downloaded from //cvi.asm.org/content/cdli/early/2012/06/14/cvi.00250-12... · 102 4619 (rd142);...
TRANSCRIPT
1
Beijing sublineages of Mycobacterium tuberculosis differ in pathogenicity in the 1
guinea pig. 2
3
Running title: East Asian sublineage MTB and pathogenicity 4
5
Midori Kato-Maeda, a# Crystal A Shanley,b David Ackart,b Leah G Jarlsberg,a 6
Shaobin Shang,b Andres Obregon-Henao,b Marisabel Harton,b Randall J 7
Basaraba,b Marcela Henao-Tamayo,b Joyce C. Barrozo,a Jordan Rose,a L Masae 8
Kawamura,c Mireia Coscolla,d,e Viacheslav Y. Fofanov,f Heather Koshinsky,f 9
Sebastien Gagneux,d,e Philip C Hopewell,a Diane J Ordway,b and Ian M Ormeb 10
11
Curry International Tuberculosis Center, Division of Pulmonary and Critical Care 12
Medicine, University of California, San Francisco, San Francisco CA 94110, USAa 13
Department of Microbiology, Immunology and Pathology, Colorado State University, 14
Fort Collins CO 80523, USAb 15
San Francisco Tuberculosis Clinic, San Francisco Department of Public Health, San 16
Francisco CA 94110, USAc 17
Swiss Tropical & Public Health Institute, 4002 Basel, Switzerlandd 18
University of Basel, 4002 Basel, Switzerlande 19
Eureka Genomics, Hercules CA 94547, USAf 20
21
Present address: LMK: Cepheid, Sunnyvale CA 94089, USA. 22
#Corresponding author: [email protected] 23
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Clin. Vaccine Immunol. doi:10.1128/CVI.00250-12 CVI Accepts, published online ahead of print on 20 June 2012
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
2
Abstract 24
The Beijing family of Mycobacterium tuberculosis strains is part of Lineage 2 (also 25
known as East Asian lineage). In clinical studies we have observed that isolates from 26
the sublineage RD207 of Lineage 2 were more readily transmitted among humans. To 27
investigate the basis for this difference, we tested representative strains with the 28
characteristic Beijing spoligotype from four of the five sublineages of Lineage 2 in the 29
guinea pig model and subjected these strains to comparative whole genome 30
sequencing. The results of these studies showed that all of the clinical strains were 31
capable of growing and causing lung pathology in guinea pigs after low dose aerosol 32
exposure. Differences between the ability of the four sublineages to grow in the lungs of 33
these animals were not overt, but members of RD207 were significantly more 34
pathogenic, resulting in severe lung damage. The RD207 strains also induced much 35
higher levels of markers associated with regulatory T cells, and showed a significant 36
loss of activated T cells in the lungs over the course of the infections. Whole genome 37
sequencing of the strains revealed mutations specific for RD207 which may explain this 38
difference. Based on these data, we hypothesize that the sublineages of M. tuberculosis 39
are associated with distinct pathological and clinical phenotypes, and that these 40
differences influence the transmissibility of particular M. tuberculosis strains in human 41
populations. 42
43
44
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
3
Introduction. 45
The emergence and spread of apparently new strains of Mycobacterium tuberculosis, 46
including multiple and extensively drug resistant (M/XDR) strains has raised 47
considerable concern (43). Of particular concern is the Beijing family of strains, a family 48
that is thought to have enhanced pathogenicity, a predilection for drug resistance (15, 49
47), and a less effective response to BCG-based vaccines (32, 35). 50
51
The Beijing family belongs to Lineage 2 (also known as the East Asian lineage) 52
of M. tuberculosis. This lineage is defined by the region of difference (RD)105, is 53
monophyletic, and is divided into five sublineages based on their specific RDs: RD105, 54
RD207, RD181, RD150, and RD142 (48). Strains from four of the five sublineages 55
(RD207, RD181, RD150, and RD142) have the characteristic spoligotype that defines 56
the Beijing family (21). In a recent population-based study in San Francisco, we 57
demonstrated that different sublineages of Lineage 2 differed in the number of 58
secondary cases of tuberculosis they caused (19). Based on this observation we 59
hypothesized that there are differences in the pathogenicity of these sublineages. To 60
investigate this hypothesis, we used an animal model to examine the pathogenicity of 61
four sublineages among Lineage 2. We examined the capacity of a representative 62
panel of clinical isolates to cause infection and grow in the guinea pig model (31) after 63
low dose aerosol exposure. The primary question posed was whether our model could 64
demonstrate increased pathogenicity of RD207, the sublineage that was associated 65
with more secondary cases than the other three sublineages in San Francisco. In 66
addition, we performed analysis of whole genome sequence data to explore the 67
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
4
possible mechanisms that could explain the different epidemiological and pathological 68
characteristics of the different sublineages. We also repeated the epidemiological 69
analysis with a larger sample size to confirm the relationship between the sublineages 70
and their ability to cause secondary cases in San Francisco. 71
72
MATERIALS AND METHODS 73
74
Study Population. We have been conducting a population-based study of the 75
molecular epidemiology of tuberculosis in San Francisco since 1991 (9). For the current 76
study we used M. tuberculosis identified as belonging to the Lineage 2 isolated from 77
incident cases of tuberculosis between January 1991 and December 2008. The 78
protocols and procedures for the protection of human participants were approved by the 79
University of California, San Francisco. 80
81
Genotyping. For the molecular epidemiological assessment, we used insertion 82
sequence (IS)6110 restriction fragment length polymorphism (RFLP) to determine the 83
genotype of clinical isolates of M. tuberculosis. Strains with the same IS6110 genotype 84
(identical number and molecular weight of the IS6110 bands) were defined as clustered 85
(51). Patients within the cluster were considered to have an epidemiologic link and, 86
thus, to be part of a chain of transmission. The initial case identified was considered to 87
be the index case and subsequent cases were considered secondary cases. Cases 88
having isolates with no matching RFLPs (unique cases) were considered a result of 89
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
5
reactivation of latent infection. The methods for determination of lineage and sublineage 90
have been described previously (16, 49). 91
92
Animal model. Female outbred Hartley guinea pigs (~500 g in weight) were purchased 93
from the Charles River Laboratories (North Wilmington, MA, USA) and held under 94
barrier conditions in a Biosafety Level III animal laboratory. The specific pathogen-free 95
nature of the guinea pig colonies was demonstrated by testing sentinel animals. All 96
experimental protocols were approved by the Animal Care and Usage Committee of 97
Colorado State University and comply with NIH guidelines. 98
99
Experimental infections. Ten strains representing the four sublineages with the Beijing 100
spoligotype were used in this study (Table 1). These consisted of strains 4233, 4588, 101
4619 (RD142); 3376, 3446 (RD150); 3393, 3507, 4147 (RD181); and 4334, 5097 102
(RD207). 103
104
All strains were grown in 7H9 broth containing 0.05% Tween-80. Thawed 105
aliquots of frozen cultures were diluted in sterile water to the desired inoculum 106
concentrations. A Madison chamber aerosol generation device was used to expose the 107
animals to M. tuberculosis. This device was calibrated to deliver approximately 20 bacilli 108
into the lungs. Lung bacterial counts on days 30 and 60 were determined by plating 109
serial dilutions of tissue homogenates on nutrient 7H11 agar and counting colony-110
