans (Fig 5A) and bovine serum (Fig 5C) were heterogeneous (0.5618 and 0.4449, 234

respectively). Moreover, the difference between the absorbance obtained for Loa22 (0.6404) 235

and LIC20035 (0.4449) for bovine infected serum samples was very high (Fig 5B and 5D). 236

The calculated sensitivity and specificity of serological detection of LIC20035 by 237

bovine/human serum was 100/98 % and 100/100 %, respectively. In contrast, Loa22 showed 238

sensitivity and specificity of 100/100 % with bovine/human serum. 239

240

LIC20035 binds to extracellular matrix components of host 241

The numerous study about the attachment of L. interrogans to extracellular matrices of host 242

gave a clue to the existence of several adhesion molecules (3). Thus, ELISA was performed 243


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

to study the interaction of r-LIC20035 with the ECM components. The r-LIC20035 along 244

with r-Loa22 was allowed to bind with the immobilized ECM components on a 96-well plate 245

with BSA and the highly glycosylated serum protein, fetuin, as negative controls. The r-246

LIC20035 showed significant binding (P<0.001) with all the ECM components in contrast to 247

Loa22 (Fig 6A). The highest affinity of r-LIC20035 was seen with collagen type I and 248

chondroitin sulfate. Additionally, quantitative analyses of the binding of r-LIC20035 with 249

each of these ECM components are shown in Fig 6B. A dose-dependent saturable binding 250

was observed with increasing concentration of the recombinant protein (0-8 µM) over a fixed 251

amount of the ECM components (1 µg). The r-LIC20035 protein interacts with the host 252

ligands in a dose-dependent and saturable fashion with the calculated KD of 200 nM, 250 nM 253

and 200 nM for collagen type I and chondroitin sulfate A, and chondroitin sulfate B, 254

respectively. 255

256

Discussion 257

A wide range of pathogenic bacteria like Salmonella (60), Helicobacter (16), and 258

Staphylococcus (18) have been found to be responsive to the stress hormones. However, very 259

little is known about the spirochetes response to stress hormones in mammalian host. 260

Therefore, in the present study, effects of stress hormones on the transcription of selective 261

membrane proteins of Leptospira were investigated. The typical concentration of stress 262

hormone used in various studies of microbes-hormone chemical communication was in the 263

range of 50-500 µM which is equivalent to the physiological concentration detected in the 264

host (18, 35). In this study, catecholamines or its antagonist, alone or in combination did not 265

alter the rate of growth of Leptospira under IVCL at 29 ºC. These were in agreement with the 266

growth pattern of another spirochete Borrelia borgdorferi in the presence of the 267

catecholamines and its antagonist propranolol (54). However, in numerous other bacteria, 268


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

growth rates is also augmented in the presence of catecholamines (52, 56). Apparently, the 269

response of bacteria to catecholamines on its growth rate is variable. 270

It is evident from the present work that the Leptospira in the presence of stress hormones can 271

modulate its gene transcripts selectively and the effect of which can be inhibited in the 272

presence of its antagonist. The mechanistic of such gene modulation in spirochetes due to 273

catecholamine is under infancy till date, however, Sperandio and his co-workers have 274

reported that the catecholamines can induce expression of virulence factors of E. coli 275

0157:H7 by mimicking the action of the autoinducer-3 (AI-3) quorum sensing (QS) system in 276

bacteria (57). AI-3 and Epi/NE are thought to be recognized by the same two- component 277

histidine kinase (HK) receptor (QseBC) of E. coli 0157:H7 (64). We speculate that similar 278

form of interaction with mammalian catecholamine and HK receptor might be playing role in 279

differential transcription of Leptospira genes. Using PSORT program, it is estimated that 280

Leptospira possesses 29 HK two-component receptors, out of which 19 are predicted to be 281

located in the inner membrane, 9 in the cytoplasm and one in periplasm of Leptospira (42). 282

Nevertheless, understanding the Leptospira mechanism of differential transcription of genes 283

in response to catecholamine is warranted for future studies. 284

285

Catecholamines have been reported to bind to the ferric iron binding proteins of host (19) and 286

facilitate in release of iron for microbial uptake. Therefore 10 genes (LA1005, LA1796, 287

LA4253, LA0634, LB194, LB187, LB191, LB183, LA2579, LB186) of Leptospira involved in 288

iron-uptake (34) were included in this study. Our results indicate that only two genes of 289

Leptospira involved in iron-uptake (LB186 and LB191) were repressed in the presence of 290

catecholamines. The possible reason for such discrepancy in gene transcription may be due to 291

difference in the availability of iron source under in vitro and in vivo condition (65). In other 292


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

words, the available iron in the culturing EMJH medium exists as free Fe2+

(39, 40) whereas 293

in the host it is in bound form. 294

Besides iron-uptake regulators, two genes namely LA3961/LIC13166 (OmpL36) and 295

LA0616/LIC12966 (LipL41, Omp) were upregulated in the presence of NE. Leptospires outer 296

membrane lipoprotein OmpL36 is characterized as a flagellar component of both pathogenic 297

and non-pathogenic strains of Leptospira (48). While Leptospira LipL41, the third most 298

predominant outer membrane lipoprotein (14) is absent in the saprophytic strains (6). The 299

trend of upregulation of OmpL36 transcripts in the presence of NE was possibly a token 300

towards the enhanced motility of the bacteria in the host during stress condition leading to 301

dissemination of spirochetes to various host tissues. Our findings that OMPs (LipL41 and 302

OmpL36) are differentially regulated due to host hormonal stress is in agreement with an 303

erstwhile microarray study where LipL41 and OmpL36 were highly repressed in the presence 304

of macrophages (65). 305

The molecular function of one the differential expressed rfe gene (LA3307/LIC10841) has 306

been predicted to be involved in lipopolysaccharide (LPS) synthesis (UniProtKB Q72U23). 307

This rfe gene in our experimental condition was found to be many folds (35/40 folds) 308

upregulated in the presence of Epi/NE. Therefore, understanding rfe physiological 309

requirement and mechanism of sensing such biochemicals will be an appealing subject of 310

future study. In addition, two hypothetical proteins (HP) namely LB047/LIC20035 and 311

LA3263/LIC10878 were found to be differentially regulated in the presence of Epi or NE, 312

respectively. This gene regulation was endorsed by the recent report of differentially 313

regulated genes of Leptospira grown inside dialysis membrane chamber or in the presence of 314

macrophages (7, 65) 315

316


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

Among the differentially regulated genes, LIC20035/LB047 was further characterized as it 317

codes for a conserved hypothetical protein in Leptospira. Additionally, LIC20035 orthologs 318

are more conserved among pathogenic leptospires than the intermediate or saprophytic 319

strains. Interestingly, many known leptospiral virulent OMPs like Loa22 have orthologs in 320

saprophytic strains of Leptospira and therefore absence or presence of orthologs in the 321

saprophytes may not be an accurate criteria for predicting a gene to be virulent (25). 322

323

The polyclonal antibodies generated against r-LIC20035 were able to recognize native-324

LIC20035 expression predominantly in the detergent phase of Triton X-114. Similarly, 325

cellular localization experiment using protease-accessibility assay describes LB047 to be 326

surface-exposed membrane protein. However, for some surface exposed proteins the 327

Proteinase K cleavage sites are inaccessible due to steric hindrance by LPS at the surface of 328

Leptospira (48). A previous study on LIC20035 (demarcated as NT03LIA0039, TIGR locus) 329

from elsewhere (41), described LIC20035 to be present in the Triton X-114 fraction of IVCL 330

and was detectable in the immunoblot using antibodies raised against Leptospira outer 331

membrane vesicles (OMV). Nevertheless, in the same study LIC20035 was not recognized in 332

the Triton X-114 fraction of spirochetes isolated from infected guinea pig liver (41). The 333

spirochetes expression of LIC20035 in guinea pig liver may be due to the multiple effects of 334

host factors; however, this is in agreement to the LIC20035 repression in the presence of Epi. 335

