downloaded from //cvi.asm.org/content/cdli/early/2012/06/14/cvi.00250-12... · 102 4619 (rd142);...

1

Beijing sublineages of Mycobacterium tuberculosis differ in pathogenicity in the 1

guinea pig. 2

3

Running title: East Asian sublineage MTB and pathogenicity 4

5

Midori Kato-Maeda, a# Crystal A Shanley,b David Ackart,b Leah G Jarlsberg,a 6

Shaobin Shang,b Andres Obregon-Henao,b Marisabel Harton,b Randall J 7

Basaraba,b Marcela Henao-Tamayo,b Joyce C. Barrozo,a Jordan Rose,a L Masae 8

Kawamura,c Mireia Coscolla,d,e Viacheslav Y. Fofanov,f Heather Koshinsky,f 9

Sebastien Gagneux,d,e Philip C Hopewell,a Diane J Ordway,b and Ian M Ormeb 10

11

Curry International Tuberculosis Center, Division of Pulmonary and Critical Care 12

Medicine, University of California, San Francisco, San Francisco CA 94110, USAa 13

Department of Microbiology, Immunology and Pathology, Colorado State University, 14

Fort Collins CO 80523, USAb 15

San Francisco Tuberculosis Clinic, San Francisco Department of Public Health, San 16

Francisco CA 94110, USAc 17

Swiss Tropical & Public Health Institute, 4002 Basel, Switzerlandd 18

University of Basel, 4002 Basel, Switzerlande 19

Eureka Genomics, Hercules CA 94547, USAf 20

21

Present address: LMK: Cepheid, Sunnyvale CA 94089, USA. 22

#Corresponding author: [email protected] 23

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Clin. Vaccine Immunol. doi:10.1128/CVI.00250-12 CVI Accepts, published online ahead of print on 20 June 2012

on Septem

ber 29, 2018 by guesthttp://cvi.asm

.org/D

ownloaded from

http://cvi.asm.org/

2

Abstract 24

The Beijing family of Mycobacterium tuberculosis strains is part of Lineage 2 (also 25

known as East Asian lineage). In clinical studies we have observed that isolates from 26

the sublineage RD207 of Lineage 2 were more readily transmitted among humans. To 27

investigate the basis for this difference, we tested representative strains with the 28

characteristic Beijing spoligotype from four of the five sublineages of Lineage 2 in the 29

guinea pig model and subjected these strains to comparative whole genome 30

sequencing. The results of these studies showed that all of the clinical strains were 31

capable of growing and causing lung pathology in guinea pigs after low dose aerosol 32

exposure. Differences between the ability of the four sublineages to grow in the lungs of 33

these animals were not overt, but members of RD207 were significantly more 34

pathogenic, resulting in severe lung damage. The RD207 strains also induced much 35

higher levels of markers associated with regulatory T cells, and showed a significant 36

loss of activated T cells in the lungs over the course of the infections. Whole genome 37

sequencing of the strains revealed mutations specific for RD207 which may explain this 38

difference. Based on these data, we hypothesize that the sublineages of M. tuberculosis 39

are associated with distinct pathological and clinical phenotypes, and that these 40

differences influence the transmissibility of particular M. tuberculosis strains in human 41

populations. 42

43

44

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

3

Introduction. 45

The emergence and spread of apparently new strains of Mycobacterium tuberculosis, 46

including multiple and extensively drug resistant (M/XDR) strains has raised 47

considerable concern (43). Of particular concern is the Beijing family of strains, a family 48

that is thought to have enhanced pathogenicity, a predilection for drug resistance (15, 49

47), and a less effective response to BCG-based vaccines (32, 35). 50

51

The Beijing family belongs to Lineage 2 (also known as the East Asian lineage) 52

of M. tuberculosis. This lineage is defined by the region of difference (RD)105, is 53

monophyletic, and is divided into five sublineages based on their specific RDs: RD105, 54

RD207, RD181, RD150, and RD142 (48). Strains from four of the five sublineages 55

(RD207, RD181, RD150, and RD142) have the characteristic spoligotype that defines 56

the Beijing family (21). In a recent population-based study in San Francisco, we 57

demonstrated that different sublineages of Lineage 2 differed in the number of 58

secondary cases of tuberculosis they caused (19). Based on this observation we 59

hypothesized that there are differences in the pathogenicity of these sublineages. To 60

investigate this hypothesis, we used an animal model to examine the pathogenicity of 61

four sublineages among Lineage 2. We examined the capacity of a representative 62

panel of clinical isolates to cause infection and grow in the guinea pig model (31) after 63

low dose aerosol exposure. The primary question posed was whether our model could 64

demonstrate increased pathogenicity of RD207, the sublineage that was associated 65

with more secondary cases than the other three sublineages in San Francisco. In 66

addition, we performed analysis of whole genome sequence data to explore the 67

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

4

possible mechanisms that could explain the different epidemiological and pathological 68

characteristics of the different sublineages. We also repeated the epidemiological 69

analysis with a larger sample size to confirm the relationship between the sublineages 70

and their ability to cause secondary cases in San Francisco. 71

72

MATERIALS AND METHODS 73

74

Study Population. We have been conducting a population-based study of the 75

molecular epidemiology of tuberculosis in San Francisco since 1991 (9). For the current 76

study we used M. tuberculosis identified as belonging to the Lineage 2 isolated from 77

incident cases of tuberculosis between January 1991 and December 2008. The 78

protocols and procedures for the protection of human participants were approved by the 79

University of California, San Francisco. 80

81

Genotyping. For the molecular epidemiological assessment, we used insertion 82

sequence (IS)6110 restriction fragment length polymorphism (RFLP) to determine the 83

genotype of clinical isolates of M. tuberculosis. Strains with the same IS6110 genotype 84

(identical number and molecular weight of the IS6110 bands) were defined as clustered 85

(51). Patients within the cluster were considered to have an epidemiologic link and, 86

thus, to be part of a chain of transmission. The initial case identified was considered to 87

be the index case and subsequent cases were considered secondary cases. Cases 88

having isolates with no matching RFLPs (unique cases) were considered a result of 89

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

5

reactivation of latent infection. The methods for determination of lineage and sublineage 90

have been described previously (16, 49). 91

92

Animal model. Female outbred Hartley guinea pigs (~500 g in weight) were purchased 93

from the Charles River Laboratories (North Wilmington, MA, USA) and held under 94

barrier conditions in a Biosafety Level III animal laboratory. The specific pathogen-free 95

nature of the guinea pig colonies was demonstrated by testing sentinel animals. All 96

experimental protocols were approved by the Animal Care and Usage Committee of 97

Colorado State University and comply with NIH guidelines. 98

99

Experimental infections. Ten strains representing the four sublineages with the Beijing 100

spoligotype were used in this study (Table 1). These consisted of strains 4233, 4588, 101

4619 (RD142); 3376, 3446 (RD150); 3393, 3507, 4147 (RD181); and 4334, 5097 102

(RD207). 103

104

All strains were grown in 7H9 broth containing 0.05% Tween-80. Thawed 105

aliquots of frozen cultures were diluted in sterile water to the desired inoculum 106

concentrations. A Madison chamber aerosol generation device was used to expose the 107

animals to M. tuberculosis. This device was calibrated to deliver approximately 20 bacilli 108

into the lungs. Lung bacterial counts on days 30 and 60 were determined by plating 109

serial dilutions of tissue homogenates on nutrient 7H11 agar and counting colony-110

forming units after 3 weeks incubation at 37°C. The infection inoculum and day 1 lung 111

bacterial counts were determined for all the bacterial strains tested by plating serial 112