forming units after 3 weeks incubation at 37°C. The infection inoculum and day 1 lung 111
bacterial counts were determined for all the bacterial strains tested by plating serial 112
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
6
dilutions of inoculum or tissue homogenates on nutrient 7H11 agar and counting colony-113
forming units after 3 weeks incubation at 37°C. No significant differences in terms of 114
the infection dose or the day 1 bacterial uptake values were seen among any of the 115
strains tested. 116
117
Histological analysis. Same lung lobes from each guinea pig were fixed with 4% 118
paraformaldehyde in phosphate buffered saline. Paraffin embedded sections from these 119
tissues were stained using haematoxylin and eosin and examined microscopically. The 120
concurrent progression of lung and lymph node lesions was evaluated using a 121
histological grading system (37). 122
123
Organ digestion. To prepare single cell suspensions, the same lungs, lymph nodes, 124
and spleens were perfused with 20 ml of a solution containing PBS and heparin (50 125
U/ml; Sigma-Aldrich, St. Louis, MO) through the pulmonary artery. The caudal lobe was 126
aseptically removed from the pulmonary cavity, placed in media and dissected. The 127
dissected lung tissue was incubated with complete DMEM (cDMEM media) containing 128
collagenase XI (0.7 mg/ml; Sigma-Aldrich) and type IV bovine pancreatic DNase (30 129
ug/ml; Sigma-Aldrich) for 30 minutes at 37°C. The digested lungs were further disrupted 130
by gently pushing the tissue twice through a cell strainer (BD Biosciences, Lincoln Park, 131
NJ). Red blood cells were lysed with ACK buffer, washed and resuspended in cDMEM. 132
Total cell numbers were determined by flow cytometry using BD™ Liquid Counting 133
Beads, as described by the manufacturer (BD PharMingen, San Jose, CA USA 95131). 134
135
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
7
Flow cytometric analysis of cell surface markers. Single cell suspensions from each 136
individual guinea pig were incubated first with antibodies as previously described (30, 137
31) to CD4, CD8, pan T cell, CD45, MIL4, B cell, macrophage and class II antibodies at 138
4°C for 30 minutes in the dark after washing the cells with PBS containing 0.1% sodium 139
azide (Sigma-Aldrich). The anti-guinea pig macrophage MR-1 antibody is an 140
intracytoplasmic antigen and therefore cell membranes were permeabilized using 141
Leucoperm (Serotec Inc, Raleigh, NC) according to the manufacturer’s instructions prior 142
to intracellular staining. Data acquisition and analysis were done using a FACSCalibur 143
flow cytometer (BD Biosciences, Mountain View, CA) and CellQuest software (BD 144
Biosciences, San Jose, CA). Compensation of the spectral overlap for each 145
fluorochrome was done using CD4 or MIL4 or CD3 antigens from cells gated in the 146
FSClow versus SSClow; FSCmid/high versus SSCmid/high; SSClow versus MIL4pos/neg SSChigh 147
versus MIL4neg and SSChigh versus MIL4pos region respectively. Analyses were 148
performed with an acquisition of at least 100,000 total events. 149
150
RT-PCR analysis. Expression of mRNA encoding the cytokines IFNγ, IL-12p40, TNFα, 151
TGFβ, IL-17 and the regulatory T cell associated intracellular marker Foxp3, was 152
quantified using real-time reverse transcription-polymerase chain reactions (RT-PCR). 153
The same lobe from each guinea pig (n=5) lung was added to 1 ml of TRIzol RNA 154
reagent (Invitrogen), homogenized, and frozen immediately, and total RNA was 155
extracted according to the manufacturer’s protocol. RNA samples from each group and 156
each time point were reverse transcribed using the Reverse Transcriptase Enzyme (M-157
MLV RT- Invitrogene). Four µl samples of cDNA were then amplified using the iQ SYBR 158
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
8
Green Supermix (Bio-Rad) following the manufacturer's protocol on the iQ5 iCycler 159
amplification detection system (Bio-Rad). A negative control using ultrapure Molecular 160
Biology water as the template and a non-template control (NTC) were run to confirm 161
that the signals were derived from RNA and not due to contaminating genomic DNA. In 162
order to ensure that only the correct gene was amplified, and not primer-dimer or non-163
specific secondary products, a Melt Curve was performed for each run. Fold induction of 164
mRNA was determined by analyzing cycle threshold (CT) values normalized for HPRT 165
(CT) expression. The primer sequences for guinea pig IFNγ, IL-12p40, TNFα, TGFβ1 166
and 18S were previously published (3, 26). The primer sequences for guinea pig Foxp3 167
were determined with assistance from Dr. Anand Damodaran (Genotypic Technology, 168
Bangalore, India): forward: 5’ AGAAAGCACCCTTTCAAGCA 3’; reverse: 5’ 169
GAGGAAGTCCTCTGGCTCCT 3’, and forward: 5’ TTCTTCCAAACACAGGATCAGC 170
3’; reverse: 5’ TCATTTCCGATAGGGCTTGG 3’. Primer sequences used for IL-17 were 171
forward: 5’ CTCTGCAGGACCATCTC 3’; reverse: 5’ TTACTCGGGCTGTGTCAATG 3’, 172
and forward: 5’ AGTCGTGTGTGATGGGAGTG 3’; reverse: 5’ 173
TCAAGTTCCTGCTGCTGTTG 3’. 174
175
Whole genome sequencing. Illumina technology was used to sequence the whole 176
genome of the ten M. tuberculosis strains. Briefly, DNA was fragmented, end repaired, 177
A’ tagged, ligated to adaptors, size-selected, and enriched with 18 PCR cycles. 178
Between 305 and 542 Mb of paired end 51 cycle sequence data was generated on each 179
library. 180
181
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
9
Mapping and single nucleotide polymorphism (SNP) calling. BWA was used to map 182
the reads from the 10 strains against the M. tuberculosis complex reference genome 183
which is a reconstructed ancestor that is H37Rv-like in its structure, but H37Rv alleles 184
were substituted by those present in the inferred common ancestor of all M. tuberculosis 185
complex lineages (12). BWA outputs were analyzed using the SAM tools software (23, 186
24). We applied heuristic filters to remove problematic positions and a threshold the 187
probability of difference from the reference base. We set 200 as the maximum read 188
depth to call a SNP and Phred-scaled probability was set as 20. SNP lists for individual 189
strains were combined in a single nonredundant data set, and the corresponding base 190
call was recovered for each strain. We excluded SNPs in PE/PPE genes, genes 191
described as integrase, transposase or phage and SNPs for which at least one strain 192
showed an ambiguous SNPs call. Mega 4 (46) was used to reconstruct a neighbor-193
joining phylogeny, using the number of differences for the 10 Lineage 2 strains 194
sequenced for this study, 23 sequences from different M. tuberculosis complex lineages 195
previously published (11) and the sequence of a M. tuberculosis strain from the RD105 196
sublineage from our collection of strains. SNPs were mapped to the tree using Mesquite 197
(25) and specific sublineage SNPs were identified. 198
199
Prediction of the functional effect of the nsSNPs (nonsynonymous SNPs). Sorting 200
Intolerant From Tolerant (SIFT) algorithm (28) was used to predict the mutations most 201
likely to affect protein function. SIFT searches for homologs of the gene of interest in 202
other bacteria and 1) scores the conservation of the positions where mutations are 203
found, and 2) weights this score by the nature of the amino acid change. These 204
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
10
measures were then used as a proxy for the impact of a specific mutation on protein 205
function. Mutated positions with normalized probabilities less than 0.05 were predicted 206
to have an impact on the protein and those greater than or equal to 0.05 were predicted 207
to have no impact (28). We used the non-redundant protein sequence database 208
downloaded from NCBI on June 6th, 2012. This database combines entries from 209
