downloaded from //iai.asm.org/content/iai/early/2010/11/01/iai.00663-10.full.pdf7 1 provided with...

1

1

2

3

4

5

6

7

A fadD mutant of Vibrio cholerae is impaired in the production of virulence factors 8

and membrane localization of the virulence regulatory protein TcpP 9

10

11

12 13

Sreejana Ray1, Epshita Chatterjee

1, Arpita Chatterjee

2, Kalidas Paul

and 14

Rukhsana Chowdhury*

15

Infectious Diseases and Immunology Division, Indian Institute of Chemical Biology, 16

Council of Scientific and Industrial Research, Kolkata 700 032, India 17

18

19

20

Running title: 21

V. cholerae FadD affects membrane localization of TcpP 22

23

*Corresponding author. Mailing address: Infectious Diseases and Immunology Division, Indian 24

Institute of Chemical Biology, 4 Raja S. C. Mullick Road, Kolkata 700 032, India. 25

Phone: 91 33 2499 5842, Fax: 91 33 2473 5197, E-mail: [email protected] 26

27

1 These authors contributed equally to this work 28

2 Current address: Department of Internal Medicine, University of Texas Medical 29

Branch, Galveston, USA 30

31

32

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00663-10 IAI Accepts, published online ahead of print on 1 November 2010

on March 15, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

2

1

ABSTRACT 2

3

4 In the enteric pathogen Vibrio cholerae expression of the major virulence factors is 5

controlled by the hierarchical expression of several regulatory proteins comprising the 6

ToxR regulon. In this study, we demonstrate that disruption of the fadD gene encoding a 7

long chain fatty acyl-CoA ligase has marked effects on expression of the ToxR virulence 8

regulon, motility and in vivo lethality of V. cholerae. In the V. cholerae fadD mutant, 9

expression of the major virulence genes ctxAB and tcpA encoding cholera toxin (CT) and 10

the major subunit of the toxin coregulated pilus (TCP) was drastically repressed and a 11

growth phase dependent reduction in the expression of toxT, encoding the transcriptional 12

activator of ctxAB and tcpA, was observed. Expression of toxT from an inducible 13

promoter completely restored CT to wild type levels in the V. cholerae fadD mutant 14

suggesting that FadD probably acts upstream of toxT expression. Expression of toxT is 15

activated by the synergistic effect of two transcriptional regulators, TcpP and ToxR. RT-16

PCR and Western blot analysis indicated that although gene expression and production of 17

both TcpP and ToxR are unaffected in the fadD mutant strain, membrane localization of 18

TcpP, but not ToxR, is severely impaired in the fadD mutant strain from the mid-19

logarithmic phase of growth. Since the decrease in toxT expression occurred concomitant 20

with the reduction in membrane localization of TcpP, a direct correlation between the 21

defect in membrane localization of TcpP and reduced toxT expression in the fadD mutant 22

strain is suggested. 23

24

25


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

3

INTRODUCTION 1

2

The gram negative, non invasive enteric bacterium Vibrio cholerae has caused 3

devastating outbreaks of the acute diarrheal disease cholera all over the world since 4

ancient times (33). The Indian subcontinent, particularly the Bengal Gangetic delta 5

thought to be the original reservoir of V. cholerae, is still ravaged by epidemics of 6

cholera. Indeed, even today outbreaks of cholera continue to occur in developing 7

countries triggered by natural as well as man made disasters like floods and droughts, 8

poverty and wars. The frequency and intensity of cholera epidemics may be considered as 9

a key indicator of social development. 10

The pathogenicity of V. cholerae is largely due to the production of cholera toxin 11

(CT) and a toxin coregulated pilus (TCP) thought to be essential for colonization of the 12

intestinal epithelium by the bacteria (17, 39). The expression of the ctxAB and tcpA genes 13

encoding CT and the major subunit of TCP respectively is activated by ToxT, a member 14

of the AraC family of transcriptional regulators (9). Expression of toxT in turn is 15

activated by the synergistic activity of ToxR and TcpP, inner membrane proteins with 16

cytoplasmic DNA binding domains belonging to the OmpR family (16, 29). Expression 17

of tcpP is controlled by the membrane located AphA/AphB proteins (19, 37). This 18

cascade of transcription regulators that controls the virulence of V. cholerae is known, for 19

historical reasons as the ToxR regulon (7, 27). The ToxR regulon is modulated by other 20

global regulators like the anaerobiosis response regulator ArcA/ArcB (35), the cyclic di-21

GMP phosphodiesterase VieA (40, 41), cAMP/CRP (20) etc which exert their effects at 22

different levels of the cascade. However, the exact mechanism by which these factors 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

4

modulate the ToxR regulon is known only for cAMP/CRP. The cAMP/CRP complex can 1

bind to the tcpP promoter at a site within the binding sites of AphA and AphB, thus 2

preventing the activation of tcpP expression by AphA and AphB (20). Although 3

decreased toxT transcript levels have been observed in both ∆vieSAB and arcA mutant, 4

the molecular mechanism of action of these regulators is not clear (35, 40). 5

The ToxR regulon is also strongly influenced by physico-chemical parameters 6

(22) like temperature (4, 30), osmolarity, pH, amino acids (28), aeration (21) and bile (13, 7

15, 34). We have reported earlier that the unsaturated fatty acids present in bile, 8

arachidonic, linoleic, and oleic acids, drastically repressed expression of the ctxAB and 9

tcpA genes even in the presence of the transcriptional activator ToxT (6). More recently, 10

the crystal structure of ToxT has been solved and shown to contain an almost buried, 11

solvent inaccessible singly unsaturated cis-palmitoleate and in vitro experiments have 12

demonstrated that unsaturated fatty acids inhibited the binding of ToxT to the tcpA 13

promoter (24). Unsaturated fatty acids have also been shown to bind to CT and prevent 14

the binding of CT to GM1 receptor (5). 15

In bacteria, the product of the fadD gene is a long chain fatty acyl-CoA ligase that 16

is postulated to activate exogenous long chain fatty acids by acyl-CoA ligation (LCFA-17

CoA) concomitant with transport across the cytoplasmic membrane (3, 11, 44). In this 18

study we report that a V. cholerae fadD mutant exhibits a hypovirulent phenotype. 19

Expression of the major virulence genes of the ToxR regulon is repressed and membrane 20

localization of the master regulator TcpP is impaired in the fadD mutant strain. 21

22


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

5

MATERIALS AND METHODS 1

2

Bacterial strains, plasmids and culture conditions 3

The strains and plasmids used in this study are listed in Table 1. For optimum expression 4

of virulence factors, V. cholerae was grown in LB (pH 6.6) at 30°C referred to as 5

permissive condition (28). The suicide vectors pGP704 and pCVD442 (10, 28) were used 6

for construction of insertion and deletion mutants and were maintained in the E. coli 7

strains SM10λpir or DH5αλpir. Plasmids were introduced into V. cholerae strains by 8

triparental mating using E. coli MM294 (pRK2013) as a donor of mobilization factors. 9

