Transcript
Page 1: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances11

Projected StartersPOS NO NAME HT YR 2009-10 STATSF 5 Michelle Kirk 6-0 Jr. 18.5 ppg, 5.0 rpg, 1.8 apgF 22 Liz Leer 6-2 Jr. 13.3 ppg, 6.0 rpg, 2.4 bpgF 15 Lisa Strack 5-10 So. 7.2 ppg, 4.5 rpg, 1.7 apgG 23 Raven Harris 5-7 So. 5.9 ppg, 3.6 apg, 2.3 spgC 00 Ohemaa Nyanin 6-2 Sr. 4.8 ppg, 6.0 rpg, 0.7 apg

ReservesPOS NO NAME HT YR 2009-10 STATSG 4 Geleisa George 5-9 Fr. --G 10 Nicole Ryan 5-8 Sr. 7.1 ppg, 2.4 rpg, 2.3 apgG 12 Ebony Edwards 5-8 So. 4.9 ppg, 3.3 rpg, 1.8 spgG 13 Ashley Yencho 5-7 Jr. 4.0 ppg, 1.0 rpg, 1.0 apgF 42 Janelle McDonald 6-1 So. 1.2 ppg, 1.1 rpg, 0.1 apgC 44 Stephanie Anya 6-2 Fr. 1.5 ppg, 2.7 rpg, 0.4 spg

Game 25American (16-8, 9-1) vs. Army (10-14, 4-6)

Wednesday, February 17, 2010 • 7 p.m. ETChristl Arena • West Point, N.Y.Web: Patriot League All*Access

The American University women’s basketball team will look to extend its Patriot League record to 10-1 when it visits Army on Wednesday, February 17 at 7 p.m. in West Point, N.Y.

American (16-8, 9-1 PL) is coming off an impressive 82-47 victory over Colgate on Saturday afternoon at Bender Arena. Liz Leer led the Eagles with a career-best 27 points on 9-15 shooting from the fl oor, including 4-5 from three-point range. She also added team-highs with eight rebounds, fi ve assists and two blocked shots. This performance follows her 16-point effort in AU’s win at Bucknell last Wednesday, earning the junior for her career Patriot League Player of the Week honor. Leer currently leads the Patriot League with 2.4 blocks her game, which ranks 21st in the country.

The Eagles currently rank in the top 30 in the country in several team statistics, including 14th in free throw percentage (76.0 percent), 16th in scoring defense (55.0 ppg) and 27th in fewest turnovers (15.2 per game).

Army (10-14, 4-6 PL) enters Wednesday’s game having dropped seven of its last nine contests. Erin Anthony leads the Black Knights with 16.3 points and 10.3 rebounds per game. She has recorded 11 double-doubles so far this season.

AU and Army met this season on January 20 in Washington with the Eagles coming away with a 64-49 victory. The Eagles jumped out to a 43-24 halftime lead and never looked back on their way to the win. Leer had 14 points and 13 rebounds, recording her fi rst double-double of the season and third of her career. Michelle Kirk and Lisa Strack each scored 14 points as well for American.

American leads the all-time series against Army, 12-8, and holds a 5-4 advantage in games played in West Point. The Eagles dropped last season’s meeting at Army, 60-58, although they were victorious two years ago.

NovemberNovemberSun. 8 Virginia Wesleyan (Exhib.) W, 98-34Fri. 13 at Howard W, 71-59Mon. 16 at Princeton L, 77-45Wed. 18 at Brown W, 64-54Sun. 22 EAST CAROLINA L, 70-65Tues. 24 NJIT W, 65-57Sun. 28 at Wagner L, 73-72

DecemberDecemberWed. 2 at Drexel L, 50-40Sun. 6 HIGH POINT W, 67-46Wed. 16 MORGAN STATE W, 59-45Sun. 20 MARYLAND L, 75-64 Hatter Classic @ DeLand, Fla.Mon. 28 vs. Buffalo W, 54-43Tues. 29 vs. St. Francis (Pa.) L, 60-57

JanuaryJanuarySat. 2 at Columbia L, 66-56Mon. 4 MD.-EASTERN SHORE W, 57-46Sat. 9 LEHIGH * W, 69-65 (OT)Wed. 13 BUCKNELL * W, 63-51Sat. 16 at Colgate * W, 80-58Wed. 20 ARMY * W, 64-49Sun. 24 at Holy Cross * W, 64-51Wed. 27 at Navy * W, 62-45Sat. 30 LAFAYETTE * W, 53-31

FebruaryFebruarySat. 6 at Lehigh * L, 53-46Wed. 10 at Bucknell * W, 53-49Sat. 13 COLGATE * W, 82-47Wed. 17 at Army * 7:00 p.m.Sat. 20 HOLY CROSS * 2:00 p.m.Wed. 24 NAVY * 7:00 p.m.Sat. 27 at Lafayette * 1:00 p.m.

MarchMarchSat. 6 PL Quarterfi nals @ Holy Cross TBDSun. 7 PL Semifi nals @ Holy Cross TBDSat. 13 PL Finals @ TBD 6:00 p.m.

BOLD CAPS indicates home game* indicates Patriot League Opponent

2009-10 Schedule

Athletics CommunicationsWomen’s Basketball Contact ................................ Howard SmithOffi ce Phone ....................................................... (202) 885-3032Cell Phone .......................................................... (202) 531-0160E-mail ......................................................hsmith@american.eduWebsite ................................................................ AUeagles.comMailing Address .....................................................Bender Arena 4400 Massachusetts Ave., NW Washington, D.C. 20016

Page 2: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances22

Riding a Hot StreakBefore dropping the 53-46 decision at Lehigh on February 6, American had won a season-high eight straight games, including a perfect 7-0 start in the Patriot League. The Eagles’ fi nished 8-1 in January, and their current 9-1 conference start is the best in program history.

Home Cookin’American is 9-2 in the friendly confi nes of Bender Arena this season, picking up wins in its last fi ve home games. AU is 6-5 on the road and 1-1 in neutral site games.

View From the TopIn conference play, American leads the conference in scoring offense

(63.6 ppg), scoring margin (+13.7 ppg), and ranks second in scoring defense (49.9 ppg). Lehigh is second with a +10.7 scoring margin, while Navy (+6.0) is the only other team in positive territory.

Leading the PackFor the season, American currently is on top in Patriot League in scoring defense (55.0 ppg), free throw percentage (76.0 percent), three-point fi eld goal percentage (34.4 percent) and blocked shots (3.8 per game). The Eagles also rank second in the conference in several team statistics, including scoring offense (61.3 ppg), scoring margin (+6.3 per game), fi eld goal percentage (40.8 pct.), fi eld goal percentage defense (37.6 pct.), rebounding defense (34.8 per game) and turnover margin (+2.1 per game).

Take Me to Your LeaderJunior Michelle Kirk has led the Eagles in scoring in 19 of their 24 games so far this season, scoring at least 18 points in 15 of those contests. Her 18.5 points per game average is currently leading the Patriot League, and is 28th best in the country. She is also second in the conference in minutes played (37.0 per game), while she ranks in the top fi ve in each of the following statistics: free throw percentage (83.1 percent - 2nd), three-point fi eld goals made (2.0 per game - 4th) and three-point percentage (38.0 percent - 5th). She is currently seventh in the conference in fi eld goal percentage (42.9 percent) and 14th in the conference in rebounding with 5.0 per contest.

Elite CompanyKirk became the 12th American University women’s basketball student-athlete to reach the 1,000-point mark for her career with a three-pointer in the fi rst half against Lafayette on January 30. She has since moved up to 11th on the list.

Back-to-Back-to-Back HonorsKirk was selected as the Patriot League Player of the Week in three straight weeks during conference play (January 11, January 18 and January 25). She has been recognized with the award a league-high fi ve times this season, and on six occasions in her career.

Stepping Up When it CountsIn the eight conference games, Kirk is averaging 17.8 points per game, which leads the conference’s second leading scorer, Army’s Erin Anthony, by a full 3.0 points per game. In the conference opener against defending champion Lehigh on January 9, the 2009-10 All-Patriot League Preseason selection put together one of the best individual efforts in recent AU women’s basketball history with 32 points, the fi fth-highest single-game output in school history. She was 10-of-21 from the fi eld, including a career-best fi ve made three-pointers (in nine attempts) and a perfect seven-of-seven from the free throw line. Her 32 point-performance was the most points by an AU student-athlete since Chanel Hunt scored 34 points on February 11, 2003 against Navy.

Career Game and PL HonorJunior Liz Leer scored a career-high 27 points in American’s 82-47 win over Colgate on February 13. She also recorded team-highs with eight rebounds, fi ve assists and two blocks. That performance followed a 16-point effort in AU’s win at Bucknell earlier in the week, earning her Patriot League Player of the Week honors this week for the fi rst time in her career.

Michelle Kirk 2009-10 Awards- Preseason All-Patriot League Team- 5-time Patriot League Player of the Week (11/30, 12/21, 1/11, 1/18, 1/25)- ECAC Division I Co-Player of the Week (1/11)- 2-time American University Student-Athlete of the Week (11/16, 1/11)

2009-10 Patriot League Standings Patriot OverallTEAM W L Pct. W L Pct.Lehigh 9 1 .900 22 3 .880American 9 1 .900 16 8 .667Navy 5 5 .500 13 12 .520Army 4 6 .400 10 14 .417Colgate 4 6 .400 9 15 .375Holy Cross 4 6 .400 8 17 .320Bucknell 3 7 .300 7 16 .304Lafayette 2 8 .200 4 20 .167

American University 1,000-Point Club

1. Felicia Young, 1988-92 .......................... 1,7082. Beth Shearer, 1984-88 .......................... 1,6113. Mary Klima, 1994-98 ............................. 1,4774. Kari Gaskins, 1995-99 ........................... 1,3335. Chanel Hunt, 2001-05 ........................... 1,2986. Jody Thorton, 1983-87 .......................... 1,1767. Darsi Smith, 1980-84 ............................. 1,1648. Jacqui Frazier, 1979-83 ......................... 1,1069. Kate Miller, 1997-00............................... 1,09610. Kirsten Keller, 1991-95 ........................ 1,06111. Michelle Kirk, 2007-Present .............. 1,04712. Dana Diller, 1983-87 ............................ 1,016

Page 3: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances33

Making HistoryWith fi ve blocked shots at Lehigh on February 6, Leer became the program’s career blocked shots leader. Kirsten Keller previously held the school record with 152. Leer now has 159 career blocks, including a Patriot League-leading 52 this season (2.4 per game). She had a career-high-matching six blocks in American’s win over Navy on January 27, which tied her own single-game program record.

Double TroubleLeer recorded her fi rst double-double of the 2009-10 season with 14 points and 13 rebounds in American’s victory over Army on January 20. This marked her third-career double-double, as her previous two both occured in the 2008-09 season. Taking Care of the RockSophomore Raven Harris currently leads the Patriot League with a 1.5 assist-to-turnover ratio for the entire season. She is averaging 3.6 assists per game, which is good for third in the conference.

Thieves on the LooseHarris and fellow sophomore Ebony Edwards are currently second and fourth, respectively, in the conference in steals. Harris is averaging 2.3 steals per game, while Edwards contributes 1.8 per contest. The duo contributed for nine steals in AU’s most recent win over Colgate on February 13.

Protecting the LeadAU is 13-1 in games in which it leads at halftime. Additionally, the Eagles are 15-0 when they lead with fi ve minutes remaining in the game.

Cleaning the GlassSenior Ohemaa Nyanin is currently second in the conference in rebounding during conference play with 7.7 per contest.

Aggressive Play RewardedThe Eagles are 12-2 in games in which they attempt more free throws than their opponents. On the fl ip side, AU is only 4-6 in which the opponent shoots more free throws.

Patriot League SuccessIn the last three seasons, the Eagles are 29-9 (.763) in conference play. Only Lehigh has a better Patriot League record at 30-8 (.789).

Eagles Expected to SoarAU was selected to fi nish second in the Patriot League in the preseason poll, the conference announced prior to the start of the season. The poll was voted on by the league’s coaches and sports information directors. Kirk was selected as a Preseason All-Patriot League pick.

Playing Deep into MarchFor the fi rst time in program history, AU earned trips to the postseason in each of the last two seasons as the Eagles reached the postseason WNIT in both 2007-08 and 2008-09. Last season, fi rst-year head coach Matt Corkery led the Eagles to a 19-12 record, and was the associate head coach in the 2007-08 campaign as the Eagles clinched the Patriot League regular season crown.

Three’s Better than NoneThe Eagles captured three All-Patriot League awards in the 2008-09 campaign. Current junior Michelle Kirk was named First Team All-Conference, while now-sophomores Ebony Edwards and Lisa Strack were selected to the Patriot League All-Rookie Team.

Patriot League UpdateThe Eagles currently sit in a tie for fi rst place at 9-1. American’s 7-0 start in conference play was a fi rst in school history.

In addition to AU’s 82-47 win over Colgate on Saturday, Lehigh, Holy Cross and Navy each recorded conference victories over the weekend.

Patriot League action continues on Wednesday with all eight teams in action. In addition to American versus Army, Bucknell takes on Lafayette in Easton, Pa., Colgate travels to Bethlehem, Pa., to face off against Lehigh, and Navy and Holy Cross square off in Worcester, Mass.

2009-10 Patriot LeaguePreseason Poll

1. Lehigh .............(13 fi rst-place votes) 97 points2. American ................ (3 fi rst-place votes) 763. Holy Cross .................................................. 764. Navy ........................................................... 545. Bucknell ...................................................... 526. Army ........................................................... 507. Colgate ....................................................... 228. Lafayette ..................................................... 21

Page 4: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances44

Inside the Series - ArmyAll-Time Record: American leads 12-8

Previous Meeting: American 64, Army 49 (1/20/10 in Washington, D.C.) Ebony Edwards, Michelle Kirk and Liz Leer each recorded a game-high 14 points to pace AU over Army in the teams’ fi rst matchup this season. Leer grabbed 13 rebounds, earning her third career double-double, and also chipped in three assists and three blocked shots. Edwards’ 14 points marked a new career-best. Ohemaa Nyanin also recorded nine rebounds for the Eagles, while Raven Harris led AU with fi ve assists.

Nalini Hawkins led Army with 14 points, while Jessie Coiffard and Erin Anthony each had 10 for the Black Knights.

AU held Army to 29.8 percent from the fi eld (17-57) and outrebounded the Black Knights by a 45-30 margin. AU shot 41.8 percent in the game (23-55), including 52.9 percent (9-15) from behind-the-arc.

AU is 6-5 on the road this season, while Army is 8-4 at home in 2009-10.

Milestone Watch- Leer has recorded 159 blocked shots in her career at American, including a single-season school record of 62 last season. With fi ve blocks against Lehigh on February 6, she passed Kirsten Keller for the all-time blocks record.

- In her career, Leer is shooting 52.3 percent from the fi eld, which places her fi fth in AU history. Lynne Copeland sits atop the AU list at 57.9 percent.

- Leer is currently fi rst in career free throw percentage at 82.4, while Nicole Ryan sits in third at 80.4 percent, and Michelle Kirk is in fourth at 79.9 percent. Ryan set a new AU single-season mark last year with an 87.8 percent conversion rate from the charity stripe. Leer leads the Eagles this season at 84.9 percent, while Kirk is shooting 83.1 percent.

- Kirk is fi fth in school history in three-point fi eld goal percentage at 34.9 percent.

- Ryan is second in school history with 153 made three-pointers.

Team Stats Comparison AMERICAN Army 16-8 ................. Overall Record .................10-14 9-1 ............... Conference Record .................4-6 61.3 ...................Points/Game ..................... 53.1 55.0 .............. Opp. Points/Game ................ 58.5 34.8 ................Rebounds/Game .................. 35.9 34.8 ........... Opp. Rebounds/Game ............. 38.8 40.8 ........................FG Pct. .......................... 35.4 37.6 ................... Opp. FG Pct. ..................... 37.8 34.4 .................... 3-Point Pct. ...................... 28.3 30.6 ................Opp. 3-Point Pct. .................. 35.0 76.0 .................Free Throw Pct. ................... 67.0 13.8 ............Personal Fouls/Game .............. 16.4 12.5 .................. Assists/Game .................... 10.0 15.2 ................Turnovers/Game .................. 17.1 3.8 ..............Blocked Shots/Game ................ 3.1 8.3 ..................... Steals/Game ....................... 7.0

American Record BooksBlocked Shots, Career1. Liz Leer, 2007-Pres ............................. 1592. Kirsten Keller, 1991-95 ......................... 1523. Hollie Steinman, 1998-02 ..................... 1284. Kia Cooper, 1984-88 ............................... 855. Kristin Hirschler, 1990-94 ........................ 83

Field Goal Percentage, Career1. Lynne Copeland, 1982-83 ....(110-190) 57.92. Kelly Lane, 1985-87 ............ (364-630) 57.83. Darsi Smith, 1980-84 .......... (501-955) 52.54. Beth Shearer, 1984-88 ...... (565-1078) 52.45. Liz Leer, 2007-Pres. .......... (375-717) 52.3

Free Throw Percentage, Career1. Liz Leer, 2007-Pres ............(117-142) 82.42. Kate Miller, 1997-00 ........... (296-361) 82.03. Nicole Ryan, 2005-Pres ... (156-194) 80.44. Michelle Kirk, 2007-Pres .. (246-308) 79.95. Beth Shearer, 1984-88 ....... (476-598) 79.6

Three-Point Field Goal Percentage, Career1. Kate Miller, 1997-00 .............. (70-176) 39.82. Gail Wilkins, 1992-94 ............ (93-244) 38.13. Jaye Marolla, 1999-00 .......... (47-128) 36.74. Talicia Jackson, 2005-09 .... (160-447) 35.85. Michelle Kirk, 2007-Pres. .... (89-255) 34.9

Three-Point FGs Made, Career1. Talicia Jackson, 2005-09 ...................... 1602. Nicole Ryan, 2005-Pres ...................... 1533. Kari Gaskins, 1995-99 .......................... 1474. Liz Hayes, 2006-08 ............................... 1445. Maria Werries, 1999-03 ........................ 105

American vs. ArmyAll-Time Series

Overall: American leads, 12-8Home: American leads, 7-3Away: American leads, 5-4Neutral: Army leads, 1-0

Date Site Score W/L12/31/96 West Point, N.Y. 79-39 W11/23/97 Washington 68-54 W1/12/02 Washington 69-78 L2/6/02 West Point, N.Y. 76-66 W2/2/03 West Point, N.Y. 56-71 L2/27/03 Washington 64-50 W3/9/03 Upper Marlboro, Md. (a) 65-78 L2/1/04 Washington 74-52 W2/26/04 West Point, N.Y. 49-41 W1/21/05 Washington 71-64 (OT) W2/4/05 West Point, N.Y. 51-47 W1/17/06 Washington 66-75 L2/14/06 West Point, N.Y. 49-73 L1/16/07 West Point, N.Y. 47-60 L2/13/07 Washington 58-54 W1/23/08 Washington 49-59 L2/20/08 West Point, N.Y. 63-51 W1/21/09 Washington 53-42 (OT) W2/18/09 West Point, N.Y. 58-60 L1/20/10 Washington 64-49 W

(a) Patriot League Semifi nals

Page 5: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances55

2009-10 RosterNumericalNo. Name .................Pos. Cl. ....Ht. .. Hometown/High School00 ..Ohemaa Nyanin ..C ... Sr. .......6-2 .. Accra, Ghana/Westtown School4 ....Geleisa George ...G .. Fr. ........5-9 .. Jamaica, N.Y./Christ the King Regional5 ....Michelle Kirk ........F/G Jr. .......6-0 .. Painted Post, N.Y./Corning-Painted Post West10 ..Nicole Ryan .........G .. RS Sr. 5-8 .. Safety Harbor, Fla./Clearwater12 ..Ebony Edwards ...G .. So. ......5-8 .. Forestville, Md./Bishop McNamara13 ..Ashley Yencho .....G .. Jr. .......5-7 .. Schnecksville, Pa./Parkland15 ..Lisa Strack ...........G .. So. ......5-10 Langhorne, Pa./Archbishop Wood22 ..Liz Leer ................F ... Jr. .......6-2 .. Glenside, Pa./Abington23 ..Raven Harris .......G .. So. ......5-7 .. Virginia Beach, Va./Princess Anne42...Janelle McDonald .F .... So........6-1 ... Ashburn, Va./Notre Dame Academy44 ..Stephanie Anya ...C ... Fr. .......6-2 .. Germantown, Md./Academy of the Holy Cross

AlphabeticalNo. Name .................Pos. Cl. ....Ht. .. Hometown/High School44 ..Stephanie Anya ...C ... Fr. .......6-2 .. Germantown, Md./Academy of the Holy Cross12 ..Ebony Edwards ...G .. So. ......5-8 .. Forestville, Md./Bishop McNamara4 ....Geleisa George ...G .. Fr. ........5-9 .. Jamaica, N.Y./Christ the King Regional23 ..Raven Harris .......G .. So. ......5-7 .. Virginia Beach, Va./Princess Anne5 ....Michelle Kirk ........F/G Jr. .......6-0 .. Painted Post, N.Y./Corning-Painted Post West22 ..Liz Leer ................F ... Jr. .......6-2 .. Glenside, Pa./Abington42 ..Janelle McDonald F ... So. ......6-1 .. Ashburn, Va./Notre Dame Academy00 ..Ohemaa Nyanin ..C ... Sr. .......6-2 .. Accra, Ghana/Westtown School10 ..Nicole Ryan .........G .. RS Sr. 5-8 .. Safety Harbor, Fla./Clearwater15 ..Lisa Strack ...........G .. So. ......5-10 Langhorne, Pa./Archbishop Wood13 ..Ashley Yencho .....G .. Jr. .......5-7 .. Schnecksville, Pa./Parkland

Position Breakdown

Guards ............Edwards, George, Harris, ..............................Ryan, Strack, Yencho Forwards ...............Kirk, Leer, McDonald

Centers ..............................Anya, Nyanin

Class BreakdownSeniors (‘10) ......................Nyanin, Ryan

Juniors (‘11) .............. Kirk, Leer, Yencho

Sophomores (‘12) ........Edwards, Harris, ....................................McDonald, Strack