The Sero-reactivity of LIC20035 against MAT-positive serum samples of humans/bovine 336

demonstrates that humoral immune response was generated against LIC20035 during natural 337

infection of Leptospira in the host. Recognition of LIC20035 by the hosts during infection 338

suggests that LIC20035 could be a useful serodiagnostic antigen. As OMPs are the primary 339

bacterial components that interact with host cells, targeting newly identified OMPs for 340

development of recombinant vaccines could be rewarding. Till date several OMPs of 341


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

Leptospira have been reported, nevertheless, none of them have been commercialized as 342

highly effective vaccine candidate (50). Considering the wide variety of serovars of 343

Leptospira and their host specificity, it is tempting to screen more protective antigens in order 344

to develop a multi-component vaccine. Recently, LIC20035 expression was described to be 345

undetectable using serum of rat which were chronically infected with Leptospira (41). This 346

may also indicate that the expression of Leptospira LIC20035 varies depending upon host to 347

host chemical signals. The ECM components of host facilitate adhesions with different 348

microbial proteins and these interactions are essential for microbial pathogenicity (11). 349

Binding assay of r-LIC20035 with host ECM components showed preferential higher affinity 350

for collagen and chondroitin sulfate. The measured affinity of r-LIC20035 for collagen was 351

near to that of LIC13143 (TlyC) (8) but higher than LIC11352 (LipL32) (27). Additionally, r-352

LIC20035 binding to chondroitin sulfate is corroborated by the previous reports of L. 353

interrogans adhering to chondroitin sulfate (51). The chondroitin sulfate component is one of 354

the most abundant cell surface glycosaminoglycans (GAGs) that mediates bacterial 355

attachment to the host cell surface (4). As LIC20035 is found to be surface-exposed 356

membrane protein expressed during infection and its recombinant protein adhere to more than 357

one host ECM components, it is liable to participate in mediating attachment to host tissues 358

as previously reported for other proteins of spirochetes like Len (58), and Lsa63 (61). This 359

study mimics the possible means by which one of the host factors catecholamines is being 360

adapted by Leptospira to disseminate in various host tissues. Future work on host-pathogen 361

chemical signaling is warranted for development of wide-range of disease intervention 362

strategies. 363

364

Materials and methods 365

Bacterial strains, media and growth condition 366


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

The bacterial strains L. interrogans serovar Lai and L. interrogans serovar Copenhageni 367

Strain Fiocruz L1-130 were obtained from Indian Council of Medical Research (ICMR), 368

Regional Medical Research Centre, Port Blair, Andaman and Nicobar Island, India. 369

Spirochetes were grown in EMJH (Ellinghausen-McCullough-Johnson-Harris) medium 370

(Difco) maintained at 29 °C with 10% heat-inactivated rabbit serum (56 °C for 30 min) 371

unless stated. For growth rate and gene transcription profiling, 2×103 spirochetes were seeded 372

per mL of EMJH medium. To this, catecholamines (Epi or NE; Sigma, USA) and its 373

antagonist propranolol (PO) or an equivalent volume of vehicle (control) were added in 374

combination or alone to a final concentration of 500 µM until it reached log-phase as 375

described before (32). The spirochetes were identified and counted every 24 h for five days 376

under phase contrast microscopy (CX41, Olympus) using Petroff-Hausser cell counting 377

chamber as described elsewhere (54). 378

379

Nucleic acid isolation and real time RT-PCR 380

Total RNA of spirochetes were isolated from the log-phase of the growth curve in the 381

presence and absence of catecholamines or its antagonist, using Trizol (Invitrogen) method as 382

described elsewhere (15). After DNase (NEB) treatment of total RNA, quality and quantity of 383

RNA were determined using gel electrophoresis and spectrophotometry. A total of 1 µg RNA 384

of spirochete was converted to its complementary strand DNA (cDNA) using Verso cDNA 385

synthesis kit (Thermo Scientific). To rule out genomic DNA contamination, cDNA synthesis 386

was performed without adding the reverse transcriptase as a negative control. The 387

oligonucleotides used for qRT-PCR were designed using OligoPerfect primer design program 388

(Invitrogen) from the available L. interrogans serovar Lai genomic sequence. All qRT-PCR 389

oligonucleotide pairs were designed with a similar annealing temperature (60 ºC) and 390

amplicon size (100-300 base pairs). Each primer pair was tested for efficiency and non-391


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

specific amplification using SYBR Green PCR master mix (Applied Biosystems) and 392

Leptospira genomic DNA as a template in the 7500 Real Time PCR System (Applied 393

Biosystems). The real-time PCR system was programmed with 50 ºC, 2 min; 95 ºC, 10 min; 394

40 cycles of 95 ºC, 15 s; 60 ºC, 1 min followed by melt curve analyses of the PCR products. 395

The details of the genes obtained from UniProtKB database (12) and the primers used in this 396

study are listed in Table 3. Transcripts of target genes were quantified using 2-∆∆Ct

method 397

(55) and normalized with 16S rRNA gene of Leptospira (38). The expression profile of the 398

genes regulated by the catecholamines or its antagonist in comparison to the control was 399

performed in two independent experiments to achieve statistically significant results. 400

401

Protein over-expression and purification 402

Predicted CDSs of LIC20035 (1275 bp) and LIC10191 (519 bp) were amplified without the 403

signal peptide sequence by PCR from the available genomic sequence of L. interrogans 404

serovar Copenhageni strain Fiocruz L1-130. InstaTA cloning kit (Thermo Fisher scientific) 405

was used to facilitate gene cloning. Thereafter, LIC20035 was cloned in pET28a vector and 406

over-expressed in E. coli BL21 (DE3) competent cells. The restriction endonuclease site 407

(italicized and underlined) of the oligomers used in cloning of LIC20035 and LIC10191 408

genes in pET28a vector (Novagen San Diego, CA, USA) is shown in Table 1. The calculated 409

molecular weight of r-LIC20035 and r-LIC10191 (Loa22) protein is 50 and 22 kDa, 410

respectively. 411

E. coli BL21 (DE3) competent cells were induced using 0.5 mM IPTG in 1 liter of LB 412

medium at 37 ºC for 4 h. The cell pellet obtained was lysed with cold denaturing lysis buffer 413

(8 M Urea, 20 mM Na3PO4 pH-7.8, 500 mM NaCl) and thereafter sonicated for 15 min with 414

6 s on and off cycles. The resulting homogenate was centrifuged at 12,000 g for 30 min to 415

remove cellular debris. Induced recombinant proteins were purified by affinity column 416


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

chromatography using Ni-nitrilotriacetic acid (Ni-NTA) resins (Invitrogen) using the protocol 417

published elsewhere (30). Briefly, N-terminal 6X His-tagged recombinant proteins bound to 418

Ni-NTA resins were washed with denaturing wash buffer (8 M Urea, 20 mM Na3PO4 pH-6.0, 419

500 mM NaCl) and subsequently with native wash buffer (50 mM NaH2PO4 pH-8.0, 500 mM 420

NaCl and 20 mM Imidazole). The recombinant proteins were then eluted out using elution 421

buffer (50 mM NaH2PO4 pH-8.0, 500 mM NaCl and 250 mM Imidazole). Thereafter, the 422

purified proteins were dialyzed (Pierce protein dialyzing cassette) and concentrated (Corning 423

Centricon Spin-x-UF) to 0.4 mg/mL in dialysis buffer (50 mM Tris-Cl buffer pH-8 and 100 424

mM NaCl) before storing it at -80 ºC. 425

426

Circular dichroism (CD) spectroscopy 427

Circular dichroism (CD) spectroscopy measurements were performed for r-LIC20035 at 428

room temperature using a Jasco J-815 spectropolarimeter (Japan Spectroscopic, Tokyo) at a 429

scanning speed of 100 nm/min. Far-UV CD spectra were measured using a 5 mm-path-length 430

cell at 0.5 nm intervals. The spectra were presented as an average of 3 scans recorded from 431