To construct plasmid pfadD, a 1.9 kb fragment that includes the entire fadD gene 10

(VCO395_A1570) including 64 bp upstream of the putative start codon was PCR 11

amplified using primers fadD5 and fadD6 (Table 2) and the fragment was cloned in 12

plasmid pBR322. 13

Construction of deletion and insertion mutants 14

Plasmids for generating gene deletions in V. cholerae were constructed in pCVD442, 15

which carries the sacB gene for counter selection (10). Splicing-by-overlap-extension 16

(SOE) PCR (18) was used to generate a deletion/insertion mutation in the fadD gene. 17

Upstream and downstream gene fragments were PCR amplified by using primers fadD1 18

and fadD2 and primers fadD3 and fadD4, respectively, as listed in Table 2. Another 19

fragment carrying the chloramphenicol acetyl transferase gene (cat) was also amplified 20

using the primers cat1 and cat2. The three fragments were used to generate a 1.25 kb 21

PCR fragment in which the cat gene was inserted between the fadD upstream and 22

downstream regions. The resulting SOE PCR product was ligated into plasmid pCVD442 23

to obtain plasmid pSRfadD::cat. The plasmid was conjugally transferred into V. cholerae 24


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

6

O395. Deletion mutations arising due to double cross over events were selected on 1

sucrose (20%) and Cm (3µg/ml) containing plates. The gene deletion was confirmed by 2

PCR of genomic DNA with primers fadD1 and fadD4, flanking the deleted region. 3

To construct a V. cholerae fadR mutant, a 175 bp fragment spanning 26 bp to 4

200bp of the fadR ORF (VCO395_A1490) was PCR amplified using primers fadR1 and 5

fadR2, cloned in the suicide vector pGP704 (Apr), transferred to V. cholerae O395 (Sm

r) 6

and Smr Ap

r exconjugates were selected (28) in which the suicide plasmid had integrated 7

into the V. cholerae chromosome by a single crossover in the fadR gene region. The 8

insertion was confirmed using primers fadR3 and fadR4 spanning the fadR gene. 9

RNA isolation and RT-PCR 10

V. cholerae strains were grown under permissive conditions (LB, pH 6.6, 30°C) to 11

different growth phases and RNA was extracted and purified using guanidium 12

isothiocyanate (GITC). The RNA was treated with RNase free DNase 1 (1U/µg, 13

Amplification grade, Invitrogen) in the presence of an RNase inhibitor (RNasin, 14

Invitrogen). In some experiments, rifampicin (50µg/ml) was added to the cultures and 15

RNA was extracted at different times after addition of rifampicin. Semi-quantitative 16

reverse transcription-PCR (RT-PCR) was performed using one step RT-PCR kit 17

(Takara). Genomic DNA served as a positive control, and DNase-treated RNA that had 18

not been reverse transcribed was used as a negative control. Quantitative real time RT-19

PCR (qRT-PCR) was performed in triplicate for the genes of interest and 16SrRNA in a 20

one-step reaction using the SYBR Green One-Step qRT-PCR kit (Takara) and iCycler 21

IQ5 Real Time PCR Detection System (BioRad). A dissociation curve was generated at 22

the end of each cycle to verify that a single product was amplified using software 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

7

provided with the system. The relative levels of expression of the genes of interest were 1

calculated using the 2-∆∆CT

method described by Livak and Schmittgen (23), where CT is 2

the fractional threshold cycle. 16S rRNA was used as the endogenous control. Statistical 3

significance of the fold differences in expression levels of the genes of interest was 4

calculated using the 2-sample t-test. A minimum 2-fold difference and P-value of < 0.001 5

was considered significant unless otherwise stated. 6

GM1-ganglioside-dependent enzyme linked immunosorbent assay 7

CT was estimated in culture supernatants and sonicated cell pellets of V. cholerae grown 8

in LB (pH 6.6) at 30°C by GM1-ELISA. Polyclonal rabbit serum directed against 9

purified CT was used as primary antibody, anti-rabbit IgG conjugated with horseradish 10

peroxidase was used as the secondary antibody and O-phenylenediamine dihydrochloride 11

(OPD) was used as substrate for the color reaction. Dilutions of CT of known 12

concentrations (Sigma) were used to quantitate CT in the experimental samples. 13

Western blot analysis 14

Whole cell lysates and membrane fractions were prepared as described (8) and equal 15

amounts of proteins (50 µg) were separated by SDS-PAGE. All samples were loaded in 16

triplicate, parallel lanes were stained with Coomassie blue or transferred to PVDF 17

membranes in a Transblot apparatus (Bio-Rad). The blots were probed with anti- ToxR 18

or anti-TcpP serum (generous gifts from J. Zhu and J.S. Matson), followed by HRP 19

conjugated anti-rabbit IgG and developed with 3,3′ diamino benzidene (DAB) in the 20

presence of hydrogen peroxide. The Image J program (National Institute of Health, 21

Bethesda, MD) was used to measure the signal intensity of each band on scanned images 22

of the Western blots. 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

8

Swarm plate assay 1

V. cholerae cells were stabbed into semisolid LB agar plates (pH 6.6) containing 0.3% 2

agar (Difco). The plates were incubated at 30°C for 5 to 16 hrs, and swarm diameters 3

were measured at regular intervals. Experiments were performed in triplicate and the 4

mean swarm diameter of each strain was recorded. 5

LD50 assay 6

Fifty-percent lethal doses (LD50) were determined in 4 to 5-day-old suckling mice. The 7

mice were taken from their mothers at least 5 hours before infection. V. cholerae strains 8

were grown in LB medium (pH 6.6) at 30°C to the logarithmic phase and diluted as 9

required in saline with blue food coloring. 100 µl of three doses of inoculum were 10

delivered intragastrically to five infant mice per dose. Survival of the mice was 11

determined at 20 hours. LD50 representing the means of three independent experiments 12

was calculated. 13

14

15

16

17

18

19

20

21

22

23

24


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

9

RESULTS 1 2 3 Construction and functional analysis of V. cholerae fadD mutant 4 5