GenPept, Swissprot, PIR, PDF, PDB, and NCBI RefSeq. Only nsSNPs for monophyletic 210
groups (observed in all its descendants) were included in the analysis. 211
212
Statistical analysis. To determine the association between the sublineages and 213
secondary cases, univariate analyses were performed using the χ2 test of proportions 214
and the 2-tailed Fisher's exact test. Univariate and multivariate odds ratios (ORs) were 215
calculated using logistic regression with secondary case status as the dependent 216
variable. The independent variable of primary interest was the specific Lineage 2 217
sublineage, and the analysis was controlled for place of birth (United States-born vs. 218
foreign-born), smear positivity and cavitary disease. Statistical analyses were performed 219
with SAS version 9.2 (SAS Institute Inc., Cary, NC, USA). The guinea pig data are 220
representatives of one experiment. Each experiment consisted of 5 guinea pigs infected 221
with one of the M. tuberculosis strains for each of the time points 0, 30, and 60 (total of 222
15 guinea pigs per strain). Mean values were calculated from results for individual 223
guinea pigs within each group (n=5) standard error of the mean (SEM). Student t-test 224
was used to compare the statistical differences in numbers of bacilli, flow cytometric 225
data and RT-PCR values between different groups. 226
227
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
11
228
229
230
RESULTS 231
232
Relationship between sublineages and the ability to cause secondary cases. From 233
January 1991 to December 2008, 3847 cases of tuberculosis were reported in San 234
Francisco, of whom 3311 (86%) had a positive culture for M. tuberculosis. RFLPs and 235
lineage data were available for 2361 (71%) of all culture-positive cases. There were 648 236
(27%) patients with M. tuberculosis from Lineage 2 and 593 (92%) had sublineage data. 237
We excluded 7 index cases with solely extrapulmonary disease, as their likelihood of 238
transmitting M. tuberculosis is low, and assigned index case status to the next 239
pulmonary case in sequence. The clinical characteristics were similar among patients 240
with and those without sublineage data. Based on RFLP genotyping, there were 114 241
secondary cases associated with 65 index cases and 407 cases with unique isolates. 242
Univariate analysis demonstrated that patients born in the United States were more 243
likely to be secondary cases (OR 6.61, 95% CI 3.88–11.2, P < 0.001) as well as 244
patients with isolates from sublineage RD207 when compared with the other 245
sublineages (OR 2.04, 95% CI 1.02–4.08 P = 0.04; Table 2). The multivariate analysis 246
was based on 92 clustered cases (of 114) in 481 observations (sputum smear status 247
was not available in several cases). It showed that the only independently significant 248
risk factor for being a secondary case was being born in the United States (OR 5.22, 249
95% CI 2.89–9.42, P < 0.001) . The adjusted odds of sublineage RD207 being a 250
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
12
secondary case were 1.98 (95% CI 0.91–4.29, P = 0.08, Table 2), which is higher than 251
we previously published (19) and supports the previous observation that in San 252
Francisco sublineage RD207 may be more likely to be transmitted than other 253
sublineages. 254
255
Capacity of clinical isolates to grow after low dose aerosol exposure. The course 256
of infection in the lungs of guinea pigs harboring each isolate is shown in Figure 1. All 257
ten strains grew progressively for the first 30 days, with the members of the RD142, 258
RD150, and RD207 sublineages growing well, with more modest growth seen for the 259
three RD181 isolates. 260
261
All ten infections caused moderate to severe pathology in the lungs over the 262
course of the infection (Fig. 2 and 3). In all cases the infections induced extensive mixed 263
inflammation and necrosis, but this was particularly pronounced in the case of the two 264
RD207 sublineage strains 4334 and 5097 infections (Fig. 3G-J) which established 265
multiple large highly necrotic lesions in the lungs by day 30, resulting in marked 266
consolidation by day 60. Milder degrees of pathology at day 30 were seen in the other 267
groups, particularly RD150 and RD181. By day 60, lesions in all the animals infected 268
with the clinical isolates showed severe increases in secondary lesion progression, 269
characterized by multiple foci of extensive inflammation coalescing within the pulmonary 270
parenchyma (Fig. 2 and 3) whereas lung involvement in the cases of the two RD207 271
sublineage strains was especially severe (Fig. 3G-J). These progressive changes in 272
tissue lesions were further reflected by lesion score analysis, revealing that RD207 273
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
13
sublineage strains showed statistically significantly more extensive damage in the lungs 274
compared to all the other sublineages over the course of the infections (Fig. 4A-B). 275
276
Immune responses to the clinical isolates. We tracked the expression of the TH1 277
cytokines IFN , IL-12p40 and TNF (Fig. 5) and compared this information based on 278
the closer phylogenetic relationship between the respective two strains to levels of pro-279
inflammatory IL-17, and Foxp3 and TGFβ (Fig. 6), markers associated with down-280
regulation of immunity. All ten strains generated appreciable levels of the cytokines 281
IFN , IL-12p40 and TNF , indicating generation of a TH1 response (Fig. 5A-C). 282
Whereas strong signals were observed for IFN (Fig. 5A), these waned significantly by 283
day 60 in animals infected with the RD150 and RD207 strains. 284
285
We also examined the induction of regulatory molecules, given our earlier 286
observations (32, 44) that this seems to be a common property of many of the Beijing 287
strains. As the infections progressed increases in message for Foxp3 were seen in all 288
strains (Fig. 6A), most significantly for the two RD207 strains, suggesting the arrival in 289
the lungs of regulatory T cells. In addition, a very large increase in TGFβ expression 290
(Fig. 6B) in animals infected with the two RD207 strains was observed during this time. 291
Finally, increased expression of IL-17 message was observed (Fig 6C), again very 292
prominently in response to the two RD207 and RD150 strains. This observation is 293
consistent with the high levels of lung consolidation seen, presumably driven by IL-17 294
mediated local chemokine release. 295
296
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
14
We used flow cytometric protocols (31) to further define the cellular response in 297
the guinea pig lungs. As shown in Figure 7A, we observed substantially increased 298
numbers of activated CD4+ CD45hi T cells in the lungs of guinea pigs infected with the 299
RD207 and RD142 sublineage strains on day 30 after infection. However, as the 300
infection progressed the numbers of these cells dropped precipitously by day 60 (Fig. 301
7B). 302
303
Whole genome sequence analysis. Analysis of the 10 whole-genome sequences 304
identified a total of 1534 SNPs specific for Lineage 2. We inferred 51 nsSNPs specific 305
for the RD207 sublineage, 24 for the RD142 sublineage, and 28 for the RD150 306
sublineage. There were no mutations exclusive for the RD181 sublineage as all the 307
mutations observed in RD181 were also present in RD150 and RD142 strains. The 308
number of nsSNPs that were considered to have an impact on the gene function based 309
on the SIFT analysis, were 18, 13 and 16, respectively. The list of the genes affected 310
and their SIFT value are shown in Table 3. 311
312
DISCUSSION 313
All the strains representing four sublineages of the Lineage 2 of M. tuberculosis with the 314
Beijing spoligotype were capable of growing and causing lung pathology in guinea pigs 315