Freshman (‘13) ............... Anya, George

Geographical BreakdownInternational ................................Nyanin

Maryland .........................Anya, Edwards

New York ............................George, Kirk

Pennsylvania......... Leer, Strack, Yencho

Virginia ....................... Harris, McDonald

Height Breakdown5-7 ....................................Harris, Yencho

5-8 ...................................Edwards, Ryan

5-9 ............................................... George

5-10 ...............................................Strack

6-0 .....................................................Kirk

6-1 ...........................................McDonald

6-2 .............................Anya, Leer, Nyanin

Page 6: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances66

#5 • Michelle KirkSeason Category Career-High32 vs. Lehigh (1/9/10) Points 32 vs. Lehigh (1/9/10)8, two times, last vs. Buffalo (12/28/09) Rebounds 11 vs. Navy (1/28/09)10, three times, last vs. Lehigh (1/9/10) FG Made 12 vs. Navy (1/28/09)21 vs. Lehigh (1/9/10) FG Atts 22 vs. Navy (1/28/09)5, two times, last vs. Bucknell (1/13/10) 3 FG Made 5, two times, last vs. Bucknell (1/13/10)9 vs. Lehigh (1/9/10) 3 FG Atts 9 vs. Lehigh (1/9/10)12 vs. Buffalo (12/28/09) FT Made 12 vs. Buffalo (12/28/09)14 at Brown (11/18/09) FT Atts 14 at Brown (11/18/09)4 at Colgate (1/16/10) Assists 5, two times, last vs. Brown (1/6/09)2 at Brown (11/18/09) Blocks 2, two times, last at Brown (11/18/09)4, two times, last at Colgate (1/16/10) Steals 4, two times, last at Colgate (1/16/10)45 vs. Lehigh (1/9/10) Minutes 45 vs. Lehigh (1/9/10)

Season/Career Highs

#10 • Nicole RyanSeason Category Career-High16 at Princeton (11/16/09) Points 25 at Navy (3/3/07)10 at Brown (11/13/09 Rebounds 10 at Brown (11/18/09)6 at Princeton (11/16/09) FG Made 8 vs. Holy Cross (1/20/07)11 at Princeton (11/16/09) FG Atts 18, four times, last vs. HC (2/17/07)4 at Princeton (11/16/09) 3 FG Made 5, three times, last at Navy (2/25/09)6, two times, last at Wagner (11/28/09) 3 FG Atts 16 at Monmouth (12/22/06)6 at Wagner (11/28/09) FT Made 9 vs. Drexel (12/30/06)7 at Wagner (11/28/09) FT Atts 10 vs. Drexel (12/30/06)4 at Wagner (11/28/09) Assists 4 two times, last at Wagner (11/28/09)2 at Wagner (11/28/09) Blocks 2 at Wagner (11/28/09)2. two times, last at Wagner (11/28/09) Steals 5, three times, last vs. Navy (1/24/07)36 at Brown (11/18/09) Minutes 39 vs. Army (2/18/09)

#12 • Ebony EdwardsSeason Category Career-High14 vs. Army (1/20/10) Points 14 vs. Army (1/20/10)8 at Colgate (1/16/10) Rebounds 8 at Colgate (1/16/10)5 vs. Army (1/20/10) FG Made 5 vs. Army (1/20/10)11 vs. Army (1/20/10) FG Atts 11 vs. Army (1/20/10)3, two times, last vs. UMES (1/4/10) 3 FG Made 3, four times, last vs. UMES (1/4/10)7 vs. UMES (1/4/10) 3 FG Atts 7 vs. UMES (1/4/10)4 vs. Lehigh (1/9/10) FT Made 4 vs. Lehigh (1/9/10)5 vs. Lehigh (1/9/10) FT Atts 5 vs. Lehigh (1/9/10)6 vs. Lehigh (1/9/10) Assists 6 vs. Lehigh (1/9/10))2 at Bucknell (2/10/10) Blocks 2 at Bucknell (2/10/10) 6 at Wagner (11/28/09) Steals 6 at Wagner (11/28/09)43 vs. Lehigh (1/9/10) Minutes 43 vs. Lehigh (1/9/10)

#00 • Ohemaa NyaninSeason Category Career-High10 vs. Colgate (2/13/10) Points 10 vs. Colgate (2/13/10)13 vs. Lehigh (1/9/10) Rebounds 13 vs. Lehigh (1/9/10)4, six times, last vs. Colgate (2/13/10) FG Made 4, six times, last vs. Colgate (2/13/10)9 vs. Lafayette (1/30/10) FG Atts 9 vs. Lafayette (1/30/10)-- 3 FG Made ---- 3 FG Atts --3 vs. Lehigh (1/9/10) FT Made 3 vs. Lehigh (1/9/10)4 vs. Lehigh (1/9/10) FT Atts 4 vs. Lehigh (1/9/10)3 vs. St. Francis (Pa.) (12/29/09) Assists 3 vs. St. Francis (Pa.) (12/29/09)1, fi ve times, last at Bucknell (2/10/10) Blocks 1, eight times, last at Bucknell (2/10/10)1, fi ve times, last vs. Colgate (2/13/10) Steals 1, nine times, last vs. Colgate (2/13/10)33 vs. Lehigh (1/9/10) Minutes 33 vs. Lehigh (1/9/10)

#4 • Geleisa GeorgeSeason Category Career-High-- Points ---- Rebounds ---- FG Made ---- FG Atts ---- 3 FG Made ---- 3 FG Atts ---- FT Made ---- FT Atts ---- Assists ---- Blocks ---- Steals ---- Minutes --

#13 • Ashley YenchoSeason Category Career-High15 vs. St. Francis (Pa.) (12/29/09) Points 15 vs. St. Francis (Pa.) (12/29/09)3, three times, last at Bucknell (2/10/10) Rebounds 4 at Drexel (12/31/07)6 vs. St. Francis (Pa.) (12/29/09) FG Made 6 vs. St. Francis (Pa.) (12/29/09)9 vs. St. Francis (Pa.) (12/29/09) FG Atts 9 vs. St. Francis (Pa.) (12/29/09)3 vs. St. Francis (Pa.) (12/29/09) 3 FG Made 3 vs. St. Francis (Pa.) (12/29/09)6, two times, last vs. UMES (1/4/10) 3 FG Atts 6, three times, last vs. UMES (1/4/10)2, three times, last vs. Lafayette (1/30/10) FT Made 4, two times, last at Clev St (12/29/07)4 at Princeton (11/16/09) FT Atts 5 at Cleveland State (12/29/07)5 vs. St. Francis (Pa.) (12/29/09) Assists 5 vs. St. Francis (Pa.) (12/29/09)-- Blocks --3 vs. Maryland (12/20/09) Steals 3 vs.Maryland (12/20/09)40 vs. St. Francis (Pa.) (12/29/09) Minutes 40 vs. St. Francis (Pa.) (12/29/09)

Page 7: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances77

#23 • Raven HarrisSeason Category Career-High15 at Holy Cross (1/24/10) Points 15 at Holy Cross (1/24/10)4, two times, last vs. Lehigh (1/9/10) Rebounds 4, three times, last vs. Lehigh (1/9/10)5 at Holy Cross (1/24/10) FG Made 5 at Holy Cross (1/24/10)13 at Lehigh (2/6/10) FG Atts 13 at Lehigh (2/6/10)2, two times, last at Holy Cross (1/24/10) 3 FG Made 2, two times, last at Holy Cross (1/24/10)4, two times, last at Lehigh (2/6/10) 3 FG Atts 4, two times, last at Lehigh (2/6/10)6 vs. Buffalo (12/28/09) FT Made 6 vs. Buffalo (12/28/09)8 vs. Buffalo (12/28/09) FT Atts 8 vs. Buffalo (12/28/09)6, three times, last at Colgate (1/16/10) Assists 6, four times, last at Colgate (1/16/10)1 at Holy Cross (1/24/10) Blocks 1, two times, last at Holy Cross (1/24/10)5 at Columbia (1/2/10) Steals 5 at Columbia (1/2/10)42 vs. Lehigh (1/9/10) Minutes 42 vs. Lehigh (1/9/10)

Season/Career Highs

#42 • Janelle McDonaldSeason Category Career-High6 at Navy (1/27/10) Points 6, two times, last at Navy (1/27/10)5 at Princeton (11/16/09) Rebounds 5 at Princeton (11/16/09)3 at Navy (1/27/10) FG Made 3, two times, last at Navy (1/27/10)6 at Princeton (11/16/09) FG Atts 7 at Bucknell (1/14/09)-- 3 FG Made ---- 3 FG Atts ---- FT Made 2 at NJIT (11/14/08)-- FT Atts 2, two times, last at Lehigh (1/10/09)1, two times, last vs. Lehigh (1/9/10) Assists 2, two times, last vs. Lafayette (2/28/09)1 at Princeton (11/16/09) Blocks 1, two times, last at Princeton (11/16/09)1 at Howard (11/13/09) Steals 2 vs. Navy (1/28/09)17 at Princeton (11/16/09) Minutes 19 at Bucknell (1/14/09)

#44 • Stephanie AnyaSeason Category Career-High4, two times, last vs. Bucknell (1/13/10) Points 4, two times, last vs. Bucknell (1/13/10)7, two times, last vs. St. Francis (Pa.) (12/29/09) Rebounds 7, two times, last vs. St. Francis (Pa.) (12/29/09)2, two times, last vs. Bucknell (1/13/10) FG Made 2, two times, last vs. Bucknell (1/13/10)5, six times, last vs. Army (1/20/10) FG Atts 5, six times, last vs. Army (1/20/10)-- 3 FG Made ---- 3 FG Atts --2, two times, last vs. Colgate (2/13/10) FT Made 2, two times, last vs. Colgate (2/13/10)4 vs. Morgan State (12/16/09) FT Atts 4 vs. Morgan State (12/16/09)1, two times, last vs. St. Francis (Pa.) (12/29/09) Assists 1, two times, last vs. St. Francis (Pa.) (12/29/09)1, six times, last at Bucknell (2/10/10) Blocks 1, six times, last at Bucknell (2/10/10)2, three times, last at Lehigh (2/6/10) Steals 2, three times, last at Lehigh (2/6/10)18, two times, last at Colgate (1/16/10) Minutes 18, two times, last at Colgate (1/16/10)

#15 • Lisa StrackSeason Category Career-High15 at Navy (1/27/10) Points 15 at Navy (1/27/10)8, three times, last at Navy (1/27/10) Rebounds 8, three times, last at Navy (1/27/10)6, three times, last vs. Colgate (2/13/10) FG Made 6, three times, last vs. Colgate (2/13/10)11 vs. Maryland (12/20/09) FG Atts 11 vs. Maryland (12/20/09)1, seven times, last vs. Colgate (2/13/10) 3 FG Made 1, 14 times, last vs. Colgate (2/13/10)4, two times, last at Lehigh (2/6/10) 3 FG Atts 4, two times, last at Lehigh (2/6/10)6 at Wagner (11/28/09) FT Made 6 at Wagner (11/28/09)6, two times, last vs. High Point (12/6/09) FT Atts 6, two times, last vs. High Point (12/6/09)4 at Navy (1/27/10) Assists 8 vs. Howard (11/19/08)2 vs. Buffalo (12/28/09) Blocks 2 vs. Buffalo (12/28/09)4 vs. High Point (12/6/09) Steals 4 vs. High Point (12/6/09)34 at Navy (1/27/10) Minutes 34 at Navy (1/27/10)

#22 • Liz LeerSeason Category Career-High27 vs. Colgate (2/13/10) Points 27 vs. Colgate (2/13/10)13 vs. Army (1/20/10) Rebounds 14 at Morgan State (11/28/08)9 vs Colgate (2/13/10) FG Made 9, two times, last vs. Colgate (2/13/10)16 at Columbia (1/2/10) FG Atts 16, two times, last at Columbia (1/2/10)4 vs. Colgate (2/13/10) 3 FG Made 4 vs. Colgate (2/13/10)7 vs. Maryland (12/20/09) 3 FG Atts 7 vs. Maryland (12/20/09)6 vs. High Point (12/6/09) FT Made 8 at Lafayette (1/31/09)7 vs. High Point (12/6/09) FT Atts 8 at Lafayette (1/31/09)5, two times, last vs. Colgate (2/13/10) Assists 5, two times, last vs. Colgate (2/13/10)6 at Navy (1/27/10) Blocks 6, two times, last at Navy (1/27/10)3, three times, last vs. UMES (1/4/10) Steals 3, six times, last vs. UMES (1/4/10)43 vs. Lehigh (1/9/10) Minutes 43 vs. Lehigh (1/9/10)

Page 8: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances88

TOTAL 3-PTS REBOUNDS ## Player GP GS Min Avg FG FGA Pct 3FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO A TO Blk Stl Pts Avg05 Kirk, Michelle 24 24 883 36.8 141 329 .429 49 129 .380 113 136 .831 33 86 119 5.0 29 0 42 48 12 28 444 18.5

22 Leer, Liz 24 24 819 34.1 128 270 .474 19 42 .452 45 53 .849 50 93 143 6.0 62 0 40 98 57 18 320 13.3

15 Strack, Lisa 20 4 490 24.5 52 121 .430 8 39 .205 32 40 .800 42 47 89 4.5 38 1 34 30 4 23 144 7.2

10 Ryan, Nicole 7 7 198 28.3 16 54 .296 9 31 .290 9 15 .600 2 15 17 2.4 8 0 16 17 2 6 50 7.1

23 Harris, Raven 23 16 658 28.6 48 138 .348 8 35 .229 31 42 .738 6 47 53 2.3 42 0 82 56 1 53 135 5.9

12 Edwards, Ebony 24 19 610 25.4 39 120 .325 21 63 .333 19 24 .792 25 54 79 3.3 48 0 42 22 2 43 118 4.9

00 Nyanin, Ohemaa 24 23 474 19.8 50 120 .417 0 0 .000 15 29 .517 72 72 144 6.0 40 1 17 22 5 5 115 4.8

13 Yencho, Ashley 22 3 327 14.9 30 66 .455 17 42 .405 12 16 .750 4 19 23 1.0 16 0 22 30 0 11 89 4.0

44 Anya, Stephanie 23 0 259 11.3 13 52 .250 0 0 .000 8 18 .444 17 45 62 2.7 33 0 2 17 6 9 34 1.5

42 Mcdonald, Janelle 19 0 108 5.7 11 25 .440 0 0 .000 1 2 .500 6 15 21 1.1 16 0 2 14 1 2 23 1.2

TM TEAM................ 37 49 86 3.6 0 11

Total.......... 24 528 1295 .408 131 381 .344 285 375 .760 294 542 836 34.8 332 2 299 365 90 198 1472 61.3

Opponents...... 24 486 1294 .376 107 350 .306 241 347 .695 316 520 836 34.8 366 1 310 415 57 154 1320 55.0

2009-10 Overall Statistics (16-8)

2009-10 Statistics

TOTAL 3-PTS REBOUNDS ## Player GP GS Min Avg FG FGA Pct 3FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO A TO Blk Stl Pts Avg05 Kirk, Michelle 10 10 368 36.8 56 131 .427 23 60 .383 43 51 .843 14 27 41 4.1 7 0 19 19 4 12 178 17.8

22 Leer, Liz 10 10 319 31.9 58 123 .472 11 28 .393 21 24 .875 19 39 58 5.8 28 0 19 32 30 4 148 14.8

23 Harris, Raven 10 10 343 34.3 29 78 .372 8 22 .364 15 19 .789 5 20 25 2.5 17 0 36 25 1 29 81 8.1

15 Strack, Lisa 9 3 221 24.6 28 60 .467 5 20 .250 9 11 .818 18 20 38 4.2 16 0 17 12 1 9 70 7.8

00 Nyanin, Ohemaa 10 10 222 22.2 25 58 .431 0 0 .000 7 12 .583 40 37 77 7.7 13 0 6 5 2 3 57 5.7

12 Edwards, Ebony 10 7 272 27.2 14 61 .230 7 31 .226 11 13 .846 19 24 43 4.3 15 0 28 8 2 18 46 4.6

13 Yencho, Ashley 9 0 132 14.7 9 26 .346 5 17 .294 5 7 .714 3 11 14 1.6 9 0 8 5 0 4 28 3.1

44 Anya, Stephanie 9 0 106 11.8 7 28 .250 0 0 .000 3 6 .500 8 20 28 3.1 14 0 0 7 2 4 17 1.9

42 Mcdonald, Janelle 8 0 42 5.3 5 10 .500 0 0 .000 1 2 .500 1 7 8 1.0 5 0 1 2 0 1 11 1.4

TM TEAM................ 16 18 34 3.4 0 4

Total.......... 10 231 575 .402 59 178 .331 115 145 .793 143 223 366 36.6 124 0 134 119 42 84 636 63.6

Opponents...... 10 183 515 .355 42 140 .300 91 142 .641 130 215 345 34.5 148 0 122 171 28 51 499 49.9

2009-10 Conference Statistics (9-1)

TOTAL 3-PTS REBOUNDS ## Player GP GS Min Avg FG FGA Pct 3FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO A TO Blk Stl Pts Avg05 Kirk, Michelle 14 14 515 36.8 85 198 .429 26 69 .377 70 85 .824 19 59 78 5.6 22 0 23 29 8 16 266 19.0

22 Leer, Liz 14 14 500 35.7 70 147 .476 8 14 .571 24 29 .828 31 54 85 6.1 34 0 21 66 27 14 172 12.3

10 Ryan, Nicole 7 7 198 28.3 16 54 .296 9 31 .290 9 15 .600 2 15 17 2.4 8 0 16 17 2 6 50 7.1

15 Strack, Lisa 11 1 269 24.5 24 61 .393 3 19 .158 23 29 .793 24 27 51 4.6 22 1 17 18 3 14 74 6.7

12 Edwards, Ebony 14 12 338 24.1 25 59 .424 14 32 .438 8 11 .727 6 30 36 2.6 33 0 14 14 0 25 72 5.1

13 Yencho, Ashley 13 3 195 15.0 21 40 .525 12 25 .480 7 9 .778 1 8 9 0.7 7 0 14 25 0 7 61 4.7

23 Harris, Raven 13 6 315 24.2 19 60 .317 0 13 .000 16 23 .696 1 27 28 2.2 25 0 46 31 0 24 54 4.2

00 Nyanin, Ohemaa 14 13 252 18.0 25 62 .403 0 0 .000 8 17 .471 32 35 67 4.8 27 1 11 17 3 2 58 4.1

44 Anya, Stephanie 14 0 153 10.9 6 24 .250 0 0 .000 5 12 .417 9 25 34 2.4 19 0 2 10 4 5 17 1.2

42 Mcdonald, Janelle 11 0 66 6.0 6 15 .400 0 0 .000 0 0 .000 5 8 13 1.2 11 0 1 12 1 1 12 1.1

TM TEAM................ 21 31 52 3.7 0 7

Total.......... 14 297 720 .413 72 203 .355 170 230 .739 151 319 470 33.6 208 2 165 246 48 114 836 59.7

Opponents...... 14 303 779 .389 65 210 .310 150 205 .732 186 305 491 35.1 218 1 188 244 29 103 821 58.6

2009-10 Non-Conference Statistics (7-7)

Page 9: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances99

DATE TIME OPPONENT SCORE RECORD ATTEND HIGH POINTS HIGH REBOUNDS11/13/09 7:00 p.m. at Howard W 71-59 1-0 413 (25) Kirk, Michelle (8) Leer, Liz11/16/09 7:00 p.m. at Princeton L 77-45 1-1 274 (16) Ryan, Nicole (6) Kirk, Michelle11/18/09 4:00 p.m. at Brown W 64-54 2-1 450 (27) Kirk, Michelle (10) Ryan, Nicole11/22/09 2:00 p.m. EAST CAROLINA L 70-65 2-2 435 (19) Kirk, Michelle (9) Nyanin, Ohemaa11/24/09 7:00 p.m. NJIT W 65-57 3-2 148 (24) Kirk, Michelle (7) Kirk, Michelle (7) Leer, Liz (7) Strack, Lisa11/28/09 3:00 p.m. at Wagner L 73-72 3-3 497 (25) Kirk, Michelle (8) Leer, Liz12/02/09 7:00 p.m. at Drexel L 50-40 3-4 612 (13) Kirk, Michelle (8) Strack, Lisa12/06/09 2:00 p.m. HIGH POINT W 67-46 4-4 355 (22) Kirk, Michelle (9) Leer, Liz12/16/09 7:00 p.m. MORGAN STATE W 59-45 5-4 256 (20) Kirk, Michelle (9) Nyanin, Ohemaa12/20/09 2:00 p.m. MARYLAND L 75-64 5-5 331 (18) Kirk, Michelle (5) Leer, Liz12/28/09 3:00 p.m. vs. Buffalo ^ W 54-43 6-5 146 (18) Kirk, Michelle (8) Kirk, Michelle12/29/09 1:00 p.m. St. Francis (Pa.) ^ L 60-57 6-6 113 (16) Kirk, Michelle (7) Anya, Stephanie1/02/10 1:00 p.m. at Columbia L 66-56 6-7 210 (17) Leer, Liz (5) Leer, Liz (5) Nyanin, Ohemaa1/04/10 7:00 p.m. MD. EASTERN SHORE W 57-46 7-7 146 (19) Kirk, Michelle (8) Kirk, Michelle1/09/10 2:00 p.m. LEHIGH * W 69-65 OT 8-7 (1-0) 468 (32) Kirk, Michelle (13) Nyanin, Ohemaa1/13/10 7:00 p.m. BUCKNELL * W 63-51 9-7 (2-0) 223 (20) Kirk, Michelle (7) Nyanin, Ohemaa1/16/10 2:00 p.m. at Colgate * W 80-58 10-7 (3-0) 249 (26) Kirk, Michelle (8) Edwards, Ebony1/20/10 7:00 p.m. ARMY * W 64-49 11-7 (4-0) 327 (14) Edwards, Ebony (13) Leer, Liz (14) Kirk, Michelle (14) Leer, Liz1/24/10 2:00 p.m. at Holy Cross * W 64-51 12-7 (5-0) 2105 (21) Kirk, Michelle (8) Kirk, Michelle1/27/10 7:00 p.m. at Navy * W 62-45 13-7 (6-0) 1258 (17) Kirk, Michelle (8) Strack, Lisa (17) Leer, Liz 1/30/10 2:00 p.m. LAFAYETTE * W 53-31 14-7 (7-0) 421 (15) Leer, Liz (10) Nyanin, Ohemaa2/06/10 7:00 p.m. at Lehigh * L 53-46 14-8 (7-1) 1162 (13) Leer, Liz (6) Nyanin, Ohemaa (6) Strack, Lisa2/10/10 7:00 p.m. at Bucknell * W 53-49 15-8 (8-1) 290 (19) Kirk, Michelle (8) Nyanin, Ohemaa2/13/10 2:00 p.m. COLGATE * W 82-47 16-8 (9-1) 1291 (18) Leer, Liz (8) Leer, Liz2/17/10 7:00 p.m. at Army * 2/20/10 2:00 p.m. HOLY CROSS * 2/24/09 7:00 p.m. NAVY * 2/27/09 1:00 p.m. at Lafayette * 3/06/09 TBD Patriot League Quarterfi nals

* indicates Patriot League game^ Hatter Classic in DeLand, Fla.