A fadD deletion/insertion mutant (∆fadD::cat) of the V. cholerae O395 strain was 6

constructed using the suicide vector pCVD442. The mutation was confirmed by PCR 7

with fadD flanking primers and also by examining phenotypic effects on growth in the 8

presence of exogenous fatty acids. In LB medium, the ∆fadD::cat mutant strain and the 9

parental strain O395 exhibited nearly identical growth patterns (Fig.1A). However, in M9 10

medium containing palmitic acid (5 mM) as the sole carbon and energy source, the 11

mutant strain grew poorly as compared to the wild type strain (Fig. 1B). The growth 12

defect of the mutant could be complemented by the plasmid pfadD carrying the cloned V. 13

cholerae fadD gene (Fig. 1B). Thus, in V. cholerae, FadD is necessary for growth in the 14

presence of fatty acids as the sole carbon and energy source, as has been reported for E. 15

coli (3) and Sinorhizobium meliloti (38). 16

CT production is reduced in the V. cholerae fadD mutant 17

To examine if FadD has any role in the virulence of V. cholerae, production of CT, the 18

major virulence factor, was examined in the ∆fadD::cat mutant at different stages of 19

growth and compared with the amount produced in the parental strain O395. Even under 20

conditions optimum for CT production (LB medium, pH 6.6, 30°C) little CT was 21

detected in the culture supernatants of both O395 and the isogenic ∆fadD::cat mutant 22

until the late-exponential phase of growth (Fig. 2). Thereafter, CT production rapidly 23

increased in strain O395 and reached a maximum of about 7.5 µg per 109 CFU by late 24

stationary phase. However, no more than 0.5 µg CT was detected in the fadD mutant 25

under identical conditions (Fig. 2). Thus, inactivation of FadD reduced CT production by 26


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

10

more than 95%. Complementation of the V. cholerae ∆fadD::cat mutant with plasmid 1

pfadD carrying the full length fadD gene restored CT to wild type levels (Fig. 2). 2

Transcriptional repression of ctxAB and tcpA genes in the V. cholerae fadD mutant 3

To examine if the decrease in CT production observed in the V. cholerae ∆fadD::cat 4

mutant was at the level of transcription, RNA was isolated from the parent and mutant 5

strains in the early (O.D600 0.3) and late (O.D600 0.7) exponential phases and the amounts 6

of ctxA specific mRNA in the two strains was estimated by RT-PCR (Fig. 3). Analysis of 7

the results obtained indicated that the amounts of ctxA mRNA in the wild type and 8

mutant strains was similar in the early logarithmic phase (Fig. 3A). However, in the late 9

exponential phase, a statistically significant (P= 0.001) difference was observed in the 10

amounts of ctxAB mRNA obtained from the wild type and fadD mutant strains. After 11

normalization according to the amounts of 16S rRNA present in each RNA population, 12

the amount of ctxA mRNA in V. cholerae O395 was about 7 (±2) folds higher than that in 13

strain ∆fadD::cat (Fig. 3B, C). 14

Since ctxAB gene expression is coordinately regulated with expression of the tcpA 15

gene (39), transcription of tcpA was examined in the V. cholerae ∆fadD mutant. 16

Practically no difference in tcpA expression was observed between V. cholerae O395 and 17

the ∆fadD mutant in the early exponential phase (Fig. 3A). However, in cultures grown to 18

an O.D600 0.7, the amount of tcpA specific transcript was about 5 (±2.3) fold lower in the 19

fadD mutant strain as compared to that in the parental strain O395 (Fig.3B, C). The 20

difference was statistically significant (P=0.001). Thus a mutation in the fadD gene 21

represses the expression of the two major virulence genes of the ToxR regulon, though 22

the repression was more pronounced for ctxAB. RT-PCR analysis indicated that both ctxA 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

11

and tcpA expression increased to wild type levels in strain ∆fadD::cat carrying plasmid 1

pfadD (Fig. 3) indicating that the repression of ctxAB and tcpA expression in the fadD 2

mutant was indeed due to disruption of the fadD coding sequence and was not due to an 3

unrecognized secondary mutation. 4

Expression of the regulatory gene toxT 5

Expression of the ctxAB and tcpA genes is coordinately regulated by the transcriptional 6

activator ToxT (9). Since both ctxAB and tcpA expression was reduced in the ∆fadD::cat 7

mutant, the effect of the fadD mutation on toxT expression was examined. Strains O395 8

and ∆fadD::cat were grown under permissive conditions (LB medium, pH 6.6, 300 C), 9

RNA was isolated at different stages of growth and the amounts of toxT specific 10

transcript were estimated by RT-PCR. In the wild type cells, toxT expression occurred at 11

high levels from the early (O.D.600 0.25) to the mid (O.D.600 0.65) logarithmic phase after 12

which toxT expression declined (Fig. 4). In the early logarithmic phase (up to O.D.600 13

0.25) practically no difference in toxT expression was detected between the strains O395 14

and ∆fadD::cat (Fig. 4A). Subsequently, however, toxT expression in the fadD mutant 15

strain gradually decreased and by the late logarithmic phase of growth, toxT expression in 16

∆fadD::cat strain was about 8 fold lower than in strain O395 (Fig. 4A). Introduction of 17

the full-length fadD gene in plasmid pfadD into the ∆fadD::cat mutant restored toxT 18

expression to wild type levels (Fig. 4B). 19

To determine if the reduction of toxT specific transcripts in the ∆fadD mutant was 20

due to decreased synthesis or increased degradation of the toxT mRNA, the O395 and 21

∆fadD::cat strains were grown to the exponential phase (O.D.600 0.6), treated with 22

rifampicin to stop transcription initiation, and RNA was extracted at short intervals 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

12

thereafter. The amounts of toxT transcript remaining at 2, 4, 6 and 8 min after rifampicin 1

addition were measured by qRT-PCR (Fig. 4C). At the time of addition of rifampicin (0 2

min, Fig 4C) the amount of toxT mRNA was about 6 fold lower in the fadD mutant than 3

in the parent strain. In both the strains, practically no decay of toxT mRNA was observed 4

until about 6 min of rifampicin exposure (Fig. 4C). After 8 min, about 30% of the amount 5

of transcript originally present could be detected in both strains, indicating that there was 6

practically no difference in the stability of toxT mRNA in the strains O395 and 7

∆fadD::cat. The 16S rRNA levels remained unchanged in both strains upto 8 min of 8

rifampicin exposure examined (data not shown). Thus, the lower toxT mRNA in the 9

∆fadD strain was due to reduced de novo synthesis and not accelerated degradation. 10

To examine if the reduced CT production in the V. cholerae fadD mutant was 11

indeed due to repression of toxT expression, plasmid pKEK162 containing the V. 12

cholerae toxT gene (Table 1) was introduced in the ∆fadD::cat strain as well as in the 13

wild type strain O395, and CT was examined in these cells under optimum conditions. 14

CT production was restored to wild type levels in the strain ∆fadD::Cm bearing plasmid 15

pKEK162 (data not shown). These results indicated that FadD does not directly affect 16

expression of ctxAB or tcpA but most likely acts upstream of ToxT. 17

TcpP and ToxR production is unaffected but TcpP membrane localization is 18

impaired in the fadD mutant 19

Expression of the toxT gene requires the transcriptional activators TcpP and ToxR which 20

act synergistically to promote expression from the toxT promoter (7, 27). Since toxT 21

expression was reduced in the V. cholerae fadD mutant in the mid- to late- exponential 22

phase of growth, expression of tcpP and toxR was examined in the strains O395 and 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