exposed to low dose aerosol infection. The ability of mycobacteria to grow in the lungs 316
over time is the most conventional measure of strain virulence. While differences 317
between the four sublineages were not overt, members of the RD207 sublineage, 318
consisting of strains more likely to cause secondary clinical cases, caused more severe 319
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
15
pathology in these animals compared to members of the RD142 or RD181 sublineages, 320
with the fourth sublineage, RD150, showing an intermediate pattern. All strains tested 321
were capable of inducing TH1 immunity. In comparison with the RD207 sublineage the 322
RD142 strains showing the highest IFN responses which were associated with mild 323
inflammation and reduced regulatory Foxp3+ expression. This finding suggests that the 324
RD142 strains are more immunogenic, and is consistent with the ability of the guinea 325
pigs to control and contain these particular strains more quickly. In addition, all strains 326
induced some degree of regulatory host molecules [Foxp3, TGF , and IL-17] which 327
seems to be a general property of the Beijing strains analyzed in animal studies to date 328
(32, 44). Members of the RD207 sublineage gave the highest signals. 329
330
Animals infected with the RD207 sublineage showed both a significant drop in 331
activated CD4+ CD45hi T cells in the lungs as the infections progressed, and a 332
concomitant large rise in markers associated with regulatory T cell influx into the lungs. 333
Together, these data indicate that different sublineages of Lineage 2 do not behave in a 334
comparable manner in the animal model, but instead have some observable differences 335
in their degree of immunopathology and capacity to generate protective and/or 336
regulatory immunity. Hence, this supports the hypothesis, albeit made cautiously, that 337
the sublineage of Lineage 2 may be associated with distinct clinical and pathological 338
properties, and that these properties may influence the transmission capacity of isolates 339
within patient communities. 340
341
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
16
To explore the possible mechanisms for differences observed across 342
sublineages, we analyzed the whole genome sequence of the strains included in this 343
study. Each of the sublineages had specific mutations that based on their SIFT values 344
suggested an impact on gene function. The strains from sublineage RD207 had a 345
mutation in Rv0989c (grcC2) a diphosphate synthase required for cell wall biosynthesis 346
(27). These strains had also a mutation in the gene Rv2959c, a methyltransferase 347
involved in the biosynthesis of phenolglycolipid, which is considered a virulence factor 348
(39). It is tantalizing to speculate that a mutation in this gene may render the bacteria 349
more virulent as observed in the epidemiologic analysis (more secondary cases) and in 350
the animal model (more necrosis and inflammation). 351
352
The strains from sublineage RD150 had mutations that may have an impact on 353
the function of four interesting genes. Rv0577, a gene restricted to members of the MTB 354
complex (18), has been used for diagnostic purposes (45). The protein encoded by 355
Rv0577 may regulate innate and adaptive immunity by interacting with Toll-like receptor 356
2 (8). Rv1009 (rpfB) is one of the most immunogenic resuscitation-promoting factors 357
(40) and deletion of this gene has been associated with delayed reactivation from 358
chronic tuberculosis in mouse (50). Rv1638 (uvrA) is part of the nucleotide excision 359
repair system which counteracts the deleterious effects of DNA lesions (41) and is 360
essential for M. smegmatis to survive in conditions of hypoxia and low carbon source 361
(13). Rv2416c (eis) is a secretory protein, and enhances intracellular survival of M. 362
tuberculosis in monocytes and contributes to its pathogenicity (53). A study 363
demonstrated that Eis impaired the host defense against tuberculosis by disturbing the 364
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
17
cross regulation of T-cells, producing an imbalance between TH1 and TH2 response, 365
which could be a factor in the pathogenesis of tuberculosis (22). 366
367
The strains from sublineage 142 have mutations in three interesting genes for 368
which other polymorphisms have been described. Rv0989c (grcC2), which had a 369
different mutation in RD142 strains than the RD 207 strains discussed previously. 370
Rv1811 (mgtC) encodes a virulence factor required to survive in the macrophages and 371
in conditions with low Mg2+ (6). Different mutations in this gene have been described in 372
strains from the Euro-American lineage (spoligotype Haarlem) (2). Rv1317c (alkA) is 373
part of the AdaA-AlkA adaptive response in M. tuberculosis, and multiple mutations 374
have been described in strains from Lineage 4 (Euro-American), Lineage 2 (same 375
mutation has been described before in the W-Beijing 210 strain which belongs to the 376
RD 142 sublineage) and in M. bovis (29) . It has been suggested that a defective 377
adaptive response by these genes will confer a selective advantage to the M. 378
tuberculosis (54). 379
The strains from RD181 are a paraphyletic group, defined as a group of 380
organisms which includes the most recent common ancestor of all of its members, but 381
not all of the descendants of that most recent common ancestor. In this particular case, 382
RD181 strains share a common ancestor, but the group also includes RD150 and 383
RD142 strains. This implies that SNPs shared by all RD181 strains are also present in 384
RD150 and RD142 strains, and there were not common nsSNPs exclusive for all 385
RD181. 386
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
18
Although some of these mutations may explain the pathological and 387
immunological differences observed, there are a multitude of factors that can influence 388
the transmission and pathogenic capabilities of a given isolate, such as host and 389
environmental factors (5, 20, 27, 38), HIV co-infection (42) and the concentration of 390
organisms in environmental air (17). Until recently, the only bacterial factor considered 391
was the presence of drug resistance; some studies have suggested that M. tuberculosis 392
resistant to isoniazid is less transmissible (52) and less pathogenic than fully 393
susceptible organisms (7, 11), although an earlier study in our laboratory (33) 394
investigating the virulence of multidrug resistant isolates did not show much evidence of 395
loss of virulence of these strains. More recent studies suggest that different groups of 396
isolates of M. tuberculosis may contribute to different clinical outcomes (14). As noted 397
recently (52), the application of new molecular typing techniques has increased both our 398
knowledge of bacterial factors and also the identification of separate lineages of 399
isolates. It is overly optimistic to expect that the myriad of factors can be modeled in 400
animals such as the guinea pig used here, but such models can provide clues. Like 401
humans, the guinea pig undergoes a process of granulomatous inflammation and 402
necrosis when infected with M. tuberculosis, and the differing degrees to which this 403
occurs may be an indicator of the virulence of the infecting isolate (36, 37). Moreover, 404
by applying new flow cytometric techniques (30, 31) and RT-PCR methods, one can 405
detect differences in the expression of protective immunity (RD142 strains clearly 406
generated the strongest response, suggesting that they are of increased 407
immunogenicity), as well as the induction of signals consistent with the generation of 408
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
19
regulatory T cells (which we found here to be highest in animals infected with the 409
RD207 strains). 410
411
Most studies to date on the pathogenicity of strains in the guinea pig model have 412