190 to 260 nm and smoothed using Savitzky–Golay filter (53). The molar ellipticity (Φ) is 432

expressed in degree.cm2.dmol

-1. Spectra data were submitted to K2D2 web server (46) that 433

calculated the secondary structure content from the ellipticity experimental data. The 434

theoretical secondary structure was calculated using PSIPRED v3.3 (28). 435

436

Generation of polyclonal antibodies against purified recombinant-LIC20035 and Loa22 437

Antigen r-LIC20035 was used to immunize 4-6 weeks old female BALB/c mice 438

subcutaneously. About 10 µg per mouse of recombinant protein emulsified in Freund’s 439

complete adjuvant (FCA, Cat No. sc-3727 from Santa Cruz Biotechnology) was used for 440


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

primary immunization (5 mice per group). A negative control group was injected with equal 441

volume phosphate buffer saline (PBS) along with the adjuvant. Immunized mice were further 442

given two booster injections of recombinant protein emulsified in Freund’s incomplete 443

adjuvant (FIA, Cat No. 3726 from Santa Cruz Biotechnology) at 14 and 24 days of primary 444

immunization. At 10 days of second booster, blood was collected from each mouse by retro-445

orbital bleeding and then was sacrificed using atlantooccipital dislocation method as 446

described before (30). Sera obtained were pooled for antibody titre analysis by ELISA before 447

experimental use. Immunization experiments in mice were performed in Department of 448

Veterinary Microbiology, College of Veterinary Science, Assam Agriculture University 449

Guwahati, India, after approval by Institutional Animal Ethics Committee. Antibodies against 450

r-Loa22 were generated in rabbit by outsourcing the purified protein to Abgenex, 451

Bhubaneswar, India. 452

453

Enzyme linked immunosorbent assay (ELISA) for LIC20035 titre determination 454

Disposable 96-well polystyrene plate was coated with 50 µL of r-LIC20035 (400 ng/well) 455

and incubated overnight at 4 ºC. It was blocked with 100 µL of 3 % bovine serum albumin 456

(BSA) at 37 ºC for 2 h. After three times washing of wells with 200 µL of phosphate buffer 457

saline containing 0.05 % Tween 20 (PBS-T), plate was incubated with 50 µL of mouse anti-458

LIC20035 of various dilutions (1:1000; 1:5,000; and 1:10,000) at 37 ºC for 2 h. Pooled pre-459

immune serum of mice was used as a negative control. After three washing, wells were 460

probed with 50 µL of goat anti-mouse IgG HRP-conjugated (1:5000) for 1 hour at 37 ºC. The 461

plate was washed as described above and the binding was detected by adding TMB 462

(Tetramethyl Benzidine) peroxidase substrate (Thermo Fisher scientific) for 10 min at 37 ºC. 463

Final optical density (OD) was taken at 450 nm wavelength using ELISA plate reader 464

(Infinite 200 Pro, Tecan) after terminating the reaction with 1 M H2SO4. The endpoint titre 465


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

was determined visually, being the highest serum dilution giving a positive color 466

development. 467

468

Immunoblot assay 469

Whole cell lysates of L. interrogans serovar Lai grown in the presence and absence of 470

catecholamines were resolved onto 12 % SDS-PAGE and transferred to a nitrocellulose 471

membrane (HiMedia). Membranes were blocked with 5 % non-fat dried milk diluted in Tris-472

buffer saline (TBS, pH-8) containing 0.05 % Tween 20 (TBS-T) and probed with anti-473

LIC20035 (1:500) mouse polyclonal serum for 2 h at room temperature. After washing, the 474

membranes were incubated with HRP-conjugated goat anti-mouse IgG (1:5,000; Sigma) in 475

TBS for 1 h. The protein reactivity was revealed by adding chemiluminescence substrate 476

(Thermo scientific, Catalog no. 32209) over nitrocellulose membrane and imaged under 477

Chemidoc (Biorad XRS+). Band densitometry of the LB047 expression obtained from 478

immunoblot was quantified using Image Lab software (Biorad) as described before (59) and 479

the density values were normalized with LipL31 expression in the immunoblot. The relative 480

densitometry of LB047 expression was calculated in terms of percentage from two 481

independent immunoblot experiments. 482

483

Phase separation of integral membrane protein using Triton X-114 484

Phase separation of the integral membrane proteins of Leptospira to localize LIC20035 was 485

performed using Triton X-114 solution as described elsewhere (5). Briefly, 1×109

spirochetes 486

grown in EMJH medium were centrifuged (5,000 g) and washed 3 times with phosphate 487

buffer saline (PBS). The pellet obtained was sonicated four times with 20 s burst after 488

suspension in 800 µL of PBS. The suspension was added with 200 µL of 10% Triton X-114 489

(Sigma, Cat No. X114) and was rocked overnight at 4 °C. The insoluble debris was removed 490


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

by centrifugation at 13,000 g for 15 min at 4 °C and placed in 37 °C water bath for 10 min. 491

The suspension was centrifuged for 10 min at 13,000 g at room temperature to separate the 492

detergent (D) and the aqueous phase (A). The detergent phase (50 µL) was mixed with 1 ml 493

of original buffer at 0 °C, rewarmed at 37 °C and spun in a microcentrifuge as before. Later, 494

the final aqueous (A) and detergent phase (D) obtained after three times wash were 495

precipitated with 10 volumes of chilled acetone. The aqueous (A) and detergent phase (D) 496

was then resolved on 10% SDS-PAGE before transferring to nitrocellulose membrane 497

(Himedia) for immunoblot. 498

499

Protease-accessibility assay for the cellular localization of LB047 500

Proteinase K assay was performed for cellular localization of LB047 using the procedures 501

described elsewhere (17). Briefly, suspensions of 15 mL of 6 day old live L. interrogans Lai 502

(2.5 × 108

spirochetes/mL) were harvested and resuspended in 6 mL of PBS containing 25 µg 503

of Proteinase K (SRL). Tubes containing 1 mL of resuspended spirochetes were then 504

incubated for 0, 1, 3, and 5 h before the addition of 10 µl of 100 mM phenylmethylsulfonyl 505

fluoride (PMSF) to terminate the Proteinase K activity. The suspensions were subsequently 506

pelleted by centrifugation at 5000 g for 15 min, washed twice with PBS and resuspended in 1 507

mL of PBS for performing ELISA using antibodies against OmpL54, LB047 and LipL31. 508

OmpL54 and LipL31 are outer membrane and cytoplasmic leptospiral proteins that were used 509

in this experiment as positive and negative controls respectively (22, 48). The antibodies 510

against OmpL54 and LipL31 raised in rabbits were obtained from Dr. David Haake. For the 511

cellular localization of LB047 by ELISA, 100 µl of the Proteinase K treated leptospires were 512

coated onto the microtest plates and incubated for 16 h at room temperature. The primary 513

antibody against OmpL54, LIC20035, and LipL31 were used at a dilution of 1:50, 1:500 and 514

1:1000, respectively. Goat anti-Rabbit/anti-Mouse IgG HRP-conjugated secondary antibodies 515


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

were used at a dilution of 1:5000. The binding was detected as described in endpoint titre 516

determination. 517

518

ELISA for recognition of recombinant-LIC20035 using sera tested positive for leptospirosis 519

Serum samples of human and bovine (n=50) which had tested positive for leptospirosis 520

through Microscopic agglutination test (MAT), were used for recognition of r-LIC20035 by 521

ELISA. Another antigen r-LIC10191 (Loa22), a known surface-exposed lipoprotein of 522

leptospirosis diagnosis (9), was taken in equivalent amount to testify the ELISA results and to 523

scale the absorbance obtained for r-LIC20035. Microtitre plates were coated in duplicates 524

with equal amount (400 ng/well) of recombinant proteins (r-LIC20035 and r-Loa22) 525

overnight at 4 ºC and thereafter unbound surface was blocked with 3% BSA at 37 ºC for 2 526

hours. After 3 washing of the plate with 200 µL of phosphate buffer saline containing 0.05% 527

Tween 20 (PBS-T), wells were probed with human/bovine leptospirosis serum (1:100) at 37 528