13

∆fadD::cat grown to the late exponential phase. No significant difference in expression of 1

tcpP and toxR was detected between the strains O395 and ∆fadD::cat (Fig. 5). Also, 2

expression of aphA and aphB that code for transcriptional activators of tcpP was similar 3

between strains O395 and ∆fadD::cat (Fig. 5). 4

To examine if overproduction of TcpP and ToxR could complement toxT expression in 5

the strain ∆fadD::cat, plasmids ptcpPH and pVM7 carrying the tcpPH and toxR genes 6

respectively (Table 1) were introduced in strains O395 and ∆fadD::cat and expression of 7

the virulence genes was examined. In strains O395/ptcpPH and ∆fadD::cat/ptcpPH, 8

expression of tcpP increased 19-fold and 14- fold respectively (Fig. 6), however, while 9

toxT expression increased 19 fold in O395/ptcpPH as compared to O395, only 5 fold 10

increase was observed in ∆fadD::cat/ptcpPH as compared to ∆fadD::cat. 11

Correspondingly, significantly higher ctxA expression was observed in O395/ptcpPH 12

than in ∆fadD::cat/ptcpPH. Thus over expression of TcpP in the ∆fadD mutant strain 13

could only partially complement the defect in toxT expression. Overproduction of ToxR 14

from plasmid pVM7 (Table 1) did not restore toxT expression in the strain ∆fadD::cat 15

(data not shown). 16

Next, Western blot analysis was performed to examine the levels of ToxR and 17

TcpP proteins in strains O395 and ∆fadD::cat. The results obtained indicated that there 18

were practically no differences in the levels of TcpP and ToxR proteins in whole cell 19

lysates of the two strains (Fig. 7A). TcpP and ToxR are transmembrane DNA binding 20

proteins with a cytoplasmic amino-terminus and a periplasmic carboxy-terminus 21

separated by a short transmembrane domain. The localization of TcpP and ToxR in the V. 22

cholerae fadD mutant was examined by preparing membrane fractions from strains O395 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

14

and ∆fadD::cat and subjecting them to Western blot analysis with anti-TcpP and anti-1

ToxR sera. Quantitation of the signals obtained in three independent experiments using 2

the Image J program (http://rsbweb.nih.gov/ij/) indicated that the amounts of ToxR 3

localized in the membrane fractions of strains O395 and ∆fadD::cat were similar, both in 4

the early (O.D. 0.3) and late (O.D. 0.7) logarithmic phases of growth (Fig. 7B, C). 5

However, although practically no difference was observed in the amounts of membrane 6

localized TcpP in the early logarithmic phase of the two strains, a significantly lower 7

amount of TcpP was detected in the membrane fraction of strain ∆fadD::cat than in strain 8

O395 in the late logarithmic phase (Fig. 7 B, C). Quantitation of the signals obtained in 9

three independent experiments indicate that on average 65% less TcpP was located in the 10

membrane fraction of strain ∆fadD::cat than O395 (Fig. 7C). Thus, although comparable 11

amounts of TcpP protein is produced in strains O395 and ∆fadD::cat, membrane 12

localization of TcpP is impaired in the fadD mutant in the mid to late logarithmic phase. 13

It has been reported earlier (2, 26) that under certain conditions, TcpP is 14

proteolytically processed to smaller peptides. No such peptides could be detected in the 15

Western blots with anti-TcpP sera in cell lysates or membrane fractions of ∆fadD::cat. 16

Furthermore, the steady state levels of TcpP in the strains O395 or ∆fadD::cat were 17

similar, since a single band of equal size and intensity was observed in the Western blots 18

of whole cell lysates of the two strains (Fig. 7A), hence, it is unlikely that TcpP is 19

degraded at an enhanced rate in the ∆fadD mutant. 20

21

22

23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

15

Effect of fatty acids on virulence gene expression in the fadD mutant 1

It has earlier been demonstrated that unsaturated long chain fatty acids when added 2

exogenously to V. cholerae cultures, strongly repressed expression of ctxAB and tcpA 3

genes (6). Since FadD is necessary for CoA ligation and transport of exogenous fatty 4

acids into the bacterial cytoplasm (44), the effect of fatty acids on the residual ctxAB 5

expression in the V. cholerae fadD mutant was examined. Little effect of linoleic acid 6

on ctxA expression in the ∆fadD::cat strain could be detected. However, it is possible that 7

ctxA expression in the ∆fadD::cat strain might be too low (Fig. 3) for the effect of linoleic 8

acid, if any, to be discernable. Expression of toxT from plasmid pKEK162 could increase 9

ctxA expression in the ∆fadD::cat strain to wild type levels, thus effect of linoleic acid on 10

ctxA expression in∆fadD::cat carrying plasmid pKEK162 was examined and compared to 11

that in the wild type strain. Although ctxA expression was reduced in both the strains, the 12

expression was 4 to 5 fold higher in ∆fadD::cat/pKEK162 than in the wild type strain 13

(Fig. 8 ). This result suggested that fatty acid transport into the cytoplasm of the 14

∆fadD::cat/pKEK162 strain might be reduced but not totally abolished. Since V. cholerae 15

O395 has a single annotated fadD gene, it is not clear how fatty acids might be 16

transported into the ∆fadD::cat/pKEK162 strain. One possibility is that exogenous fatty 17

acids might bind to the outer membrane receptor FadL and be transported to the 18

periplasmic space from where passive diffusion across the cytoplasmic membrane might 19

allow small amounts to enter the cytoplasm even in the absence of concomitant CoA 20

ligation in the ∆fadD mutant. Within the cytoplasm, the free fatty acids might bind to 21

ToxT and render it non-functional, indeed it has been reported that free fatty acids bind 22

efficiently to ToxT (24). 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

16

Effect of FadD on motility of V. cholerae 1

Virulence gene expression and motility are known to be oppositely regulated in 2

V.cholerae (12). Since the major virulence factors were reduced in the ∆fadD::cat strain, 3

motility of the strain was examined by swarm plate assays (Fig. 9). The swarm diameter 4

of ∆fadD::cat (11.6 ± 1mm) was about 2 fold greater than the parent strain O395 (5.66 ± 5

0.5 mm). The swarm diameter of strain ∆fadD::cat complemented with plasmid pfadD 6

was comparable to that of the wild type strain. 7

LD50 assay 8

Since in vitro experiments clearly indicated that production of the major virulence factors 9

is significantly reduced in the ∆fadD strain, the effect of fadD mutation in vivo was 10

examined using the infant mouse cholera model. Four-day-old mice were orally 11

inoculated with V. cholerae wild type O395 or ∆fadD::cat and observed after 20 hours. 12