ATTENDANCE SUMMARY GAMES TOTALS AVG/GAMEHOME 11 4401 400AWAY 11 7520 684NEUTRAL 2 259 130TOTAL 24 12180 508

Overall: 16-8 • Patriot League: 9-1 • Home: 9-2 • Away: 6-5 • Neutral: 1-1

2009-10 Schedule and Results

Page 10: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1010

Opponent P-R-A P-R-A P-R-A P-R-A P-R-A P-R-A P-R-A P-R-A P-R-A P-R-A P-R-A

at Howard 8-5-1 DNP 25-7-3 4-2-3 5-1-2 2-0-0 3-3-3 18-8-4 6-3-1 0-0-1 0-0-0

at Princeton 0-3-1 DNP 8-6-3 16-0-1 0-3-0 4-0-0 5-4-1 6-3-0 2-3-4 4-5-0 0-0-0

at Brown 4-2-1 DNP 27-8-0 2-10-3 2-2-1 3-0-0 3-4-2 19-9-2 0-1-1 2-2-0 2-0-0

EAST CAROLINA 8-9-0 DNP 19-6-2 11-0-2 6-2-1 DNP 2-2-0 14-5-1 2-0-4 2-0-0 1-3-1

NJIT 5-2-0 DNP 24-7-0 3-3-3 3-1-3 3-0-1 11-7-0 10-7-3 4-2-5 2-1-0 0-0-0

at Wagner 8-3-0 DNP 25-4-1 14-2-4 2-3-1 0-0-0 10-4-1 10-8-1 0-2-5 DNP 3-7-0

at Drexel 2-5-1 DNP 13-4-1 0-0-0 3-1-0 3-1-0 4-8-1 9-7-1 4-3-3 0-0-0 2-3-0

HIGH POINT 2-5-1 DNP 22-7-1 DNP 8-1-0 4-2-2 12-7-3 16-9-1 3-3-6 0-1-0 0-3-0

MORGAN STATE 7-9-0 DNP 20-3-1 DNP 7-6-2 2-0-1 4-8-2 10-7-1 8-3-6 0-0-0 1-3-0

MARYLAND 4-3-1 DNP 18-3-1 DNP 3-1-0 5-1-3 14-1-2 11-5-1 7-4-5 DNP 2-1-0

vs. Buffalo ^ 0-2-1 DNP 18-8-3 DNP 5-1-0 3-0-0 6-3-2 12-2-0 10-2-1 0-1-0 0-4-0

vs. St. Francis (Pa.) ^ 3-6-3 DNP 16-6-2 DNP 11-6-2 15-1-5 DNP 8-3-0 DNP 2-2-0 2-7-1

at Columbia 5-5-0 DNP 12-1-2 DNP 8-3-1 6-1-1 DNP 17-5-5 4-2-3 0-1-0 4-1-0

MD. EASTERN SHORE 2-7-1 DNP 19-8-3 DNP 9-6-1 11-3-1 DNP 12-7-1 4-0-3 DNP 0-2-0

LEHIGH * 9-13-0 DNP 32-4-0 DNP 9-7-6 DNP DNP 6-5-3 9-4-4 2-1-1 2-6-0

BUCKNELL * 3-7-1 DNP 20-5-2 DNP 6-1-3 2-1-1 6-2-2 12-3-0 10-2-5 DNP 4-2-0

at Colgate * 9-5-0 DNP 26-6-4 DNP 10-8-5 3-1-1 9-3-0 13-7-3 6-1-6 2-1-0 2-4-0

ARMY * 4-9-1 DNP 14-2-2 DNP 14-1-1 6-2-0 2-5-1 14-13-3 8-3-5 0-1-0 2-5-0

at Holy Cross * 2-7-2 DNP 21-8-0 DNP 3-7-3 3-0-1 5-4-2 15-4-2 15-3-3 0-0-0 0-0-0

at Navy * 2-7-0 DNP 17-3-3 DNP 0-5-2 0-3-2 15-8-4 17-6-2 5-1-1 6-3-0 DNP

LAFAYETTE * 8-10-0 DNP 9-5-1 DNP 2-6-4 6-1-0 8-5-3 15-2-0 7-3-1 0-0-0 0-0-0

at Lehigh * 2-6-0 DNP 6-3-2 DNP 2-5-1 4-2-0 9-6-1 13-5-1 7-1-5 0-0-0 3-5-0

at Bucknell * 8-8-1 DNP 19-2-3 DNP 0-2-0 0-3-1 2-2-1 16-5-0 6-4-2 DNP 2-1-0

COLGATE * 10-5-1 DNP 14-3-2 DNP 2-1-3 4-1-2 14-4-2 27-8-5 8-3-4 1-2-0 2-5-0

at Army *

HOLY CROSS *

NAVY *

at Lafayette *

PL Quarterfi nals

* indicates Patriot League game^ Hatter Classic in DeLand, Fla.

00 N

yani

n

4 G

eorg

e

10 R

yan

12 E

dwar

ds

13 Y

ench

o

15 S

trac

k

22 L

eer

23 H

arris

42 M

dDon

ald

44 A

nya

2009-10 Scoring Summary

5 K

irk

Page 11: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1111

Points High Low

82 vs. Colgate (2/13/10)40 at Drexel (12/2/09)

77 by Princeton (11/16/09)31 by Lafayette (1/30/10)

FG Made High Low

31 at Colgate (1/16/10)12 vs. Buffalo (12/28/09)

31 by Princeton (11/16/09)12 by Lafayette (1/30/10)

FG Attempts High Low

62, fi ve times, last at Colgate (1/16/10)42 vs. Buffalo (12/28/09)

68 by Lehigh (1/9/10)36 by Lafayette (1/30/10)

FG % High Low

52.2 vs. NJIT (11/24/09)28.6 vs. Buffalo (12/28/09)

51.9 by Maryland (12/20/09)28.3 by Colgate (2/13/10)

3-Pt. FG Made High Low

9 vs. Army (1/20/10)1 at Bucknell (2/10/10)

10 by Princeton (11/16/09)0 by Lafayette (1/30/10)

3-Pt. FG Attempted High Low

26 vs. Maryland (12/20/09) 10 at Bucknell (2/10/10)

25 by Morgan State (12/16/09)6 by Lafayette (1/30/10)

3-Pt. FG % High Low

58.3 at Princeton (11/16/09)10.0 at Bucknell (2/10/10)

57.1 by Wagner (11/28/09)0.0 by Lafayette (1/03/10)

Free Throws Made High Low

25 vs. Buffalo (12/28/09)2 at Princeton (11/16/09)

19 by Howard (11/13/09)3 by Morgan State (12/16/09)

Free Throws Att. High Low

28, two times, last vs. Buffalo (12/28/09)5 at Lehigh (2/6/10)

24 by Lehigh (2/6/10)4 by Morgan State (12/16/09)

Free Throw % High Low

100.0 at Navy (1/27/10)33.3 at Princeton (11/16/09)

100.0 by NJIT (11/24/09)46.7 by Lafayette (1/30/10)

Rebounds High Low

45, two times, last vs. Army (1/20/10)21 vs. Maryland (12/20/09)

46 by Maryland (12/20/09)27 by NJIT (11/24/09)

Assists High Low

19, two times, last vs. Colgate (2/13/10)6 vs. Buffalo (12/28/09)

20 by Princeton (11/16/09) 8, two times, last by Army (1/20/10)

Steals High Low

15 at Columbia (1/2/10)3 vs. NJIT (11/24/09)

12 by East Carolina (11/22/09)2 by Bucknell (1/13/10)

Blocked Shots High Low

8 at Lehigh (2/6/10)0 vs. East Carolina (11/22/09)

8 by Wagner (11/28/09)0, five times, last by St. Francis (Pa.) (12/29/09)

Turnovers High Low

25, two times, last vs. St.Francis (Pa.) (12/29/09)7 at Holy Cross (1/24/10)

28 by Bucknell (1/13/10)11, twice, last by Lehigh (1/9/10)

Fouls High Low

19, two times, last at Lehigh (2/6/10)9, two times, last vs. Bucknell (1/13/10)

21 by High Point (12/6/09)8 by Maryland (12/20/09)

2009-10 Team Game Highs/LowsAmerican Opponents

Page 12: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1212

Eagles win opening tip .........................................................5-2 Opponent wins opening tip .......................................... 11-6Eagles lead at halftime .......................................................13-1 Eagles trail at halftime ...................................................3-6 Eagles tied at halftime ...................................................0-1Eagles lead with 5:00 left ...................................................15-0 Eagles trail with 5:00 left ...............................................1-8 Eagles tied with 5:00 left ...............................................0-0Eagles outrebound opponent .............................................10-5 Opponent outrebounds the Eagles................................6-3 Eagles tie opponent in rebounds ...................................0-0Eagles shoot 50% or better from the fi eld ............................3-0 Opponent shoots 50% or better from the fi eld...............1-2Eagles shoot 40% or better from 3-point range ...................7-3 Opponent shoots 40% or better from 3-pt .....................3-2 Eagles shoot better than opponent from 3-pt ..............13-2Eagles have better FG% than opponent ............................14-1 Opponent has better FG% than the Eagles .................2-6 Eagles and opponent shoot equal FG%........................0-1Eagles have more FT attempts ..........................................12-2 Opponent has more FT attempts ..................................4-6 Eagles and opponent have equal FT attempts ..............0-0Eagles’ bench outscores opponent ......................................4-1 Opponent’s bench outscores Eagles’ .......................... 11-7 Bench scoring is equal ..................................................1-0Following an Eagle win ........................................................9-6 Following an Eagle loss.................................................6-2Eagles commit fewer turnovers than opponent ..................12-3 Eagles commit more turnovers than opponent..............4-5 Eagles and opponent commit equal turnovers ..............0-0Two or fewer Eagles score in double fi gures .......................6-4 Three Eagles score in double fi gures ............................9-3 Four Eagles score in double fi gures ..............................1-1 Five or more Eagles score in double fi gures .................0-0

Eagles score 59 points or less .............................................5-5 Eagles score between 60-69 points ..............................8-2 Eagles score between 70-79 points ..............................1-1 Eagles score between 80-89 points ..............................2-0 Eagles score between 90-99 points ..............................0-0 Eagles score 100 points or more...................................0-0In games decided by three points or less.............................0-2 In games decided by 4-10 points ..................................4-4 In games decided by 11-20 points .................................8-1 In games decided by 21-29 points ................................3-0 In games decided by 30 points or more ........................1-1In November games .............................................................3-3 In December games ......................................................3-3 In January games ..........................................................8-1 In February games ........................................................2-1 In March games.............................................................0-0Monday games.....................................................................2-1 Tuesday games .............................................................1-1 Wednesday games ........................................................6-1 Thursday games............................................................0-0 Friday games.................................................................1-0 Saturday games ............................................................4-3 Sunday games ..............................................................2-2Afternoon games ..................................................................8-5 Evening games..............................................................8-3Against ranked teams ..........................................................0-0Overtime games ...................................................................1-0Tournament games ..............................................................1-1

Eagles Record in 2009-10 When...

An American Student-Athlete ...Scored 30-39 Points: ......................... ................Michelle Kirk (32) vs. Lehigh, 1/9/10Scored 40+ Points: ............................................................................ ............... NeverAttempted 20+ Field Goals: ............................... Michelle Kirk (21) vs. Lehigh, 1/9/10Made 10+ Free Throws: ................................ Michelle Kirk (12) vs. Buffalo, 12/28/09Record 13+ Rebounds: ................................. Ohemaa Nyanin (13) vs. Lehigh, 1/9/10Registered 10+ Assists: ................................ .. ..Pam Stanfi eld (11) vs. Navy, 2/21/06Made 5+ Three-Pointers: .................... ........... .Michelle Kirk (5) vs. Bucknell, 1/13/10Blocked 5+ Shots: .............................. ........................ ...Liz Leer (5) at Lehigh, 2/6/10Had 5+ Steals: ........................ ........ ........... Ebony Edwards (5) vs. Colgate, 2/13/10Had a Double-Double: ............ ............. Liz Leer (14 pts., 13 rebs.) vs. Army, 1/20/10Had Three Cons. Double-Doubles: .................................................................... NeverLed Team in Points, Rebs. & Assists: ... .........Liz Leer (27, 8, 5) vs. Colgate, 2/13/10Hit Shot in Final Five Seconds to Win: ....... Chanel Hunt (0:00.5) at Colgate, 1/23/04

An American Team ...Had a 20+ point win: .....................................................vs. Lafayette (53-31), 1/30/10Had a 30+ point win: ....................................................... vs. Colgate (82-47), 2/13/10Had a 40+ point win: .................................. .. vs. Sacramento State (82-41), 11/21/97Had a 50+ point win: ..................................................... .vs. Baltimore (97-43), 1/6/83Scored 100+ points: ..................................... .vs. George Mason (109-74 W), 2/21/81Combined with opponent to score 200+ points: .. .... at Richmond (93-115 L), 1/28/00Tallied 50+ rebounds: ............................................. .................50 vs. Bucknell. 3/9/08Three players fouled out: .............. at Navy (Costenbader, Spriggs, Werries), 2/11/03

Made 10-14 three-pointers:.......................................... vs. Rhode Island (10), 12/7/08Made 15+ three-pointers: ................................................ ... .............................. NeverMade more 3-ptrs. than 2-point fi eld goals: ...................................................... Never Dished 20+ assists: .................................................... .........vs. Columbia (26), 1/4/09Four players scored in double-digits: ............................ vs. Colgate (Leer 27, Kirk 14, .................................................................................... Strack 14, Nyanin 10), 2/13/10Five players scored in double-digits: .....................................................vs.Holy Cross.....................(Hayes 17, Stanfi eld 15, Jackson 14, Leer 12, N’Garsanet 10), 2/23/08Six players scored in double-digits: ............................................................... vs. Navy .................................................................................(Spriggs 16, Hunt 15, McNatt 14, ................................................................. Barnes 13, Salem 13, Schuyler 10), 3/5/04All fi ve starters scored in double-digits: ........................................at Mount St. Mary’s........................................................................... (Spriggs 16, Schuyler 15, Salem 13,.......................................................................................Hunt 12, Barnes 10), 12/3/03Two+ players recorded double-digit rebounds: .............................vs. Bucknell, 3/9/08.................................................. Smith-Davidson (12), N’Garsanet (11), Jackson (10)Had a single-overtime win: ..................................................vs. Lehigh (69-65), 1/9/10Had a single-overtime loss: .................................................. vs. Army (60-58) 2/18/09Had a double-overtime win: .................................................. vs. Penn (84-80), 3/2/93Had a double-overtime loss: ...............................................vs. Liberty (76-72), 1/6/04Lost when scoring 75 points: .............................. vs. Holy Cross (78-84 OT), 1/26/03Had a 20+ win season: ........................................................................1997-98 (23-7)Played in a postseason tournament:.....................................................2008-09 WNIT

The Last Time...

Page 13: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1313

Game 1 - Nov. 13, 2009 American 71, Howard 59Burr Gymnasium • Washington, D.C.

Michelle Kirk scored a game-high 25 points on 10-of-20 shooting from the fi eld to lead the American University women’s basketball team to a 71-59 victory at Howard on Friday night in both teams’ 2009-10 season-opener. American (1-0) got off to a slow start, falling behind 15-10 in the game’s fi rst seven-plus minutes in a contest that was played at Howard’s Burr Gymnasium in Washington, D.C. A Liz Leer three-point play spurred an 8-0 Eagles’ run, which gave them an 18-15 lead with 11 minutes to play in the opening half. American proceeded to open up a seven-point advantage late in the half, but a 9-0 Bison run late in the fi rst stanza helped give Howard (0-1) a 34-33 lead heading into halftime. The Eagles began to take control of the game in the second half, as a Kirk layup less than two minutes in gave AU a 37-36 lead. The Eagles would not trail in the rest of the contest, as AU proceeded to go on a 7-1 run, capped by a Nicole Ryan three-pointer, to take a 48-39 lead with less than 15 minutes to play. Howard tried to get back in the game throughout the remain-der of the second half, but was unable to get within fi ve points of AU. A mini 5-0 spurt by American on a Lisa Strack three-pointer and Raven Harris bucket gave the Eagles a 58-48 lead with7:07 to play. The Eagles put the fi nal stamp on their victory with an 11-0 run over a three-minute span to open up a 19-point (71-52) advantage with just over two minutes to play. Howard would score the fi nal seven points of the game to close the fi nal margin to 12, 71-59. Kirk, a junior forward, led the way for American with 25 points, only two points shy of her career-high, which she set last January versus Navy. The Preseason All-Patriot League selection also chipped in seven rebounds and three assists in 37 minutes of action. Leer added 18 points for AU on 8-of-13 shooting and recorded game-highs with eight rebounds and four assists. Leer’s 18 points and four helpers both matched career-highs. She has now reached the 18-point mark in six different games throughout her career. Additionally, the junior forward converted her fi rst-career three-point fi eld goal in the victory over Howard. For the game, the Eagles shot 46.8 per-cent from the fi eld compared to only 32.8 percent for Howard. American was six-of-15 from three-point range (40 percent), and held the Bison to two-of-14 from deep (14.2 percent). “It was a good team effort tonight,” remarked American University Head Coach Matt Corkery. “We made some adjustments at the half that were good for us. We did a better job on the boards as well. We were pleased with our offensive execution in the second half.”

American (1-0) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 4-8 0-1 5 8 0 0 0 25Kirk, Michelle 10-20 3-5 7 25 3 1 2 37Ryan, Nicole 1-7 1-2 2 4 3 0 0 26 Leer, Liz 8-13 1-1 8 18 4 1 0 38Harris, Raven 2-4 2-2 3 6 1 0 0 22Edwards, Ebony 2-4 0-0 1 5 2 0 1 14Yencho, Ashley 1-1 0-0 0 2 0 0 0 2Strack, Lisa 1-3 0-0 3 3 3 0 2 21McDonald, Janelle 0-2 0-0 0 0 1 0 1 10Anya, Stephanie 0-0 0-1 0 0 0 0 0 5Team 9Totals 29-62 7-12 38 71 18 2 6 200

Howard (0-1) FG-A FT-A Reb TP A Blk S MinCurley-Payne, C. 2-6 1-3 3 5 4 0 0 35Brown, Zakia 4-18 6-7 2 16 2 0 2 35Doyle, Saadia 3-7 10-10 12 16 1 0 1 29Deterville, Portia 0-2 0-0 0 0 0 0 0 10Smith, Kara 2-6 1-1 2 5 0 0 0 25Holmes, Tamoria 3-10 1-2 3 7 1 0 1 23Baulkman, Charae 1-2 0-0 3 2 0 0 1 14O’Neal, Julee 2-3 0-0 4 4 0 0 0 10Edwards, Amanda 2-4 0-0 3 4 0 0 1 19Team 11Totals 19-58 19-23 43 59 8 0 6 200

Halftime: Howard 34, American, 33. 3-Point Goals: American 6-15 (Kirk 2-6, Ryan 1-4, Leer 1-1, Edwards 1-3, Strack 1-1), Howard 2-14 (Curley-Payne 0-1, Brown 2-10, Holmes 0-3). Turnovers: Howard 15, American 13.

Game 2 - Nov. 16, 2009 Princeton 77, American 45Jadwin Gym • Princeton, N.J.

The American University women’s basketball played at Princeton on Monday night at Jadwin Gym in Princeton, N.J., and was defeated by a score of 77-45. It began well for the Eagles, as senior Nicole Ryan knocked down back-to-back three pointers in the fi rst three minutes of play to give American (1-1) an early 6-0 lead. Princeton (2-0), however, stormed right back with 18 straight points over the next eight minutes to take a 18-6 advantage before a Michelle Kirk three-point fi eld goal broke the scoreless drought for the Eagles. The Tigers continued to have their way on the of-fensive end throughout the remainder of the fi rst half, opening up a 19-point advantage, 30-11, with 3:20 to play on a Addie Micir three-pointer. American began to get its rhythm toward the end of the opening stanza on back-to-back buckets by junior Liz Leer to cut the Princeton lead to 32-15. The Tigers ended up taking a 17-point lead, 34-17, into the halftime intermission after shoot-ing 42.9 percent from the fl oor (15-35) compared to only 27.3 percent (6-22) for the Eagles. The second half played out in a similar fashion to the fi rst 20 minutes, as the Eagles got off to a good start on back-to-back early buckets by Leer and sophomore Lisa Strack to trim the Princeton lead to 15. But the Tigers proceeded to rattle off 16 unanswered points to take a commanding 55-24 advantage with 14 minutes left in the contest. The teams would play even basketball over the fi nal several minutes, as Princeton cruised to a 77-45 home victory. In the game, Princeton shot 50.8 percent from the fl oor (31-61), including an impressive 52.6 (10-19) percent from three-point range. The Eagles fi nished the game at 40 per-cent overall (18-45), and were seven-of-12 from beyond-the-arc. The combination of Micir and Niveen Rasheed fi nished with 20 and 18 points for Princeton, respectively. The duo combined to shoot 15-for-25 from the fl oor and grabbed 10 total rebounds. American was led by Ryan, who scored 16 points on six-of-11 shooting, including four-of-six from behind the arc. Her four triples gives her 149 in her career, moving her second in AU history. Kari Gaskins, who played at AU from 1995-99, was previously second all-time in made three-pointers with 147. American (1-1) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 0-2 0-0 3 0 1 0 0 19Kirk, Michelle 3-8 0-2 6 8 3 0 0 30Ryan, Nicole 6-11 0-0 0 16 1 0 0 27 Leer, Liz 3-6 0-0 3 6 0 0 0 27Harris, Raven 1-5 0-0 3 2 4 0 2 27Edwards, Ebony 0-0 0-0 3 0 0 0 1 12Yencho, Ashley 1-2 2-4 0 4 0 0 0 14Strack, Lisa 2-4 0-0 4 5 1 0 1 23McDonald, Janelle 2-6 0-0 5 4 0 1 0 17Anya, Stephanie 0-1 0-0 0 0 0 0 0 4Team 1Totals 18-45 2-6 28 45 10 1 4 200

Princeton (2-0) FG-A FT-A Reb TP A Blk S MinMicir, Addie 7-13 0-0 2 20 0 0 1 31Edwards, Lauren 4-9 0-0 5 9 5 0 3 23Allgood, Devona 5-11 0-0 7 10 2 1 1 25Polansky, Lauren 0-1 0-0 2 0 4 0 1 21Rasheed, Niveen 8-12 1-2 5 18 5 0 2 27Hill, Krystal 4-8 2-2 0 11 1 0 0 17Binkley, Beth 0-0 0-0 0 0 1 0 0 2Miller, Kate 1-2 2-2 1 4 1 0 0 11Johnson, Laura 1-3 0-0 0 3 0 0 0 15Brown, Tani 1-1 0-0 2 2 1 0 0 13Bowen, Megan 0-0 0-0 3 0 0 0 0 3Stevens, Cheryl 0-1 0-0 4 0 0 1 0 12Team 1Totals 31-61 5-6 32 77 20 2 8 200

Halftime: Princeton 34, American, 17. 3-Point Goals: American 7-12 (Kirk 2-4, Ryan 4-6, Harris 0-1, Strack 1-1), Princeton 10-19 (Micir 6-11, Edwards 1-4, Rasheed 1-1, Hill 1-2, Johnson 1-1). Turnovers: American 25, Princeton 14.