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

6

dilutions of inoculum or tissue homogenates on nutrient 7H11 agar and counting colony-113

forming units after 3 weeks incubation at 37°C. No significant differences in terms of 114

the infection dose or the day 1 bacterial uptake values were seen among any of the 115

strains tested. 116

117

Histological analysis. Same lung lobes from each guinea pig were fixed with 4% 118

paraformaldehyde in phosphate buffered saline. Paraffin embedded sections from these 119

tissues were stained using haematoxylin and eosin and examined microscopically. The 120

concurrent progression of lung and lymph node lesions was evaluated using a 121

histological grading system (37). 122

123

Organ digestion. To prepare single cell suspensions, the same lungs, lymph nodes, 124

and spleens were perfused with 20 ml of a solution containing PBS and heparin (50 125

U/ml; Sigma-Aldrich, St. Louis, MO) through the pulmonary artery. The caudal lobe was 126

aseptically removed from the pulmonary cavity, placed in media and dissected. The 127

dissected lung tissue was incubated with complete DMEM (cDMEM media) containing 128

collagenase XI (0.7 mg/ml; Sigma-Aldrich) and type IV bovine pancreatic DNase (30 129

ug/ml; Sigma-Aldrich) for 30 minutes at 37°C. The digested lungs were further disrupted 130

by gently pushing the tissue twice through a cell strainer (BD Biosciences, Lincoln Park, 131

NJ). Red blood cells were lysed with ACK buffer, washed and resuspended in cDMEM. 132

Total cell numbers were determined by flow cytometry using BD™ Liquid Counting 133

Beads, as described by the manufacturer (BD PharMingen, San Jose, CA USA 95131). 134

135

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

7

Flow cytometric analysis of cell surface markers. Single cell suspensions from each 136

individual guinea pig were incubated first with antibodies as previously described (30, 137

31) to CD4, CD8, pan T cell, CD45, MIL4, B cell, macrophage and class II antibodies at 138

4°C for 30 minutes in the dark after washing the cells with PBS containing 0.1% sodium 139

azide (Sigma-Aldrich). The anti-guinea pig macrophage MR-1 antibody is an 140

intracytoplasmic antigen and therefore cell membranes were permeabilized using 141

Leucoperm (Serotec Inc, Raleigh, NC) according to the manufacturer’s instructions prior 142

to intracellular staining. Data acquisition and analysis were done using a FACSCalibur 143

flow cytometer (BD Biosciences, Mountain View, CA) and CellQuest software (BD 144

Biosciences, San Jose, CA). Compensation of the spectral overlap for each 145

fluorochrome was done using CD4 or MIL4 or CD3 antigens from cells gated in the 146

FSClow versus SSClow; FSCmid/high versus SSCmid/high; SSClow versus MIL4pos/neg SSChigh 147

versus MIL4neg and SSChigh versus MIL4pos region respectively. Analyses were 148

performed with an acquisition of at least 100,000 total events. 149

150

RT-PCR analysis. Expression of mRNA encoding the cytokines IFNγ, IL-12p40, TNFα, 151

TGFβ, IL-17 and the regulatory T cell associated intracellular marker Foxp3, was 152

quantified using real-time reverse transcription-polymerase chain reactions (RT-PCR). 153

The same lobe from each guinea pig (n=5) lung was added to 1 ml of TRIzol RNA 154

reagent (Invitrogen), homogenized, and frozen immediately, and total RNA was 155

extracted according to the manufacturer’s protocol. RNA samples from each group and 156

each time point were reverse transcribed using the Reverse Transcriptase Enzyme (M-157

MLV RT- Invitrogene). Four µl samples of cDNA were then amplified using the iQ SYBR 158

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

8

Green Supermix (Bio-Rad) following the manufacturer's protocol on the iQ5 iCycler 159

amplification detection system (Bio-Rad). A negative control using ultrapure Molecular 160

Biology water as the template and a non-template control (NTC) were run to confirm 161

that the signals were derived from RNA and not due to contaminating genomic DNA. In 162

order to ensure that only the correct gene was amplified, and not primer-dimer or non-163

specific secondary products, a Melt Curve was performed for each run. Fold induction of 164

mRNA was determined by analyzing cycle threshold (CT) values normalized for HPRT 165

(CT) expression. The primer sequences for guinea pig IFNγ, IL-12p40, TNFα, TGFβ1 166

and 18S were previously published (3, 26). The primer sequences for guinea pig Foxp3 167

were determined with assistance from Dr. Anand Damodaran (Genotypic Technology, 168

Bangalore, India): forward: 5’ AGAAAGCACCCTTTCAAGCA 3’; reverse: 5’ 169

GAGGAAGTCCTCTGGCTCCT 3’, and forward: 5’ TTCTTCCAAACACAGGATCAGC 170

3’; reverse: 5’ TCATTTCCGATAGGGCTTGG 3’. Primer sequences used for IL-17 were 171

forward: 5’ CTCTGCAGGACCATCTC 3’; reverse: 5’ TTACTCGGGCTGTGTCAATG 3’, 172

and forward: 5’ AGTCGTGTGTGATGGGAGTG 3’; reverse: 5’ 173

TCAAGTTCCTGCTGCTGTTG 3’. 174

175

Whole genome sequencing. Illumina technology was used to sequence the whole 176

genome of the ten M. tuberculosis strains. Briefly, DNA was fragmented, end repaired, 177

A’ tagged, ligated to adaptors, size-selected, and enriched with 18 PCR cycles. 178

Between 305 and 542 Mb of paired end 51 cycle sequence data was generated on each 179

library. 180

181

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

9

Mapping and single nucleotide polymorphism (SNP) calling. BWA was used to map 182

the reads from the 10 strains against the M. tuberculosis complex reference genome 183

which is a reconstructed ancestor that is H37Rv-like in its structure, but H37Rv alleles 184

were substituted by those present in the inferred common ancestor of all M. tuberculosis 185

complex lineages (12). BWA outputs were analyzed using the SAM tools software (23, 186

24). We applied heuristic filters to remove problematic positions and a threshold the 187

probability of difference from the reference base. We set 200 as the maximum read 188

depth to call a SNP and Phred-scaled probability was set as 20. SNP lists for individual 189

strains were combined in a single nonredundant data set, and the corresponding base 190

call was recovered for each strain. We excluded SNPs in PE/PPE genes, genes 191

described as integrase, transposase or phage and SNPs for which at least one strain 192

showed an ambiguous SNPs call. Mega 4 (46) was used to reconstruct a neighbor-193

joining phylogeny, using the number of differences for the 10 Lineage 2 strains 194

sequenced for this study, 23 sequences from different M. tuberculosis complex lineages 195

previously published (11) and the sequence of a M. tuberculosis strain from the RD105 196

sublineage from our collection of strains. SNPs were mapped to the tree using Mesquite 197

(25) and specific sublineage SNPs were identified. 198

199

Prediction of the functional effect of the nsSNPs (nonsynonymous SNPs). Sorting 200

Intolerant From Tolerant (SIFT) algorithm (28) was used to predict the mutations most 201

likely to affect protein function. SIFT searches for homologs of the gene of interest in 202

other bacteria and 1) scores the conservation of the positions where mutations are 203

found, and 2) weights this score by the nature of the amino acid change. These 204