LD50 of ∆fadD::cat (6.25 × 108

CFU) was about 225 times higher than that of strain O395 13

(2.7 × 106 CFU). 14

FadR has no effect on the virulence regulon of V. cholerae 15

The primary known function of FadD is the activation of long chain fatty acids by 16

ligation with CoA, the LCFA-CoA binds to and inactivates FadR, a transcriptional 17

regulator that controls expression of several genes and pathways involved in fatty acid 18

metabolism, stress response, glyoxalate pathway and other processes (11, 44). To 19

examine if the effect of fadD on the virulence of V. cholerae was mediated by FadR, a V. 20

cholerae O395 fadR mutant was constructed. As expected, expression of fabB, a fatty 21

acid biosynthetic gene known to be activated by FadR, was reduced in the O395 fadR 22

mutant while expression of fadB, a fatty acid degradation pathway gene known to be 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

17

FadR repressed, was induced in the fadR mutant strain (Fig. 10). However, no significant 1

difference in expression of the virulence gene ctxA (Fig. 10) or production of CT (data 2

not shown) was observed in the V. cholerae fadR mutant strain. Thus FadD affects the 3

virulence regulon of V. cholerae through a FadR independent pathway. 4

5

6

DISCUSSION 7

In this study we present evidence that a mutation in the fadD gene encoding a long chain 8

fatty acyl-CoA ligase, has profound effects on the expression of virulence genes, motility 9

and in vivo lethality of the human pathogen V. cholerae. In the V. cholerae fadD mutant, 10

expression of the major virulence genes ctxAB and tcpA was drastically repressed and a 11

significant reduction in the expression of toxT encoding the transcriptional activator of 12

ctxAB and tcpA, was observed (Fig. 3, 4). Expression of toxT from an inducible promoter 13

completely restored CT to wild type levels in the V. cholerae fadD mutant suggesting that 14

FadD probably acts upstream of toxT expression. Expression of toxT is activated by the 15

synergistic effect of two transcriptional regulators, TcpP and ToxR, members of the 16

OmpR family of transcription factors (16, 29). Unlike many OmpR family activators, 17

both ToxR and TcpP have a membrane localization domain and a cytoplasmic DNA 18

binding domain. The membrane localization of ToxR has been shown to be necessary for 19

the activation of toxT expression (8), however, the significance of the membrane 20

localization of TcpP is not yet known. In this study we demonstrate that ToxR production 21

and membrane localization are not altered in the V. cholerae fadD mutant (Fig. 7). 22

However although tcpP gene expression and TcpP protein production are unaffected in 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

18

the V. cholerae fadD mutant, membrane localization of TcpP is seriously impaired in the 1

mutant strain from the mid-logarithmic phase of growth (Fig. 5, 7). In the early 2

logarithmic phase however, no defect in membrane localization of TcpP was observed in 3

the fadD mutant (Fig. 7B). Interestingly, toxT expression in the mutant was comparable 4

to the parent strain in the early logarithmic phase, but from the mid logarithmic phase 5

onwards toxT expression was much lower in the fadD mutant strain (Fig. 4) concomitant 6

with reduced membrane localization of TcpP (Fig. 7C). These observations suggested a 7

direct correlation between the defect in membrane localization of TcpP and reduced toxT 8

expression in the fadD mutant strain. 9

What might be the reason for the defect in membrane localization of TcpP in the V. 10

cholerae fadD mutant. The mechanism of interaction of integral or loosely associated 11

membrane proteins with the membrane is not very clear, but there is enough evidence to 12

suggest that membrane localization of a protein or indeed the membrane proteome, is 13

influenced by the lipid composition of the membrane (36). It has long been known that 14

membrane lipid composition is altered in an E. coli fadD mutant (43). It would be 15

interesting to examine if there are differences in membrane lipids of V. cholerae O395 16

and ∆fadD::cat, whether the differences, if any, are growth phase specific and how they 17

might affect membrane localization of TcpP. It may be mentioned in this context that 18

when lipid composition in E. coli, B. subtilis, and S. pyrogenes was monitored as a 19

function of growth phase, differences between early, mid and late exponential phases 20

were detected (14, 32). 21

Although the results presented in this study, suggest that the defect in membrane 22

localization of TcpP might be responsible for the decrease in toxT expression in the V. 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

19

cholerae fadD mutant, other possibilities may also be considered. Even though no 1

exogenous fatty acids were added to the growth medium, endogenous fatty acids 2

produced by membrane turnover and fatty acid biosynthesis are thought to be converted 3

to acyl-CoA by FadD, these fatty acyl-CoA molecules might regulate the activity of some 4

transcription factor that directly or indirectly controls toxT expression. The most 5

important LCFA-CoA responsive transcription factor is FadR, which has been clearly 6

shown in this study not to have any role in virulence gene expression (Fig. 10). Another 7

fatty acid-responsive transcriptional regulator, FarR has been identified in E. coli (31). 8

However, no close homolog of E. coli FarR could be identified in the V. cholerae genome 9

sequence database. Still, the possibility that an as yet unknown LCFA-CoA responsive 10

transcription factor might modulate toxT expression cannot be ruled out at this stage. 11

It may be noted that a mutation in fadD affects the virulence of several bacterial 12

pathogens, including the plant pathogens S. meliloti (38) and Xanthomonas campestris 13

(1) and the enteric bacterium Salmonella enterica serovar Typhimurium (25). Notably, in 14

S. typhimurium, mutation in fadD represses the expression of hilA, whose product is 15

involved in activating the expression of invasion genes. Although the mechanism of hilA 16

repression by FadD has not yet been identified, it has been shown to be FadR 17

independent. hilA gene expression is controlled by many factors including several 18

membrane associated two component signal transduction systems (42). It would be 19

interesting to examine if membrane localization of these regulators is affected in the S. 20

typhimurium fadD mutant similar to the defect in membrane localization of TcpP in the 21

V. cholerae fadD mutant reported in this study. 22

23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

20

ACKNOWLEDGEMENTS 1

We thank all members of the Biophysics Division for cooperation, encouragement and 2

helpful discussions during the study. We are grateful to J.J. Mekalanos, Harvard Medical 3

School, Boston, Mass., K.E. Klose, University of Texas Health Science Center, San 4

Antonio, Texas, J.S. Matson, Department of Microbiology and Immunology, University 5

of Michigan Medical School, Ann Arbor, Michigan, J. Zhu, Department of Microbiology, 6

University of Pennsylvania School of Medicine, Philadelphia for generous gifts of 7

strains, plasmids and antisera. The work was supported by a research grant from 8