Game 3 - Nov. 18, 2009 American 64, Brown 54Pizzitola Sports Center • Providence, R.I.The duo of Michelle Kirk and Liz Leer recorded career-highs with 27 and 19 points, respectively, to lead the American University women’s basketball team to a 64-54 victory at Brown on Wednesday afternoon in Providence, R.I. Senior Nicole Ryan grabbed a career-high 10 rebounds in the vic-tory, as the Eagles used a 17-0 run in the second half to take control of the game. The fi rst several minutes went back-and-forth before Brown (0-2) scored four straight points to take a 20-15 lead midway through the fi rst half. Leer re-sponded for American (2-1) with consecutive left-handed layups to close the gap to one, 20-19, with 7:55 to play in the opening stanza. After back-to-back Kirk three-pointers gave AU a 25-22 lead, Brown put together an 8-0 spurt to take a 30-25 advantage. The Bears opened up a six-point lead, 32-26, late in the fi rst half before the Eagles scored three points in the fi nal two seconds on a Lisa Strack free throw and a Leer rebound, put-back as time expired. Brown took a 32-29 lead into halftime and extended it to fi ve on a Courtney Lee jumper a minute into the second half. The rest of the contest turned into a game of runs, as the Eagles initially rolled off fi ve straight points - on a Kirk free throw, a beautiful dish from Strack to Leer for a close-range bucket and an Ebony Edwards steal and coast-to-coast layup - to knot the score at 34 with 17:03 to play. The Bears quickly responded, running off seven unanswered points over the next two-plus minutes to take a seven-point advantage, 41-34. Facing their largest defi cit of the game, the Eagles showed toughness and found their rhythm on both ends of the fl oor, rolling off 17 consecu-tive points over an eight-and-a-half minute span to take a 51-41 lead with 5:59 to go. American knocked down three three-pointers during the spurt, two by Kirk and one by Ash-ley Yencho. Ohemaa Nyanin scored initial bucket to get the run started on a rebound and follow-up layup. Brown would scrap its way back into the contest, cutting the AU lead to four with 2:08 to play before a pair of Kirk free throws and a back-breaking three-point play by Leer at the 1:12 mark gave the Eagles a 58-49 advantage. Kirk would convert four more free throws in the fi nal minute, and AU came away with a 64-54 road victory. The Eagles shot 37.5 percent from the fl oor (21-56) in the contest, although they held Brown to only 33.3 percent (20-60). Additionally, American took good care of the basketball with only 12 turnovers. Kirk, a Preseason All-Patriot League selection, led the Eagles with 27 points, which matches her career-high that she set last January ver-sus Navy. She was six-of-14 from the fi eld, and converted career-best 11 made free throws in 14 attempts. She also added seven rebounds and a career-high two blocked shots. Leer, a junior forward, had her way in the paint all afternoon, scoring 19 points on eight-of-15 shooting. She also recorded nine rebounds and had three blocks. While Ryan struggled shooting the ball with only two points, she made an impact on the game in other ways. From the guard position, she notched a career-best 10 rebounds and picked up two steals. “I thought we showed a lot of character and resiliency in coming back from a defi cit in the second half,” remarked American University Head Coach Matt Corkery. “We kept our turnovers down and were able to get some stops. It was the way we wanted to end our three-game road swing.”

American (2-1) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 2-3 0-3 3 4 1 0 0 19Kirk, Michelle 6-14 11-14 8 27 0 2 0 35Ryan, Nicole 1-8 0-1 10 2 3 0 2 36 Leer, Liz 8-15 3-3 9 19 2 3 0 35Edwards, Ebony 1-6 0-0 1 2 1 0 2 29Yencho, Ashley 1-1 0-0 0 3 0 0 0 9Strack, Lisa 0-4 3-4 4 3 2 0 1 31Harris, Raven 0-2 0-0 1 0 1 0 0 4McDonald, Janelle 1-1 0-0 2 2 0 1 0 5Anya, Stephanie 1-2 0-0 0 2 0 0 0 3Team 7Totals 21-56 17-25 45 64 10 5 5 200

Brown (0-2) FG-A FT-A Reb TP A Blk S MinBonds, Natalie 1-5 0-0 3 2 0 1 1 13Delk, Sarah 3-8 0-0 6 8 0 0 0 23Nickel, Lindsay 1-5 0-0 1 2 1 0 0 16Lee, Coutney 4-6 1-4 4 9 5 0 2 22Passafuime, H. 4-9 0-0 5 9 1 0 2 29King, Caroline 0-1 0-0 4 0 0 0 1 9Johnson, Christina 4-8 3-3 6 12 1 0 1 21Dixon, Sheila 0-9 0-0 2 0 4 0 0 16Steele, Lindsay 1-5 2-2 3 5 2 0 0 26Daniels, Aileen 0-1 0-0 0 0 0 0 0 4Masaschi, Taylor 2-3 1-1 1 7 0 0 0 21Team 3Totals 20-60 7-10 38 54 14 1 6 200

Halftime:Brown 32, American, 29. 3-Point Goals: American 5-21 (Kirk 4-8, Leer 0-1, Ryan 0-5, Edwards 0-3, Yencho 1-1, Harris 0-1, Strack 0-2), Brown 7-22 (Delk 2-6, Nickel 0-2, Passafuime 1-4, Johnson 1-1, Dixon 0-4, Steele 1-2, Mas-aschi 2-3). Turnovers: Brown 13, American 12.

Page 14: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1414

Game 4 - Nov. 22, 2009 ECU 70, American 65Bender Arena • Washington, D.C.Despite shooting 15-of-16 from the free throw line in the game, the American University women’s basket-ball team fell 70-65 to East Carolina in AU’s home opener at Bender Arena. Junior Michelle Kirk led the Eagles with 19 points, 15 of which she scored in the second half. After East Carolina (4-0) jumped out to a quick 6-2 lead in the fi rst four-plus minutes, American (2-2) fi red back with six unanswered points to take an 8-6 advantage with 13:32 to play in the fi rst half. The next several minutes would go back-and-forth with ju-nior Liz Leer knocked down a jumper to tie the score at 17 at the 7:23 mark. The Pirates, however, pro-ceeded to go on an 11-2 run to open up a 28-19 lead with 5:07 to play, and took a 32-25 lead into halftime. The Eagles got off to a strong start in the second half on the shoulders of Kirk, who scored seven points in the fi rst four minutes to help cut the defi cit to two, 38-36. East Carolina kept a steady lead between four and six points for the next six-plus minutes until two Ebony Edwards free throws cut the ECU advantage back to two, 46-44, with 10:56 to play. With a high number of personal fouls committed early in the second half, both teams were in the bonus midway through the second half. AU proceeded to knock down four consecutive free throws, two each by Nicole Ryan and Kirk, to knot the score at 48. After a made free throw by East Car-olina’s Ashley Clarke, Kirk converted two more from the foul line to give the Eagles a 50-49 lead, their fi rst advantage since leading 8-6 in the fi rst half. The two squads would exchange blows over the next few min-utes before two Ohemaa Nyanin free throws knotted the score at 54 with under seven minutes to play. The Pirates, however, responded with the next fi ve points to take a 59-54 lead before an Edwards rebound, put-back, followed by a Leer backdoor layup, cut the East Carolina advantage to one, 59-58, with four minutes to play. The game would continue to remain tight down the stretch, as consecutive jumpers by AU’s Leer and a runner in the lane by Raven Harris, would knot the score at 65 with one minute left in the ballgame. The fi nal minute, however, belonged to the Pirates. A Kelly Smith fl oater from close range gave East Carolina a 67-65 lead with 35 seconds to play, and then a steal and coast-to-coast layup by ECU’s Crystal Wilson with 14 seconds left put the game out of reach for AU. The Pirates would tack on a late free throw in the fi nal fi ve seconds to come away with a 70-65 road victory over American. In the game, American shot 93.8 percent (15-16) from the free-throw line, the sixth-best single-game team free throw percentage in program history. Kirk led the Eagles with a perfect six-of-six mark from the charity stripe. The other fi nal statistics were similar across the board for both squads. East Carolina held a slight 49 percent to 46 percent advantage in fi eld goal percentage, and committed two fewer turnovers (18) to American’s 20. Both teams struggled from three-point range, as AU was 2-11, while East Carolina shot 2-10 from deep. For the third game this season, Kirk led the Eagles in scoring with 19 points. She also chipped in six rebounds. Leer and Ryan recorded double-digit scoring outputs for the Eagles with 14 and 11 points, respectively. Leer was seven-of-nine from the fl oor. The senior Nyanin also recorded career-highs with eight points and nine rebounds for AU.

ECU (4-0) FG-A FT-A Reb TP A Blk S MinGay, Kim 6-7 6-7 11 18 1 0 3 31Spivey, Allison 3-9 0-0 2 7 2 0 2 36Clarke, Ashley 4-10 3-5 2 11 6 0 2 34Smith, Kelly 2-6 0-0 2 5 1 0 0 24Best, Jean 2-3 4-4 2 8 0 0 0 10Stewart, Celeste 0-0 0-0 0 0 1 0 0 6Smith, Chareya 4-8 2-4 1 10 1 0 1 27Wilson, Crystal 4-7 1-2 2 9 1 0 4 23Jackson, Ariana 1-1 0-0 1 2 0 0 0 1Ashford, Shuanda 0-2 0-0 3 0 0 0 0 9Team 4Totals 26-53 16-22 30 70 13 0 12 200

American (2-2) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 3-7 0-0 9 8 0 0 0 23Kirk, Michelle 6-16 6-6 6 19 2 0 0 38Ryan, Nicole 4-8 2-2 0 11 2 0 1 32Edwards, Ebony 2-4 2-2 2 6 1 0 3 22Leer,Liz 7-9 0-0 5 14 1 0 0 36Strack, Lisa 0-2 2-2 2 2 0 0 0 13Harris, Raven 1-4 0-0 0 2 4 0 0 16Mcdonald, Janelle 1-1 0-0 0 2 0 0 0 5Anya, Stephanie 0-1 1-2 3 1 1 0 0 15Team 1Totals 24-52 15-16 28 65 11 0 4 200

Halftime: East Carolina 32, American 25. 3-Point Goals: East Carolina 2-10 (Spivey 1-3, Clarke 0-1, K. Smith 1-5, C. Smith 0-1), American 2-11 (Kirk 1-6, Ryan 1-3, Edwards 0-1, Harris 0-1). Turnovers: American 20, East Carolina 18.

Game 5 - Nov. 24, 2009 American 65, NJIT 57Bender Arena • Washington, D.C.On the strength of 24 points by junior Michelle Kirk and a career-game by sophomore Lisa Strack, the American University prevailed 65-57 over the New Jersey Institute of Technology in a hard-fought con-test on Tuesday night at Bender Arena. The game was evenly-contested for the majority of the fi rst half, as the margin was within four points until the 1:45 mark. NJIT (2-3) opened up a four-point lead, 12-8, with 10:17 to play in the fi rst half on a Rayven John-son jumper, although the Highlanders’ advantage was short-lived. With American (3-2) trailing 18-15, senior Nicole Ryan’s three-pointer sparked a 10-0 Eagles’ run over a two-plus minute span to give AU a 25-18 lead with just over a minute to play in the opening stanza. American would take a 25-20 lead into intermission in a fi rst half that saw eight different Eagles score at least two points. The Eagles would continue the strong play in the second half, scoring the fi rst fi ve points on a Liz Leer jumper and Strack three-point play to take a 30-20 lead. American would eventually increase the margin to 12, 40-28, with 13:41 left on another bucket by Strack. But the re-silient Highlanders would not go away, as they ran off nine-unanswered points to cut the margin to three, 40-37, at the midway point of the second half before a key Ohemaa Nyanin basket pushed the AU lead back to fi ve. The squads would play even until a 5-0 spurt by NJIT trimmed the American advantage to one, 50-49, with 4:19 to go. Facing a strong second-half push by NJIT, the Eagles turned to their Preseason All-Patriot League player, Kirk, down the stretch. She proceeded to run off seven straight points, including a key three-pointer, to give AU a 59-51 advantage, breaking the hearts of the hard-charging Highlanders. The Eagles also turned up the defensive intensity dur-ing the stretch, forcing fi ve NJIT turnovers in the fi nal four minutes. The Eagles would visit the free throw line frequently in the fi nal minute, and were able to hang on for a 65-57 victory. For the fourth game this season, Kirk led American in scoring with 24 points on an effi cient eight-of-14 shooting from the fl oor. She also recorded seven rebounds, which tied her for the game-high with teammates Strack and Leer. Strack’s seven boards, as well as her 11 points, both set career-highs. Leer was in double-fi gures for the fourth game this season with 10 points, and recorded a season-high four blocked shots.NJIT had four play-ers in double fi gures, led by Kehinde Oyelola’s 13 points and 12 from Ivana Seric. Jessica Gerald and Johnson contributed 11 and 10 points, respectively. The Eagles shot a season-high 52.2 percent from the fl oor, including a red-hot 60 percent (15-25) in the second half. AU was six-of-13 from three-point range (46.2 percent) in the contest. The Highlanders shot 40 percent from the fl oor and had a 33.3 percent mark from beyond-the-arc.

NJIT (2-3) FG-A FT-A Reb TP A Blk S MinGriffi n, Melanie 2-6 0-0 2 4 1 0 1 22Seric, Ivana 5-9 2-2 2 12 2 0 3 34Gerald, Jessica 3-13 2-2 4 11 1 0 0 33Oyelola, Taiwo 1-4 0-0 5 3 2 0 2 20Oyelola, Kehinde 5-9 2-2 5 13 1 0 4 31Johnson, Rayven 5-8 0-0 3 10 0 0 0 17Zoric, Jelena 0-0 0-0 0 0 0 0 0 0+Schartner, Emily 0-1 0-0 1 0 0 0 0 7Dweck, Kimberly 1-3 2-2 1 4 1 0 1 19Piekielski, Katie 0-2 0-0 3 0 3 0 0 17Sanchez, Maria 0-0 0-0 0 0 0 0 0 0+ Team 1Totals 22-55 8-8 27 57 11 0 11 200

American (3-2) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 8-14 6-7 7 24 0 1 1 39Ryan, Nicole 1-6 0-3 3 3 3 0 0 30Edwards, Ebony 1-2 0-2 1 3 3 0 0 20Strack, Lisa 4-6 2-3 7 11 0 0 0 25Leer, Liz 4-9 2-2 7 10 3 4 1 35Nyanin, Ohemaa 2-3 1-2 2 5 0 0 0 15Yencho, Ashley 1-1 0-0 0 3 1 0 0 9Harris, Raven 2-3 0-1 2 4 5 0 1 17Mcdonald, Janelle 1-2 0-0 1 2 0 0 0 8Anya, Stephanie 0-0 0-0 0 0 0 0 0 2Team 2Totals 24-46 11-20 32 65 11 5 3 200

Halftime: American 25, NJIT, 20. 3-Point Goals: NJIT 5-15 (Gerald 3-8, T. Oyelo-la 1-2, K. Oyelola 1-5), American 6-13 (Kirk 2-5, Ryan 1-4, Edwards 1-1, Strack 1-2, Yencho 1-1). Turnovers: American 18, NJIT 16.

Game 6 - Nov. 28, 2009 Wagner 73, American 72Spiro Sports Center • Staten Island, N.Y.A three-pointer by Wagner’s Stephanie McBride with under 30 seconds remaining gave the Seahawks a hard-fought 73-72 victory over the American University women’s basketball team on Saturday afternoon in Staten Island, N.Y. AU junior Michelle Kirk led the Eagles with a game-high 25 points in the defeat. Both teams got off to slow starts on the offensive ends, although American (3-3) was the first to find its range thanks to Nicole Ryan. The senior scored eight early points, includ-ing two three-pointers, to give the Eagles a 15-4 lead midway through the first half. Wagner (2-3) quickly found its rhythm over the next two minutes, rolling off seven unanswered points to cut the AU lead to four, 15-11. The Eagles, however, would regain a nine-point advantage, 22-13, on an Ohemaa Nyanin layup with 7:11 left in the opening stanza. The Seahawks con-trolled the action for the remainder of the opening half. Wagner went on a 10-2 run to cut the AU lead to one, 24-23, with just over five minutes remaining. Back-to-back three pointers by Wagner’s McBride gave the Seahawks their first lead of the game, 34-31, with 2:32 to play. Wagner eventually stretched its lead to eight, 39-31, before the Eagles responded with the last four points of the half on buckets by Nyanin and Lisa Strack, to cut the halftime deficit to a 39-35 margin. AU continued the strong play opening up the second half, scoring the first four points on baskets by Ryan and Kirk to tie the game at 39. But Wagner responded with the next five to take a 44-39 lead be-fore back-to-back buckets by Kirk to cut the margin to one, 46-45. Kirk would continue to have the hot hand for the Eagles, as the teams played even before a pair of Ryan free throws tied the score at 56 with exactly 10 minutes to play. Wagner, how-ever, would rattle off seven unanswered points to take a 63-56 advantage. The Eagles responded, eventually fighting back to tie the game at 66 with 3:14 to play on a Liz Leer bucket from close-range. The game would go back-and-forth throughout the remainder of the second half, although the Eagles never led until a pair of Strack free throws gave AU a 72-70 lead with 52.9 seconds to play. Facing a one-point deficit, Wagner came down the floor, where McBride knocked down a clutch three-pointer from the corner to give the Seahawks a 73-72 lead with 28 seconds left in the contest. After a pair of timeouts, the Ea-gles had a game-winning opportunity, as Kirk penetrated and kicked it out to a wide-open Strack in the corner, who rimmed out a three-pointer in the final seconds. Both teams scrambled for the rebound, but time ran out before the Eagles could get another shot on target. Kirk led American with a game-high 25 points on 10-of-18 shooting from the floor. She was a per-fect three-of-three from three-point range. Ryan chipped in 14 points, including six-of-seven from the free throw line, and dished out four assists. Leer and Strack were in double-figures with 10 points each as well for the Eagles. Leer also collected a game-high eight rebounds. McBride paced Wagner with 18 points, including the game-winning bucket. She was seven-of-11 from the field, including four-of-five from deep. In the game, Wagner shot 50 percent from the floor compared to 43 percent for the Eagles. Both teams were hot from three-point range, as the Seahawks shot 57 percent (8-14) while AU was 5-11 from long-range (46 percent).

American (3-3) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 10-18 2-2 4 25 1 1 0 37Leer, Liz 3-8 4-5 8 10 1 1 0 29Nyanin, Ohemaa 4-8 0-0 3 8 0 0 0 16Ryan, Nicole 3-7 6-7 2 14 4 2 2 35Edwards, Ebony 1-2 0-0 3 2 1 0 6 25Yencho, Ashley 0-0 0-0 0 0 0 0 0 2Strack, Lisa 2-4 6-6 4 10 1 0 0 27Harris, Raven 0-3 0-0 2 0 5 0 2 15Anya, Stephanie 1-5 1-3 7 3 0 1 2 14Team 1Totals 24-55 19-23 34 72 13 5 12 200

Wagner (2-3) FG-A FT-A Reb TP A Blk S MinArchambault, Marie 2-6 1-2 1 7 2 0 0 29Olsen, Ashley 3-7 0-0 8 7 0 1 0 27Harrison, Sha’Ron 4-10 2-2 5 10 4 3 1 27McBride, Stephanie 7-11 0-0 2 18 3 0 1 33Reed, Andrea 3-7 2-5 5 8 8 0 2 36Fourneir, Veronick 0-0 0-0 0 0 0 0 1 10Poole, John’a 2-4 0-0 2 5 2 0 0 11Hicks, Kanifa 0-0 0-0 0 0 0 0 0 1Patterson, Nyoto 1-2 4-5 1 6 0 0 0 4Thorpe, Brittney 0-0 0-0 0 0 0 0 0 2Clark, Kelly 5-7 2-3 4 12 0 4 0 20Team 3Totals 27-54 11-17 31 73 19 8 5 200

Halftime: Wagner 39, American 35. 3-Point Goals: Wagner 8-14 (McBride 4-5, Archambault 2-5, Olsen 1-3, Poole 1-1), American 5-11 (Kirk 3-3, Ryan 2-6, Strack 0-1, Harris 0-1). Turnovers: Wagner 18, American 15.

Page 15: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1515

Game 7 - Dec. 2, 2009 Drexel 50, American 40Daskalakis Ath. Center • Philadelphia, Pa.

With the score tied at 40 with four minutes to play, Drexel converted 10 straight free throws down the stretch to come away with a 50-40 victory over the American University women’s basketball team. The game was played Wednesday night at the Daska-lakis Athletic Center in Philadelphia, Pa. Early on, Drexel (3-2) jumped out to a 9-4 lead with all nine points being scored by Gabriela Marginean. American (3-4), however, responded with a 6-0 run over the next four minutes on Stephanie Anya and Ohemma Nyanin buckets and a pair of free throws by Michelle Kirk to take a 10-9 advantage. The teams would trade the lead over the next sev-eral minutes until a Kirk three-point play gave the Eagles an 18-15 advantage with 2:02 to play in the opening half. Ashley Yencho then knocked down a straight-away three on the following possession to give AU a 21-15 lead before a late Drexel bucket trimmed the Eagles’ halftime margin to four, 21-17. The Eagles increased their lead to six, 23-17, on a pair of Liz Leer free throws to start the second half. After a Dragons’ three, Leer knocked down a jumper from the corner to give AU a 25-20 ad-vantage. Kirk scored American’s next four points, although Drexel rallied to knot the score at 29 on a Marginean basket with 14:32 to play. After Drexel opened up a four-point lead, a heads-up steal in the frontcourt and three-point play by Ebony Edwards cut AU’s defi cit to one, 35-34. The Dragons would regain its four-point lead, 40-36, although back-to-back beautiful turnaround jumpers by Kirk tied the score at 40 at the under four-minute media timeout. Kirk’s basket at the 3:51 mark would end up being the last fi eld goal converted by either team in the game. Unfortunately for American, the Dragons would end up going a perfect 10-of-10 from the free throw line in the game’s fi nal three-plus minutes, and that proved to be the difference in Drexel’s 50-40 victory. Overall, in the game, the Dragons shot 17-of-18 from the free throw stripe. Marginean knocked down six of the free throws for Drexel in the fi nal few minutes, and was 11-of-12 from the line. She converted seven-of-12 fi eld goal opportu-nities, and scored a game-high 26 points. She also collected a team-high six rebounds for the Dragons. For the sixth time in seven games this season, Kirk led the Eagles on the offensive attack. She scored 13 points on fi ve-of-11 shooting from the fl oor. Leer recorded nine points and seven rebounds, while Lisa Strack grabbed a career-high eight rebounds for AU.