°C for 2 hours. Microtitre wells were probed with secondary HRP-conjugated anti-human 529

IgG (Genei, Catalog No. 62114028001A) /anti-bovine IgG (Sigma, Cat No.A5295) for 1 hour 530

(1:5,000) at 37 ºC and the binding was measured as described in end-point titre 531

determination. The cut-off value for antibody reactivity was calculated as described 532

previously (9). The cut-off value for antibody reactivity was calculated as described 533

previously (9). Briefly, the average and the standard deviation (SD) were calculated from the 534

MAT negative serum groups and the cut-off value of the average + 2 SD was used for 535

analysis. All the absorbance values obtained from the ELISA assay which equaled or 536

exceeded the cut-off value was considered as positive for infection and thus sensitivity (%) of 537

the assay was calculated. The specificity (%) of the assay was calculated on the number of 538

samples of the MAT negative group below the calculated cut-off. 539

540


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

ELISA for binding of r-LIC20035 to host extracellular matrix (ECM) components 541

Host ligands included in the study were fibronectin (Sigma, Cat No. F4759), laminin (Sigma, 542

Cat No. L2020), bovine skin collagen type I (Sigma, Cat No. C9791), elastin (Sigma, Cat No. 543

E1625), chondroitin sulphate A & B (Sigma, Cat No.C9819/C3788), and hyaluronic acid 544

(Sigma, Catalog No. H7630). As negative controls for ligand, fetuin from fetal calf serum and 545

BSA (New England Biolabs) were used. Recombinant-Loa22 was used as a negative control 546

antigen in this assay, as it was previously shown to interact moderately with the tested ECM 547

components (3).The attachments of r-LIC20035 and r-Loa22 to these host ECM components 548

were analyzed by indirect ELISA. Briefly, ELISA plates were coated in duplicates with 1 µg 549

of the solubilized ECM components, BSA (negative control ligand) and fetuin (highly 550

glycosylated attachment negative control ligand) in 50 µL of PBS for 2 h at 37 ºC. Further 551

procedures were followed as described in endpoint titre determination. 552

553

Dose-response curves and KD values 554

ELISA plates were coated overnight with 1 µg of different ECM components. Each plate was 555

blocked and increasing concentrations of purified r-LIC20035 (0-8 µM), was added (50 µL 556

per well, in PBS) followed by incubation for 2 h at 37 ºC. The assessment of bound protein 557

was performed with polyclonal antiserum raised in mice against LIC20035 followed by HRP-558

conjugated anti-mouse IgG. The ELISA data, when reactions reached a saturation point, were 559

used to calculate the equilibrium dissociation constant (KD), according to the described 560

method (33) following the equation KD=(Amax[protein])/A)-[protein], where A is the 561

absorbance at a given protein concentration, Amax is the maximum absorbance for the ELISA 562

plate reader (equilibrium), [protein] is the protein concentration and KD is the equilibrium 563

dissociation constant for a given protein concentration (ELISA data point). 564

565


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

Statistical analysis 566

All results are expressed as the ± Standard error. Student’s paired t-test was used to determine 567

the significance of differences between means and P <0.05 was considered statistically 568

significant. Two independent experiments were performed, each one in duplicate or triplicate. 569

570

Acknowledgments: The authors would like to acknowledge ICMR, Port Blair India for 571

providing the Leptospira strains. The authors would like to thank the DBT program support, 572

Department of Biosciences and Bioengineering of IIT Guwahati for generating the Circular 573

Dichroism data and Department of Microbiology, College of Veterinary Science, Khanapara 574

Assam, India for raising polyclonal antibodies. The authors are also grateful to Professor 575

Rajeev Kumar Sharma and Professor Sailendra Kumar Das, College of Veterinary Science, 576

Khanapara, Guwahati Assam, India for helping us in raising polyclonal antibodies. 577

578

Funding: The present work was financially supported by Indian Council of Medical 579

Research bearing project number RCH/NER/16/2012-13 and Department of Science and 580

Technology, Government of India, Ministry of Science and Technology bearing project 581

number SB/FT/LS-354/2012. 582

Conflict of interest statement: None declared 583

584

585

586

587

588

589

590

591


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

References 592

1. al-Ramadi, B. K., G. Bashir, T. A. Rizvi, and M. J. Fernandez-Cabezudo. 2004. 593

Poor survival but high immunogenicity of IL-2-expressing Salmonella typhimurium 594

in inherently resistant mice. Microbes and Infection 6:350-359. 595

2. Bansal, T., D. Englert, J. Lee, M. Hegde, T. K. Wood, and A. Jayaraman. 2007. 596

Differential effects of epinephrine, norepinephrine, and indole on Escherichia coli 597

O157: H7 chemotaxis, colonization, and gene expression. Infection and immunity 598

75:4597-4607. 599

3. Barbosa, A. S., P. A. E. Abreu, F. O. Neves, M. V. Atzingen, M. M. Watanabe, 600

M. L. Vieira, Z. M. Morais, S. A. Vasconcellos, and A. L. T. O. Nascimento. 601 2006. A Newly Identified Leptospiral Adhesin Mediates Attachment to Laminin. 602

Infection and immunity 74:6356-6364. 603

4. Baron, M. J., S. L. Wong, K. Nybakken, V. J. Carey, and L. C. Madoff. 2009. 604

Host glycosaminoglycan confers susceptibility to bacterial infection in Drosophila 605

melanogaster. Infection and immunity 77:860-866. 606

5. Bordier, C. 1981. Phase separation of integral membrane proteins in Triton X-114 607

solution. Journal of Biological Chemistry 256:1604-1607. 608

6. Bulach, D. M., R. L. Zuerner, P. Wilson, T. Seemann, A. McGrath, P. A. Cullen, 609

J. Davis, M. Johnson, E. Kuczek, and D. P. Alt. 2006. Genome reduction in 610

Leptospira borgpetersenii reflects limited transmission potential. Proceedings of the 611

National Academy of Sciences 103:14560-14565. 612

7. Caimano, M. J., S. K. Sivasankaran, A. Allard, D. Hurley, K. Hokamp, A. A. 613

Grassmann, J. C. Hinton, and J. E. Nally. 2014. A model system for studying the 614

transcriptomic and physiological changes associated with mammalian host-adaptation 615

by Leptospira interrogans serovar Copenhageni. PLoS pathogens 10:e1004004. 616

8. Carvalho, E., A. S. Barbosa, R. M. Gómez, A. M. Cianciarullo, P. Hauk, P. A. 617

Abreu, L. C. Fiorini, M. L. Oliveira, E. C. Romero, and A. P. Gonçales. 2009. 618

Leptospiral TlyC is an extracellular matrix‐binding protein and does not present 619

hemolysin activity. FEBS letters 583:1381-1385. 620

9. Chalayon, P., P. Chanket, T. Boonchawalit, S. Chattanadee, P. Srimanote, and T. 621

Kalambaheti. 2011. Leptospirosis serodiagnosis by ELISA based on recombinant 622

outer membrane protein. Transactions of the Royal Society of Tropical Medicine and 623

Hygiene 105:289-297. 624

10. Chen, C., M. Lyte, M. P. Stevens, L. Vulchanova, and D. R. Brown. 2006. 625

Mucosally-directed adrenergic nerves and sympathomimetic drugs enhance non-626

intimate adherence of Escherichia coli O157: H7 to porcine cecum and colon. 627

European journal of pharmacology 539:116-124. 628

11. Chen, Y., M. Goette, J. Liu, and P. W. Park. 2008. Microbial subversion of 629

heparan sulfate proteoglycans. Molecules & Cells (Springer Science & Business 630

Media BV) 26. 631

12. Consortium, U. 2015. UniProt: a hub for protein information. Nucleic acids research 632

43:D204-D212. 633

13. Cullen, P. A., D. A. Haake, and B. Adler. 2004. Outer membrane proteins of 634

pathogenic spirochetes. FEMS Microbiology Reviews 28:291-318. 635

14. Cullen, P. A., X. Xu, J. Matsunaga, Y. Sanchez, A. I. Ko, D. A. Haake, and B. 636

Adler. 2005. Surfaceome of Leptospira spp. Infection and immunity 73:4853-4863. 637