Council of Scientific and Industrial Research (CSIR), Government of India. EC is 9

grateful to University Grants Commission for a research fellowship. 10

11

12

13

14

15

16

17

18

19

20

21

22


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

21

REFERENCES 1

1. Barber, C. E., J. L. Tang, J. X. Feng, M. Q. Pan, T. J. G. Wilson, H. Slater et 2

al. 1997. A novel regulatory system required for pathogenicity of Xanthomonas 3

campestris is mediated by a small diffusible signal molecule. Mol. Microbiol. 24: 4

555–566. 5

2. Beck, N. A., E. S. Krukonis, and V. J. DiRita. 2004. TcpH influences virulence 6

gene expression in Vibrio cholerae by inhibiting degradation of the transcription 7

activator TcpP. J Bacteriol. 186: 8309-16 8

3. Black, P. N., C. C. DiRusso, A. K. Metzger, and T. L. Heimert. 1992. Cloning, 9

sequencing, and expression of the fadD gene of Escherichia coli encoding acyl 10

coenzyme A synthetase. J. Biol. Chem. 267: 25513–25520. 11

4. Chakrabarti, S., N. Sengupta, and R. Chowdhury. 1999. Role of DnaK in in 12

vitro and in vivo expression of virulence factors of Vibrio cholerae. Infect. 13

Immun. 67: 1025 – 1033. 14

5. Chatterjee, A., and R. Chowdhury. 2008. Bile and unsaturated fatty acids 15

inhibit the binding of cholera toxin and Escherichia coli heat-labile enterotoxin to 16

GM1 receptor. Antimicrob. Agents and Chemother. 52: 220-224. 17

6. Chatterjee, A., P. K. Dutta, and R. Chowdhury. 2007. Effect of fatty acids and 18

cholesterol present in bile on expression of virulence factors and motility of 19

Vibrio cholerae. Infect. Immun. 75: 1946-1953. 20

7. Childers, B. M., and K. E. Klose. 2007. Regulation of virulence in Vibrio 21

cholerae: the ToxR regulon. Future Microbiol. 2: 335-344. 22


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

22

8. Crawford, J. A., E. S Krukonis., V. J. DiRita. 2003. Membrane localization of 1

the ToxR winged-helix domain is required for TcpP-mediated virulence gene 2

activation in Vibrio cholerae. Mol. Microbiol. 47: 1459–1473. 3

9. DiRita, V. J., C. Parsot, G. Jander, and J. J. Mekalanos. 1991. Regulatory 4

cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci USA 88 : 5

5403-5407. 6

10. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletion 7

mutant of enteropathogenic Escherichia coli by using a positive-selection suicide 8

vector. Infect. Immun. 59: 4310–4317. 9

11. Fujita, Y., H. Matsuoka, and K. Hirooka. 2007. Regulation of fatty acid 10

metabolism in bacteria. Mol. Microbiol. 66: 829-839. 11

12. Gardel, C. L., and J. J. Mekalanos. 1996. Alterations in Vibrio cholerae 12

motility phenotypes correlate with changes in virulence factor expression. Infect. 13

Immun. 64: 2246-2255. 14

13. Ghosh, A., K. Paul, and R. Chowdhury. 2006. Role of H-NS in colonization, 15

motility and bile dependent repression of virulence gene expression in Vibrio 16

cholerae. Infect. Immun. 74: 3060-3064. 17

14. Gidden, J., J. Denson, R. Liyanage, D. M. Ivey, J. O. Lay. 2009. Lipid 18

compositions in Escherichia coli and Bacillus subtilis during growth as 19

determined by MALDI-TOF and TOF/TOF Mass Spectrometry. Int. J. Mass. 20

Spectrom. 283: 178-184. 21


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

23

15. Gupta, S., and R. Chowdhury. 1997. Bile affects production of virulence factors 1

and motility of Vibrio cholerae. Infect. Immun. 65: 1131 – 1134. 2

16. Hase, C. C, and J. J. Mekalanos. 1998. TcpP protein is a positive regulator of 3

virulence gene expression in Vibrio cholerae. Proc. Natl. Acad. Sci. 95: 730-734. 4

17. Herrington, D. A., R. H. Hall, G. Losonsky, J. J. Mekalanos, R. K. Taylor, 5

and M. M. Levine. 1988. Toxin, toxin co-regulated pili and the toxR regulon are 6

essential for Vibrio cholerae pathogenesis in humans. J. Exp. Med. 168: 1487-7

1492. 8

18. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. 9

Engineering hybrid genes without the use of restriction enzymes: gene splicing by 10

overlap extension. Gene 77: 61–68. 11

19. Kovacikova, G., and K. Skorupski. 1999. A Vibrio cholerae LysR homolog, 12

AphB, cooperates with AphA at the tcpPH promoter to activate expression of the 13

ToxR virulence cascade. J. Bacteriol. 181: 4250- 4256. 14

20. Kovacikova, G., and K. Skorupski. 2001. Overlapping binding sites for the 15

virulence gene regulators AphA, AphB and cAMP-CRP at the Vibrio cholerae 16

tcpPH promoter. Mol. Microbiol. 41: 393-407. 17

21. Krishnan, H. H., A. Ghosh, K. Paul, and R. Chowdhury. 2004. Effect of 18

anaerobiosis on expression of virulence factors in Vibrio cholerae. Infect. Immun. 19

72: 3961-3967. 20

22. Krokonis, E. S., and V. J. DiRita. 2003. From motility to virulence: Sensing and 21

responding to environmental signals in Vibrio cholerae. Curr. Opin. Microbiol. 6: 22

186-190. 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

24

23. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression 1

data using real-time quantitative PCR and the 2-∆∆CT

method. Methods 25: 402–2

408. 3

24. Lowden, M. J., K. Skorupski, M. Pellegrini, M. G. Chiorazzo, R. K. Taylor, 4

and F. J. Kull. 2010. Structure of Vibrio cholerae ToxT reveals a mechanism for 5

fatty acid regulation of virulence genes. Proc Natl Acad Sci USA 107: 2860-2865. 6

25. Lucas R. L., C. P. Lostroh, C. C. DiRusso, M. P. Spector, B. L. Wanner and 7

C. A. Lee. 2000. Multiple factors independently regulate hilA and invasion gene 8

expression in Salmonella enterica serovar typhimurium. J. Bacteriol. 182: 1872-9

1882. 10

26. Matson, J. S., and V. J. DiRita. 2005 Degradation of the membrane-localized 11

virulence activator TcpP by the YaeL protease in Vibrio cholerae. Proc Natl Acad 12

Sci U S A. 102: 16403-16408 13

27. Matson, J. S., J. H. Withey, and V. J. DiRita. 2007. Regulatory networks 14

controlling Vibrio cholerae virulence gene expression. Infect. Immun. 75: 5542-15