American (3-4) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 5-11 3-4 4 13 1 0 0 32Leer, Liz 3-6 2-3 7 9 1 2 1 34Nyanin, Ohemaa 1-5 0-0 5 2 1 0 0 24Ryan, Nicole 0-7 0-0 0 0 0 0 1 12Edwards, Ebony 1-1 1-1 1 3 0 0 1 16Yencho, Ashley 1-3 0-0 1 3 0 0 0 13Strack, Lisa 2-7 0-0 8 4 1 1 1 18Harris, Raven 1-7 2-4 3 4 3 0 4 29McDonald, Janelle 0-0 0-0 0 0 0 0 0 4Anya, Stephanie 1-5 0-0 3 2 0 1 0 18Team 3Totals 15-52 8-12 35 40 7 4 8 200

Drexel (3-2) FG-A FT-A Reb TP A Blk S MinNacickaite, Kamile 0-4 0-0 2 0 3 0 1 14Marginean, Gabriela 7-12 11-12 6 26 1 0 1 32Stjarnstrom, Jen 0-0 0-0 1 0 0 0 0 2Rosseel, Jasmina 2-11 0-0 5 6 1 0 1 35Crane, Marisa 0-4 2-2 3 2 1 0 1 38Hale, Tyler 5-9 0-0 5 10 3 1 2 24Johnson-Allen, R. 0-0 0-0 0 0 1 0 0 4Mershon, Hollie 0-2 4-4 3 4 1 1 0 16Wootton, Taylor 1-4 0-0 4 2 0 0 1 22Lee, Ayana 0-0 0-0 0 0 1 0 0 13Team 11Totals 15-46 17-18 34 50 12 2 7 200

Halftime: American 21, Drexel 17. 3-Point Goals: American 2-12 (Kirk 0-3, Leer 1-1, Ryan 0-3, Yencho 1-1, Strack 0-2, Harris 0-2), Drexel 3-18 (Nacickaite 0-3, Marginean 1-2, Rosseel 2-9, Crane 0-2, Mershon 0-2). Turnovers: American 19, Drexel 17.

Game 8 - Dec. 6, 2009 American 67, High Point 46Bender Arena • Washington, D.C.The trio of Michelle Kirk, Liz Leer and Lisa Strack combined for 50 points en route to a 67-46 victory for the American University women’s basketball team over High Point on Sunday afternoon at Bender Are-na. Kirk’s 22 points paced the Eagles, marking the seventh game this season she has led the team in scoring. The beginning of the game did not start out as well as American (4-4) had hoped, as High Point (2-5) jumped out to a 14-6 lead in the fi rst seven-plus minutes. The Eagles were able to quickly re-group, and dominated the rest of the fi rst half thanks to the play of Leer. The junior forward fi nished the fi rst 20 minutes with 14 points and seven rebounds, and led the Eagles on a 30-12 run to close out the half. American took a ten-point advantage, 36-26, into intermission. The second half began in a similar fashion to how the fi rst half ended, as the Eagles continued to control the action against High Point. The Panthers opened with the fi rst four points of the second half to cut the AU lead to six, 36-30, although that is as close as they would get. American went on a 10-2 run over the next two-plus minutes, which included eight Kirk points, to open up a 46-32 ad-vantage at the 12:54 mark. After a High Point three-pointer to cut its defi cit to 11, the Eagles responded with the next fi ve on buckets by Ebony Edwards and Strack to take a 51-35 lead midway through the sec-ond half. AU would continue to apply the pressure, eventually opening up a 20-point advantage, 60-40, on a made free throw by Strack with 7:12 remaining in the game. The two squads would play even down the stretch, as the Eagles came away with a con-vincing 67-46 home victory. American was highly ef-fi cient from the free throw line in the game, shooting 22-of-28 for 78.6 percent. In the past fi ve games, the Eagles have shot an impressive 75.8 percent (75-99) from the charity stripe. Additionally, the defen-sive pressure from American did the job against High Point, holding the Panthers to 31 percent shooting, including 18.2 percent (2-11) from three-point range. LeTeisha Dean, the second-leading scorer for High Point coming into the game at 9.8 points per contest, was held to two points on one-of-13 shooting from the fl oor. Individually for the Eagles, Kirk’s 22 points improves her Patriot League-leading scoring aver-age to 20.4 points per game. She was six-of-15 from the fl oor, and eight-of-nine from the free throw line. She also chipped in seven rebounds while playing all 40 minutes for the fi rst time in her career. After a hot fi rst half, Leer fi nished with 16 points on fi ve-of-13 shooting and six-of-seven from the free throw line. She recorded game-highs with nine rebounds and four blocked shots. Additionally, Strack chipped in a career-high 12 points for AU and seven rebounds, while Raven Harris dished out a game-high six as-sists. “I thought we did a good job on both ends of the fl oor,” American University Head Coach Matt Corkery commented on his live postgame interview on Eagles Vision TV. “Defensively, we got a lot of stops, and we followed our game plan as far as what we were trying to do on that end of the fl oor....Of-fensively, we executed. We really got to the foul line, and made a bunch of free throws and that always helps you win.”

High Point (2-5) FG-A FT-A Reb TP A Blk S MinDean, LeTeisha 1-13 0-0 7 2 3 0 1 22Fields, Frances 2-6 0-0 3 4 3 1 3 29Dodd, Amy 5-7 1-2 4 11 2 1 0 33Maier, Mackenzie 2-8 0-0 6 5 2 3 1 27Samuels, Ashlee 2-5 3-7 7 7 0 0 0 20Reynolds, Erin 2-4 0-1 1 5 1 0 0 11Hargraves, Jurica 0-3 0-0 0 0 0 0 1 18Whitt, Laura 0-2 0-0 0 0 0 0 0 9Cromartie, Jazmin 1-2 0-1 2 2 0 0 1 6Brown, Shamia 3-8 4-4 1 10 0 0 0 25Team 7Totals 18-58 8-15 38 46 11 5 7 200

American (4-4) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 1-3 0-0 5 2 1 0 1 13Kirk, Michelle 6-15 8-9 7 22 1 1 1 40Edwards, Ebony 3-5 1-2 1 8 0 0 1 21Leer, Liz 5-13 6-7 9 16 1 4 1 38Harris, Raven 1-6 1-2 3 3 6 0 1 37Yencho, Ashley 1-3 2-2 2 4 2 0 0 14Strack, Lisa 4-7 4-6 7 12 3 0 4 26McDonald, Janelle 0-0 0-0 1 0 0 0 0 1Anya, Stephanie 0-1 0-0 3 0 0 0 0 10Team 6Totals 21-53 22-28 44 67 14 5 9 200

Halftime: American 36, High Point 26. 3-Point Goals: High Point 2-11 (Dean 0-2, Maier, 1-3, Reynolds 1-3, Hargraves 0-3), American 3-11 (Kirk 2-5, Edwards 1-2, Harris 0-2, Yencho 0-1, Strack 0-1). Turnovers: High Point 21, American 17.

Game 9 - Dec. 16, 2009 American 59, Morgan State 45Bender Arena • Washington, D.C.Michelle Kirk’s sixth 20-point effort of the young season led the American University women’s bas-ketball team to a 59-44 win over Morgan State on Wednesday night at Bender Arena. American (5-4) never trailed in the game, jumping out to a hot 7-0 start in the game’s opening two minutes on fi ve points by Kirk. Morgan State (3-6) would get on track and knot the score at 13 with 10:35 to play in the opening half, although this would be the last tie of the game. Kirk, a junior, proceeded to knock down another three-pointer to open up a 16-13 ad-vantage, and later in the half, back-to-back trifectas by junior Liz Leer and Ebony Edwards would extend the Eagles’ lead to 26-15 with just under three min-utes to play in the opening stanza. American carried a 30-17 lead into halftime, and continued to apply the pressure early in the second half. AU went on a 9-2 run to begin the second 20 minutes, giving the Eagles a 39-19 advantage with 15:58 left in the game. Morgan State refused to go away easily, however, as the Bears grinded their way back into the game over the next 12 minutes. Morgan State eventually cut its defi cit to eight, 47-39, with 4:01 to play, but that is as close as the game would get. A key Leer layup stopped the Bears’ momentium, and Kirk cemented the victory with the next four points to extend the American advantage to 53-39 with 2:28 remaining. The two squads played even in the fi nal few minutes, and the Eagles came away with the 59-45 victory. Kirk led the Eagles for the eighth time in nine games this season with 20 points on an effi cient eight-of-13 shooting from the fl oor. The leading scorer in the Patriot League (20.3 ppg) has now scored at least 19 points in seven of AU’s games this season. Leer also scored in double fi g-ures for the Eagles with 10 points, while grabbing seven rebounds. Senior Ohemaa Nyanin chipped in seven points and matched a career-high with nine rebounds for AU. Additionally, sophomore Raven Harris tied career-bests with eight points and six assists, while classmate Lisa Strack matched her career-high with eight rebounds. The Eagles out-shot Morgan State by a 44 to 29 percent margin, and were fi ve-for-12 (41.7 percent) from three-point range. The Bears were led by Corin Adams’ 14 points, although her production came on four-of-20 from the fi eld. AU also held a 43-31 rebounding advantage. “I really felt good about the defensive game that we played,” remarked American Univer-sity Head Coach Matt Corkery on his live postgame interview on Eagles Vision TV. “I thought that was the key to our success tonight...we didn’t give up many second chance opportunities. That was one of our goals going into the game.”

Morgan St. (3-6) FG-A FT-A Reb TP A Blk S MinHawkins, Erin 3-7 0-0 1 8 1 0 0 22Diagne, Abby 0-1 0-0 1 0 0 0 0 4Thomas, Mahala 2-6 0-0 4 4 0 0 1 23Mathis, DeKeisha 3-5 0-0 2 6 2 0 0 12Davis, Theresa 1-6 0-0 5 2 1 0 0 25Adams, Corin 4-20 3-4 7 14 2 0 5 36Noel, Brittany 1-2 0-0 0 2 0 0 0 4Dodson, Brittany 3-8 0-0 3 7 0 0 3 24Turner, Tireion 0-3 0-0 1 0 0 0 0 7Reed, Aaires 1-3 0-0 1 2 0 0 1 19Williams, Georgien 0-1 0-0 1 0 2 0 0 10Jones, Phylicis 0-0 0-0 1 0 1 0 0 11Williams, Tevonia 0-0 0-0 0 0 0 0 0 3 Team 4Totals 18-62 3-4 31 45 9 0 10 200

American (5-4) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 3-7 1-2 9 7 0 1 0 16Kirk, Michelle 8-13 2-2 3 20 1 0 2 33Edwards, Ebony 2-7 2-2 6 7 2 0 3 30Leer, Liz 4-9 0-0 7 10 1 2 1 36Harris, Raven 3-5 2-3 3 8 6 0 2 34Yencho, Ashley 0-0 2-2 0 2 1 0 2 6Strack, Lisa 2-8 0-0 8 4 2 0 0 30McDonald, Janelle 0-0 0-0 0 0 0 0 0 1Anya, Stephanie 0-1 1-4 3 1 0 1 0 14Team 4Totals 22-50 10-15 43 59 13 4 10 200

Halftime: American 30, Morgan State 17. 3-Point Goals: Morgan State 6-25 (Hawkins 2-4, Thomas 0-1, Mathis 0-2, Davis 0-1, Adams 3-11, Dodson 1-5, Turner 0-1), American 5-12 (Kirk 2-4, Edwards 1-2, Leer 2-2, Harris 0-1, Strack 0-3). Turnovers: American 21, Morgan State 18.

Page 16: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1616

Game 10 - Dec. 20, 2009 Maryland 75, American 64Bender Arena • Washington, D.C.

Junior Michelle Kirk scored a team-high 18 points on seven-of-14 shooting to lead three Eagles in double-digits, but it was not enough as the wom-en’s basketball team fell to Maryland, 75-64, at Bender Arena on Sunday afternoon. Sophomore Lisa Strack netted 14 points and added three steals while Liz Leer notched 11 points. Mary-land (9-2) jumped out to a quick 7-0 start in the game’s fi rst two minutes before American (5-5) got on the board on a Leer three-pointer, her fi rst of a career-high three made trifectas. The Ter-rapins played from ahead for the entire fi rst half, although AU continued to play tough and hang around. The Eagles’ defi cit remained constant between three and seven points for the fi nal 15 minutes of the opening stanza before Maryland took a 37-31 advantage into intermission. AU came out of halftime fi ring on all cylinders in the fi rst minute of the second half, scoring the fi rst fi ve points on a three-pointer by Kirk and a Raven Harris bucket to cut the Maryland lead to one, 37-36. But that’s as close as the Eagles would get in the game, as the Terps scored the next nine points to open up a 45-36 advantage at the 16:27 mark. The Eagles made one fi nal run mid-way through the second half, as they trimmed the Maryland advantage to three, 51-48. But Maryland responded to score the next 10 points and regain a 13-point margin, 63-50, with 7:26 to play. The Terps’ lead would remain relatively constant for the last few minutes of the ballgame, coming away with a hard-fought 75-64 road vic-tory. The Eagles took care of the basketball, only committing 11 turnovers compared to 19 for the Terps, but that was not enough to overcome Maryland’s dominace on the glass and its high shooting percentage. Maryland outrebounded AU, 46-21, and shot 51.9 percent from the fl oor compared to 40.3 for AU. For the ninth time in 10 games this season, Kirk led the Eagles in scor-ing with 18 points in 39 minutes. She was three-of-six from three-point range. Strack scored a career-high 14 points off the bench for AU on six-of-11 from the fl oor, while Leer chipped in 11. Maryland was led by 21 points from Lynetta Kizer on seven-of-nine shooting, along with 13 rebounds. Tianna Hawkins scored 20 points on eight-of-10 from the fl oor, and she also recorded 12 rebounds. Diandra Tchatchouang and Kim Rodgers chipped in 12 and 10 points, respec-tively, for the Terps. Dara Taylor dished out 11 assists for Maryland as well.

Maryland (9-2) FG-A FT-A Reb TP A Blk S MinTaylor, Dara 1-5 2-3 6 4 11 0 1 38Kizer, Lynetta 7-9 7-9 13 21 0 1 1 37Rodgers, Kim 3-8 2-2 2 10 1 0 0 28Tchatchouang, Diandra 6-13 0-0 5 12 4 1 1 31Bjork, Lori 2-7 0-0 2 5 0 0 0 19Nared, Jackie 1-2 0-0 1 3 1 0 0 8Barrett, Anjale 0-0 0-0 2 0 2 0 0 10Hawkins, Tianna 8-10 4-8 12 20 0 0 0 30Team 3Totals 28-54 15-22 46 75 19 2 3 201

American (5-5) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 1-2 2-2 3 4 1 0 0 21Kirk, Michelle 7-14 1-2 3 18 1 0 2 39Edwards, Ebony 1-4 0-0 1 3 0 0 1 19Leer, Liz 4-14 0-0 5 11 1 1 3 35Harris, Raven 3-9 1-1 4 7 5 0 3 34Yencho, Ashley 2-5 0-0 1 5 3 0 1 11Strack, Lisa 6-11 2-4 1 14 2 0 3 28Anya, Stephanie 1-3 0-0 1 2 0 0 0 14Team 2Totals 25-62 6-9 21 64 13 1 13 201

Halftime: Maryland 37, American 31. 3-Point Goals: Maryland 4-15 (Taylor 0-1, Rodgers 2-6, Tchatchouang 0-2, Bjork 1-5, Nared 1-1), American 8-26 (Kirk 3-6, Edwards 1-3, Leer 3-7, Harris 0-2, Yencho 1-4, Strack 0-4). Turnovers: Maryland 19, American 11.

Game 11 - Dec. 28, 2009 American 54, Buffalo 43Edmunds Center • DeLand, Fla.On the strength of 25-of-28 from the free throw line and strong defensive play, the American University women’s basketball team earned a 54-43 victory over Buffalo on Monday afternoon in the Hatter Classic in DeLand, Fla. The Eagles will face St. Francis (Pa.) on Tuesday af-ternoon at 1 p.m. in the championship game. American (6-5) got off to a slow start, trailing the entire way in the fi rst half and managing to score only 19 points in the fi rst 20 minutes. Sophomores Raven Harris and Ebony Ed-wards were two early bright spots on the offensive end, scoring six and fi ve points, respectively, on a combined three-of-fi ve shooting from the fl oor. Despite shooting 21.4 percent from the fi eld (6-28), the Eagles’ defensive effort kept them in the game, as they only trailed by four, 23-19, at intermission. The Eagles began to fi nd their rhythm at the start of the second half, scoring the open-ing eight points in fi rst four-plus minutes to take a 27-23 lead. The run began on a pair of Lisa Strack free throws, followed by a runner in the lane by Harris, a Liz Leer free throw and a Michelle Kirk straightaway three-pointer. Af-ter a Buffalo three-point fi eld goal, Kirk knocked down four consecutive free throws to give the Eagles a fi ve-point advantage, 31-26, with 12:45 to play. Buffalo (2-9) responded with back-to-back buckets to trim the Eagles lead to one before an Ashley Yencho three-pointer ex-tended the American advantage back to four, 34-30, at the 10:35 mark. AU and Buffalo traded baskets for the next few minutes until consecutive three-pointers Leer and Kirk gave American an eight-point lead, 44-36, at the under four-minute media timeout. The Bulls fought hard down the stretch to claw their way back into the game, but AU proved to be too much, especially from the free throw line. The Eagles fi nished the game 25-28 (89.3 percent) from the charity stripe, including an impressive 19-22 mark in the second half. Kirk struggled from the fl oor, but still notched a game-high 18 points, all of which came in the second half. She was 12-of-12 from the free throw line, becoming only the ninth Eagle in program history to be perfect from the charity stripe on at least 10 attempts in a single-game. Additionally, the All-Patriot League performer recorded eight rebounds, three assists and three steals. Leer scored 12 points for AU, while Harris chipped in 10, setting a new career-high. The duo fi nished a combined nine-of-12 from the free throw line. Strack put together a solid all-around game for AU with six points, three rebounds, two assists, two blocked shots and two steals. In the game, Ameri-can shot only 28.6 percent from the fl oor, but was fi ve-of-13 (38.5 percent) from three-point range. The Eagles’ defense held Buffalo to 31.4 shooting in the contest and forced 25 turnovers, although AU was outrebounded by a 42-30 margin. “We came out in the second half with a much more aggressive mentality,” remarked American University Head Coach Matt Corkery. “That helped us get to the foul line and that was the difference in the game. We need to be much better on the glass in the future if we want to have success. Buffalo controlled the boards today for sure.”

American (6-5) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 2-14 12-12 8 18 3 0 3 39Leer, Liz 4-9 3-4 2 12 0 0 0 39Nyanin, Ohemaa 0-2 0-0 2 0 1 0 0 11Edwards, Ebony 2-4 0-0 1 5 0 0 1 26Harris, Raven 2-4 6-8 2 10 0 0 4 32Yencho, Ashley 1-3 0-0 0 3 0 0 0 13Strack, Lisa 1-5 4-4 3 6 2 2 2 27McDonald, Janelle 0-1 0-0 1 0 0 0 0 1Anya, Stephanie 0-0 0-0 4 0 0 1 1 12Team 7Totals 12-42 25-28 30 54 6 16 11 200

Buffalo (2-9) FG-A FT-A Reb TP A Blk S MinBrown, Kourtney 4-11 4-5 11 12 0 1 1 38Kendricks, Bridgette 0-2 0-0 6 0 2 0 0 16Fortman, Jessica 3-9 1-4 6 8 2 1 2 36Holmes, Ephesia 1-2 1-1 0 3 1 0 1 15Dowd, Abby 3-10 2-2 5 9 2 0 0 38Zuber, Ashley 2-3 0-0 0 4 1 0 1 7Cooper, Chrissy 0-1 0-0 0 0 0 0 0 5Hopkins, Nicky 1-3 0-0 0 3 0 0 0 10Smith, Dayna 0-4 0-0 0 0 0 0 0 6Longar, Nytor 0-1 0-1 3 0 0 0 0 5Semalulu, Teresa 1-2 0-0 2 2 0 0 1 5Christensen, Beth 1-3 0-0 1 2 1 2 0 19Team 8Totals 16-51 8-13 42 43 9 4 6 200

Halftime: Buffalo 23, American 19. 3-Point Goals: American 5-13 (Kirk 2-7, Leer 1-1, Edwards 1-1, Yencho 1-2, Strack 0-2), Buffalo 3-10 (Fortman 1-2, Dowd 1-4, Hopkins 1-3). Turnovers: Buffalo 25, American 16.