15. Dixit, B., K. K. Ghosh, G. Fernandes, P. Kumar, P. Gogoi, and M. Kumar. 2016. 638

Dual Nuclease Activity of a Cas2 protein in CRISPR‐Cas subtype I‐B of Leptospira 639

interrogans. FEBS letters. 640


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

16. Doherty, N. C., A. Tobias, S. Watson, and J. C. Atherton. 2009. The Effect of the 641

Human Gut‐Signalling Hormone, Norepinephrine, on the Growth of the Gastric 642

Pathogen Helicobacter pylori. Helicobacter 14:223-230. 643

17. Domingos, R. F., M. L. Vieira, E. C. Romero, A. P. Gonçales, Z. M. de Morais, S. 644

A. Vasconcellos, and A. L. T. O. Nascimento. 2012. “Features of two proteins of 645

Leptospira interrogans with potential role in host-pathogen interactions”. BMC 646

microbiology 12:50. 647

18. Freestone, P. P., R. D. Haigh, and M. Lyte. 2008. Catecholamine inotrope 648

resuscitation of antibiotic-damaged staphylococci and its blockade by specific 649

receptor antagonists. Journal of Infectious Diseases 197:1044-1052. 650

19. Freestone, P. P., R. D. Haigh, and M. Lyte. 2007. Specificity of catecholamine-651

induced growth in Escherichia coli O157: H7, Salmonella enterica and Yersinia 652

enterocolitica. FEMS microbiology letters 269:221-228. 653

20. Freestone, P. P., R. D. Haigh, P. H. Williams, and M. Lyte. 2003. Involvement of 654

enterobactin in norepinephrine-mediated iron supply from transferrin to 655

enterohaemorrhagic Escherichia coli. FEMS microbiology letters 222:39-43. 656

21. Haake, D. A., G. Chao, R. L. Zuerner, J. K. Barnett, D. Barnett, M. Mazel, J. 657

Matsunaga, P. N. Levett, and C. A. Bolin. 2000. The leptospiral major outer 658

membrane protein LipL32 is a lipoprotein expressed during mammalian infection. 659

Infect. Immun 68. 660

22. Haake, D. A., and J. Matsunaga. 2002. Characterization of the leptospiral outer 661

membrane and description of three novel leptospiral membrane proteins. Infect. 662

Immun 70. 663

23. Haake, D. A., and J. Matsunaga. 2010. Leptospira: a spirochaete with a hybrid outer 664

membrane. Molecular microbiology 77:805-814. 665

24. Haake, D. A., E. Walker, D. Blanco, C. Bolin, M. Miller, and M. Lovett. 1991. 666

Changes in the surface of Leptospira interrogans serovar grippotyphosa during in 667

vitro cultivation. Infection and immunity 59:1131-1140. 668

25. Haake, D. A., and W. R. Zückert. 2015. The Leptospiral Outer Membrane. Current 669

topics in microbiology and immunology 387:187-221. 670

26. Hendrickson, B. A., J. Guo, R. Laughlin, Y. Chen, and J. C. Alverdy. 1999. 671

Increased type 1 fimbrial expression among commensal Escherichia coli isolates in 672

the murine cecum following catabolic stress. Infection and immunity 67:745-753. 673

27. Hoke, D. E., S. Egan, P. A. Cullen, and B. Adler. 2008. LipL32 is an extracellular 674

matrix-interacting protein of Leptospira spp. and Pseudoalteromonas tunicata. 675

Infection and immunity 76:2063-2069. 676

28. Jones, D. T. 1999. Protein secondary structure prediction based on position-specific 677

scoring matrices. Journal of molecular biology 292:195-202. 678

29. Kanehisa, M., Y. Sato, M. Kawashima, M. Furumichi, and M. Tanabe. 2016. 679

KEGG as a reference resource for gene and protein annotation. Nucleic acids research 680

44:D457-D462. 681

30. Kumar, M., X. Yang, A. S. Coleman, and U. Pal. 2010. BBA52 facilitates Borrelia 682

burgdorferi transmission from feeding ticks to murine hosts. The Journal of infectious 683

diseases 201:1084-1095. 684

31. Li, L., Z. Xu, Y. Zhou, L. Sun, Z. Liu, H. Chen, and R. Zhou. 2012. Global effects 685

of catecholamines on Actinobacillus pleuropneumoniae gene expression. PloS one 686

7:e31121. 687

32. Li, W., M. Lyte, P. P. Freestone, A. Ajmal, J. A. Colmer-Hamood, and A. N. 688

Hamood. 2009. Norepinephrine represses the expression of toxA and the siderophore 689

genes in Pseudomonas aeruginosa. FEMS microbiology letters 299:100-109. 690


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

33. Lin, Y. P., D. W. Lee, S. P. McDonough, L. K. Nicholson, Y. Sharma, and Y. F. 691

Chang. 2009. Repeated domains of leptospira immunoglobulin-like proteins interact 692

with elastin and tropoelastin. J. Biol. Chem 284. 693

34. Lo, M., G. L. Murray, C. A. Khoo, D. A. Haake, R. L. Zuerner, and B. Adler. 694

2010. Transcriptional response of Leptospira interrogans to iron limitation and 695

characterization of a PerR homolog. Infection and immunity 78:4850-4859. 696

35. Lyte, M. 2004. Microbial endocrinology and infectious disease in the 21st century. 697

Trends in microbiology 12:14-20. 698

36. Lyte, M., A. K. Erickson, B. P. Arulanandam, C. D. Frank, M. A. Crawford, and 699

D. H. Francis. 1997. Norepinephrine-induced expression of the K99 pilus adhesin of 700

enterotoxigenicEscherichia coli. Biochemical and biophysical research 701

communications 232:682-686. 702

37. Lyte, M., C. D. Frank, and B. T. Green. 1996. Production of an autoinducer of 703

growth by norepinephrine cultured Escherichia coli O157: H7. FEMS microbiology 704

letters 139:155-159. 705

38. Matsui, M., M.-E. Soupé, J. Becam, and C. Goarant. 2012. Differential in vivo 706

gene expression of major Leptospira proteins in resistant or susceptible animal 707

models. Applied and environmental microbiology 78:6372-6376. 708

39. Murray, G. L., K. M. Ellis, M. Lo, and B. Adler. 2008. Leptospira interrogans 709

requires a functional heme oxygenase to scavenge iron from hemoglobin. Microbes 710

and Infection 10:791-797. 711

40. Murray, G. L., A. Srikram, R. Henry, A. Puapairoj, R. W. Sermswan, and B. 712

Adler. 2009. Leptospira interrogans requires heme oxygenase for disease 713

pathogenesis. Microbes and Infection 11:311-314. 714

41. Nally, J. E., J. P. Whitelegge, S. Bassilian, D. R. Blanco, and M. A. Lovett. 2007. 715

Characterization of the Outer Membrane Proteome of Leptospira interrogans 716

Expressed during Acute Lethal Infection. Infection and immunity 75:766-773. 717

42. Nascimento, A. L. T. O. d., S. Verjovski-Almeida, M. Van Sluys, C. Monteiro-718

Vitorello, L. Camargo, L. Digiampietri, R. Harstkeerl, P. Ho, M. Marques, and 719 M. Oliveira. 2004. Genome features of Leptospira interrogans serovar Copenhageni. 720

Brazilian Journal of Medical and Biological Research 37:459-477. 721

43. O'Donnell, P. M., H. Aviles, M. Lyte, and G. Sonnenfeld. 2006. Enhancement of In 722

Vitro Growth of Pathogenic Bacteria by Norepinephrine: Importance of Inoculum 723

Density and Role of Transferrin. Applied and environmental microbiology 72:5097-724

5099. 725

44. Oliveira, R., Z. M. de Morais, A. P. Gonçales, E. C. Romero, S. A. Vasconcellos, 726

and A. L. Nascimento. 2011. Characterization of novel OmpA-like protein of 727

Leptospira interrogans that binds extracellular matrix molecules and plasminogen. 728