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

10

measures were then used as a proxy for the impact of a specific mutation on protein 205

function. Mutated positions with normalized probabilities less than 0.05 were predicted 206

to have an impact on the protein and those greater than or equal to 0.05 were predicted 207

to have no impact (28). We used the non-redundant protein sequence database 208

downloaded from NCBI on June 6th, 2012. This database combines entries from 209

GenPept, Swissprot, PIR, PDF, PDB, and NCBI RefSeq. Only nsSNPs for monophyletic 210

groups (observed in all its descendants) were included in the analysis. 211

212

Statistical analysis. To determine the association between the sublineages and 213

secondary cases, univariate analyses were performed using the χ2 test of proportions 214

and the 2-tailed Fisher's exact test. Univariate and multivariate odds ratios (ORs) were 215

calculated using logistic regression with secondary case status as the dependent 216

variable. The independent variable of primary interest was the specific Lineage 2 217

sublineage, and the analysis was controlled for place of birth (United States-born vs. 218

foreign-born), smear positivity and cavitary disease. Statistical analyses were performed 219

with SAS version 9.2 (SAS Institute Inc., Cary, NC, USA). The guinea pig data are 220

representatives of one experiment. Each experiment consisted of 5 guinea pigs infected 221

with one of the M. tuberculosis strains for each of the time points 0, 30, and 60 (total of 222

15 guinea pigs per strain). Mean values were calculated from results for individual 223

guinea pigs within each group (n=5) standard error of the mean (SEM). Student t-test 224

was used to compare the statistical differences in numbers of bacilli, flow cytometric 225

data and RT-PCR values between different groups. 226

227

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

11

228

229

230

RESULTS 231

232

Relationship between sublineages and the ability to cause secondary cases. From 233

January 1991 to December 2008, 3847 cases of tuberculosis were reported in San 234

Francisco, of whom 3311 (86%) had a positive culture for M. tuberculosis. RFLPs and 235

lineage data were available for 2361 (71%) of all culture-positive cases. There were 648 236

(27%) patients with M. tuberculosis from Lineage 2 and 593 (92%) had sublineage data. 237

We excluded 7 index cases with solely extrapulmonary disease, as their likelihood of 238

transmitting M. tuberculosis is low, and assigned index case status to the next 239

pulmonary case in sequence. The clinical characteristics were similar among patients 240

with and those without sublineage data. Based on RFLP genotyping, there were 114 241

secondary cases associated with 65 index cases and 407 cases with unique isolates. 242

Univariate analysis demonstrated that patients born in the United States were more 243

likely to be secondary cases (OR 6.61, 95% CI 3.88–11.2, P < 0.001) as well as 244

patients with isolates from sublineage RD207 when compared with the other 245

sublineages (OR 2.04, 95% CI 1.02–4.08 P = 0.04; Table 2). The multivariate analysis 246

was based on 92 clustered cases (of 114) in 481 observations (sputum smear status 247

was not available in several cases). It showed that the only independently significant 248

risk factor for being a secondary case was being born in the United States (OR 5.22, 249

95% CI 2.89–9.42, P < 0.001) . The adjusted odds of sublineage RD207 being a 250

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

12

secondary case were 1.98 (95% CI 0.91–4.29, P = 0.08, Table 2), which is higher than 251

we previously published (19) and supports the previous observation that in San 252

Francisco sublineage RD207 may be more likely to be transmitted than other 253

sublineages. 254

255

Capacity of clinical isolates to grow after low dose aerosol exposure. The course 256

of infection in the lungs of guinea pigs harboring each isolate is shown in Figure 1. All 257

ten strains grew progressively for the first 30 days, with the members of the RD142, 258

RD150, and RD207 sublineages growing well, with more modest growth seen for the 259

three RD181 isolates. 260

261

All ten infections caused moderate to severe pathology in the lungs over the 262

course of the infection (Fig. 2 and 3). In all cases the infections induced extensive mixed 263

inflammation and necrosis, but this was particularly pronounced in the case of the two 264

RD207 sublineage strains 4334 and 5097 infections (Fig. 3G-J) which established 265

multiple large highly necrotic lesions in the lungs by day 30, resulting in marked 266

consolidation by day 60. Milder degrees of pathology at day 30 were seen in the other 267

groups, particularly RD150 and RD181. By day 60, lesions in all the animals infected 268

with the clinical isolates showed severe increases in secondary lesion progression, 269

characterized by multiple foci of extensive inflammation coalescing within the pulmonary 270

parenchyma (Fig. 2 and 3) whereas lung involvement in the cases of the two RD207 271

sublineage strains was especially severe (Fig. 3G-J). These progressive changes in 272

tissue lesions were further reflected by lesion score analysis, revealing that RD207 273

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

13

sublineage strains showed statistically significantly more extensive damage in the lungs 274

compared to all the other sublineages over the course of the infections (Fig. 4A-B). 275

276

Immune responses to the clinical isolates. We tracked the expression of the TH1 277

cytokines IFN , IL-12p40 and TNF (Fig. 5) and compared this information based on 278

the closer phylogenetic relationship between the respective two strains to levels of pro-279

inflammatory IL-17, and Foxp3 and TGFβ (Fig. 6), markers associated with down-280

regulation of immunity. All ten strains generated appreciable levels of the cytokines 281

IFN , IL-12p40 and TNF , indicating generation of a TH1 response (Fig. 5A-C). 282

Whereas strong signals were observed for IFN (Fig. 5A), these waned significantly by 283

day 60 in animals infected with the RD150 and RD207 strains. 284

285

We also examined the induction of regulatory molecules, given our earlier 286

observations (32, 44) that this seems to be a common property of many of the Beijing 287

strains. As the infections progressed increases in message for Foxp3 were seen in all 288

strains (Fig. 6A), most significantly for the two RD207 strains, suggesting the arrival in 289

the lungs of regulatory T cells. In addition, a very large increase in TGFβ expression 290

(Fig. 6B) in animals infected with the two RD207 strains was observed during this time. 291

Finally, increased expression of IL-17 message was observed (Fig 6C), again very 292

prominently in response to the two RD207 and RD150 strains. This observation is 293

consistent with the high levels of lung consolidation seen, presumably driven by IL-17 294

mediated local chemokine release. 295

296

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

14

We used flow cytometric protocols (31) to further define the cellular response in 297

the guinea pig lungs. As shown in Figure 7A, we observed substantially increased 298

numbers of activated CD4+ CD45hi T cells in the lungs of guinea pigs infected with the 299

RD207 and RD142 sublineage strains on day 30 after infection. However, as the 300

infection progressed the numbers of these cells dropped precipitously by day 60 (Fig. 301

7B). 302

303

Whole genome sequence analysis. Analysis of the 10 whole-genome sequences 304

identified a total of 1534 SNPs specific for Lineage 2. We inferred 51 nsSNPs specific 305

for the RD207 sublineage, 24 for the RD142 sublineage, and 28 for the RD150 306

sublineage. There were no mutations exclusive for the RD181 sublineage as all the 307

mutations observed in RD181 were also present in RD150 and RD142 strains. The 308

number of nsSNPs that were considered to have an impact on the gene function based 309

on the SIFT analysis, were 18, 13 and 16, respectively. The list of the genes affected 310

and their SIFT value are shown in Table 3. 311

312

DISCUSSION 313

All the strains representing four sublineages of the Lineage 2 of M. tuberculosis with the 314

Beijing spoligotype were capable of growing and causing lung pathology in guinea pigs 315

exposed to low dose aerosol infection. The ability of mycobacteria to grow in the lungs 316

over time is the most conventional measure of strain virulence. While differences 317

between the four sublineages were not overt, members of the RD207 sublineage, 318

consisting of strains more likely to cause secondary clinical cases, caused more severe 319

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

15

pathology in these animals compared to members of the RD142 or RD181 sublineages, 320

with the fourth sublineage, RD150, showing an intermediate pattern. All strains tested 321

were capable of inducing TH1 immunity. In comparison with the RD207 sublineage the 322