tended to focus on the Beijing strains, and far less is known about other lineages or 413
families of strains. There is a growing concern that the newly emerging isolates of M. 414
tuberculosis in general are more pathogenic, and this may have a serious impact on 415
vaccine effectiveness. Not only is there a suspicion that BCG may actually have 416
selected for the more virulent strains (1), but recent data (32) shows that BCG is only 417
transiently protective against Beijing strains and cannot overcome the induction of 418
regulatory T cells. Since some new generation vaccines are also based on BCG (4), this 419
raises the real possibility that such vaccines will not work (32, 34, 35). While as yet 420
unproven, the induction of regulatory T cells by these pathogenic strains, coupled with 421
dampening or loss of protective immunity but continuance of TH17 responses (as seen 422
here) may drive the degree of severity of lung pathology, which in turn will enable bacilli 423
to escape the lungs and then potentially be transmitted. 424
425
One of the primary public health strategies to control tuberculosis is the 426
evaluation of persons in close contact with an infectious tuberculosis patient (contact 427
investigation) to identify secondary cases of active tuberculosis and latent tuberculosis 428
infection. The bacterial factors governing transmissibility and pathogenicity of M. 429
tuberculosis are poorly understood. Therefore, additional clinical and animal studies 430
such as ours may serve to identify factors (like the features of the exposure or the 431
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
20
immune status of the exposed person) that suggest a situation in which there is a 432
greater risk to developing active tuberculosis. In these cases, the evaluation of contacts 433
should be undertaken with greater urgency. Also, we have discovered mutations likely 434
to be functional in genes that are currently being used for diagnostic purposes (Rv0577, 435
Rv1009) (10, 45) or as candidates for sub-unit vaccines (Rv1009). These 436
polymorphisms may limit their efficacy as diagnostic or vaccine targets. 437
438
In conclusion, the current molecular-based sublineage classification appears to 439
be associated biologically with clinical and pathological consequences, and differences 440
between sublineages, particularly in the context of loss of protective immunity and 441
increased lung damage, may favor or influence the capacity of these isolates to be 442
transmitted within communities. 443
444
445
ACKNOWLEDGEMENTS 446
This work was supported by the National Instituteof Allergy and Infectious Diseases at 447
the National Institutes of Health [grant numbers AI083856, AI081959, AI070456, 448
AI092002, AI034238, AI090928, and HHSN266200700022C]; National Institutes of 449
Health Innovation Award [grant number 1DP2OD006450], the American Recovery and 450
Reinvestment Act funds, and the Swiss National Science Foundation [PP00A-119205]. 451
Further support was provided by the College of Veterinary Medicine and Biomedical 452
Sciences, Colorado State University. We would like to thank M Shin and J Nguyen for 453
library preparation and sequence data generation. 454
455
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
21
456
REFERENCES 457
1. Abebe, F., and G. Bjune. 2006. The emergence of Beijing family genotypes of 458
Mycobacterium tuberculosis and low-level protection by bacille Calmette-Guerin 459
(BCG) vaccines: is there a link? Clin Exp Immunol 145:389-397. 460
2. Alix, E., S. Godreuil, and A. B. Blanc-Potard. 2006. Identification of a Haarlem 461
genotype-specific single nucleotide polymorphism in the mgtC virulence gene of 462
Mycobacterium tuberculosis. J Clin Microbiol 44:2093-2098. 463
3. Allen, S. S., J. T. Mackie, K. Russell, A. Jeevan, T. A. Skwor, and D. N. 464
McMurray. 2008. Altered inflammatory responses following transforming growth 465
factor-beta neutralization in experimental guinea pig tuberculous pleurisy. 466
Tuberculosis (Edinb) 88:430-436. 467
4. Beresford, B., and J. C. Sadoff. Update on research and development pipeline: 468
tuberculosis vaccines. Clin Infect Dis 50 Suppl 3:S178-183. 469
5. Borgdorff, M. W., S. van den Hof, K. Kremer, L. Verhagen, N. Kalisvaart, C. 470
Erkens, and D. van Soolingen. Progress towards tuberculosis elimination: 471
secular trend, immigration and transmission. Eur Respir J 36:339-347. 472
6. Buchmeier, N., A. Blanc-Potard, S. Ehrt, D. Piddington, L. Riley, and E. A. 473
Groisman. 2000. A parallel intraphagosomal survival strategy shared by 474
Mycobacterium tuberculosis and Salmonella enterica. Mol Microbiol 35:1375-475
1382. 476
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
22
7. Burgos, M., K. DeRiemer, P. M. Small, P. C. Hopewell, and C. L. Daley. 2003. 477
Effect of drug resistance on the generation of secondary cases of tuberculosis. J 478
Infect Dis 188:1878-1884. 479
8. Byun, E. H., W. S. Kim, J. S. Kim, I. D. Jung, Y. M. Park, H. J. Kim, S. N. Cho, 480
and S. J. Shin. 2012. Mycobacterium tuberculosis Rv0577, a novel TLR2 481
agonist, induces maturation of dendritic cells and drives Th1 immune response. 482
FASEB J. 483
9. Cattamanchi, A., P. C. Hopewell, L. C. Gonzalez, D. H. Osmond, L. Masae 484
Kawamura, C. L. Daley, and R. M. Jasmer. 2006. A 13-year molecular 485
epidemiological analysis of tuberculosis in San Francisco. Int J Tuberc Lung Dis 486
10:297-304. 487
10. Chegou, N. N., G. F. Black, A. G. Loxton, K. Stanley, P. N. Essone, M. R. 488
Klein, S. K. Parida, S. H. Kaufmann, T. M. Doherty, A. H. Friggen, K. L. 489
Franken, T. H. Ottenhoff, and G. Walzl. 2012. Potential of novel Mycobacterium 490
tuberculosis infection phase-dependent antigens in the diagnosis of TB disease 491
in a high burden setting. BMC Infect Dis 12:10. 492
11. Cohen, T., B. Sommers, and M. Murray. 2003. The effect of drug resistance on 493
the fitness of Mycobacterium tuberculosis. Lancet Infect Dis 3:13-21. 494
12. Comas, I., J. Chakravartti, P. M. Small, J. Galagan, S. Niemann, K. Kremer, 495
J. D. Ernst, and S. Gagneux. 2010. Human T cell epitopes of Mycobacterium 496
tuberculosis are evolutionarily hyperconserved. Nat Genet 42:498-503. 497
13. Cordone, A., B. Audrain, I. Calabrese, D. Euphrasie, and J. M. Reyrat. 2011. 498
Characterization of a Mycobacterium smegmatis uvrA mutant impaired in 499
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
23
dormancy induced by hypoxia and low carbon concentration. BMC Microbiol 500
11:231. 501
14. de Jong, B. C., P. C. Hill, A. Aiken, T. Awine, M. Antonio, I. M. Adetifa, D. J. 502
Jackson-Sillah, A. Fox, K. Deriemer, S. Gagneux, M. W. Borgdorff, K. P. 503
McAdam, T. Corrah, P. M. Small, and R. A. Adegbola. 2008. Progression to 504
active tuberculosis, but not transmission, varies by Mycobacterium tuberculosis 505
lineage in The Gambia. J Infect Dis 198:1037-1043. 506
15. Ebrahimi-Rad, M., P. Bifani, C. Martin, K. Kremer, S. Samper, J. Rauzier, B. 507
Kreiswirth, J. Blazquez, M. Jouan, D. van Soolingen, and B. Gicquel. 2003. 508
Mutations in putative mutator genes of Mycobacterium tuberculosis strains of the 509
W-Beijing family. Emerg Infect Dis 9:838-845. 510
16. Gagneux, S., K. DeRiemer, T. Van, M. Kato-Maeda, B. C. de Jong, S. 511
Narayanan, M. Nicol, S. Niemann, K. Kremer, M. C. Gutierrez, M. Hilty, P. C. 512
Hopewell, and P. M. Small. 2006. Variable host-pathogen compatibility in 513
Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 103:2869-2873. 514
17. Houk, V. N., J. H. Baker, K. Sorensen, and D. C. Kent. 1968. The 515
epidemiology of tuberculosis infection in a closed environment. Arch Environ 516
Health 16:26-35. 517
18. Huard, R. C., S. Chitale, M. Leung, L. C. Lazzarini, H. Zhu, E. Shashkina, S. 518
Laal, M. B. Conde, A. L. Kritski, J. T. Belisle, B. N. Kreiswirth, J. R. Lapa e 519
Silva, and J. L. Ho. 2003. The Mycobacterium tuberculosis complex-restricted 520