PloS one 6:e21962. 729

45. Pan, X., Y. Yang, and J.-R. Zhang. 2014. Molecular basis of host specificity in 730

human pathogenic bacteria. Emerging microbes & infections 3:e23. 731

46. Perez-Iratxeta, C., and M. A. Andrade-Navarro. 2008. K2D2: estimation of 732

protein secondary structure from circular dichroism spectra. BMC structural biology 733

8:25. 734

47. Peterson, G., A. Kumar, E. Gart, and S. Narayanan. 2011. Catecholamines 735

increase conjugative gene transfer between enteric bacteria. Microbial pathogenesis 736

51:1-8. 737

48. Pinne, M., and D. A. Haake. 2009. A comprehensive approach to identification of 738

surface-exposed, outer membrane-spanning proteins of Leptospira interrogans. PloS 739

one 4:e6071. 740


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

49. Pinne, M., J. Matsunaga, and D. A. Haake. 2012. Leptospiral Outer Membrane 741

Protein Microarray, a Novel Approach to Identification of Host Ligand-Binding 742

Proteins. Journal of Bacteriology 194:6074-6087. 743

50. Raja, V., and K. Natarajaseenivasan. 2015. Pathogenic, diagnostic and vaccine 744

potential of leptospiral outer membrane proteins (OMPs). Critical reviews in 745

microbiology 41:1-17. 746

51. Robbins, G. T., B. L. Hahn, K. V. Evangelista, L. Padmore, P. S. Aranda, and J. 747

Coburn. 2015. Evaluation of cell binding activities of Leptospira ECM adhesins. 748

PLoS neglected tropical diseases 9:e0003712. 749

52. Sandrini, S., F. Alghofaili, P. Freestone, and H. Yesilkaya. 2014. Host stress 750

hormone norepinephrine stimulates pneumococcal growth, biofilm formation and 751

virulence gene expression. BMC microbiology 14:180. 752

53. Savitzky, A., and M. J. Golay. 1964. Smoothing and differentiation of data by 753

simplified least squares procedures. Analytical chemistry 36:1627-1639. 754

54. Scheckelhoff, M. R., S. R. Telford, M. Wesley, and L. T. Hu. 2007. Borrelia 755

burgdorferi intercepts host hormonal signals to regulate expression of outer surface 756

protein A. Proceedings of the National Academy of Sciences 104:7247-7252. 757

55. Schmittgen, T. D., and K. J. Livak. 2008. Analyzing real-time PCR data by the 758

comparative CT method. Nature protocols 3:1101-1108. 759

56. Sharaff, F., and P. Freestone. 2011. Microbial endocrinology. Open Life Sciences 760

6:685-694. 761

57. Sperandio, V., A. G. Torres, B. Jarvis, J. P. Nataro, and J. B. Kaper. 2003. 762

Bacteria–host communication: the language of hormones. Proceedings of the National 763

Academy of Sciences 100:8951-8956. 764

58. Stevenson, B., H. A. Choy, M. Pinne, M. L. Rotondi, M. C. Miller, E. DeMoll, P. 765

Kraiczy, A. E. Cooley, T. P. Creamer, and M. A. Suchard. 2007. Leptospira 766

interrogans endostatin-like outer membrane proteins bind host fibronectin, laminin 767

and regulators of complement. PloS one 2:e1188. 768

59. Taylor, S. C., T. Berkelman, G. Yadav, and M. Hammond. 2013. A Defined 769

Methodology for Reliable Quantification of Western Blot Data. Molecular 770

Biotechnology 55:217-226. 771

60. Toscano, M., T. Stabel, S. Bearson, B. Bearson, and D. Lay. 2007. Cultivation of 772

Salmonella enterica serovar Typhimurium in a norepinephrine-containing medium 773

alters in vivo tissue prevalence in swine. Journal of Experimental Animal Science 774

43:329-338. 775

61. Vieira, M. L., Z. M. de Morais, A. P. Gonçales, E. C. Romero, S. A. Vasconcellos, 776

and A. L. Nascimento. 2010. Lsa63, a newly identified surface protein of Leptospira 777

interrogans binds laminin and collagen IV. Journal of Infection 60:52-64. 778

62. Vlisidou, I., M. Lyte, P. M. Van Diemen, P. Hawes, P. Monaghan, T. S. Wallis, 779

and M. P. Stevens. 2004. The neuroendocrine stress hormone norepinephrine 780

augments Escherichia coli O157: H7-induced enteritis and adherence in a bovine 781

ligated ileal loop model of infection. Infection and immunity 72:5446-5451. 782

63. Voigt, W., A. Fruth, H. Tschäpe, R. Reissbrodt, and P. H. Williams. 2006. 783

Enterobacterial autoinducer of growth enhances shiga toxin production by 784

enterohemorrhagic Escherichia coli. Journal of clinical microbiology 44:2247-2249. 785

64. Walters, M., M. P. Sircili, and V. Sperandio. 2006. AI-3 synthesis is not dependent 786

on luxS in Escherichia coli. Journal of Bacteriology 188:5668-5681. 787

65. Xue, F., H. Dong, J. Wu, Z. Wu, W. Hu, A. Sun, B. Troxell, X. F. Yang, and J. 788

Yan. 2010. Transcriptional responses of Leptospira interrogans to host innate 789


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

immunity: significant changes in metabolism, oxygen tolerance, and outer membrane. 790

PLoS Negl Trop Dis 4:e857. 791

792

793

794

795

796

797

798

799

800

801

802

803

804

805

806

807

808

809

810

811

812

813

814

815

816

817

818

819

820

821

822


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

Table 1: Comparative analyses of the gene sequence identity of the differentially regulated 823

genes of serovars Lai and Copenhageni in the presence of catecholamines. 824

Leptospira

serovars Locus Gene CDS Identity (%)

Lai LA0616 lipL41

1068 1065/1068

(99%) Copenhageni LIC12966 1068

Lai LA3961 ompl36

912 910/912


Lai LB186 hol

678 676/678


Lai LB191 hbpA

2133 2131/2133


Lai LA3307 rfe

1047 912/915


Lai LA3263 Hypothetical

1224 1221/1224


Lai LB047 Hypothetical

1320 1313/1320


Note: CDS stands for coding sequence. 825

826

827

828

829

830

831

832

833

834

835

836

837

838


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

Table 2: Comparative analyses of the protein sequence identity of LIC20035 in the different 839

strains of Leptospira. 840

Leptospira

species

Pathogenic (++),

Intermediate (+)

or Saprophyte (-)

Query

coverage

(%)

Identity

(%)

NCBI

Accession number

kirschneri ++ 99 99 WP_004765841.1

noguchii ++ 99 96 WP_061247126.1

santarosai ++ 99 90 WP_004475508.1

weilii ++ 99 90 WP_002999236.1

alexanderi ++ 99 90 WP_078124341.1

alstonii ++ 99 90 WP_020775287.1

kmetyi ++ 99 90 WP_010572225.1

mayottensis ++ 99 89 WP_002764046.1

borgpetersenii ++ 99 88 WP_011671265.1

wolffii + 99 64 WP_016545620.1

fainei + 99 64 WP_016551189.1

inadai + 99 63 WP_010410057.1

broomii + 99 63 WP_010568341.1

licerasiae + 98 62 WP_008589084.1

wolbachii - 99 40 WP_015682912.1

biflexa - 100 39 WP_012476493.1

841

842

843

844

845

846

847

848

849

850

851

852

853


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

Table 3: Details of the Leptospira genes selected and its oligomers in this study. 854

Gene ID of

serovars

(Lai/

Copenhageni)

Gene name/

function

Gene

size

(bp)