Game 12 - Dec. 29, 2009 St. Francis (Pa.) 60, American 57Edmunds Center • DeLand, Fla.Despite three double-digit scorers, including a ca-reer-high 15 points from junior Ashley Yencho, the American University women’s basketball team fell 60-57 to St. Francis (Pa.) on Tuesday afternoon in the championship game of the Hatter Classic in De-Land, Fla. St. Francis (4-6) jumped quickly out of the gates, taking a 7-1 lead over American (6-6) in the fi rst few minutes. Yencho single-handily responded for the Eagles, scoring eight points in the opening four-plus minutes, including two three-pointers, to keep AU within reach. American took its fi rst lead of the game at the 10:53 mark, 14-11, on a Michelle Kirk trifecta off a Yencho feed. The Red Flash, how-ever, evened the score at 16, and led the remain-der of the fi rst half. Yencho kept the Eagles within striking distance with 13 points on fi ve-of-seven shooting, including three three-point fi eld goals. A bucket at the buzzer gave St. Francis a 33-28 lead at intermission. After a relatively back-and-forth fi rst half, the second 20 minutes turned into a game of runs. Facing an early seven-point defi cit, the Eagles scored nine unanswered points to take a 37-35 lead with 16:40 to play. Liz Leer began the run with a layup, followed by a Kirk three-pointer, a Yencho transition layup and an Ohemaa Nyanin rebound-putback. St. Francis, however, quickly responded with a 12-0 spurt and opened up a 10-point lead, 47-37, with 11:05 remaining. Six straight Kirk points trimmed the Red Flash advantage to four, 47-43, at the 7:26 mark. After the teams traded buckets, a pair of made free throws by Stephanie Anya and Kirk, sandwiched around a rebound and putback layup by Janelle McDonald, sparked a 6-0 AU run and tied the game at 52 with 2:48 remaining. St. Francis’ Quinessa Johnson scored the go-ahead basket with 2:00 left to give the Red Flash a 54-52 advantage, a lead the Red Flash would not relin-quish down the stretch. AU had one fi nal push with an Ebony Edwards three-pointer, which cut the mar-gin to one, 58-57, with 1.9 second remaining. But St. Francis was able to successfully inbounds the ball and knocked down a pair of free throws in the last second to set the fi nal margin at 60-57. For the 11th time in 12 games this season, Kirk led the Ea-gles in scoring with 16 points, and also grabbed six rebounds. Yencho scored a career-best 15 points for AU on six-of-nine shooting from the fl oor in 40 minutes of action. She recorded a new career-high with fi ve assists. Edwards was also in double fi g-ures for AU with a career-best 11 points, including three-of-four from the three-point range, and a ca-reer-high-matching six rebounds. Additionally, Anya led the Eagles on the boards with a team-high sev-en rebounds, which tied a career-best for the fresh-man. St. Francis was paced by Britney Hodges, who scored 15 points and was named tournament most valuable player. AU’s Kirk was recognized to the all-tournament team for averaging 17 points per game in the two Hatter Classic contests. The junior currently leads the Patriot League at 19.6 ppg.

St. Francis (4-6) FG-A FT-A Reb TP A Blk S MinKillian, Janie 3-4 0-0 1 6 0 0 0 14Leach, Stephanie 5-10 0-0 2 11 3 0 1 29Hodges, Britney 3-14 7-8 1 15 3 0 4 37Daly, Allison 1-6 1-2 4 4 1 0 0 20Johnson, Quinessa 3-10 2-3 9 8 5 0 1 36Gibbs, Nickia 2-6 0-0 1 4 2 0 1 15Smith, Allison 0-1 0-0 0 0 0 0 0 4Lilley, Brittany 1-5 0-0 1 2 0 0 0 19Fleming, Shene 4-9 2-3 8 10 1 0 0 26Team 5Totals 22-65 12-16 32 60 15 0 7 200

American (6-6) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 5-18 4-4 6 16 2 1 1 38Leer, Liz 4-7 0-0 3 8 0 3 1 38Nyanin, Ohemaa 1-3 1-2 6 3 3 0 0 21Edwards, Ebony 3-5 2-2 6 11 2 0 1 33Yencho, Ashley 6-9 0-0 1 15 5 0 2 40McDonald, Janelle 1-2 0-0 2 2 0 0 0 11Anya, Stephanie 0-1 2-2 7 2 1 0 2 19Team 5Totals 20-45 9-10 36 57 13 4 7 200

Halftime: St. Francis 33, American 28. 3-Point Goals: St. Francis 4-16 (Leach 1-2, Hodges, 2-8, Daly 1-4, Johnson 0-1, Lilley 0-1), American 8-17 (Kirk 2-7, Edwards 3-4, Yencho 3-6). Turnovers: American 25, St. Francis 11.

Page 17: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1717

Game 13 - Jan. 2, 2010 Columbia 66, American 56Levien Gymnasium • New York, N.Y.

The American University women’s basketball team began the 2010 portion of its schedule at Columbia on Saturday afternoon, and fell by a fi nal score of 66-56. The Eagles held a four-point advantage midway through the second half, but Columbia proved to be too much down the stretch, coming away with the 10-point victory at Levien Gymnasium in New York, N.Y. American (6-7) got on the scoreboard fi rst with a Liz Leer jumper, but Columbia (8-4) responded with sev-en straight points to take a 7-2 advantage early in the opening half. Columbia continued to con-trol play over the next several minutes and would never trail in the fi rst half, opening up a 21-9 lead at the 9:17 mark. The Eagles, however, scored the next seven points, including fi ve from Mi-chelle Kirk, to cut the defi cit to fi ve, 21-16, with 6:52 to play. The two squads would play even over the fi nal few minutes of the fi rst half, as Co-lumbia took a 28-24 advantage into intermission. In the second half, Leer provided an offensive spark for the Eagles, scoring the team’s fi rst eight points to trim the Columbia lead to two, 34-32, with 16:29 to play. The two teams would trade buckets before an Ohemaa Nyanin layup gave American a 38-37 advantage, its fi rst lead since 2-0. The Eagles would open up a four-point ad-vantage, 46-42, midway through the second half on back-to-back Ashley Yencho three-pointers. But the Lions took over down the stretch, going on a 19-3 run over the next nine minutes to take a 62-49 lead with 1:05 remaining. Judie Lomax proved to be too much inside for the Eagles, scoring nine points during Columbia’s run. An Ebony Edwards three-pointer with 52 seconds remaining cut the defi cit back to single digits, but Columbia held tough and came away with a 66-56 home victory. Columbia’s Lomax recorded game-highs with 24 points, 15 rebounds and six steals, while Kathleen Barry and Lauren Dwyer chipped in 17 and 15 points, respectively, for the Lions. American was led by Leer’s 17 points on eight-of-16 shooting from the fl oor. She also re-corded team-highs with fi ve rebounds, a career-high fi ve assists and three blocked shots in 40 minutes of action. Kirk registered double fi gures for the Eagles with 12 points, while notching a career-best four steals. Raven Harris also re-corded a career-high with four steals. Columbia outshot the Eagles by a slim 47.9 percent to 44.2 percent margin. The Lions were an effi cient 6-11 from three-point range, while American was 4-12 from long range. Columbia outrebounded AU, 35-23, although American forced 23 Columbia turnovers. American (6-7) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 4-11 4-5 1 12 2 1 4 37Leer, Liz 8-16 1-2 5 17 5 3 3 40Nyanin, Ohemaa 2-6 1-3 5 5 0 1 0 15Edwards, Ebony 3-8 0-0 3 8 1 0 2 35Yencho, Ashley 2-3 0-0 1 6 1 0 1 28Harris, Raven 2-5 0-0 2 4 3 0 5 29McDonald, Janelle 0-0 0-0 1 0 0 0 0 3Anya, Stephanie 2-3 0-0 1 4 0 0 0 13Team 4Totals 23-52 6-10 23 56 12 5 15 200

Columbia (8-4) FG-A FT-A Reb TP A Blk S MinLomax, Judie 8-15 8-9 15 24 2 0 6 40Dwyer, Lauren 6-12 2-2 9 15 1 1 0 35Browne, Danielle 2-4 0-0 1 4 4 1 1 31Barry, Kathleen 5-9 4-7 2 17 1 0 1 31Yee, Sara 1-5 0-0 1 3 4 0 0 36Fuller, Jazmin 1-1 0-0 2 3 0 0 0 3Stachon, Caitlin 0-0 0-0 1 0 1 0 1 5Shafer, Melissa 0-1 0-0 0 0 3 0 0 11Beato, Mary 0-1 0-0 0 0 2 0 0 8Team 2Totals 23-48 14-18 35 66 18 2 9 200

Halftime: Columbia 28, American 24. 3-Point Goals: American 4-12 (Kirk 0-2, Leer 0-1, Edwards 2-5, Yencho 2-3, Harris 0-1), Columbia 6-11 (Dwyer 1-1, Barry 3-5, Yee 1-2, Fuller 1-1, Shafer 0-1, Beato 0-1). Turnovers: Columbia 23, American 20.

Game 14 - Jan. 4, 2010 American 57, Maryland-Eastern Shore 46Bender Arena • Washington, D.C.

Three Eagles scored in double fi gures, includ-ing a game-high 19 points from Michelle Kirk, to push the American University women’s basket-ball team to a 57-46 victory over Maryland-East-ern Shore on Monday night at Bender Arena. American (7-7), which was competing in its fi nal non-conference game of the 2009-10 season, got off to a fast start in the opening three-plus minutes, jumping out to an early 7-0 lead. Buck-ets by Ebony Edwards, Liz Leer and Ashley Yen-cho provided the Eagles that early cushion. AU would open up an 11-point advantage, 21-10, with 6:39 to play in the opening half on a layup by Kirk. UMES (2-6), however, went on a 6-0 run late in the fi rst half to trim the Eagles’ lead to fi ve before a Kirk bucket in the fi nal minute set the halftime margin at seven, 25-18. The two squads played even basketball for the fi rst seven minutes of the second half before an Edwards three-point basket gave American a 10-point lead, 41-31. But the Lady Hawks responded with the next nine points over a seven-minute span to trim AU’s lead to one, 41-40, with 6:16 remaining in the game. Facing a critical posses-sion, the Eagles worked their offense to give Yencho a wide-open three-pointer from straight away, which extended the AU advantage to four. American would add the eight more unanswered points, capping a 10-0 run and giving the Eagles a 51-40 lead with 1:56 to play. AU held its ad-vantage down the stretch and fi nished with a 57-46 home victory. For the 12th time in 14 games this season, Kirk led the Eagles’ scoring attack with 19 points, including eight-of-11 from the free throw line. She also grabbed a game-high eight rebounds and recorded three assists. Leer and Yencho were also in double fi gures for AU with 12 and 11 points, respectively. Leer added seven rebounds, three blocks and three steals for the Eagles. UMES was paced by April McBride’s 14 points, while Casey Morton and Chelsea Sand-ers each contributed nine points. “I thought we kind of set the tone defensively from the begin-ning of the game and kept them [UMES] from getting easy shots,” American University Head Coach Matt Corkery commented on his live post-game interview on Eagles Vision TV. “That con-tinued pretty much through the fi rst half. In the second half, we didn’t make a lot of adjustments; we just stayed with our man-to-man, and they made a little bit of a run ... but we settled down and when we needed to, we got stops and made some plays in the last four minutes.” UMES (2-6) FG-A FT-A Reb TP A Blk S MinCook, Amber 1-2 1-2 1 3 0 0 0 32Sanders, Chelsea 4-14 1-4 6 9 1 0 2 36Morton, Casey 4-11 1-1 8 9 5 0 0 28McBride, April 4-11 3-4 7 14 2 2 4 32Green, Alicia 2-3 0-0 0 4 0 1 0 16Agbasi, Adobi 0-0 0-0 0 0 0 0 0 4Buckner, Latoya 0-0 1-2 1 1 0 0 0 7Jackson, Bria 1-7 0-0 4 2 1 0 0 20Parker, Chena 2-5 0-0 4 4 1 0 0 20Roach, Karona 0-1 0-0 1 0 0 0 0 5Team 3Totals 18-54 7-13 35 46 10 3 6 200

American (7-7) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 1-3 0-0 7 2 1 1 1 23Kirk, Michelle 5-12 8-11 8 19 3 0 0 38Edwards, Ebony 3-7 0-0 6 9 1 0 2 36Yencho, Ashley 4-9 1-1 3 11 1 0 1 34Leer, Liz 5-13 2-2 7 12 1 3 3 40Harris, Raven 1-3 2-2 0 4 3 0 0 19Anya, Stephanie 0-1 0-0 2 0 0 0 0 10Team 1Totals 19-48 13-16 34 57 10 4 7 200

Halftime: American 25, UMES 18. 3-Point Goals: UMES 3-10 (Cook 0-1, Sand-ers 0-2, McBride 3-4, Jackson 0-3), American 6-17 (Kirk 1-3, Edwards 3-7, Yen-cho 2-6, Harris 0-1). Turnovers: UMES 16, American 14.

Game 15 - Jan. 9, 2010 American 69, Lehigh 65 (OT)Bender Arena • Washington, D.C.The American University women’s basketball team took Lehigh’s best shot down the stretch, but AU was able to fi ght off the defending Patriot League champions, 69-65, in overtime on Saturday afternoon at Bender Arena. Junior Michelle Kirk led the Eagles with a career-high 32 points in the victory. After leading by fi ve, 35-30, at half-time, American (8-7, 1-0) scored the fi rst seven points of the second half to take a 12-point advantage with 16:34 to play. Raven Harris began the scoring for the Eagles during the spurt with a three-pointer, and then Kirk knocked down back-to-back buckets, which provided AU its largest lead of the game. But Lehigh (13-3, 0-1) would not go down easily. The Mountain Hawks pro-ceeded to run off nine-unanswered points over the next six minutes to cut the AU lead to 42-41. Lehigh would eventually take a 51-50 advantage with 5:06 to play on an Emily Gratch bucket. The lead changed hands three times over the next three-plus minutes, capped by an Ebony Edwards steal and coast-to-coast layup to give AU a 54-53 advantage with 1:42 to play. Moments later, Harris stole the ball and beat the Lehigh defense down the fl oor for the layup, as AU took a 56-53 lead. Facing a three-point defi cit in the fi nal minute, Lehigh commit-ted its seventh team foul of the half, sending Harris to the line for a one-and-one with eight seconds remain-ing. She missed, and after a timeout and an AU foul on the fl oor, Lehigh’s Alex Ross knocked down a contested 25-footer with 0.2 seconds remaining to knot the score at 56 and send the game to overtime. Lehigh seemed to have all the momentum heading to the extra period, but the Eagles proved to be resilient. AU’s fi rst fi eld goal of the overtime session occurred on a beautiful, step-back three-pointer by Kirk, but Lehigh tied the score, 61-61 on an Alex Ross basket with 2:15 to go. Liz Leer then got in the scoring act, hitting a key baseline jumper from 17 feet, providing the Eagles a 63-61 advantage. Following a missed Lehigh jumper, Ohemaa Nyanin grabbed an offensive rebound off a Leer miss and put in the put-back layup, opening up a 65-61 American lead with only 36 seconds to play. Prosser trimmed the AU lead to two, 65-63, but Kirk knocked down all four of her free throw attempts in the fi nal few seconds to set the fi nal margin at 69-65. Kirk scored her career-best 32 points on 10-of-21 shooting from the fl oor, including 5-9 from three-point range and 7-7 from the charity stripe. She played all 45 minutes, which also set a career-high. The 2009-10 Preseason All-Patriot League selection is now averaging a Patriot League-leading 19.9 points per game this season, and has led the Eagles in scoring in 13 of 15 contests this season. The trio of Edwards, Har-ris and Nyanin each added nine points for AU. Nyanin’s nine points are a career-best, and she also grabbed a career-high 13 rebounds. Edwards fi lled out her stat line with seven rebounds and six assists, both of which are career-bests. The entire starting fi ve for the Eagles recorded career-highs in minutes played, including four players with over 40 minutes of action apiece. “I’m very proud of our team’s effort today,” commented American University Head Coach Matt Corkery. “It was defi nitely a team victory with everybody who saw the court contrib-uting. I was really pleased with how we bounced back in overtime and with the way we played down the stretch.”

Lehigh (13-3, 0-1) FG-A FT-A Reb TP A Blk S MinGratch, Emily 5-9 3-4 12 13 1 1 0 41Dentler, Courtney 5-9 1-2 5 11 0 0 0 32Prosser, Erica 4-13 4-5 2 13 10 0 2 44Smith, Tricia 3-5 0-0 11 7 2 0 2 41Ross, Alex 4-21 0-0 1 10 2 0 0 27Ingalls, Ryan 1-2 0-0 4 2 1 1 0 18Dalton, Kristen 2-6 2-2 3 7 0 0 0 12Williams, Alexa 1-3 0-0 0 2 0 0 0 10Team 2Totals 25-68 10-13 40 65 16 2 4 225

American (8-7, 1-0) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 10-21 7-7 4 32 0 0 0 45Leer, Liz 3-9 0-0 5 6 3 1 1 43Nyanin, Ohemaa 3-4 3-4 13 9 0 0 0 33Edwards, Ebony 2-10 4-5 7 9 6 0 1 43Harris, Raven 4-10 0-1 4 9 4 0 4 42McDonald, Janelle 1-3 0-0 1 2 1 0 0 6Anya, Stephanie 1-5 0-0 6 2 0 0 0 13Team 2Totals 24-62 14-17 42 69 14 1 6 225

Halftime: American 35, Lehigh 30. 3-Point Goals: Lehigh 5-22 (Dentler 0-1, Prosser 1-3, Smith 1-3, Ross 2-13, Dalton 1-2), American 7-21 (Kirk 5-9, Leer 0-3, Edwards 1-5, Harris 1-4). Turnovers: American 13, Lehigh 11.

Page 18: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1818

Game 16 - Jan. 13, 2010 American 63, Bucknell 51Bender Arena • Washington, D.C.The American University women’s basketball team began strong en route to a 63-51 victory over Bucknell on Wednesday night at Bender Arena. Three Eagles scored in double fi gures, including a game-high 20 points by junior Mi-chelle Kirk, as American won its third straight game. Kirk came out of the gates sizzling, pick-ing up right where she left off in her career-high 32-point performance on Saturday against Lehigh. She knocked down three consecutive three-pointers in the fi rst 2:52, giving American (9-7, 2-0 Patriot League) an 11-4 advantage. Kirk’s fourth trifecta with 13:48 to play in the fi rst half gave the Eagles a 16-8 lead. Raven Harris followed up with another three-pointer minutes later, extending the AU advantage to 19-8 less than nine minutes into the contest. Bucknell (4-11, 0-2 PL) would never get back within single digits in the rest of the game. Buckets by Stephanie Anya and Liz Leer ex-tended the Eagles’ advantage to 23-8 midway through the fi rst half, and a layup by Ashley Yencho minutes later gave AU a 20-point lead, 38-18, with 1:26 to go in the opening half. The Eagles took a 40-21 lead into halftime after shooting a red-hot six-of-nine from three-point range in the fi rst 20 minutes. Bucknell picked up its play in the second half, creeping closer to the Eagles throughout the fi rst 10 minutes of the second half. The Bison eventually got within 12, 49-37, with 9:32 remaining in the contest, but a free throw and three-point bas-ket by Kirk extended the AU advantage back to 16, 53-37. Minutes later, Bucknell made one fi nal push, as it trimmed the defi cit to 12 with 5:25 to go, but a fi nal Kirk trifecta dashed the Bison’s hopes. Bucknell continued to fi ght hard to the end cutting the fi nal margin to 12, 63-51. For the 14th time in 16 games this season, Kirk led the Eagles in scoring with 20 points on seven-of-16 shooting from the fl oor. She was an effi cient fi ve-of-eight from three-point range, matching her career-high for most three-pointers in a single-game. She also grabbed fi ve rebounds. Leer and Harris scored 12 and 10 points, respectively, for AU. Leer recorded four blocked shots, while Har-ris had fi ve assists and four steals. Bucknell’s scoring was relatively evenly-distributed, as Joyce Novacek led the Bison with 14 points. Trisha Krewson and Rachel Voss chipped in 13 points each. The difference in the game proved to be the turnover battle as AU held a plus-17 margin. Bucknell committed 28 give-aways, while AU only turned the ball over 11 times. Additionally, the Bison shot 50 percent from the fl oor (21-42) compared to only 35.5 percent (22-62) for AU. Despite the percent-age differential, the Eagles actually made one more fi eld goal in the game due to 20 more attempts from the fi eld. Bucknell (4-11, 0-2) FG-A FT-A Reb TP A Blk S MinMgbada, Felicia 1-5 1-2 6 3 0 1 1 18 Voss, Rachel 4-7 2-2 3 13 1 1 1 36Krewson, Trisha 5-8 1-2 3 13 1 0 0 32Novacek, Joyce 7-8 0-0 8 14 2 2 0 28Higham, Cosima 3-8 0-0 4 6 5 0 0 40Dunn, Alyssa 0-2 0-0 2 0 1 0 0 7Wrightson, Morgan 0-2 0-0 0 0 2 0 0 11Chukwuedo, Christina 1-2 0-0 0 2 1 0 0 23Horbatuck, Lindsay 0-0 0-0 1 0 1 0 0 5Team 7Totals 21-42 4-6 34 51 14 4 2 200

American (9-7, 2-0) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 1-7 1-3 7 3 1 0 0 20Kirk, Michelle 7-16 1-2 5 20 2 0 1 34Edwards, Ebony 2-4 0-0 1 6 3 0 2 28Leer, Liz 5-14 2-2 3 12 0 4 2 38 Harris, Raven 3-8 3-3 2 10 5 0 4 35Yencho, Ashley 1-1 0-0 1 2 1 0 0 8Strack, Lisa 1-4 4-5 2 6 2 0 1 20Anya, Stephanie 2-5 0-0 2 4 0 0 0 17Team 6Totals 22-62 11-15 29 63 14 4 10 200

Halftime: American 40, Bucknell 21. 3-Point Goals: Bucknell 5-11 (Voss 3-4, Krewson 2-4, Dunn 0-1, Wrightson 0-1, Chukwuedo 0-1), American 8-16 (Kirk 5-8, Edwards 2-3, Leer 0-1, Harris 1-2, Strack 0-2). Turnovers: Bucknell 28, American 11.

Game 17 - Jan. 16, 2010 American 80, Colgate 58Cotterell Court • Hamilton, N.Y.The American University women’s basketball team got off to a quick start and never looked back against Colgate on Saturday afternoon, rolling to an 80-58 victory in Hamilton, N.Y. Five Eagles re-corded at least nine points in the win, including a game-high 26 points from Michelle Kirk. American (10-7, 3-0 Patriot League) came out fi ring on all cylinders, jumping out to a 10-0 lead in the fi rst six-plus minutes of action. AU’s scoring began on a steal and layup by Kirk, which was followed by back-to-back jumpers by Liz Leer and Kirk. Raven Harris continued the run with a driving layup and Lisa Strack concluded the streak with a bucket in transition, forcing Colgate (6-11, 1-2 PL) into burning an early timeout. The Raiders quickly got back into the game, cutting the defi cit to one, 16-15, before the Eagles went on another 10-0 surge to take a 26-15 advantage with 6:34 remaining in the fi rst half. Leer hit three consecutive jumpers during the stretch to provide the offensive spark for American. A Kirk three-pointer extended the AU advantage to 12, 29-17, although Colgate re-sponded with a 9-0 run to cut the Eagles’ lead to 33-30 with 1:21 left in the fi rst half. The Eagles took a 37-32 lead into halftime on the strength of 13 points from Kirk in the opening 20 minutes. Colgate opened the second half with a quick three-pointer to trim the AU lead to two, although the Eagles responded with their third 10-0 spurt of the game to take a 47-35 lead with 16:44 to play. American continued to control the action over the next several minutes, opening up an 18-point ad-vantage, 58-40, on a beautiful three-point play by Kirk with 13:44 to go. The Eagles extended their advantage to 20, 71-51, on a Kirk trifecta with 6:30 remaining, and AU cruised to the 80-58 road victory. The Eagles’ 80 points scored set a new season-high, which came on 50 percent shoot-ing from the fi eld (31-62) and 47.1 percent from three-point range (8-17). Colgate shot a respect-able 44.7 percent from the fl oor (21-47), but it was not enough to keep pace with AU. Additionally, American committed a season-low nine turnovers while forcing 18 from Colgate. For the 15th time in 17 games, Kirk led AU in scoring, recording a game-high 26 points on eight-of-15 shooting from the fl oor. She also matched a career-best with four steals and was a perfect seven-of-seven from the free throw line. Leer was productive for the Eagles with 13 points, seven rebounds, three assists and three blocks, while Edwards recorded 10 points, a career-best eight rebounds, fi ve as-sists and four steals. Ohemaa Nyanin and Strack each chipped in nine points.