gene cfp32 encodes an expressed protein that is detectable in tuberculosis 521
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
24
patients and is positively correlated with pulmonary interleukin-10. Infect Immun 522
71:6871-6883. 523
19. Kato-Maeda, M., E. Y. Kim, L. Flores, L. G. Jarlsberg, D. Osmond, and P. C. 524
Hopewell. 2010. Differences among sublineages of the East-Asian lineage of 525
Mycobacterium tuberculosis in genotypic clustering. Int J Tuberc Lung Dis 526
14:538-544. 527
20. Kik, S. V., S. Verver, D. van Soolingen, P. E. de Haas, F. G. Cobelens, K. 528
Kremer, H. van Deutekom, and M. W. Borgdorff. 2008. Tuberculosis outbreaks 529
predicted by characteristics of first patients in a DNA fingerprint cluster. American 530
journal of respiratory and critical care medicine 178:96-104. 531
21. Kremer, K., J. R. Glynn, T. Lillebaek, S. Niemann, N. E. Kurepina, B. N. 532
Kreiswirth, P. J. Bifani, and D. van Soolingen. 2004. Definition of the 533
Beijing/W lineage of Mycobacterium tuberculosis on the basis of genetic markers. 534
J Clin Microbiol 42:4040-4049. 535
22. Lella, R. K., and C. Sharma. 2007. Eis (enhanced intracellular survival) protein 536
of Mycobacterium tuberculosis disturbs the cross regulation of T-cells. J Biol 537
Chem 282:18671-18675. 538
23. Li, H., and R. Durbin. 2009. Fast and accurate short read alignment with 539
Burrows-Wheeler transform. Bioinformatics 25:1754-1760. 540
24. Li, H., B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, 541
G. Abecasis, and R. Durbin. 2009. The Sequence Alignment/Map format and 542
SAMtools. Bioinformatics 25:2078-2079. 543
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
25
25. Maddison, W. P., and D. R. Maddison. Mesquite: a modular system for 544
evolutionary analysis., 2.73. ed. 545
26. McMurray, D. N., S. S. Allen, A. Jeevan, T. Lasco, H. Cho, T. Skwor, T. 546
Yamamoto, C. McFarland, and T. Yoshimura. 2005. Vaccine-induced cytokine 547
responses in a guinea pig model of pulmonary tuberculosis. Tuberculosis (Edinb) 548
85:295-301. 549
27. Mitruka, K., J. E. Oeltmann, K. Ijaz, and M. B. Haddad. 2011. Tuberculosis 550
outbreak investigations in the United States, 2002-2008. Emerg Infect Dis 551
17:425-431. 552
28. Ng, P. C., and S. Henikoff. 2001. Predicting deleterious amino acid 553
substitutions. Genome Res 11:863-874. 554
29. Nouvel, L. X., T. Dos Vultos, E. Kassa-Kelembho, J. Rauzier, and B. Gicquel. 555
2007. A non-sense mutation in the putative anti-mutator gene ada/alkA of 556
Mycobacterium tuberculosis and M. bovis isolates suggests convergent 557
evolution. BMC Microbiol 7:39. 558
30. Ordway, D., M. Henao-Tamayo, C. Shanley, E. E. Smith, G. Palanisamy, B. 559
Wang, R. J. Basaraba, and I. M. Orme. 2008. Influence of Mycobacterium bovis 560
BCG vaccination on cellular immune response of guinea pigs challenged with 561
Mycobacterium tuberculosis. Clin Vaccine Immunol 15:1248-1258. 562
31. Ordway, D., G. Palanisamy, M. Henao-Tamayo, E. E. Smith, C. Shanley, I. M. 563
Orme, and R. J. Basaraba. 2007. The cellular immune response to 564
Mycobacterium tuberculosis infection in the guinea pig. J Immunol 179:2532-565
2541. 566
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
26
32. Ordway, D. J., S. Shang, M. Henao-Tamayo, A. Obregon-Henao, L. Nold, M. 567
Caraway, C. A. Shanley, R. J. Basaraba, C. G. Duncan, and I. M. Orme. 568
Mycobacterium bovis BCG-Mediated Protection against W-Beijing Strains of 569
Mycobacterium tuberculosis Is Diminished Concomitant with the Emergence of 570
Regulatory T Cells. Clin Vaccine Immunol 18:1527-1535. 571
33. Ordway, D. J., M. G. Sonnenberg, S. A. Donahue, J. T. Belisle, and I. M. 572
Orme. 1995. Drug-resistant strains of Mycobacterium tuberculosis exhibit a 573
range of virulence for mice. Infect Immun 63:741-743. 574
34. Orme, I. M. The Achilles heel of BCG. Tuberculosis (Edinb) 90:329-332. 575
35. Orme, I. M. Development of new vaccines and drugs for TB: limitations and 576
potential strategic errors. Future microbiology 6:161-177. 577
36. Palanisamy, G. S., N. DuTeau, K. D. Eisenach, D. M. Cave, S. A. Theus, B. N. 578
Kreiswirth, R. J. Basaraba, and I. M. Orme. 2009. Clinical strains of 579
Mycobacterium tuberculosis display a wide range of virulence in guinea pigs. 580
Tuberculosis (Edinb) 89:203-209. 581
37. Palanisamy, G. S., E. E. Smith, C. A. Shanley, D. J. Ordway, I. M. Orme, and 582
R. J. Basaraba. 2008. Disseminated disease severity as a measure of virulence 583
of Mycobacterium tuberculosis in the guinea pig model. Tuberculosis (Edinb) 584
88:295-306. 585
38. Pena, M. J., J. A. Caminero, M. I. Campos-Herrero, J. C. Rodriguez-Gallego, 586
M. I. Garcia-Laorden, P. Cabrera, M. J. Torres, B. Lafarga, F. Rodriguez de 587
Castro, S. Samper, F. Canas, D. A. Enarson, and C. Martin. 2003. 588
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
27
Epidemiology of tuberculosis on Gran Canaria: a 4 year population study using 589
traditional and molecular approaches. Thorax 58:618-622. 590
39. Perez, E., P. Constant, F. Laval, A. Lemassu, M. A. Laneelle, M. Daffe, and 591
C. Guilhot. 2004. Molecular dissection of the role of two methyltransferases in 592
the biosynthesis of phenolglycolipids and phthiocerol dimycoserosate in the 593
Mycobacterium tuberculosis complex. J Biol Chem 279:42584-42592. 594
40. Romano, M., E. Aryan, H. Korf, N. Bruffaerts, C. L. Franken, T. H. Ottenhoff, 595
and K. Huygen. 2012. Potential of Mycobacterium tuberculosis resuscitation-596
promoting factors as antigens in novel tuberculosis sub-unit vaccines. Microbes 597
Infect 14:86-95. 598
41. Rossi, F., J. S. Khanduja, A. Bortoluzzi, J. Houghton, P. Sander, C. 599
Guthlein, E. O. Davis, B. Springer, E. C. Bottger, A. Relini, A. Penco, K. 600
Muniyappa, and M. Rizzi. 2011. The biological and structural characterization of 601
Mycobacterium tuberculosis UvrA provides novel insights into its mechanism of 602
action. Nucleic Acids Res 39:7316-7328. 603
42. Selwyn, P. A., D. Hartel, V. A. Lewis, E. E. Schoenbaum, S. H. Vermund, R. 604
S. Klein, A. T. Walker, and G. H. Friedland. 1989. A prospective study of the 605
risk of tuberculosis among intravenous drug users with human immunodeficiency 606
virus infection. N Engl J Med 320:545-550. 607
43. Shah, N. S., A. Wright, G. H. Bai, L. Barrera, F. Boulahbal, N. Martin-608
Casabona, F. Drobniewski, C. Gilpin, M. Havelkova, R. Lepe, R. Lumb, B. 609
Metchock, F. Portaels, M. F. Rodrigues, S. Rusch-Gerdes, A. Van Deun, V. 610
Vincent, K. Laserson, C. Wells, and J. P. Cegielski. 2007. Worldwide 611
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
28
emergence of extensively drug-resistant tuberculosis. Emerg Infect Dis 13:380-612
387. 613
44. Shang, S., M. Harton, M. H. Tamayo, C. Shanley, G. S. Palanisamy, M. 614
Caraway, E. D. Chan, R. J. Basaraba, I. M. Orme, and D. J. Ordway. 615
Increased Foxp3 expression in guinea pigs infected with W-Beijing strains of M. 616
tuberculosis. Tuberculosis (Edinb) 91:378-385. 617
45. Sobral, L. F., R. S. Duarte, G. B. Vieira, M. G. Silva, N. Boechat, and L. d. S. 618
Fonseca. 2011. Identification of Mycobacterium bovis among mycobacterial 619
isolates from human clinical specimens at a university hospital in Rio de Janeiro, 620
Brazil. J Bras Pneumol 37:664-668. 621
46. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular 622
Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular biology 623
and evolution 24:1596-1605. 624
47. Tsenova, L., E. Ellison, R. Harbacheuski, A. L. Moreira, N. Kurepina, M. B. 625
Reed, B. Mathema, C. E. Barry, 3rd, and G. Kaplan. 2005. Virulence of 626
Selected Mycobacterium tuberculosis Clinical Isolates in the Rabbit Model of 627
Meningitis Is Dependent on Phenolic Glycolipid Produced by the Bacilli. J Infect 628
Dis 192:98-106. 629
48. Tsolaki, A. G., S. Gagneux, A. S. Pym, Y. O. Goguet de la Salmoniere, B. N. 630