5’ to 3’ Forward/Reverse Sequence

LAr04/

LIC11508 rrs2, 16S rRNA 1512

TTATTGCTCGGAGATGAGCC

TTCAGGGTTCCCCCCATT

LA2019/

LIC11889 Flagellin (flaB) 852

ATGATTATCAATCACAACCTGAGTG

TCAGTATTCCTTTCCGCTTGA

LA1005/

LIC12655 Uncharacterized 459

GATTCACAGAGTTATCCTAACTTTCTG

CCTGGTATCGAAATGTCAGTTG

LA1796 Uncharacterized 546 TAGGTGAAGGATTTTCATATCCAAA T

AAATCCATCAGCATTACTTCTTAGA

LA0634/

LIC12953 dppC 762

TTCTTCTGTGTTTGTTTCCGTTC

AAGCAAGTACAAATCCACTTCCA

LB187/

LIC20149

Multidrug efflux

transporter 1209

TACTCTTTTTACTCTTTTATTTCTCCG

CTACGGCCCCTCCTAAAGAA

LB191/

LIC20151

TonB dependent

receptor 2133

CGAAGTCATTTCCCGTAAAAAG

GTCCGGAAATTCTTTCGC

LB183/

LIC20147

fur, transcription

reglator 393

TACGAACTTTCCCGAAAGAATTT

ACACGGTCGCATTGTTTACA

LA2579/

LIC11402

feoB, Ferrous

transporter 2106

TTAGTTTGGGAGGGAGCTCA

TTTCATCGTGACCGCGAC

LB186/

LIC20148 Heme oxygenase 678

TCAAGACTATGTGCAAAGAATTCG

TAGGAAATTCGTAAAAAGAAATTCCTT

LA4253/

LIC13403 fepB 774

TCGGATTTTCAGATATACAATCGG

CTTTCTTTTCCAACCTTCAATCA

LA3064/

LIC11030

Putative

lipoprotein 1035

AAACCGATACGGAGTTGTCATC

ATTTTGTGCATAAAGTCTCGTGTTT

LA0426/

LIC10373

Putative

lipoprotein 1530

ATAGTTGGAACCTCTAATGGACCA

CCGCGACATTCTTTGGGTA

LA0616/

LIC12966

lipL41, OM

lipoprotein 1068

GTGAAGGTTCCAGCTTTATCGA

CGCTCCAATCAGATTTCCG

LA2637/

LIC11352

lipL32, OM

lipoprotein 819

GTGAAGGTTCCAGCTTTATCGA

CGCTCCAATCAGATTTCCG

LA3961/

LIC13166 ompL36

921

AAGAGCAGAAGCGTCGTA

TTGGAGAGTTGGTGGAGTT

LA3778/

LIC10464 ligB 1890

ACGGTACCAGTACAACCCTAGAAG

TAGGCCGTTGTATTCTGCTTTT


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

33

LA1569/

LIC12209

Putative

lipoprotein 1416

GGAGACGAGGATTGGGTCC

GTGTTCCGATACTAGAGGGCTTATT

LA3446/

LIC10730

Putative

lipoprotein 480

AAAAACGAATCGGACTTTCTCC

ATCCATACATTGTCTTTGTTTTGC

LA3247/

LIC10889 tonB 591

TCATCCAAGAACCAAACGTTG

GGCTTCATCGGGATAGTCTG

LA3258/

LIC10881

tonB dependent

OM receptor 1674

ATTCTAAAGTGTTTTCTTTGTCGGA

GGTTACCTTTTTTGTTTTTTGTACG

LA3478/

LIC10704

Putative

lipoprotein 669

CAGACAAGGAACGAGAATCTATTG

AGATTGACCTTTCAATTCCGC

LA3444/

LIC10731

Putative

lipoprotein 1260

ACCGGAAGATGCCGATTTA

TTTTGTGACCGAATAAACGCT

LA3501/

LIC10686

Putative

lipoprotein 1272

GTATGTCTCCAGCAGATGCTCC

GGGCGTTCGATTAGAAAAATT

LA3440/

LIC10734

Putative

lipoprotein 795

TTCCGGATTTTGTACAAAATCTTC

ATGATATTCTGCCCATATACGCA

LA3371/

LIC10792

mdoC, Glucans

biosynthesis 1173

CCCTTTTTTTCTTTCTTTCGG

AGAAATTTTCGTTCCAGCTTGT

LA3294/

LIC10854

uppS, Isoprenyl

transferase 726

CATAGAGAAGGTGCCCAGG

TGAATCGTATCTAATCGAGTTTCTATA

LA3276/


GACTTTTAGGGGTAGCGGGA

TCTTGTCCATTGTTTGTTTCCA

LA3263/


CTTCAGCATAAAAAACCTCTTTTGA

ACGATAAATCCTCCCGCC

LA3262/

LIC10879

Putative

lipoprotein 480

GATCCTTCCTTACTCAATGCTTCT

TCTACTTTTTCAGTTTTTACACGTACA

LA3230/


TAACGTTCCTCCCGATGTC

AGTGTCCGGATCTCCCAGTA

LA3307/

LIC10841 rfe, transferase 915

GATCGTCTACGTTTTGTTTGTTGT

AGTTAAAACCTAAAAAACCGAAAACA

LA3210/

LIC10920

Putative

lipoprotein 756

AACCACTGCAGAATCTATGGTG

TTCCGCTTGGATAAACTGGA

LA3200b/

LIC10927

Putative

lipoprotein 1494

CGATTACTATTTCCGGAGCC

TCCGAAGCAGTTATATCCACTC

LA3138/

LIC10973 ompL1 963

TAAATTGATTACCCTCGATAGAACTAC

CTGCTTTTGTAATACCGCCAG

LA1691/

LIC12099 lipL53 1431

AATCAAACTTGGGTCAGACAACTT

TCACGCCGAAGTCATTTATCT

LA3017/ lemA, Putative 597 TTCACAAGCGCAAGCACAG


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

34

LIC11058 lipoprotein TCTGTTTCTGGCTACGGTAATTC

LA3434/

LIC10739

amiA, alanine

amidase 1092

CGTTATGTGCGCTTTGAAGA

TAAAGAATCGGAACGGAAATTTT

LA3394/

LIC10774

Putative

lipoprotein 1107

CAAGAATCCGAAAAATCTTCTTCA

TTGAAGGGTTGGTTTGACGT

LB194/

LIC20153

Putative

lipoprotein 579

CTACTTCCATTCAAACTCTTGTTTACG

AGTATTATAAATCAAAGGTGCATTCTC

LA3340/

LIC10821

Putative

lipoprotein 783

GCGATTCCAATGCTGGTAC

ACTGTCCCCATATAGATTGACACC

LB047/

LIC20035

Hypothetical

protein 1323

TGTAACTCCACTCCTAATGTGGAG

CGATTTTAAACCATCTAACTGTTCAG

CTAGCTAGCTGTAACTCCACTCCTAATGTGGAG

CCGCTCGAGTTATTTACAACCTTGCATTTCTCC

LA0222/

LIC10191

Loa22, OmpA

lipoprotein 588

GATAGTTACGCTCTTGAA

GATACGATTTGCTGGAAT

CTAGCTAGCGCTGAAAAAAAAGAGGAATCCG

CCGCTCGAGTTATTGTTGTGGTGCGGAAG

Note: OM stands for outer membrane. 855

856

857

858

859

860

861

862

863

864

865

866

867

868

869

870

871

872


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

35

Legends to figures 873

874

Figure 1: Effect of catecholamines and inhibitor on growth of Leptospira. 875

L. interrogans Lai cultures were incubated and grown in the presence of Epi, NE, the β-876

antagonist propranolol (PO), or with the catecholamines and PO combined. Spirochete 877

culture was monitored daily and its number was determined by counting under 40X Phase 878

contrast microscopy. Each treatment showed similar growth to untreated control cultures, and 879

at no time point was a significant difference detected among any group. Results are indicative 880

of two independent experiments performed. 881

882

Figure 2: Effect of catecholamines and inhibitor on the selective gene transcripts of 883

Leptospira. Transcript analyses of the 7 genes encoding OMPs out of 41 by qRT-PCR of the 884

cDNA synthesized from Leptospira grown in the presence of catecholamines and inhibitors 885