RD142 strains showing the highest IFN responses which were associated with mild 323

inflammation and reduced regulatory Foxp3+ expression. This finding suggests that the 324

RD142 strains are more immunogenic, and is consistent with the ability of the guinea 325

pigs to control and contain these particular strains more quickly. In addition, all strains 326

induced some degree of regulatory host molecules [Foxp3, TGF , and IL-17] which 327

seems to be a general property of the Beijing strains analyzed in animal studies to date 328

(32, 44). Members of the RD207 sublineage gave the highest signals. 329

330

Animals infected with the RD207 sublineage showed both a significant drop in 331

activated CD4+ CD45hi T cells in the lungs as the infections progressed, and a 332

concomitant large rise in markers associated with regulatory T cell influx into the lungs. 333

Together, these data indicate that different sublineages of Lineage 2 do not behave in a 334

comparable manner in the animal model, but instead have some observable differences 335

in their degree of immunopathology and capacity to generate protective and/or 336

regulatory immunity. Hence, this supports the hypothesis, albeit made cautiously, that 337

the sublineage of Lineage 2 may be associated with distinct clinical and pathological 338

properties, and that these properties may influence the transmission capacity of isolates 339

within patient communities. 340

341

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

16

To explore the possible mechanisms for differences observed across 342

sublineages, we analyzed the whole genome sequence of the strains included in this 343

study. Each of the sublineages had specific mutations that based on their SIFT values 344

suggested an impact on gene function. The strains from sublineage RD207 had a 345

mutation in Rv0989c (grcC2) a diphosphate synthase required for cell wall biosynthesis 346

(27). These strains had also a mutation in the gene Rv2959c, a methyltransferase 347

involved in the biosynthesis of phenolglycolipid, which is considered a virulence factor 348

(39). It is tantalizing to speculate that a mutation in this gene may render the bacteria 349

more virulent as observed in the epidemiologic analysis (more secondary cases) and in 350

the animal model (more necrosis and inflammation). 351

352

The strains from sublineage RD150 had mutations that may have an impact on 353

the function of four interesting genes. Rv0577, a gene restricted to members of the MTB 354

complex (18), has been used for diagnostic purposes (45). The protein encoded by 355

Rv0577 may regulate innate and adaptive immunity by interacting with Toll-like receptor 356

2 (8). Rv1009 (rpfB) is one of the most immunogenic resuscitation-promoting factors 357

(40) and deletion of this gene has been associated with delayed reactivation from 358

chronic tuberculosis in mouse (50). Rv1638 (uvrA) is part of the nucleotide excision 359

repair system which counteracts the deleterious effects of DNA lesions (41) and is 360

essential for M. smegmatis to survive in conditions of hypoxia and low carbon source 361

(13). Rv2416c (eis) is a secretory protein, and enhances intracellular survival of M. 362

tuberculosis in monocytes and contributes to its pathogenicity (53). A study 363

demonstrated that Eis impaired the host defense against tuberculosis by disturbing the 364

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

17

cross regulation of T-cells, producing an imbalance between TH1 and TH2 response, 365

which could be a factor in the pathogenesis of tuberculosis (22). 366

367

The strains from sublineage 142 have mutations in three interesting genes for 368

which other polymorphisms have been described. Rv0989c (grcC2), which had a 369

different mutation in RD142 strains than the RD 207 strains discussed previously. 370

Rv1811 (mgtC) encodes a virulence factor required to survive in the macrophages and 371

in conditions with low Mg2+ (6). Different mutations in this gene have been described in 372

strains from the Euro-American lineage (spoligotype Haarlem) (2). Rv1317c (alkA) is 373

part of the AdaA-AlkA adaptive response in M. tuberculosis, and multiple mutations 374

have been described in strains from Lineage 4 (Euro-American), Lineage 2 (same 375

mutation has been described before in the W-Beijing 210 strain which belongs to the 376

RD 142 sublineage) and in M. bovis (29) . It has been suggested that a defective 377

adaptive response by these genes will confer a selective advantage to the M. 378

tuberculosis (54). 379

The strains from RD181 are a paraphyletic group, defined as a group of 380

organisms which includes the most recent common ancestor of all of its members, but 381

not all of the descendants of that most recent common ancestor. In this particular case, 382

RD181 strains share a common ancestor, but the group also includes RD150 and 383

RD142 strains. This implies that SNPs shared by all RD181 strains are also present in 384

RD150 and RD142 strains, and there were not common nsSNPs exclusive for all 385

RD181. 386

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

18

Although some of these mutations may explain the pathological and 387

immunological differences observed, there are a multitude of factors that can influence 388

the transmission and pathogenic capabilities of a given isolate, such as host and 389

environmental factors (5, 20, 27, 38), HIV co-infection (42) and the concentration of 390

organisms in environmental air (17). Until recently, the only bacterial factor considered 391

was the presence of drug resistance; some studies have suggested that M. tuberculosis 392

resistant to isoniazid is less transmissible (52) and less pathogenic than fully 393

susceptible organisms (7, 11), although an earlier study in our laboratory (33) 394

investigating the virulence of multidrug resistant isolates did not show much evidence of 395

loss of virulence of these strains. More recent studies suggest that different groups of 396

isolates of M. tuberculosis may contribute to different clinical outcomes (14). As noted 397

recently (52), the application of new molecular typing techniques has increased both our 398

knowledge of bacterial factors and also the identification of separate lineages of 399

isolates. It is overly optimistic to expect that the myriad of factors can be modeled in 400

animals such as the guinea pig used here, but such models can provide clues. Like 401

humans, the guinea pig undergoes a process of granulomatous inflammation and 402

necrosis when infected with M. tuberculosis, and the differing degrees to which this 403

occurs may be an indicator of the virulence of the infecting isolate (36, 37). Moreover, 404

by applying new flow cytometric techniques (30, 31) and RT-PCR methods, one can 405

detect differences in the expression of protective immunity (RD142 strains clearly 406

generated the strongest response, suggesting that they are of increased 407

immunogenicity), as well as the induction of signals consistent with the generation of 408

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

19

regulatory T cells (which we found here to be highest in animals infected with the 409

RD207 strains). 410

411

Most studies to date on the pathogenicity of strains in the guinea pig model have 412

tended to focus on the Beijing strains, and far less is known about other lineages or 413

families of strains. There is a growing concern that the newly emerging isolates of M. 414

tuberculosis in general are more pathogenic, and this may have a serious impact on 415

vaccine effectiveness. Not only is there a suspicion that BCG may actually have 416

selected for the more virulent strains (1), but recent data (32) shows that BCG is only 417

transiently protective against Beijing strains and cannot overcome the induction of 418

regulatory T cells. Since some new generation vaccines are also based on BCG (4), this 419

raises the real possibility that such vaccines will not work (32, 34, 35). While as yet 420

unproven, the induction of regulatory T cells by these pathogenic strains, coupled with 421

dampening or loss of protective immunity but continuance of TH17 responses (as seen 422

here) may drive the degree of severity of lung pathology, which in turn will enable bacilli 423

to escape the lungs and then potentially be transmitted. 424

425

One of the primary public health strategies to control tuberculosis is the 426

evaluation of persons in close contact with an infectious tuberculosis patient (contact 427

investigation) to identify secondary cases of active tuberculosis and latent tuberculosis 428

infection. The bacterial factors governing transmissibility and pathogenicity of M. 429

tuberculosis are poorly understood. Therefore, additional clinical and animal studies 430

such as ours may serve to identify factors (like the features of the exposure or the 431