American (10-7, 3-0) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 8-15 7-7 6 26 4 1 4 38Leer, Liz 6-10 0-0 7 13 3 3 0 25Nyanin, Ohemaa 4-7 1-2 5 9 0 0 0 22Edwards, Ebony 3-6 2-2 8 10 5 0 4 27Harris, Raven 3-6 0-0 1 6 6 0 4 31Yencho, Ashley 1-4 0-0 1 3 1 0 0 14Strack, Lisa 4-8 0-0 3 9 0 0 1 22McDonald, Janelle 1-1 0-0 1 2 0 0 0 3Anya, Stephanie 1-5 0-2 4 2 0 0 0 18Team 0Totals 31-62 10-13 36 80 19 4 13 200

Colgate (6-11, 1-2) FG-A FT-A Reb TP A Blk S MinHavenstein, Holly 1-2 0-2 3 2 1 0 0 16Oakes, Tricia 2-4 2-4 4 6 1 1 0 22Green, Candice 3-4 1-2 0 9 2 0 1 27Kozlowski, Sami 4-9 1-2 2 9 1 0 2 32Garman, Katie 4-10 0-0 4 11 2 0 0 22Lynch, Jhazmine 2-3 6-9 3 10 1 1 1 19Wejnert, Tayler 2-5 0-0 1 5 4 0 0 14Brase, Lulu 0-1 0-1 2 0 0 0 0 8Korkowski, Kelly 1-3 0-0 4 2 1 3 1 19Ward, Rebekah 0-0 0-0 1 0 1 0 0 2Brim, Kendra 2-4 0-0 1 4 0 0 1 12Librizzi, Evan 0-0 0-0 0 0 0 0 0 3Moser, Krista 0-2 0-0 2 0 0 0 0 4Team 2Totals 21-47 10-20 29 58 14 5 6 200

Halftime: American 37, Colgate 32. 3-Point Goals: American 8-17 (Kirk 3-5, Leer 1-2, Edwards 2-3, Harris 0-1, Yencho 1-4, Strack 1-2), Colgate 6-13 (Green 2-3, Kozlowski 0-1, Garman 3-5, Wejnert 1-3, Brim 0-1). Turnovers: Colgate 18, American 9.

Game 18 - Jan. 20, 2010 American 64, Army 49Bender Arena • Washington, D.C.

Junior Liz Leer recorded her fi rst double-double of the season and sophomore Ebony Edwards chipped in a career-high 14 points to push the American University women’s basketball team to a 64-49 victory over Army on Wednesday evening in Bender Arena. The win marks the Eagles’ fi fth straight, as they move to 4-0 in the Patriot League. Af-ter an initial basket by Army (8-10, 2-2 Patriot League), American (11-7, 4-0 PL) quickly got going on the offensive end, sparked by a pair of Edwards three-pointers in the fi rst 2:36. Leer followed it up with another trifecta, cap-ping an 11-0 AU run, and forcing the Black Knights to burn an early timeout. Army tied the score at 13, but the Eagles responded with an 8-0 spurt, which included long-range conversions from Leer and Ashley Yencho. A Michelle Kirk three extended American’s lead to 26-15 midway through the fi rst half, and Yencho knocked down another trifecta to give AU a 31-15 advantage with 8:49 to play in the fi rst half. American gained a 20-point lead, 41-21, on Raven Harris’ second three of the half. AU took a 43-24 advantage into halftime on a remarkable nine-of-12 from three-point range in the opening 20 minutes. The Black Knights came out of intermission strong, cutting the AU lead to 14 before a Harris steal and layup extended the Eagles’ advantage to 16, 47-31, with 14:58 to play. Army would try to make a late run, eventually cutting the defi cit to 57-47 with 4:19 remain-ing, but an Edwards driving layup pushed the AU lead back to 12 and virtually iced the contest. The Eagles would extend their fi nal margin of victory to 64-49. Edwards, Kirk and Leer each recorded a game-high 14 points to pace AU. Leer grabbed 13 rebounds, earn-ing her third career double-double, and also chipped in three assists and three blocked shots. Edwards’s 14 points marked a new career-best. Ohemaa Nyanin also recorded nine rebounds for the Eagles, while Harris led AU with fi ve assists. Nalini Hawkins led Army with 14 points, while Jessie Coiffard and Erin Anthony each had 10 for the Black Knights. AU held Army to 29.8 percent from the fi eld (17-57) and outrebounded the Black Knights by a 45-30 margin. AU shot 41.8 percent in the game (23-55), including 52.9 percent (nine-of-15) from behind-the-arc.

Army (8-9, 2-2) FG-A FT-A Reb TP A Blk S MinHawkins, Nalini 6-15 0-0 2 14 0 0 0 32 Coiffard, Jessie 2-8 0-0 1 6 2 0 1 34 Anthony, Erin 5-13 0-0 10 10 1 2 2 40 Baranek, Laura 3-8 2-4 2 10 2 0 0 35 Burdick, Laura 1-5 6-8 5 8 2 1 1 29 Douchette, Megan 0-0 0-0 0 0 0 0 0 0+ Benedict, Liz 0-1 0-0 0 0 0 0 0 2 Goodall, Kait 0-1 0-0 1 0 0 0 0 6 Yardley, Molly 0-4 1-2 1 1 1 0 2 13 Jankowksi, Erin 0-2 0-0 1 0 0 0 1 6 Grapeville, Alison 0-0 0-0 0 0 0 0 0 3Team 7Totals 17-57 9-14 30 49 8 3 7 200

American (11-7, 4-0) FG-A FT-A Reb TP A Blk S MinNyanin, Ohemaa 2-6 0-0 9 4 1 0 0 22Kirk, Michelle 4-10 5-6 2 14 2 1 2 36Edwards, Ebony 5-11 2-2 1 14 1 0 1 32Leer, Liz 5-9 2-2 13 14 3 3 0 31Harris, Raven 3-7 0-2 3 8 5 0 2 33Yencho, Ashley 2-2 0-0 2 6 0 0 0 7Strack, Lisa 1-5 0-0 5 2 1 0 0 17McDonald, Janelle 0-0 0-0 1 0 0 0 0 5Anya, Stephanie 1-5 0-0 5 2 0 0 1 17Team 4Totals 23-55 9-12 45 64 13 4 6 200

Halftime: American 43, Army 24. 3-Point Goals: Army 6-19 (Hawkins 2-5, Coif-fard 2-6, Baranek 2-5, Yardley 0-2, Jankowski 0-1), American 9-17 (Kirk 1-4, Edwards 2-6, Leer 2-3, Harris 2-2, Yencho 2-2). Turnovers: American 19, Army 13.

Page 19: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances1919

Game 19 - Jan. 24, 2010 American 64, Holy Cross 51Hart Center • Worcester, Mass.Three double-digit scorers, including a game-high 21 points from junior Michelle Kirk, propelled the American University women’s basketball team to a hard-fought 64-51 victory at Holy Cross on Sunday afternoon. Junior Liz Leer and sophomore Raven Harris each added 15 points for the Eagles in the win. The fi rst few minutes of action saw back-and-forth action before Leer’s third bucket of the game gave American (12-7, 5-0 Patriot League) a 16-11 advantage with 12:36 remaining in the opening half. An Ashley Yencho three-pointer from straight-away pushed the Eagles lead to seven, 20-13, midway through the fi rst 20 minutes. American extended its lead to nine on a pair of Kirk free throws and even-tually took an 11-point advantage, 33-22, on a re-bound, putback by Ebony Edwards with 53 seconds to go in the fi rst half. The Eagles took a 35-26 ad-vantage into intermission on the strength of 11 Kirk fi rst-half points. Holy Cross (5-15, 1-4 PL) came out strong in the second half, rallying to knot the score at 40 with 11:07 to play on a Meredith Ward three-pointer. The teams would trade buckets, eventually tying the score, 46-46, before the Eagles ran off eight-unanswered points to take a 54-46 lead with 6:35 to play. The run was sparked by a Leer bucket with the shot clock winding down. It was followed by a Kirk three and capped by a beautiful three-point play by Harris, knocking down a high-arcing runner in the lane as she drew contact. In what looked like would end up being a tight game coming down the stretch, the Eagles found their rhythm from deep to take control. First, Kirk knocked down a long-range jumper to extend AU’s lead to 57-48. Harris followed with the dagger, a three from the right wing to give American a 10-point lead, 60-50, with 3:04 to go. The Eagles would convert their free throws in the fi -nal few minutes and come away with the 64-51 road victory, only the second ever victory for AU at Holy Cross. The Eagles held Holy Cross to only two fi eld goals over the fi nal 8:42 of the game, outscoring the Crusaders by an 18-5 margin. Kirk’s 21 points came on an effi cient fi ve-of-10 from the fi eld. She added a game-high eight rebounds in 40 minutes of action. The 15 points for Harris sets a new career-high, which included a career-best-matching two three-pointers. She also recorded three assists and three steals. Additionally, Ohemaa Nyanin and Edwards added seven rebounds apiece for the Eagles. Holy Cross was paced by Briana McFadden’s 16 points. Ward was also in double-fi gures for the Crusaders with 11 points. The Eagles held Holy Cross to 32.8 percent shooting from the fl oor, including only 27.3 percent (6-22) from three-point range. AU com-mitted a season-low seven turnovers and was 15-of-19 (78.9 percent) from the free throw line. “We are proud of our defensive effort today,” remarked American Head Coach Matt Corkery. “I thought we defended consistently throughout the game and in the second half, when we needed to step up and make plays, we did that. A big key was taking care of the ball against Holy Cross’ pressure and keep-ing our turnovers down. Anytime you can go on the road and win, especially against a quality op-ponent like Holy Cross, it’s a good thing.” With the win, American moves to 5-0 in the Patriot League, the best start in program history. AU has won six consecutive games by an average margin of 12.8 points per game.American (12-7, 5-0) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 5-10 8-10 8 21 0 1 1 40Leer, Liz 6-15 3-4 4 15 2 2 0 29Nyanin, Ohemaa 1-6 0-0 7 2 2 0 0 18Edwards, Ebony 1-5 1-2 7 3 3 0 0 34Harris, Raven 5-8 3-3 3 15 3 1 3 38Yencho, Ashley 1-5 0-0 0 3 1 0 1 17Strack, Lisa 2-6 0-0 4 5 2 0 0 21McDonald, Janelle 0-0 0-0 0 0 0 0 0 0+Anya, Stephanie 0-1 0-0 0 0 0 0 1 3Team 3Totals 21-56 15-19 36 64 13 4 6 200

Holy Cross (5-15, 1-4) FG-A FT-A Reb TP A Blk S MinLepley, Amy 1-4 0-0 3 2 1 0 0 12Fremeau, Whitney 3-10 0-0 6 6 0 0 2 33May, Alyssa 0-2 2-2 5 2 3 0 0 26McFadden, Briana 6-10 3-3 3 16 5 0 2 39Ward, Meredith 3-11 3-4 7 11 2 0 0 36Cushnie, Christy 1-3 0-0 1 3 1 1 1 9Carper, Tayana 4-13 0-0 4 9 0 0 0 26Pearson, Jessica 0-0 0-0 0 0 0 0 0 2Cole, Kaitlin 0-0 0-0 0 0 0 0 0 2O’Dell, Bethany 1-5 0-0 0 2 3 0 0 15Team 9Totals 19-58 7-9 38 51 15 1 5 200

Halftime: American 35, Holy Cross 26. 3-Point Goals: American 7-24 (Kirk 3-7, Leer 0-2, Edwards 0-4, Harris 2-3, Yencho 1-5, Strack 1-3), Holy Cross 6-22 (Lepley 0-1, Fremeau 0-1, McFadden 2-5, Ward 2-7, Cushnie, 1-2, Carper 1-3, O’Dell 0-3). Turnovers: Holy Cross 13, American 7.

Game 20 - Jan. 27, 2010 American 62, Navy 45Alumni Hall • Annapolis, Md.Juniors Michelle Kirk and Liz Leer each scored 17 points and sophomore Lisa Strack contributed a career-best 15 to lead the American University women’s basketball team to a 62-45 victory at Navy on Wednesday night in Annapolis, Md. The Eagles have now won seven straight games, and are a perfect 6-0 in the Patriot League for the fi rst time ever. American (13-7, 6-0 Patriot League) and Navy (11-10, 3-3 PL) battled in a back-and-forth fi rst 15 minutes of action, as neither team was able to gain more than a three-point advantage. The Eagles began to separate themselves late in the half, putting together an 9-2 run over the fi nal 5:25 to take a 31-23 lead at intermission. The spurt was sparked by a Raven Harris three-pointer, which gave AU a 25-21 lead. She later added a pair of free throws, which followed a Leer bucket. Kirk closed the half with a fantastic crossover dribble move, setting herself up for a layup in traffi c, which extended the halftime margin to eight in favor of the Eagles. Strack opened the second half with back-to-back baskets to give American a 10-point advantage, 35-25. The Midshipmen responded cut-ting the AU lead to fi ve before an Ohemaa Nyanin rebound and putback, followed by a Strack bucket gave the Eagles a nine-point lead once again. Navy would make one fi nal push midway through the second half, trimming the Eagles’ lead to four, 43-39. But American fought back, going on a 16-2 run over the next eight-plus minutes to virtually ice the game. Kirk got the run started with consecutive baskets to extend the margin back to six, 47-41. A Janelle McDonald jumper, followed by fi ve straight Leer points, gave the Eagles a 55-41 advantage with 4:01 to play. Leer would add fi ve more points down the stretch, including a three-pointer from straight away, to give the Eagles a 19-point lead, 62-43, with 2:09 to go. Navy added a fi nal bucket in the last minute, setting the fi nal margin at 62-45 in favor of American. The Eagles shot 39.3 percent (24-61) from the fl oor compared to 33.3 percent (17-51) for Navy. American held Navy to only 23.1 percent (3-13) from three-point range. Addition-ally, AU was 10-of-10 from the free throw line, only the fourth game in program history that the Eagles were perfect from the free throw line (with a minimum of 10 attempts). Additionally, American outrebounded Navy by a 40-32 margin and held a 32-18 advantage in points in the paint. In addi-tion to Leer’s 17 points, she recorded six rebounds and a career-best-matching six blocked shots, which ties her own school record for most blocks in a single-game. Stack added career-bests with 15 points and eight rebounds, while dishing out four assists. McDonald also came off bench to record a career-best six points and grab three rebounds. Navy was led by Angela Myers and K.C. Gordon, who scored 12 and 10 points, respectively. “A big focus for us coming into the game was defending Navy’s three-point shooting. We felt like we did that consistently tonight,” commented American Head Coach Matt Corkery. “Our ball security was pretty good as well and that allowed us to put some points on the board. Navy’s an excellent team and we are excited about our performance as a team.”

American (13-7, 6-0) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 7-16 2-2 3 17 3 0 1 37Leer, Liz 6-13 4-4 6 17 2 6 0 24Nyanin, Ohemaa 1-3 0-0 7 2 0 0 0 12Edwards, Ebony 0-7 0-0 5 0 2 0 0 22Harris, Raven 1-6 2-2 1 5 1 0 3 34Yencho, Ashley 0-3 0-0 3 0 2 0 1 28Strack, Lisa 6-9 2-2 8 15 4 0 2 34McDonald, Janelle 3-4 0-0 3 6 0 0 0 9Team 4Totals 24-61 10-10 40 62 14 6 7 200

Navy (11-10, 3-3) FG-A FT-A Reb TP A Blk S MinGordon, K.C. 4-8 1-2 3 10 2 0 0 33Consedine, Cassie 3-16 2-2 5 8 2 2 0 24Arvin, Chey 1-5 0-0 3 2 0 0 0 32Pitts, Jasmine 1-2 0-0 1 3 1 0 2 18Myers, Angela 4-7 4-4 8 12 5 0 2 38Edwards, Erin 1-1 0-0 3 3 0 0 0 16Reed, Beth 0-4 0-0 2 0 0 0 0 15Bowen, Kristin 3-8 1-1 3 7 2 0 0 24Team 4Totals 17-51 8-9 32 45 12 2 4 200

Halftime: American 31, Navy 23. 3-Point Goals: American 4-12 (Kirk 1-4, Leer 1-2, Edwards 0-2, Harris 1-2, Strack 1-2), Navy 3-13 (Gordon 1-3, Consedine 0-3, Arvin 0-1, Pitts 1-2, Edwards 1-1, Bowen 0-3). Turnovers: Navy 15, Ameri-can 8.

Game 21 - Jan. 30, 2010 American 53, Lafayette 31Bender Arena • Washington, D.C.Junior Liz Leer scored a game-high 15 points to lead the American University women’s basketball team to a 53-31 victory on Saturday afternoon in Bender Arena. The Ea-gles held Lafayette to 13 second-half points to pull away from the Leopards and record their eighth straight victory. Lafayette (4-17, 2-5 Patriot League) began the game strong, as it led for the fi rst four-plus minutes before a pair of free throws by Leer gave American (14-7, 7-0 PL) its fi rst advantage of the game, 11-9, with 14:45 to go in the fi rst half. The Eagles played from ahead the rest of the opening 20 minutes, increasing their advantage to fi ve, 17-12, on an Ohemaa Nyanin jumper with 6:47 remain-ing. AU extended its lead to eight on a driving, three-point play by Lisa Strack, and that was followed by a pair of Raven Harris free throws to set the halftime margin at 28-18 in favor of the Eagles. American closed the half with a 9-0 run over the fi nal 2:32 to take control of the ballgame. The Leopards tried to fi ght back, cutting the Eagles lead to six early in the second half, but American’s defense proved to be too much for Lafayette to overcome for the remainder of the half. The Eagles virtually iced the game with a 10-1 run in the middle of the second half. It began with a free throw by Harris, and was followed by a Leer jumper and a Strack runner of the glass, which extended AU’s advantage back to 10, 33-23. Michelle Kirk followed Strack’s bucket with a deep three from the top of the arc, and a Harris steal and layup gave the Eagles a 38-23 ad-vantage with 11:24 to go. AU’s lead remained between 12 and 15 for the next six-plus minutes before an Ashley Yencho transition layup gave the Eagles a 44-28 lead with 4:38 remaining. Leer added a three from straight-away at the 2:17 mark to extend American’s margin to 17, 47-30. American took a 23-point lead, its largest of the game with less than a minute remaining before a late Lafayette free throw set the fi nal margin at 22, 53-31. American held Lafayette to only three points over the fi nal 7:17 of the game. Leer’s 15 points came on an effi cient six-of-10 shooting from the fl oor. Nyanin narrowly missed her fi rst-career double-double with an eight-point, 10-rebound ef-fort. Harris led American with four assists, while sopho-more Ebony Edwards paced the Eagles with three steals. American held the Leopards to 31 points, which sets an American record for the fewest points allowed since 1978-79. The previous record was set on February 11, 1987, when AU held Cheyney State to 34 points in a 79-34 victory. Despite only scoring 31 points, Lafayette’s 33.3 percentage from the fi eld (12-36) was only slightly lower than the Eagles’ 35.7 percent (20-56). The Leopards were zero-for-six from three-point range and only seven-of-15 from the free throw line. “I was proud of our defensive ef-fort today,” remarked Head Coach Matt Corkery following the game. “A big key to today’s game is we took 20 more shots than they (Lafayette) did. The percentages weren’t that much different, but we were able to get a lot more shots. The 14 offensive rebounds was huge.” Saturday’s action will also go down in the AU history books as Kirk became the 12th American women’s basketball student-athlete to reach the 1,000-career point plateau. The junior is the fi rst to hit 1,000 career points since Chanel Hunt hit the mark during her career at American from 2001-05.

Lafayette (4-17, 2-5) FG-A FT-A Reb TP A Blk S MinJordan, Samantha 2-7 2-6 5 6 1 0 0 32Smith, Amanda 1-3 0-0 4 2 0 0 1 17Jenkins, Danielle 1-3 0-0 0 2 1 0 0 31Downey, Melissa 0-4 0-0 2 0 2 0 1 29Wright, LeKeisha 3-6 3-4 6 9 1 1 1 30Virgin, Elizabeth 5-8 2-3 6 12 1 1 1 24Springer, Ashley 0-1 0-0 0 0 0 0 0 9Jackson, Lauren 0-2 0-2 0 0 0 1 1 16McGorry, Sarah 0-2 0-0 2 0 0 0 0 1 2Team 5Totals 12-36 7-15 30 31 6 3 5 200

American (14-7, 7-0) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 3-11 1-2 5 9 1 1 1 35Leer, Liz 6-10 2-2 2 15 0 1 0 29Nyanin, Ohemaa 4-9 0-0 10 8 0 0 1 22Edwards, Ebony 0-5 0-0 6 0 4 0 3 23Harris, Raven 2-8 3-4 3 7 1 0 2 34Yencho, Ashley 2-4 2-3 1 6 0 0 1 19Strack, Lisa 3-8 2-3 5 8 3 0 0 30McDonald, Janelle 0-1 0-0 0 0 0 0 0 7Anya, Stephanie 0-0 0-0 0 0 0 0 0 1Team 2Totals 20-56 10-14 34 53 9 2 8 200

Halftime: American 28, Lafayette 18. 3-Point Goals: Lafayette 0-6 (Jordan 0-1, Jenkins 0-2, Downey 0-1, Springer 0-1), American 3-22 (Kirk 2-8, Leer 1-3, Edwards 0-5, Harris 0-1, Yencho 0-1, Strack 0-4). Turnovers: Lafayette 20, American 9.