(500 µM). The gene transcription were calculated based on threshold cycle (Ct) values by use 886

of 2-∆∆Ct

method and normalized against 16S rRNA values. A. The genes of L. interrogans 887

serovar Lai that showed significant differential transcription. The differential transcripts of 888

seven genes in the presence of catecholamines was restored to the basal level on addition of 889

its inhibitor propranolol (PO) describing the specific role of the catecholamines in modulating 890

gene transcription. B. The differential transcription of 7 orthologous genes of L. interrogans 891

serovar Copenhageni. The patterns of differential transcription of 7 orthologs of Copenhageni 892

to serovar Lai are very close. C and D. The fold change in gene transcription of L. 893

interrogans Lai and L. interrogans Copenhageni responding significantly to catecholamines. 894

Each gene is represented by a unique color bar along with fold change value at the apex of 895

each bar. Bars denote the mean standard deviation from 2 independent qRT-PCR analyses. 896

897


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

36

Figure 3: Characterization of hypothetical protein LIC20035/LB047. 898

A. PCR for LIC20035 gene using genomic DNA of pathogenic (Copenhageni, Lai, Canicola) 899

and non-pathogenic serovars (Patoc) of Leptospira. An amplicon size of 1,275 bp by agarose 900

gel electrophoresis confirmed the existence of LIC20035 gene in pathogenic serovars (Lane 901

1, 3 & 5). In contrast, no amplification of LIC20035 was observed in the non-pathogenic 902

serovar of Leptospira (Lane 7). Primers of constitutive flaB gene were used as a positive 903

control for determining the quality of DNA (Lane 2, 4, 6 & 8). B. Induction and purification 904

of recombinant-LIC20035. The CDS LIC20035 of L. interrogans Copenhageni L1-130 was 905

cloned without its signal peptide sequence in pET28a vector and expressed in BL21 E. coli. 906

Induction of r-LIC20035 expression was done using 0.5 mM IPTG and its purification was 907

performed using Ni-NTA column chromatography under hybrid conditions. The uninduced 908

and induced lysates of BL21 E. coli along with the purified recombinant-LIC20035 are 909

shown on 12% SDS-PAGE stained with Coomassie. C. Generated polyclonal antibody titer 910

rasied against r-LIC20035. The pooled mice immune sera obtained after 10 days of second 911

booster dose was used to calculate the titer of polyclonal antibodies generated against r-912

LIC20035 using ELISA. Serum obtained before the immunization of r-LIC20035 antigen was 913

used as a control for evaluation of antibody titer and data is represented as mean± standard 914

error mean (SEM) of two independent experiments. D. Immunoblot demonstrates the 915

differential expression of LB047 in L. interrogans serovar Lai grown in the presence of 916

catecholamines and inhibitor. There was a repression of LB047 in the presence of Epi alone 917

in comparison to control and NE, the effect of which was restored to the basal levels when 918

grown along with its inhibitor propranolol (PO). Anti-LipL31 was used as a control to 919

demonstrate equal loading of Leptospira lysates. E. Relative densitometry of the immunoblot 920

shown in fig 3D was calculated and normalized with the band intensity of LipL31 using 921

Image Lab software from two independent experiment. The repression of LB047 was evident 922


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

37

in the presence of Epi and the effect of which was restored to the basal level using its 923

inhibitor PO. F. Far-ultraviolet circular dichroism (CD) of r-LIC20035. The CD spectra are 924

depicted in the range of 190-240 nm wavelengths showing a predominant signal of β-strand. 925

CD spectra are shown as an average of 3 scans with a scanning speed of 100 nm/minute. 926

927

Figure 4: Cellular localization of LIC20035/LB047. A. Triton-X-114 phase partitioning of 928

spirochetes proteins. Spirochetes lysates were subjected to Triton X-114 phase partition of 929

aqueous (A) and detergent phase (D). The aqueous and detergent phase fraction was resolved 930

onto 12 % SDS PAGE and was immunoblotted with anti-LIC20035 serum. Major portion of 931

LIC20035 was in detergent phase and partly in aqueous phase in both serovars Lai and 932

Copenhageni. Whole cell lysates of serovar Copenhageni in lane 1 was used as a molecular 933

marker for LIC20035. B. Immunoblot to validate the Triton X-114 phase-partition analysis. 934

LipL32 is a known outer membrane lipoprotein and is exclusively present only in the 935

detergent phase of Triton X-114. Anti-LipL32 (1:500) detected LipL32 only in the detergent 936

phase (D) fraction of serovars Lai and Copenhageni. Whole cell lysates of serovar 937

Copenhageni in lane 1 was used as a molecular marker for LipL32. C. Proteinase K 938

accessibility assay of L. interrogans Lai for surface exposed LB047. Spirochetes were 939

incubated with 25 µg of Proteinase K at various time interval upto 5 h. The spirochete 940

suspensions were washed with PBS and coated onto microtitre plate. Using ELISA, drastic 941

decrease in the signal for LB047 reactivity with its antiserum was observed after 1 to 5 h 942

Proteinase K treatment similar to OmpL54, a known outer membrane protein. LipL31 was 943

used as a control to keep a check on the cellular integrity of spirochetes during treatment with 944

Proteinase K. Error bars represent the standard deviations of the three replicates. Statistical 945

analysis was performed by Student's t-test by comparing the signals obtained for 0 h and 946

other time point of treatment with Proteinase K (p<0.05). 947


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

38

Figure 5: The recombinant-LIC20035 is recognized by leptospirosis positive sera. 948

Enzyme linked immunosorbent assay (ELISA) was performed to detect r-LIC20035 or r-949

LIC10191 using the sera of humans (1:100) and bovines (1:100) tested MAT-positive (n=50) 950

and control serum tested MAT-negative for leptospirosis. The cut-off value of the assay was 951

derived from the mean (M) of the control group plus 2SD (standard deviation) for each 952

recombinant antigens (dotted black lines). The mean (M) of each group represents as black 953

horizontal lines. A. ELISA to detect r-LIC20035 (400 ng/well) using human sera tested 954

positive for leptospirosis. The sensitivity and specificity of the assay was 98 and 100, 955

respectively. B. ELISA to detect r-LIC10191 (400 ng/well) using human sera tested positive 956

for leptospirosis. Recombinant-LIC10191 (r-Loa22) of equivalent amount (400 ng/well) was 957

used to scale the recognition capacity of human sera. C. ELISA to detect r-LIC20035 (400 958

ng/well) with bovine sera tested positive for leptospirosis. The sensitivity and specificity of 959

the serological assay was 100. D. ELISA to detect r-Loa22 with bovine sera tested positive 960

for leptospirosis. Recombinant-Loa22 of equivalent amount was used to scale the recognition 961

capacity of bovine sera. 962

963

Figure 6: The recombinant-LIC20035 binds to host extracellular matrix components. 964

A. ELISA depicts r-LIC20035 interacts with extracellular matrix (ECM) components, 965

laminin, fibronectin, collagen (calf skin), hyaluronic acid, chondroitin sulfate A, chondroitin 966

sulfate B and elastin. Bovine serum albumin (BSA) and the highly glycosylated serum 967

protein, fetuin, were used as controls for non-specific binding. Loa22 was included as a 968

negative control for non-specific binding with the ECM components. Recombinant-969

LIC20035 exhibited significant binding with all ECM components as compared to fetuin or 970

BSA (P<0.001) and with a higher affinity towards chondroitin sulfate and collagen. In 971


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

39

contrast, Loa22 showed moderate binding with all the ECM components used in this study. 972

Results are indicative of two independent experiments performed. B. Dose-dependent binding 973

of the LIC20035 to ECM components. One microgram of specific ECM coated microtiter 974

plate was incubated with increasing concentrations (0-8 µM) of r-LIC20035. Binding assay 975

of LIC20035 was measured using anti-LIC20035 serum at an appropriate dilution. The mean 976

absorbance values of r-LIC20035 binding to ECM of two experiments are shown at 450 nm. 977


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

downloaded from on april 4, 2020 by guest · 6 120 catecholamines were normalized with 16 s rrna...

Documents