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

20

immune status of the exposed person) that suggest a situation in which there is a 432

greater risk to developing active tuberculosis. In these cases, the evaluation of contacts 433

should be undertaken with greater urgency. Also, we have discovered mutations likely 434

to be functional in genes that are currently being used for diagnostic purposes (Rv0577, 435

Rv1009) (10, 45) or as candidates for sub-unit vaccines (Rv1009). These 436

polymorphisms may limit their efficacy as diagnostic or vaccine targets. 437

438

In conclusion, the current molecular-based sublineage classification appears to 439

be associated biologically with clinical and pathological consequences, and differences 440

between sublineages, particularly in the context of loss of protective immunity and 441

increased lung damage, may favor or influence the capacity of these isolates to be 442

transmitted within communities. 443

444

445

ACKNOWLEDGEMENTS 446

This work was supported by the National Instituteof Allergy and Infectious Diseases at 447

the National Institutes of Health [grant numbers AI083856, AI081959, AI070456, 448

AI092002, AI034238, AI090928, and HHSN266200700022C]; National Institutes of 449

Health Innovation Award [grant number 1DP2OD006450], the American Recovery and 450

Reinvestment Act funds, and the Swiss National Science Foundation [PP00A-119205]. 451

Further support was provided by the College of Veterinary Medicine and Biomedical 452

Sciences, Colorado State University. We would like to thank M Shin and J Nguyen for 453

library preparation and sequence data generation. 454

455

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

21

456

REFERENCES 457

1. Abebe, F., and G. Bjune. 2006. The emergence of Beijing family genotypes of 458

Mycobacterium tuberculosis and low-level protection by bacille Calmette-Guerin 459

(BCG) vaccines: is there a link? Clin Exp Immunol 145:389-397. 460

2. Alix, E., S. Godreuil, and A. B. Blanc-Potard. 2006. Identification of a Haarlem 461

genotype-specific single nucleotide polymorphism in the mgtC virulence gene of 462

Mycobacterium tuberculosis. J Clin Microbiol 44:2093-2098. 463

3. Allen, S. S., J. T. Mackie, K. Russell, A. Jeevan, T. A. Skwor, and D. N. 464

McMurray. 2008. Altered inflammatory responses following transforming growth 465

factor-beta neutralization in experimental guinea pig tuberculous pleurisy. 466

Tuberculosis (Edinb) 88:430-436. 467

4. Beresford, B., and J. C. Sadoff. Update on research and development pipeline: 468

tuberculosis vaccines. Clin Infect Dis 50 Suppl 3:S178-183. 469

5. Borgdorff, M. W., S. van den Hof, K. Kremer, L. Verhagen, N. Kalisvaart, C. 470

Erkens, and D. van Soolingen. Progress towards tuberculosis elimination: 471

secular trend, immigration and transmission. Eur Respir J 36:339-347. 472

6. Buchmeier, N., A. Blanc-Potard, S. Ehrt, D. Piddington, L. Riley, and E. A. 473

Groisman. 2000. A parallel intraphagosomal survival strategy shared by 474

Mycobacterium tuberculosis and Salmonella enterica. Mol Microbiol 35:1375-475

1382. 476

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

22

7. Burgos, M., K. DeRiemer, P. M. Small, P. C. Hopewell, and C. L. Daley. 2003. 477

Effect of drug resistance on the generation of secondary cases of tuberculosis. J 478

Infect Dis 188:1878-1884. 479

8. Byun, E. H., W. S. Kim, J. S. Kim, I. D. Jung, Y. M. Park, H. J. Kim, S. N. Cho, 480

and S. J. Shin. 2012. Mycobacterium tuberculosis Rv0577, a novel TLR2 481

agonist, induces maturation of dendritic cells and drives Th1 immune response. 482

FASEB J. 483

9. Cattamanchi, A., P. C. Hopewell, L. C. Gonzalez, D. H. Osmond, L. Masae 484

Kawamura, C. L. Daley, and R. M. Jasmer. 2006. A 13-year molecular 485

epidemiological analysis of tuberculosis in San Francisco. Int J Tuberc Lung Dis 486

10:297-304. 487

10. Chegou, N. N., G. F. Black, A. G. Loxton, K. Stanley, P. N. Essone, M. R. 488

Klein, S. K. Parida, S. H. Kaufmann, T. M. Doherty, A. H. Friggen, K. L. 489

Franken, T. H. Ottenhoff, and G. Walzl. 2012. Potential of novel Mycobacterium 490

tuberculosis infection phase-dependent antigens in the diagnosis of TB disease 491

in a high burden setting. BMC Infect Dis 12:10. 492

11. Cohen, T., B. Sommers, and M. Murray. 2003. The effect of drug resistance on 493

the fitness of Mycobacterium tuberculosis. Lancet Infect Dis 3:13-21. 494

12. Comas, I., J. Chakravartti, P. M. Small, J. Galagan, S. Niemann, K. Kremer, 495

J. D. Ernst, and S. Gagneux. 2010. Human T cell epitopes of Mycobacterium 496

tuberculosis are evolutionarily hyperconserved. Nat Genet 42:498-503. 497

13. Cordone, A., B. Audrain, I. Calabrese, D. Euphrasie, and J. M. Reyrat. 2011. 498

Characterization of a Mycobacterium smegmatis uvrA mutant impaired in 499

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

23

dormancy induced by hypoxia and low carbon concentration. BMC Microbiol 500

11:231. 501

14. de Jong, B. C., P. C. Hill, A. Aiken, T. Awine, M. Antonio, I. M. Adetifa, D. J. 502

Jackson-Sillah, A. Fox, K. Deriemer, S. Gagneux, M. W. Borgdorff, K. P. 503

McAdam, T. Corrah, P. M. Small, and R. A. Adegbola. 2008. Progression to 504

active tuberculosis, but not transmission, varies by Mycobacterium tuberculosis 505

lineage in The Gambia. J Infect Dis 198:1037-1043. 506

15. Ebrahimi-Rad, M., P. Bifani, C. Martin, K. Kremer, S. Samper, J. Rauzier, B. 507

Kreiswirth, J. Blazquez, M. Jouan, D. van Soolingen, and B. Gicquel. 2003. 508

Mutations in putative mutator genes of Mycobacterium tuberculosis strains of the 509

W-Beijing family. Emerg Infect Dis 9:838-845. 510

16. Gagneux, S., K. DeRiemer, T. Van, M. Kato-Maeda, B. C. de Jong, S. 511

Narayanan, M. Nicol, S. Niemann, K. Kremer, M. C. Gutierrez, M. Hilty, P. C. 512

Hopewell, and P. M. Small. 2006. Variable host-pathogen compatibility in 513

Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 103:2869-2873. 514

17. Houk, V. N., J. H. Baker, K. Sorensen, and D. C. Kent. 1968. The 515

epidemiology of tuberculosis infection in a closed environment. Arch Environ 516

Health 16:26-35. 517

18. Huard, R. C., S. Chitale, M. Leung, L. C. Lazzarini, H. Zhu, E. Shashkina, S. 518

Laal, M. B. Conde, A. L. Kritski, J. T. Belisle, B. N. Kreiswirth, J. R. Lapa e 519

Silva, and J. L. Ho. 2003. The Mycobacterium tuberculosis complex-restricted 520

gene cfp32 encodes an expressed protein that is detectable in tuberculosis 521

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

24

patients and is positively correlated with pulmonary interleukin-10. Infect Immun 522