Kreiswirth, D. Van Soolingen, and P. M. Small. 2005. Genomic deletions 631
classify the Beijing/W strains as a distinct genetic lineage of Mycobacterium 632
tuberculosis. J Clin Microbiol 43:3185-3191. 633
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
29
49. Tsolaki, A. G., A. E. Hirsh, K. DeRiemer, J. A. Enciso, M. Z. Wong, M. 634
Hannan, Y. O. Goguet de la Salmoniere, K. Aman, M. Kato-Maeda, and P. M. 635
Small. 2004. Functional and evolutionary genomics of Mycobacterium 636
tuberculosis: insights from genomic deletions in 100 strains. Proc Natl Acad Sci 637
U S A 101:4865-4870. 638
50. Tufariello, J. M., K. Mi, J. Xu, Y. C. Manabe, A. K. Kesavan, J. Drumm, K. 639
Tanaka, W. R. Jacobs, Jr., and J. Chan. 2006. Deletion of the Mycobacterium 640
tuberculosis resuscitation-promoting factor Rv1009 gene results in delayed 641
reactivation from chronic tuberculosis. Infect Immun 74:2985-2995. 642
51. van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. 643
Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, and et al. 1993. 644
Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: 645
recommendations for a standardized methodology. J Clin Microbiol 31:406-409. 646
52. Verhagen, L. M., S. van den Hof, H. van Deutekom, P. W. Hermans, K. 647
Kremer, M. W. Borgdorff, and D. van Soolingen. 2011. Mycobacterial factors 648
relevant for transmission of tuberculosis. J Infect Dis 203:1249-1255. 649
53. Wu, S., P. F. Barnes, B. Samten, X. Pang, S. Rodrigue, S. Ghanny, P. 650
Soteropoulos, L. Gaudreau, and S. T. Howard. 2009. Activation of the eis 651
gene in a W-Beijing strain of Mycobacterium tuberculosis correlates with 652
increased SigA levels and enhanced intracellular growth. Microbiology 155:1272-653
1281. 654
54. Yang, M., R. M. Aamodt, B. Dalhus, S. Balasingham, I. Helle, P. Andersen, T. 655
Tonjum, I. Alseth, T. Rognes, and M. Bjoras. 2011. The ada operon of 656
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
30
Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible 657
repair of DNA alkylation damage. DNA Repair (Amst) 10:595-602. 658
659
660
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
31
661
Figure Legends. 662
Figure 1. Course of infection following exposure of guinea pigs to approximately 20 663
viable M. tuberculosis bacilli representing four sublineages of the East Asian lineage. 664
The panel shows the bacterial growth in the lungs from guinea pigs receiving a low dose 665
aerosol of M. tuberculosis laboratory strains assayed on days 30 and 60 after infection. 666
Results are expressed logarithmically as the mean Log10 bacilli colony forming units 667
(CFU) (n=5); SEM did not exceed 0.35. 668
669
Figure 2. The granulomatous responses from guinea pigs infected with the sublineage 670
RD142 and RD150 strains of M. tuberculosis. The panel shows representative 671
photomicrographs from sections of paraformaldehyde-fixed and paraffin embedded 672
guinea pig tissues from the same lungs which were collected on days 30 and 60 after 673
infection with RD142 (A-F) and RD150 (G-J) strains. In all animals there were 674
coalescing foci of inflammation that tracked along airways. Inflammatory lesions had 675
central regions of necrosis surrounded by histiocytic cells and peripheral lymphocytes. 676
By day 60 there was often mineral present within the lesions. The severity of 677
inflammation and pulmonary consolidation was greater in RD142 relative to RD150. 678
Hematoxylin and Eosin staining, total magnification=A-J, 10x. 679
680
Figure 3. The granulomatous responses from guinea pigs infected with the sublineages 681
RD181 and RD207 strains of M. tuberculosis. The panel shows representative 682
photomicrographs from sections of paraformaldehyde-fixed and paraffin embedded 683
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
32
guinea pig tissues from the same lungs which were collected on days 30 and 60 after 684
infection with RD181 (A-F) and RD207 (G-J) strains. Pulmonary pathology was similar 685
to that seen with strains RD142 and RD150 (Fig. 2). The extent of lung involvement was 686
notably greater with the RD207 strains relative to the RD181 strains, and very severe by 687
day 60 (G-J). Hematoxylin and Eosin staining, total magnification= A-J, 10x. 688
689
Figure 4. The sublineage RD207 shows increased lesion scores in the lungs. Lung 690
lesion scores for the guinea pigs on day 30 (panel A) and day 60 (panel B) after 691
infection with the various sublineage strains. The histopathology was characterized 692
using a lesion scoring system that showed the significant extent of lung disease 693
compared to the other organs during chronic infection (n=5, * Student t-test P < 0.05). 694
Please note that the calcification:necrosis ratio was zero for all strains in Panel A. 695
696
Figure 5. RT-PCR analysis of the fold increase in expression of cytokines associated 697
with the TH1 response in the lungs of guinea pigs following exposure to representative 698
strains of the four sublineages of the East Asian lineage. Panel A shows IFN-γ, panel B 699
IL-12p40 and panel C shows TNF expression in the lungs on days 30 and 60 from 700
guinea pigs exposed to a low dose of RD142 (4588 and 4619); RD150 (3446 and 701
3376); RD181 (3507 and 3393); and RD207 (5097 and 4334) sublineage strains. 702
Cytokine mRNA expression was quantified using real-time RT-PCR. Fold induction of 703
mRNA was calculated from the threshold cycle (CT) normalized to HPRT CT values 704
using the values of the uninfected guinea pig lung cells. Results are expressed as the 705
average (n=4) of the fold induction in each group (SEM did not exceed 0.30). *Student t-706
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
33
test: for IFN RD142/150 [P < 0.01], for RD181/207 [P < 0.04], and TNF for 707
RD181/207 [P < 0.03]. 708
709
710
Figure 6. RT-PCR analysis of the fold increase in expression of proteins associated 711
with regulatory T cell and TH17 T cell responses in the lungs of guinea pigs following 712
exposure to representative strains of the four sublineages of the East Asian lineage. 713
Panel A shows Foxp3, panel B TGFβ and panel C shows IL-17 expression in the lungs 714
on days 30 and 60 from guinea pigs exposed to a low dose of RD142 (4588 and 4619); 715
RD150 (3446 and 3376); RD181 (3507 and 3393); and RD207 (5097 and 4334) 716
sublineage strains. Cytokine mRNA expression was quantified using real-time RT-PCR. 717
Fold induction of mRNA was calculated from the threshold cycle (CT) normalized to 718
HPRT CT values and then to uninfected guinea pig lung cells. Results are expressed as 719
the average (n=4) of the fold induction in each group (SEM did not exceed 0.30). 720
*Student t-test: for Foxp3 RD181/207 [P < 0.04], for TGFβ RD181/207 [P < 0.02], for IL-721
17 RD142/150 [P < 0.04], and RD181/207 [P < 0.01]. 722
723
Figure 7. Flow cytometric analysis of CD4+ and CD45hi T cell subsets accumulating in 724
the lungs over the course of the infection with representative strains of the four 725
sublineages of the East Asian lineage. Panel A shows representative flow cytometric 726
analysis after 30 days of infection of the percentages of CD4+ and CD45hi T cell cells in 727
RD142, RD150, RD181, and RD207 sublineages. Panel B shows the number of cells in 728
the lungs on day 30 and 60 for RD142 strains 4588 and 4619, RD150 strains 3446 and 729
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
34
3376, RD181 strains 3507 and 3393, and RD207 strains 5097 and 4334. Cell numbers 730
expressed as total cells (x107) expressing each phenotype per 1.0 gram of each tissue 731
(n=4) (SEM did not exceed 0.35). *Student t-test for RD150 day 30 to day 60 [P < 0.03] 732
and RD207 day 30 to day 60 [P < 0.01].733
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
35
734
Table 1. Characteristic of the M. tuberculosis strains included in the animal model 735
Sublineage Specimen
Site of
disease
Initial
chest x-
ray
HIV
status
IS6110
Band
No.