5549. 16

28. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in 17

the construction of insertion mutations: osmoregulation of outer membrane 18

proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 19

170: 2575-2583. 20

29. Miller, V. L., R. K. Taylor, and J. J. Mekalanos. 1987. Cholera toxin 21

transcriptional activator ToxR is a transmembrane DNA binding protein. Cell 48: 22

271-279. 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

25

30. Parsot, C., and J. J. Mekalanos. 1990. Expression of toxR, the transcriptional 1

activator of the virulence factors in Vibrio cholerae is modulated by the heat 2

shock response. Proc. Natl. Acad Sci. 87: 9898-9902. 3

31. Quail, M. A., C. E. Dempsey, and J. R. Guest. 1994. Identification of a fatty 4

acyl responsive regulator (FarR) in Escherichia coli. FEBS Lett. 356: 183-187 5

32. Rijn van de, I., and R. E. Kessler. 1979. Chemical analysis of changes in 6

membrane composition during growth of Streptococcus pyogenes. Infect. Immun. 7

26: 883-891. 8

33. Sack, D. A., R. B Sack, G. B. Nair, and A. K. Siddique. 2004. Cholera. Lancet 9

363: 223- 333. 10

34. Schuhmacher, D. A., and. K. K. Klose. 1999. Environmental signals modulate 11

ToxT dependent virulence factor expression in V. cholerae. J. Bacteriol. 181: 12

1508-1514. 13

35. Sengupta, N., K. Paul, and R. Chowdhury. 2003. The global regulator ArcA 14

modulates expression of virulence factors in Vibrio cholerae. Infect. Immun. 71: 15

5583-5589. 16

36. Sievers, S., C. M. Ernst, T. Geiger, M. Hecker, C. Wolz, D. Becher, A. 17

Peschel. 2010. Changing the phospholipid composition of Staphylococcus aureus 18

causes distinct changes in membrane proteome and membrane-sensory regulators. 19

Proteomics. 10: 1685-1693. 20

37. Skorupski, K., and R. K. Taylor. 1999. A new level in the Vibrio cholerae 21

virulence cascade: AphA is required for transcriptional activation of the tcpPH 22

operon. Mol. Microbiol. 31: 763- 771. 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

26

38. Soto, M.J., M. Fernández-Pascual, J. Sanjuan, and J. Olivares. 2002. A fadD 1

mutant of Sinorhizobium meliloti shows multicellular swarming migration and is 2

impaired in nodulation efficiency on alfalfa roots. Mol. Microbiol. 43: 371–382. 3

39. Taylor, R. K., V. L. Miller, D. B. Furlong, and J. J. Mekalanos. 1987. Use of 4

phoA gene fusions to identify a pilus colonization factor coordinately regulated 5

with cholera toxin. Proc. Natl. Acad. Sci. USA 84: 2833-2837. 6

40. Tischler, A. D., and A. Camilli. 2005 Cyclic diguanylate regulates Vibrio 7

cholerae virulence gene expression. Infect Immun. 73: 5873-5882. 8

41. Tischler, A. D., S. H. Lee, and A. Camilli. 2002. The Vibrio cholerae vieSAB 9

locus encodes a pathway contributing to cholera toxin production. J. Bacteriol. 10

184: 4104-13. 11

42. Valdez, Y., R. B. Ferreira, and B. B. Finlay. 2009. Molecular mechanisms of 12

Salmonella virulence and host resistance. Curr. Top. Microbiol. Immunol. .337: 13

93-127. 14

43. Weimar, J. D., C. C. DiRusso, R. Delio, P. N. Black. 2002. Functional role of 15

fatty acyl-coenzyme A synthetase in the transmembrane movement and activation 16

of exogenous long-chain fatty acids. Amino acid residues within the ATP/AMP 17

signature motif of Escherichia coli FadD are required for enzyme activity and 18

fatty acid transport. J. Biol. Chem. 277: 29369-76. 19

44. Zhang, H., P. Wang, and Q. Qi. 2006. Molecular effect of FadD on the 20

regulation and metabolism of fatty acid in Escherichia coli. FEMS Microbiol 21

Lett. 259: 249–253 22

23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

27

FIGURE LEGENDS 1

Fig. 1. Growth curves of V. cholerae O395 and ∆fadD::Cm. The strains were grown in 2

LB (A) or in M9 minimal medium containing 5mM palmitic acid (B) and CFU was 3

determined at different times. 4

5

Fig. 2. CT production in V. cholerae wild type and fadD mutant strains. The strains 6

O395, ∆fadD::cat and ∆fadD::cat containing plasmid pfadD, were grown in LB under 7

permissive conditions for CT production (pH 6.6, 300C) and at different times CT was 8

measured in culture supernatants corresponding to 109

CFU. Data presented are averages 9

of three independent experiments, and error bars represent standard deviation. 10

11

Fig. 3. Virulence gene expression in V. cholerae fadD mutant. RNA was isolated from V. 12

cholerae O395, ∆fadD::cat and ∆fadD::cat containing plasmid pfadD, grown in LB under 13

permissive conditions to an O.D600 of 0.3 (A) or 0.7 (B) for estimation of ctxAB, tcpA and 14

16SrRNA expression by qRT-PCR. C: Semi-quantitative RT-PCR was performed with 15

RNA from cultures grown to an O.D600 of 0.7. Expression of each gene was normalized 16

to that of 16S rRNA (C: lower panel). The ctxA or tcpA expression in strain O395 was 17

arbitrarily taken as 100. Results of three independent experiments are represented as 18

means ± S.D. P value < 0.001 was considered significant 19

20

Fig.4. Expression and stability of toxT mRNA. A. The strains O395 and ∆fadD::cat were 21

grown in LB under permissive conditions and at different times RNA was isolated for 22

estimation of toxT expression by qRT-PCR. 16S rRNA was taken as internal control. 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

28

toxT mRNA in strain O395 cultures in the early exponential phase (O.D600 0.25) was 1

arbitrarily taken as 100. 2

B. RNA was isolated from strains O395 (lane a), ∆fadD::cat (lane b) and ∆fadD::cat 3

/pfadD (lane c) grown to the late exponential phase (O.D600 0.7), for estimation of toxT 4

and 16SrRNA expression by semi quantitative RT-PCR. 5

C. Rifampicin was added to O395 and ∆fadD::cat cultures (O.D600 0.6) to inhibit 6

transcription initiation and aliquots were collected at different times. RNA was isolated 7

and toxT specific transcripts were estimated by qRT-PCR. toxT mRNA in strain O395 at 8

the time of addition of rifampicin (0 min) was arbitrarily taken as 100. 9

Results of three independent experiments are represented as means ± S.D. P value < 10