71:6871-6883. 523

19. Kato-Maeda, M., E. Y. Kim, L. Flores, L. G. Jarlsberg, D. Osmond, and P. C. 524

Hopewell. 2010. Differences among sublineages of the East-Asian lineage of 525

Mycobacterium tuberculosis in genotypic clustering. Int J Tuberc Lung Dis 526

14:538-544. 527

20. Kik, S. V., S. Verver, D. van Soolingen, P. E. de Haas, F. G. Cobelens, K. 528

Kremer, H. van Deutekom, and M. W. Borgdorff. 2008. Tuberculosis outbreaks 529

predicted by characteristics of first patients in a DNA fingerprint cluster. American 530

journal of respiratory and critical care medicine 178:96-104. 531

21. Kremer, K., J. R. Glynn, T. Lillebaek, S. Niemann, N. E. Kurepina, B. N. 532

Kreiswirth, P. J. Bifani, and D. van Soolingen. 2004. Definition of the 533

Beijing/W lineage of Mycobacterium tuberculosis on the basis of genetic markers. 534

J Clin Microbiol 42:4040-4049. 535

22. Lella, R. K., and C. Sharma. 2007. Eis (enhanced intracellular survival) protein 536

of Mycobacterium tuberculosis disturbs the cross regulation of T-cells. J Biol 537

Chem 282:18671-18675. 538

23. Li, H., and R. Durbin. 2009. Fast and accurate short read alignment with 539

Burrows-Wheeler transform. Bioinformatics 25:1754-1760. 540

24. Li, H., B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, 541

G. Abecasis, and R. Durbin. 2009. The Sequence Alignment/Map format and 542

SAMtools. Bioinformatics 25:2078-2079. 543

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

25

25. Maddison, W. P., and D. R. Maddison. Mesquite: a modular system for 544

evolutionary analysis., 2.73. ed. 545

26. McMurray, D. N., S. S. Allen, A. Jeevan, T. Lasco, H. Cho, T. Skwor, T. 546

Yamamoto, C. McFarland, and T. Yoshimura. 2005. Vaccine-induced cytokine 547

responses in a guinea pig model of pulmonary tuberculosis. Tuberculosis (Edinb) 548

85:295-301. 549

27. Mitruka, K., J. E. Oeltmann, K. Ijaz, and M. B. Haddad. 2011. Tuberculosis 550

outbreak investigations in the United States, 2002-2008. Emerg Infect Dis 551

17:425-431. 552

28. Ng, P. C., and S. Henikoff. 2001. Predicting deleterious amino acid 553

substitutions. Genome Res 11:863-874. 554

29. Nouvel, L. X., T. Dos Vultos, E. Kassa-Kelembho, J. Rauzier, and B. Gicquel. 555

2007. A non-sense mutation in the putative anti-mutator gene ada/alkA of 556

Mycobacterium tuberculosis and M. bovis isolates suggests convergent 557

evolution. BMC Microbiol 7:39. 558

30. Ordway, D., M. Henao-Tamayo, C. Shanley, E. E. Smith, G. Palanisamy, B. 559

Wang, R. J. Basaraba, and I. M. Orme. 2008. Influence of Mycobacterium bovis 560

BCG vaccination on cellular immune response of guinea pigs challenged with 561

Mycobacterium tuberculosis. Clin Vaccine Immunol 15:1248-1258. 562

31. Ordway, D., G. Palanisamy, M. Henao-Tamayo, E. E. Smith, C. Shanley, I. M. 563

Orme, and R. J. Basaraba. 2007. The cellular immune response to 564

Mycobacterium tuberculosis infection in the guinea pig. J Immunol 179:2532-565

2541. 566

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

26

32. Ordway, D. J., S. Shang, M. Henao-Tamayo, A. Obregon-Henao, L. Nold, M. 567

Caraway, C. A. Shanley, R. J. Basaraba, C. G. Duncan, and I. M. Orme. 568

Mycobacterium bovis BCG-Mediated Protection against W-Beijing Strains of 569

Mycobacterium tuberculosis Is Diminished Concomitant with the Emergence of 570

Regulatory T Cells. Clin Vaccine Immunol 18:1527-1535. 571

33. Ordway, D. J., M. G. Sonnenberg, S. A. Donahue, J. T. Belisle, and I. M. 572

Orme. 1995. Drug-resistant strains of Mycobacterium tuberculosis exhibit a 573

range of virulence for mice. Infect Immun 63:741-743. 574

34. Orme, I. M. The Achilles heel of BCG. Tuberculosis (Edinb) 90:329-332. 575

35. Orme, I. M. Development of new vaccines and drugs for TB: limitations and 576

potential strategic errors. Future microbiology 6:161-177. 577

36. Palanisamy, G. S., N. DuTeau, K. D. Eisenach, D. M. Cave, S. A. Theus, B. N. 578

Kreiswirth, R. J. Basaraba, and I. M. Orme. 2009. Clinical strains of 579

Mycobacterium tuberculosis display a wide range of virulence in guinea pigs. 580

Tuberculosis (Edinb) 89:203-209. 581

37. Palanisamy, G. S., E. E. Smith, C. A. Shanley, D. J. Ordway, I. M. Orme, and 582

R. J. Basaraba. 2008. Disseminated disease severity as a measure of virulence 583

of Mycobacterium tuberculosis in the guinea pig model. Tuberculosis (Edinb) 584

88:295-306. 585

38. Pena, M. J., J. A. Caminero, M. I. Campos-Herrero, J. C. Rodriguez-Gallego, 586

M. I. Garcia-Laorden, P. Cabrera, M. J. Torres, B. Lafarga, F. Rodriguez de 587

Castro, S. Samper, F. Canas, D. A. Enarson, and C. Martin. 2003. 588

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

27

Epidemiology of tuberculosis on Gran Canaria: a 4 year population study using 589

traditional and molecular approaches. Thorax 58:618-622. 590

39. Perez, E., P. Constant, F. Laval, A. Lemassu, M. A. Laneelle, M. Daffe, and 591

C. Guilhot. 2004. Molecular dissection of the role of two methyltransferases in 592

the biosynthesis of phenolglycolipids and phthiocerol dimycoserosate in the 593

Mycobacterium tuberculosis complex. J Biol Chem 279:42584-42592. 594

40. Romano, M., E. Aryan, H. Korf, N. Bruffaerts, C. L. Franken, T. H. Ottenhoff, 595

and K. Huygen. 2012. Potential of Mycobacterium tuberculosis resuscitation-596

promoting factors as antigens in novel tuberculosis sub-unit vaccines. Microbes 597

Infect 14:86-95. 598

41. Rossi, F., J. S. Khanduja, A. Bortoluzzi, J. Houghton, P. Sander, C. 599

Guthlein, E. O. Davis, B. Springer, E. C. Bottger, A. Relini, A. Penco, K. 600

Muniyappa, and M. Rizzi. 2011. The biological and structural characterization of 601

Mycobacterium tuberculosis UvrA provides novel insights into its mechanism of 602

action. Nucleic Acids Res 39:7316-7328. 603

42. Selwyn, P. A., D. Hartel, V. A. Lewis, E. E. Schoenbaum, S. H. Vermund, R. 604

S. Klein, A. T. Walker, and G. H. Friedland. 1989. A prospective study of the 605

risk of tuberculosis among intravenous drug users with human immunodeficiency 606

virus infection. N Engl J Med 320:545-550. 607

43. Shah, N. S., A. Wright, G. H. Bai, L. Barrera, F. Boulahbal, N. Martin-608

Casabona, F. Drobniewski, C. Gilpin, M. Havelkova, R. Lepe, R. Lumb, B. 609

Metchock, F. Portaels, M. F. Rodrigues, S. Rusch-Gerdes, A. Van Deun, V. 610

Vincent, K. Laserson, C. Wells, and J. P. Cegielski. 2007. Worldwide 611

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

28

emergence of extensively drug-resistant tuberculosis. Emerg Infect Dis 13:380-612