IS6110
RFLP
Pattern
Type of
case
Cluste
r size
RD142 4233 Pulmonary
Abnormal,
no cavities Unknown 18 Unique Unique
RD142 4588 Pulmonary
Abnormal,
no cavities Unknown 17 Unique Unique
RD142 4619
Lymphatic-
cervical
Abnormal,
no cavities Unknown 19 Unique Unique
RD150 3376 Pulmonary
Abnormal,
no cavities Unknown 21 2090000
Secondary
Case 10
RD150 3446 Pulmonary Cavities Negative 21 2010000
Secondary
Case 5
RD181 3393 Pulmonary
Abnormal,
no cavities Unknown 21 Unique Unique
RD181 3507 Pulmonary Cavities Unknown 21 Unique Unique
RD181 4147 Pulmonary Cavities Unknown 19 Unique Unique
RD207 4334 Pulmonary
Abnormal,
no cavities Unknown 8 4990000 First case 2
RD207 5097 Pulmonary
Abnormal,
no cavities Unknown 9 Unique Unique
736
737
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
36
Table 2. Univariate and multivariate odds of being a secondary case. 738
Risk Factor
Univariate Multivariate
Secondary
Case
N (%)
Odds Ratio a
(95% CI), p value
Secondary
Case
N (%)
Odds Ratio d
(95% CI), p value
Sublineage RD207
Other
13 (32)
101 (19)
2.04 (1.02–4.08), 0.043 13 (35)
79 (18)
1.98 (0.91–4.29), 0.083
Birth place US
Foreign
37 (54)
77 (15)
6.61 (3.88–11.2), <0.001 29 (50)
63 (15)
5.22 (2.89–9.42), <0.001
Cavities b Yes
No
10 (17)
103 (20)
0.83 (0.41–1.69), 0.609 9 (16)
83 (20)
0.72 (0.32–1.60), 0.416
Sputum smear status c
Positive
Negative
40 (22)
53 (18)
1.29 (0.81–2.04), 0.278
40 (22)
52 (17)
1.28 (0.77–2.11), 0.335
a Excluding 7 extrapulmonary index cases: 114 secondary cases in 586 observations 739
b Excluding 5 missing data on cavitary status: 113 secondary cases in 581 observations 740
c Excluding 103 missing data on smear status: 93 secondary cases in 483 observations 741
d Excluding 7 extrapulmonary index cases and 105 with missing data: multivariate 742
model composed of 92 secondary cases in 481 observations 743
744
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
37
Table 3. Genes specific for each sublineage that contained a nsSNP that may have an 745
impact on the gene function based on the SIFT analysis. 746
747
Locus Gene
Symbol
Gene description Aminoacid
change
SIFT value
Mutations in sublineage RD207
Rv0327c cyp135A1 cytochrome P450 135A1 R220H 0.05
Rv0380c RNA methyltransferase R174P 0.01
Rv0411c glnH glutamine-binding lipoprotein M1I 0
Rv0622 hypothetical protein P219L 0.01
Rv0859 fadA acetyl-CoA acetyltransferase K17N 0
Rv0892 monooxygenase T177I 0
Rv0944
formamidopyrimidine-DNA
glycosylase Y50H 0.01
Rv0989c grcC2
polyprenyl-diphosphate
synthase L257M 0
Rv1073 hypothetical protein V113L 0.02
Rv1523 methyltransferase V167A 0
Rv1557 mmpL6 transmembrane transport A158G 0.01
Rv1894c hypothetical protein V168M 0
Rv1934c fadE17 acyl-CoA dehydrogenase E394K 0.02
Rv2579 dhaA haloalkane dehalogenase T2K 0.02
Rv2688c
antibiotic ABC transporter ATP-
binding protein C213R 0
Rv2821c hypothetical protein V207L 0.02
Rv2959c methyltransferase I146M 0
Rv3057c short-chain dehydrogenase V93M 0.02
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
38
Mutations in sublineage RD150
Rv0426c hypothetical protein P97L 0.04
Rv0458 aldehyde dehydrogenase V457A 0
Rv0528 transmembrane protein D59G 0
Rv0577 TB27.3 hypothetical protein P74A 0.01
Rv0610c hypothetical protein E235A 0
Rv0634c glyoxalase II Y7H 0
Rv1009 rpfB
resuscitation-promoting factor
rpfB V265M 0
Rv1140 hypothetical protein G84D 0.02
Rv1207 folP2
dihydropteroate synthase 2
FolP2 R73G 0.04
Rv1638 uvrA excinuclease ABC subunit A D200G 0.02
Rv1665 pks11 chalcone synthase pks11 P55A 0.01
Rv2416c eis
enhanced intracellular survival
protein V163I 0
Rv2715 hydrolase P263S 0.01
Rv3167c
TetR family transcriptional
regulato L162F 0.01
Rv3665c dppB peptide ABC transporter T194I 0
Rv3886c mycP2 hypothetical protein P45T 0
Mutations in sublineage RD142
Rv0775 hypothetical protein R86Q 0.04
Rv0826 hypothetical protein N79S 0.02
Rv0989c grcC2
polyprenyl-diphosphate
synthase A182G 0.04
Rv1152 regulatory protein GntR G105A 0.04
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
39
Rv1295 thrC threonine synthase G237S 0
Rv1317c alkA ada regulatory protein A11T 0
Rv1502 hypothetical protein R196C 0.05
Rv1811 mgtC Mg2+ transport ATPase C A40M 0
Rv2124c metH methionine synthase Y1098D 0
Rv2394 ggtB gamma-glutamyltransferase V545F 0
Rv2510c hypothetical protein Q351E 0
Rv3667 acs acetyl-CoA synthetase A44T 0
Rv3774 echA21 enoyl-CoA hydratase G124D 0
748
749
on Septem
ber 29, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from