0.001 was considered significant. 11

12

Fig. 5. Expression of virulence regulatory genes. Expression of aphA, aphB, tcpP and 13

toxR, was examined in strains O395, ∆fadD::cat grown to mid exponential phase (O.D600 14

0.5). 16S rRNA expression was used as an internal control. Gene expression in strain 15

O395 was arbitrarily taken as 100. Data presented are averages of three independent 16

experiments, and error bars represent standard deviation. P value < 0.001 was considered 17

significant. 18

19

Fig. 6. Effect of tcpP over expression on virulence gene expression. Expression of tcpP, 20

toxT and ctxA was examined in strains O395, ∆fadD::cat, O395/ptcpPH and 21

∆fadD::cat/ptcpPH grown under permissive conditions. 16S rRNA expression was used 22

as an internal control. Gene expression in strain O395 was arbitrarily taken as 1. 23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

29

Fig. 7. Western blot analysis. Cell lysate and membrane proteins of strains O395 (lane 1

a) and ∆fadD::cat (lane b) were separated by SDS-PAGE and analyzed by Western 2

blotting with anti-ToxR (I) or anti-TcpP (II) sera (right). Coomassie blue staining of 3

parallel lanes is shown as a control for protein load (left). 4

A. Total cell lysates of strains grown to an O.D600 of 0.7. Membrane fractions of the 5

strains grown to an O.D600 of 0.2 (B) or O.D600. of 0.7 (C). 6

7

Fig. 8. Effect of fatty acid on ctxA expression. The strains O395 and 8

∆fadD::cat/pKEK162 were grown under permissive conditions in LB without or with 9

linoleic acid (0.015%) to the late logarithmic phase and ctxAB expression was estimated 10

in the strains by qRT-PCR. The fold change in ctxA expression in each strain grown 11

without and with linoleic acid is indicated. 12

13

Fig. 9. Swarming of V. cholerae strains O395, ∆fadD::cat and ∆fadD::cat /pfadD on 14

motility plates. 15

16

Fig. 10. Expression of fabB, fadB and ctxA genes in the V. cholerae fadR mutant. RT-17

PCR analysis was performed to estimate expression of the genes and 16SrRNA in V. 18

cholerae O395 (lane a) and fadR mutant (lane b). 19

20

21

22

23


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

30

TABLE 1. Bacterial strains and plasmids 1

2

Strains/ Plasmids Relevant characteristics Reference/ Source 3

4

V. cholerae strains 5

6

O395 O1, classical; wild type, Smr Laboratory collection 7

8

O395∆fadD::cat Derivative of O395; Smr Cm

r This study 9

10

O395 fadR O395fadR::pGP704; Smr Ap

r This study 11

12

E. coli strains 13

14

DH5α λpir F−(lacZYA-argF)U169 recA1 endA1 J. J. Mekalanos 15

hsdR17 supE44 thi-1 gyrA96 relA1λ::pir 16

17

SM10λpir thi recA thr leu tonA lacY supE J. J. Mekalanos 18

RP4-2-Tc::Mu λ::pir 19

20

Plasmids 21

22

pCVD442 oriR6K mobRP4 sacB, Apr 10 23

24

pGP704 oriR6K mobRP4, Apr 28 25

26

pKEK162 pUC118 carrying toxT gene 34, K. E. Klose 27

28

pVM7 pBR327carrying toxR gene 28, J.J. Mekalanos 29

30

ptcpPH pACYC184 carrying V. cholerae tcpPH Laboratory collection 31

32

pSRfadD::cat pCVD442 carrying fadD::cat This study 33

34

pfadD pBR322 carrying V. cholerae fadD gene This study 35

36

37

38

39

40

41

42

43

44

45

46


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

31

Table 2: Primers used in this study 1

2 Primers for

cloning/ mutant

construction

Sequence

fadD 1 (F)

fadD 2 (R)

fadD 3 (F)

fadD 4 (R)

fadD 5 (F)

fadD 6 (R)

fadR 1 (F)

fadR 2 (R)

fadR 3 (F)

fadR 4 (R)

cat 1 (F)

cat 2 (R)

5´ GATAAACCTTGGCTTTCACG 3´

5´ ATCCACTTTTCAATCTATATCAAGTTCGGCATCATCAGA 3´

5´ CCCAGTTTGTCGCACTGATAAGATTCTGGTTTCAGGCTTTA 3´

5´ AACTGTGCGTCATTTTCTTC 3´

5´ TCGTTGTAGATCGCCTACTT 3´

5´ TTGCATGACTACTGCATGAT 3´

5´ CCGGTTTCGCTGAGAAGTAT 3´

5´ TTACCGTGTTGAATCGTGAG 3´

5´ TGTGAGCTGTGTCCA 3´

5´ TGGCTTTGATTGGTC 3´

5´ ATCCACTTTTCAATCTATATC 3´

5´ CCCAGTTTGTCGCACTGATAA 3´

Primers for RT-

PCR

Sequence

ctxA 1 (F)

ctxA 2 (R)

tcpA 1 (F)

tcpA 2 (R)

toxT 1 (F)

toxT 2 (R)

tcpP 1 (F)

tcpP 2 (R)

toxR 1 (F)

toxR 2 (R)

aphA 1(F)

aphA 2(R)

aphB 1(F)

aphB 2(R)

16SrRNA 1 (F)

16SrRNA 2 (R)

fabB 1(F)

fabB 2(R)

fadB 1(F)

fadB 2(R)

5´ CTCAGACGGGATTTGTTAGGCACG 3´

5´ TCTATCTCTGTAGCCCCTATTACG 3´

5´ GTGGTTTCGGCGGGGGTTGT 3´

5´ AGCGGGAGCGATGATTTGA 3´

5´ CAGCGATTTTCTTTGACTTC 3´

5´ CTCTGAAACCATTTACCACTTC 3´

5´ CCAATGAAGCCAGAAAGG 3´

5´ CACAGGTAGCAAAGCAAC 3´

5´ TTAACCCAAGCCATTTCGAC 3´

5´ GATGAAGGCACACTGCTTG 3´

5´ ATCTCAGTGGGGGTTATCA 3´

5´ TGGATGAAAGTGGACAAAA 3´

5´ GATTGCTCTCCCCTGCTG 3´

5´ GTTTCACCTTGGCTGTTGG 3´

5´ CGATGTCTACTTGGAGGTTG 3´

5´ GCTGGCAAACAAAGGATAAGG 3´

5´ ACTATCCACCAAATACAACGA 3´

5´ ACCCAGTTCTTTCACATCAG 3´

5´ TGGAAAATCCGAAAGTAAAA 3´

5´ GGTGTCTTCTGAGGTGTGTT 3´

3

4


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

downloaded from //iai.asm.org/content/iai/early/2010/11/01/iai.00663-10.full.pdf7 1 provided with...

Documents