387. 613

44. Shang, S., M. Harton, M. H. Tamayo, C. Shanley, G. S. Palanisamy, M. 614

Caraway, E. D. Chan, R. J. Basaraba, I. M. Orme, and D. J. Ordway. 615

Increased Foxp3 expression in guinea pigs infected with W-Beijing strains of M. 616

tuberculosis. Tuberculosis (Edinb) 91:378-385. 617

45. Sobral, L. F., R. S. Duarte, G. B. Vieira, M. G. Silva, N. Boechat, and L. d. S. 618

Fonseca. 2011. Identification of Mycobacterium bovis among mycobacterial 619

isolates from human clinical specimens at a university hospital in Rio de Janeiro, 620

Brazil. J Bras Pneumol 37:664-668. 621

46. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular 622

Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular biology 623

and evolution 24:1596-1605. 624

47. Tsenova, L., E. Ellison, R. Harbacheuski, A. L. Moreira, N. Kurepina, M. B. 625

Reed, B. Mathema, C. E. Barry, 3rd, and G. Kaplan. 2005. Virulence of 626

Selected Mycobacterium tuberculosis Clinical Isolates in the Rabbit Model of 627

Meningitis Is Dependent on Phenolic Glycolipid Produced by the Bacilli. J Infect 628

Dis 192:98-106. 629

48. Tsolaki, A. G., S. Gagneux, A. S. Pym, Y. O. Goguet de la Salmoniere, B. N. 630

Kreiswirth, D. Van Soolingen, and P. M. Small. 2005. Genomic deletions 631

classify the Beijing/W strains as a distinct genetic lineage of Mycobacterium 632

tuberculosis. J Clin Microbiol 43:3185-3191. 633

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

29

49. Tsolaki, A. G., A. E. Hirsh, K. DeRiemer, J. A. Enciso, M. Z. Wong, M. 634

Hannan, Y. O. Goguet de la Salmoniere, K. Aman, M. Kato-Maeda, and P. M. 635

Small. 2004. Functional and evolutionary genomics of Mycobacterium 636

tuberculosis: insights from genomic deletions in 100 strains. Proc Natl Acad Sci 637

U S A 101:4865-4870. 638

50. Tufariello, J. M., K. Mi, J. Xu, Y. C. Manabe, A. K. Kesavan, J. Drumm, K. 639

Tanaka, W. R. Jacobs, Jr., and J. Chan. 2006. Deletion of the Mycobacterium 640

tuberculosis resuscitation-promoting factor Rv1009 gene results in delayed 641

reactivation from chronic tuberculosis. Infect Immun 74:2985-2995. 642

51. van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. 643

Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, and et al. 1993. 644

Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: 645

recommendations for a standardized methodology. J Clin Microbiol 31:406-409. 646

52. Verhagen, L. M., S. van den Hof, H. van Deutekom, P. W. Hermans, K. 647

Kremer, M. W. Borgdorff, and D. van Soolingen. 2011. Mycobacterial factors 648

relevant for transmission of tuberculosis. J Infect Dis 203:1249-1255. 649

53. Wu, S., P. F. Barnes, B. Samten, X. Pang, S. Rodrigue, S. Ghanny, P. 650

Soteropoulos, L. Gaudreau, and S. T. Howard. 2009. Activation of the eis 651

gene in a W-Beijing strain of Mycobacterium tuberculosis correlates with 652

increased SigA levels and enhanced intracellular growth. Microbiology 155:1272-653

1281. 654

54. Yang, M., R. M. Aamodt, B. Dalhus, S. Balasingham, I. Helle, P. Andersen, T. 655

Tonjum, I. Alseth, T. Rognes, and M. Bjoras. 2011. The ada operon of 656

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

30

Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible 657

repair of DNA alkylation damage. DNA Repair (Amst) 10:595-602. 658

659

660

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

31

661

Figure Legends. 662

Figure 1. Course of infection following exposure of guinea pigs to approximately 20 663

viable M. tuberculosis bacilli representing four sublineages of the East Asian lineage. 664

The panel shows the bacterial growth in the lungs from guinea pigs receiving a low dose 665

aerosol of M. tuberculosis laboratory strains assayed on days 30 and 60 after infection. 666

Results are expressed logarithmically as the mean Log10 bacilli colony forming units 667

(CFU) (n=5); SEM did not exceed 0.35. 668

669

Figure 2. The granulomatous responses from guinea pigs infected with the sublineage 670

RD142 and RD150 strains of M. tuberculosis. The panel shows representative 671

photomicrographs from sections of paraformaldehyde-fixed and paraffin embedded 672

guinea pig tissues from the same lungs which were collected on days 30 and 60 after 673

infection with RD142 (A-F) and RD150 (G-J) strains. In all animals there were 674

coalescing foci of inflammation that tracked along airways. Inflammatory lesions had 675

central regions of necrosis surrounded by histiocytic cells and peripheral lymphocytes. 676

By day 60 there was often mineral present within the lesions. The severity of 677

inflammation and pulmonary consolidation was greater in RD142 relative to RD150. 678

Hematoxylin and Eosin staining, total magnification=A-J, 10x. 679

680

Figure 3. The granulomatous responses from guinea pigs infected with the sublineages 681

RD181 and RD207 strains of M. tuberculosis. The panel shows representative 682

photomicrographs from sections of paraformaldehyde-fixed and paraffin embedded 683

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

32

guinea pig tissues from the same lungs which were collected on days 30 and 60 after 684

infection with RD181 (A-F) and RD207 (G-J) strains. Pulmonary pathology was similar 685

to that seen with strains RD142 and RD150 (Fig. 2). The extent of lung involvement was 686

notably greater with the RD207 strains relative to the RD181 strains, and very severe by 687

day 60 (G-J). Hematoxylin and Eosin staining, total magnification= A-J, 10x. 688

689

Figure 4. The sublineage RD207 shows increased lesion scores in the lungs. Lung 690

lesion scores for the guinea pigs on day 30 (panel A) and day 60 (panel B) after 691

infection with the various sublineage strains. The histopathology was characterized 692

using a lesion scoring system that showed the significant extent of lung disease 693

compared to the other organs during chronic infection (n=5, * Student t-test P < 0.05). 694

Please note that the calcification:necrosis ratio was zero for all strains in Panel A. 695

696

Figure 5. RT-PCR analysis of the fold increase in expression of cytokines associated 697

with the TH1 response in the lungs of guinea pigs following exposure to representative 698

strains of the four sublineages of the East Asian lineage. Panel A shows IFN-γ, panel B 699

IL-12p40 and panel C shows TNF expression in the lungs on days 30 and 60 from 700

guinea pigs exposed to a low dose of RD142 (4588 and 4619); RD150 (3446 and 701

3376); RD181 (3507 and 3393); and RD207 (5097 and 4334) sublineage strains. 702

Cytokine mRNA expression was quantified using real-time RT-PCR. Fold induction of 703

mRNA was calculated from the threshold cycle (CT) normalized to HPRT CT values 704

using the values of the uninfected guinea pig lung cells. Results are expressed as the 705

average (n=4) of the fold induction in each group (SEM did not exceed 0.30). *Student t-706

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

33

test: for IFN RD142/150 [P < 0.01], for RD181/207 [P < 0.04], and TNF for 707

RD181/207 [P < 0.03]. 708

709

710

Figure 6. RT-PCR analysis of the fold increase in expression of proteins associated 711

with regulatory T cell and TH17 T cell responses in the lungs of guinea pigs following 712

exposure to representative strains of the four sublineages of the East Asian lineage. 713

Panel A shows Foxp3, panel B TGFβ and panel C shows IL-17 expression in the lungs 714

on days 30 and 60 from guinea pigs exposed to a low dose of RD142 (4588 and 4619); 715

RD150 (3446 and 3376); RD181 (3507 and 3393); and RD207 (5097 and 4334) 716

sublineage strains. Cytokine mRNA expression was quantified using real-time RT-PCR. 717

Fold induction of mRNA was calculated from the threshold cycle (CT) normalized to 718

HPRT CT values and then to uninfected guinea pig lung cells. Results are expressed as 719

the average (n=4) of the fold induction in each group (SEM did not exceed 0.30). 720

*Student t-test: for Foxp3 RD181/207 [P < 0.04], for TGFβ RD181/207 [P < 0.02], for IL-721

17 RD142/150 [P < 0.04], and RD181/207 [P < 0.01]. 722

723

Figure 7. Flow cytometric analysis of CD4+ and CD45hi T cell subsets accumulating in 724

the lungs over the course of the infection with representative strains of the four 725

sublineages of the East Asian lineage. Panel A shows representative flow cytometric 726

analysis after 30 days of infection of the percentages of CD4+ and CD45hi T cell cells in 727

RD142, RD150, RD181, and RD207 sublineages. Panel B shows the number of cells in 728

the lungs on day 30 and 60 for RD142 strains 4588 and 4619, RD150 strains 3446 and 729

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

34

3376, RD181 strains 3507 and 3393, and RD207 strains 5097 and 4334. Cell numbers 730

expressed as total cells (x107) expressing each phenotype per 1.0 gram of each tissue 731

(n=4) (SEM did not exceed 0.35). *Student t-test for RD150 day 30 to day 60 [P < 0.03] 732

and RD207 day 30 to day 60 [P < 0.01].733

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

35

734

Table 1. Characteristic of the M. tuberculosis strains included in the animal model 735

Sublineage Specimen

Site of

disease

Initial

chest x-

ray

HIV

status

IS6110

Band

No.

IS6110

RFLP

Pattern

Type of

case

Cluste

r size

RD142 4233 Pulmonary

Abnormal,

no cavities Unknown 18 Unique Unique


Abnormal,


RD142 4619

Lymphatic-

cervical

Abnormal,



Abnormal,

no cavities Unknown 21 2090000

Secondary

Case 10

RD150 3446 Pulmonary Cavities Negative 21 2010000

Secondary

Case 5


Abnormal,


RD181 3507 Pulmonary Cavities Unknown 21 Unique Unique

RD181 4147 Pulmonary Cavities Unknown 19 Unique Unique


Abnormal,

no cavities Unknown 8 4990000 First case 2


Abnormal,


736

737

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

36

Table 2. Univariate and multivariate odds of being a secondary case. 738

Risk Factor

Univariate Multivariate

Secondary

Case

N (%)

Odds Ratio a

(95% CI), p value

Secondary

Case

N (%)

Odds Ratio d

(95% CI), p value

Sublineage RD207

Other

13 (32)

101 (19)

2.04 (1.02–4.08), 0.043 13 (35)

79 (18)

1.98 (0.91–4.29), 0.083

Birth place US

Foreign

37 (54)

77 (15)

6.61 (3.88–11.2), <0.001 29 (50)

63 (15)

5.22 (2.89–9.42), <0.001

Cavities b Yes

No

10 (17)

103 (20)

0.83 (0.41–1.69), 0.609 9 (16)

83 (20)

0.72 (0.32–1.60), 0.416

Sputum smear status c

Positive

Negative

40 (22)

53 (18)

1.29 (0.81–2.04), 0.278

40 (22)

52 (17)

1.28 (0.77–2.11), 0.335

a Excluding 7 extrapulmonary index cases: 114 secondary cases in 586 observations 739

b Excluding 5 missing data on cavitary status: 113 secondary cases in 581 observations 740

c Excluding 103 missing data on smear status: 93 secondary cases in 483 observations 741

d Excluding 7 extrapulmonary index cases and 105 with missing data: multivariate 742

model composed of 92 secondary cases in 481 observations 743

744

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

37

Table 3. Genes specific for each sublineage that contained a nsSNP that may have an 745

impact on the gene function based on the SIFT analysis. 746

747

Locus Gene

Symbol

Gene description Aminoacid

change

SIFT value

Mutations in sublineage RD207

Rv0327c cyp135A1 cytochrome P450 135A1 R220H 0.05

Rv0380c RNA methyltransferase R174P 0.01

Rv0411c glnH glutamine-binding lipoprotein M1I 0

Rv0622 hypothetical protein P219L 0.01

Rv0859 fadA acetyl-CoA acetyltransferase K17N 0

Rv0892 monooxygenase T177I 0

Rv0944

formamidopyrimidine-DNA

glycosylase Y50H 0.01

Rv0989c grcC2

polyprenyl-diphosphate

synthase L257M 0

Rv1073 hypothetical protein V113L 0.02

Rv1523 methyltransferase V167A 0

Rv1557 mmpL6 transmembrane transport A158G 0.01

Rv1894c hypothetical protein V168M 0

Rv1934c fadE17 acyl-CoA dehydrogenase E394K 0.02

Rv2579 dhaA haloalkane dehalogenase T2K 0.02

Rv2688c

antibiotic ABC transporter ATP-

binding protein C213R 0

Rv2821c hypothetical protein V207L 0.02

Rv2959c methyltransferase I146M 0

Rv3057c short-chain dehydrogenase V93M 0.02

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

38


Rv0426c hypothetical protein P97L 0.04

Rv0458 aldehyde dehydrogenase V457A 0

Rv0528 transmembrane protein D59G 0

Rv0577 TB27.3 hypothetical protein P74A 0.01

Rv0610c hypothetical protein E235A 0

Rv0634c glyoxalase II Y7H 0

Rv1009 rpfB

resuscitation-promoting factor

rpfB V265M 0

Rv1140 hypothetical protein G84D 0.02

Rv1207 folP2

dihydropteroate synthase 2

FolP2 R73G 0.04

Rv1638 uvrA excinuclease ABC subunit A D200G 0.02

Rv1665 pks11 chalcone synthase pks11 P55A 0.01

Rv2416c eis

enhanced intracellular survival

protein V163I 0

Rv2715 hydrolase P263S 0.01

Rv3167c

TetR family transcriptional

regulato L162F 0.01

Rv3665c dppB peptide ABC transporter T194I 0

Rv3886c mycP2 hypothetical protein P45T 0


Rv0775 hypothetical protein R86Q 0.04

Rv0826 hypothetical protein N79S 0.02

Rv0989c grcC2

polyprenyl-diphosphate

synthase A182G 0.04

Rv1152 regulatory protein GntR G105A 0.04

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

39

Rv1295 thrC threonine synthase G237S 0

Rv1317c alkA ada regulatory protein A11T 0

Rv1502 hypothetical protein R196C 0.05

Rv1811 mgtC Mg2+ transport ATPase C A40M 0

Rv2124c metH methionine synthase Y1098D 0

Rv2394 ggtB gamma-glutamyltransferase V545F 0

Rv2510c hypothetical protein Q351E 0

Rv3667 acs acetyl-CoA synthetase A44T 0

Rv3774 echA21 enoyl-CoA hydratase G124D 0

748

749

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

on Septem


.org/D

ownloaded from

http://cvi.asm.org/

downloaded from //cvi.asm.org/content/cdli/early/2012/06/14/cvi.00250-12... · 102 4619 (rd142);...

Documents