Page 20: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2020

Game 22 - Feb. 6, 2010 Lehigh 53, American 46Stabler Arena • Bethlehem, Pa.While Saturday evening will be a night that goes down in American University women’s basketball history as junior Liz Leer broke the school’s ca-reer blocked shots record, the Eagles fell 53-46 to defending conference champion Lehigh in a hard-fought battle in Bethlehem, Pa. The loss snapped AU’s eight game winning streak, as the Eagles’ suffered their fi rst Patriot League loss of the sea-son. Lehigh (20-3, 7-1 Patriot League) opened up an 8-5 lead in the fi rst fi ve-plus minutes, but American (14-8, 7-1 PL) responded with a 10-0 spurt over the next 2:38 to take a 15-8 advan-tage. Leer knocked down two three-pointers dur-ing the stretch, along with a Stephanie Anya layup and an Ashley Yencho runner in the lane. After a Lehigh bucket, Lisa Strack followed with a three to give AU an 18-10 lead with 9:24 to play in the fi rst half. The Mountain Hawks quickly found their rhythm, running off 11 unanswered points over the next six-plus minutes to take a 21-18 lead. Strack broke American’s scoreless streak with a layup off a Raven Harris pass with 1:48 to go in the opening stanza. Harris would follow by knocking down a deep three-pointer in the fi nal seconds of the half to knot the score at 25 at halftime. After an initial Lehigh basket to begin the second half, Ameri-can rattled off six straight points on buckets by Strack, Leer and Kirk to take a 31-28 advantage. The Eagles went cold, however, for the next 6:23, allowing Lehigh to run off 11 consecutive points before a Michelle Kirk rebound-and-putback layup trimmed the Lehigh lead to six, 39-33 with 11:10 to go. Lehigh would continue to apply the pressure, eventually opening up an 11-point advantage, 44-33. The Eagles did not quit, going on a 9-1 spurt, capped by a Leer three-point play, to trim the defi -cit to three, 45-42, with 4:52 to play. But that is as close as American would get down the stretch, as Lehigh held on for the 53-46 victory. Leer led the Eagles with a game-high 13 points, and added fi ve rebounds and fi ve blocked shots. The junior now has 154 career blocks, as she passed Kirsten Keller for the program’s all-time mark. Keller had 152 blocked shots in her career at American from 1991-95. Strack chipped in nine points and six re-bounds for AU, while Harris had seven points and fi ve assists. Lehigh was paced by Emily Gratch, Erica Prosser and Courtney Dentler, who scored 12, 11, and 10 points, respectively. The victory for the Mountain Hawks is their 30th straight home win, which is the third longest active streak in the country behind Connecticut (55) and Stanford (40). Both teams shot an equal 33.3 percent from the fl oor with American (19) actually converting more fi eld goals than Lehigh (17). The difference proved to be Lehigh’s advantage at the free-throw line, as the Mountain Hawks were 18-of-24 from the stripe, while AU was only four-of-fi ve in the game. “It boiled down to Lehigh being the more aggressive team. That was evident in them get-ting to the free throw line almost 20 more times than we did tonight,” commented American Head Coach Matt Corkery. “We had an opportunity with three minutes to go to make it a game, but unfor-tunately we did not execute in our late game situ-ations.” With Lehigh’s victory, American and the Mountain Hawks now sit in a fi rst-place tie in the Patriot League at 7-1. American (14-8, 7-1) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 3-9 0-0 3 6 2 0 0 37Leer, Liz 5-12 1-1 5 13 1 5 0 33Nyanin, Ohemaa 1-2 0-0 6 2 0 1 0 21Strack, Lisa 4-9 0-0 6 9 1 1 2 28Harris, Raven 3-13 0-0 1 7 5 0 0 31Edwards, Ebony 1-5 0-0 5 2 1 0 1 16 Yencho, Ashley 1-4 2-2 2 4 0 0 0 15 McDonald, Janelle 0-0 0-0 0 0 0 0 0 4 Anya, Stephanie 1-3 1-2 5 3 0 1 2 15Team 8Totals 19-57 4-5 41 46 10 8 5 200

Lehigh (20-3, 7-1) FG-A FT-A Reb TP A Blk S MinDentler, Courtney 4-11 1-2 2 10 1 0 0 25Williams, Alexa 2-8 2-2 5 6 0 2 0 17Prosser, Erica 3-11 5-9 2 11 5 0 3 36Smith, Tricia 2-2 2-2 7 6 3 0 2 31Ross, Alex 2-8 0-0 4 6 2 0 0 35Ingalls, Ryan 0-2 0-0 2 0 0 0 0 12Gratch, Emily 4-8 4-7 6 12 1 0 1 25Dalton, Kristen 0-1 2-2 1 2 0 0 1 19Team 7Totals 17-51 16-24 36 53 12 2 7 200

Halftime: American 25, Lehigh 25. 3-Point Goals: American 4-22 (Kirk 0-4, Leer 2-7, Strack 1-4, Harris 1-4, Edwards 0-1, Yencho 0-2), Lehigh 3-13 (Dentler 1-1, Prosser 0-5, Ross 2-6, Ingalls 0-1). Turnovers: American 20, Lehigh 13.

Game 23 - Feb. 10, 2010 American 53, Bucknell 49Sojka Pavilion • Lewisburg, Pa.The American University women’s basketball team travelled to Lewisburg, Pa., on Wednesday evening, claiming a 53-49 victory over host Bucknell. Junior Liz Leer led the Eagles with 12 fi rst-half points while classmate Michelle Kirk found her rhythm in the sec-ond half, exploding for 17 points in the fi nal 20 minutes to lead AU to its ninth victory in its last 10 games. Af-ter an initial Bucknell (7-15, 3-6 Patriot League) bas-ket to open the game, American (15-8, 8-1 PL) ran off 12 consecutive points to take a 12-2 lead. Leer had six points during the stretch, which was capped on a beautiful Kirk pass to Stephanie Anya for the layup. The Bison responded with seven straight points to get the margin back to three, 12-9, with 11:15 to play in the fi rst half. Leer would break the Bucknell run with a layup off a pass from Kirk, and it was followed by a Raven Harris steal and coast-to-coast bucket to give the Eagles a 16-9 advantage. AU regained a 10-point lead, 24-14, on an Ohemaa Nyanin rebound and put-back layup. The Eagles took a 26-20 halftime lead on the strength of 12 fi rst-half points by Leer. Kirk found her rhythm at the start of the second half, scoring AU’s fi rst fi ve points, including a three-pointer, to give the Eagles a 31-21 advantage. Kirk followed with a transition three-point play off a feed from Lisa Strack to open up a 14-point lead, 36-22, with 18:10 to play. But Bucknell was able to slowly claw its way back into the contest thanks to a prolonged 21-9 run over a 12-plus minute span. With only a two-point lead and all the momentum working against AU, Kirk hit a clutch fade-away jumper to extend the advantage back to four with 5:31 to play. A Kirk free throw extended the American advantage to 48-45 with 4:04 remaining, and both offenses went cold over the next three min-utes as the score remained the same as the game hit the one minute mark. Kirk was again up to the chal-lenge for the Eagles, hitting an almost identical fade-away jumper in the lane, this time with the shot clock winding down. The bucket gave the Eagles a 50-45 lead with 55 seconds to play. American sealed the victory at the free throw line, as Harris knocked down a pair on a one-and-one with 24.9 seconds remaining to regain the fi ve point margin. Kirk led the Eagles with 19 points, 17 of which came in the second half. The junior scored eight of AU’s fi nal 10 points in the game. She was eight-of-11 from the free throw line. Leer was also highly effective for the Eagles, as she added 16 points while also grabbing fi ve rebounds and recording three blocks. Nyanin was a force inside for AU, fi nishing with eight points and eight rebounds. Harris also played a good all-around game for Ameri-can with six points, four rebounds, three steals and two assists. Bucknell was led by Trisha Krewson’s 18 points. Morgan Wrightson was also in double digits with 11 points off the bench for the Bison. The two squads shot nearly identical clips from the fl oor, as AU was 20-52 (38.5 percent) compared to 19-52 (36.5 percent) for Bucknell. American turned the ball over only nine times while forcing 20 Bucknell give-aways, although the Bison held a 42-27 advantage in rebounding. “I was proud of the way we stepped up and made plays late in the game on both ends of the fl oor,” said American Head Coach Matt Corkery. “We hit some big free throws down the stretch and got some critical stops defensively when we needed them. The rebounding differential was disappointing, but that’s a credit to Bucknell. They are a physical team and really played well.”American (15-8, 8-1) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 5-13 8-11 2 19 3 0 2 35Leer, Liz 7-16 2-3 5 16 0 3 1 37Nyanin, Ohemaa 4-8 0-1 8 8 1 1 1 28Strack, Lisa 1-3 0-0 1 2 2 0 1 22Harris, Raven 2-6 2-2 4 6 2 0 3 31Edwards, Ebony 0-4 0-0 2 0 0 2 1 22 Yencho, Ashley 0-0 0-0 3 0 1 0 0 13 Anya, Stephanie 1-2 0-0 1 2 0 1 0 12Team 1Totals 20-52 12-17 27 53 9 7 9 200

Bucknell (7-15, 3-6) FG-A FT-A Reb TP A Blk S MinMgbada, Felicia 0-2 0-0 2 0 0 0 0 12Novacek, Joyce 2-3 1-2 9 5 2 2 0 30Higham, Cosima 4-7 1-2 5 9 0 0 0 15Voss, Rachel 1-10 0-0 2 2 3 0 0 36Krewson, Tricia 7-15 1-1 4 18 3 0 1 40Dunn, Alyssa 0-2 0-0 0 0 0 0 0 4Wrightson, Morgan 4-9 2-3 2 11 2 0 1 23Chukwuedo, Christina 0-0 0-0 1 0 0 0 0 5Horbatuck, Lindsay 1-4 2-2 10 4 3 2 3 35Team 7Totals 19-52 7-10 42 49 13 4 5 200

Halftime: American 26, Bucknell 20. 3-Point Goals: American 1-10 (Kirk 1-6, Strack 0-1, Harris 0-2, Edwards 0-1), Bucknell 4-10 (Voss 0-3, Krewson 3-5, Dunn 0-1, Wrightson 1-1). Turnovers: Bucknell 13, American 9.

Game 24 - Feb. 13, 2010 American 82, Colgate 47Bender Arena • Washington, D.C.Junior Liz Leer scored a career-best 27 points and added eight rebounds, fi ve assists and two blocks en route to an 82-47 victory for the American University women’s basketball team on Saturday afternoon at Bender Arena. With the victory, the Eagles move to 9-1 in the Patriot League and have now won 10 of 11 games. American (16-8, 9-1 Patriot League) led the entire game following Ohemaa Nyanin’s initial bucket 13 seconds into the game. Colgate (9-15, 4-6 PL) hung tough the fi rst few minutes, as a Sami Kozlows-ki three-pointer cut its defi cit to 8-7 three minutes in. But the Eagles took control from that point forward, running off eight straight points over 2:36 to take a 16-7 advantage. Leer accounted for all eight points during the stretch on three consecutive made fi eld goals, including a three-pointer. American followed with another 8-0 run to extend its lead to 14, 27-13, with 9:03 remaining in the opening half. The margin remained between 10 and 15 for the remainder of the half, as the Eagles took a 38-26 advantage into halftime on the strength of 18 Leer fi rst-half points. In the second half, Leer continued exactly where she left off prior to intermission, knocking down an opening three to extend AU’s lead to 15. The Eagles eventually opened up a 20-point advantage, 49-29, on another Leer trifecta with 12:47 remaining. The lead expanded to 26, 60-36, on a Michelle Kirk layup with 9:19 to go, and eventually became 30, 70-40, on a Nyanin jumper with 3:47 to play. The fi nal mar-gin ended up at 82-47 in favor of AU, marking the Eagles’ fi rst 30-point win since January 19, 2 008, when AU won at Colgate, 88-58. Leer scored a ca-reer-high 27 points for American on an effi cient 9-15 from the fl oor, including 4-5 from three-point range. She was also 5-6 from the free throw line, and added team-highs with eight rebounds, fi ve assists and two blocks. “She really played well, knocked down open shots,” remarked Head Coach Matt Corkery in talk-ing about Leer’s performance. “She’s got a little of versatility in the ways she can score. When she’s shooting the three...that’s pretty dangerous because you can also post her. I’m very proud of the way Liz played but also proud of our team as far as how they got her the ball.” Kirk, the Patriot League leading scorer at 18.5 ppg, and Lisa Strack each chipped in 14, while Nyanin had 10 points. Raven Harris also had eight points along with four steals, four assists and three rebounds, while Ebony Edwards picked up fi ve steals for the Eagles. American shot an impres-sive 54.2 percent from the fl oor (27-52), which led to a season-high 82 points. Addtionally, the Eagles were 8-17 from three-point range (47.1 percent). Col-gate only shot 28.3 percent in the game (15-53). The 1,291 fans at Saturday’s game set a new women’s basketball attendance record in Bender Arena. The previous mark was 1,177, which was set on last sea-son on February 7. Additionally, the contest was part of a special day of events, including National Girls and Women in Sports Day; Pink Zone, the WBCA’s breast cancer initiative; and Phil Bender. In honor of the day, members from each of AU’s women’s teams conducted a youth clinic following the game.Colgate (9-15, 4-6) FG-A FT-A Reb TP A Blk S MinGarman, Katie 0-1 3-4 1 3 1 0 0 21Moser, Krista 4-12 7-10 10 15 1 1 2 27Havenstein, Holly 1-3 0-0 0 2 0 0 0 13Green, Candice 0-3 0-0 2 0 3 0 0 22Kozlowski, Sami 3-6 0-1 1 7 3 0 0 33Lynch, Lhazmine 1-5 0-1 3 2 0 0 1 18Wejnert, Tayler 1-8 1-2 0 4 2 0 2 17Durkett, Kaleigh 0-0 0-0 1 0 0 0 0 7Korkowski, Kelly 0-1 0-0 1 0 0 0 0 6Ward, Rebekah 0-0 0-0 0 0 1 0 0 4Brim, Kendra 1-2 0-0 4 3 1 1 0 9Librizzi, Evan 1-2 0-0 0 3 0 0 0 4Oakes, Tricia 3-10 2-4 4 8 0 0 1 19Team 7Totals 15-53 13-22 34 47 12 2 6 200

American (16-8, 9-1) FG-A FT-A Reb TP A Blk S MinKirk, Michelle 4-10 4-4 3 14 2 0 0 31 Leer, Liz 9-15 5-6 8 27 5 2 0 30Nyanin, Ohemaa 4-6 2-2 5 10 1 0 1 24Strack, Lisa 6-8 1-1 4 14 2 0 2 27Harris, Raven 3-6 2-2 3 8 4 0 4 34Edwards, Ebony 0-1 2-2 1 2 3 0 5 25Yencho, Ashley 1-3 1-2 1 4 2 0 1 11 McDonald, Janelle 0-1 1-2 2 1 0 0 1 8Anya, Stephanie 0-2 2-2 5 2 0 0 0 10Team 4Totals 27-52 20-23 36 82 19 2 14 200

Halftime: American 38, Colgate 26. 3-Point Goals: Colgate 4-11 (Garman 0-1, Green 0-1, Kozlowski 1-1, Wejnart 1-5, Brim 1-1, Librizzi 1-2), American 8-17 (Kirk 2-5, Leer 4-5, Strack 1-2, Harris 0-1, Edwards 0-1, Yencho 1-3). Turnovers: Colgate 20, American 12.

Page 21: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2121

TOTAL 3-PTS REBOUNDS ## Player GP GS Min Avg FG FGA Pct 3FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO A TO Blk Stl Pts Avg05 Kirk,Michelle 30 30 864 28.8 152 338 .450 27 88 .307 88 111 .793 41 125 166 5.5 47 0 43 53 6 23 419 14.010 Ryan,Nicole 31 26 880 28.4 111 307 .362 62 183 .339 65 74 .878 14 51 65 2.1 33 0 40 38 5 34 349 11.322 Leer,Liz 31 26 879 28.4 152 274 .555 0 2 .000 40 47 .851 68 104 172 5.5 83 3 37 78 62 28 344 11.102 Jackson,Talicia 31 31 838 27.0 71 194 .366 47 128 .367 40 57 .702 27 105 132 4.3 43 0 49 48 1 40 229 7.403 Stanfi eld,Pam 30 30 861 28.7 56 164 .341 4 15 .267 39 87 .448 51 81 132 4.4 47 1 113 82 1 54 155 5.212 Edwards,Ebony 30 0 368 12.3 48 96 .500 23 52 .442 8 11 .727 19 39 58 1.9 41 0 18 25 1 30 127 4.215 Strack,Lisa 31 6 410 13.2 32 101 .317 7 38 .184 27 51 .529 28 30 58 1.9 37 0 35 27 5 30 98 3.223 Harris,Raven 22 0 232 10.5 20 73 .274 4 21 .190 19 28 .679 10 25 35 1.6 28 0 37 40 1 18 63 2.921 Coles,Kristin 23 0 183 8.0 27 45 .600 0 0 .000 8 19 .421 16 28 44 1.9 31 0 9 16 1 14 62 2.713 Yencho,Ashley 28 1 241 8.6 21 64 .328 6 33 .182 8 10 .800 3 18 21 0.8 12 0 26 30 0 11 56 2.031 Nusseibeh,Sahar 27 5 262 9.7 24 52 .462 0 0 .000 6 19 .316 28 20 48 1.8 32 0 3 16 10 5 54 2.001 Bell,Brittany 17 0 102 6.0 9 28 .321 0 0 .000 9 14 .643 8 12 20 1.2 20 0 3 11 4 4 27 1.642 Mcdonald,Janelle 17 0 90 5.3 10 24 .417 0 0 .000 2 4 .500 7 14 21 1.2 12 0 2 3 1 4 22 1.351 Moritz,Alisha 7 0 15 2.1 2 2 1.000 0 0 .000 0 0 .000 0 4 4 0.6 3 0 0 1 0 0 4 0.6TM TEAM................ 61 52 113 3.6 0 11 Total.......... 31 735 1762 .417 180 560 .321 359 532 .675 381 708 1089 35.1 469 4 415 479 98 295 2009 64.8 Opponents...... 31 663 1645 .403 142 434 .327 325 466 .697 336 735 1071 34.5 516 - 385 580 77 188 1793 57.8

TOTAL 3-PTS REBOUNDS ## Player GP GS Min Avg FG FGA Pct 3FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO A TO Blk Stl Pts Avg05 Kirk,Michelle 13 13 388 29.8 74 161 .460 8 26 .308 44 57 .772 21 63 84 6.5 24 0 13 19 3 13 200 15.410 Ryan,Nicole 14 14 414 29.6 50 129 .388 28 78 .359 36 40 .900 4 27 31 2.2 13 0 21 13 4 15 164 11.722 Leer,Liz 14 14 414 29.6 59 125 .472 0 1 .000 23 27 .852 34 40 74 5.3 38 1 18 34 29 13 141 10.102 Jackson,Talicia 14 14 392 28.0 29 76 .382 19 53 .358 18 25 .720 16 52 68 4.9 23 0 21 18 0 16 95 6.803 Stanfi eld,Pam 13 13 389 29.9 30 91 .330 2 6 .333 21 50 .420 23 33 56 4.3 16 0 42 34 0 21 83 6.415 Strack,Lisa 14 1 193 13.8 16 46 .348 4 20 .200 13 24 .542 13 17 30 2.1 19 0 12 14 2 11 49 3.512 Edwards,Ebony 14 0 184 13.1 20 44 .455 6 19 .316 3 4 .750 11 23 34 2.4 18 0 13 8 0 13 49 3.523 Harris,Raven 6 0 59 9.8 5 15 .333 2 6 .333 2 6 .333 2 5 7 1.2 5 0 10 8 0 4 14 2.301 Bell,Brittany 9 0 68 7.6 7 19 .368 0 0 .000 6 10 .600 7 8 15 1.7 11 0 3 7 2 3 20 2.221 Coles,Kristin 9 0 60 6.7 7 13 .538 0 0 .000 2 6 .333 5 9 14 1.6 9 0 3 7 0 4 16 1.813 Yencho,Ashley 13 1 122 9.4 8 30 .267 2 15 .133 5 7 .714 0 6 6 0.5 6 0 12 17 0 5 23 1.831 Nusseibeh,Sahar 11 0 87 7.9 7 14 .500 0 0 .000 3 5 .600 5 7 12 1.1 11 0 1 3 3 4 17 1.542 Mcdonald,Janelle 8 0 52 6.5 5 14 .357 0 0 .000 0 2 .000 2 9 11 1.4 7 0 2 1 0 3 10 1.351 Moritz,Alisha 2 0 3 1.5 1 1 1.000 0 0 .000 0 0 .000 0 0 0 0.0 0 0 0 0 0 0 2 1.0TM TEAM................ 25 19 44 3.1 0 3 Total.......... 14 318 778 .409 71 224 .317 176 263 .669 168 318 486 34.7 200 1 171 186 43 125 883 63.1 Opponents...... 14 293 711 .412 69 188 .367 141 201 .701 124 340 464 33.1 239 - 179 249 35 75 796 56.9

2008-09 Overall Statistics (19-12)

2008-09 Patriot League Games (9-5)

TOTAL 3-PTS REBOUNDS## Player GP GS Min Avg FG FGA Pct 3FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO A TO Blk Stl Pts Avg22 Leer,Liz 15 10 407 27.1 86 137 .628 0 1 .000 14 16 .875 31 61 92 6.1 37 1 17 41 31 15 186 12.405 Kirk,Michelle 15 15 413 27.5 64 147 .435 18 57 .316 38 46 .826 18 54 72 4.8 19 0 27 29 3 9 184 12.310 Ryan,Nicole 15 10 405 27.0 55 159 .346 33 97 .340 27 31 .871 9 22 31 2.1 17 0 18 23 0 19 170 11.302 Jackson,Talicia 15 15 390 26.0 40 112 .357 26 69 .377 19 29 .655 11 47 58 3.9 18 0 25 25 1 23 125 8.312 Edwards,Ebony 14 0 151 10.8 22 41 .537 14 26 .538 2 3 .667 8 13 21 1.5 20 0 4 15 1 13 60 4.303 Stanfi eld,Pam 15 15 409 27.3 23 63 .365 2 8 .250 16 33 .485 20 41 61 4.1 28 1 66 44 1 28 64 4.321 Coles,Kristin 14 0 123 8.8 20 32 .625 0 0 .000 6 13 .462 11 19 30 2.1 22 0 6 9 1 10 46 3.323 Harris,Raven 15 0 162 10.8 15 55 .273 2 14 .143 17 22 .773 8 19 27 1.8 23 0 24 31 1 14 49 3.315 Strack,Lisa 15 5 197 13.1 13 45 .289 2 14 .143 13 24 .542 15 13 28 1.9 15 0 20 12 3 17 41 2.731 Nusseibeh,Sahar 14 5 153 10.9 16 34 .471 0 0 .000 2 10 .200 21 9 30 2.1 15 0 2 12 6 1 34 2.413 Yencho,Ashley 14 0 113 8.1 13 31 .419 4 17 .235 3 3 1.000 3 10 13 0.9 6 0 12 12 0 6 33 2.442 Mcdonald,Janelle 9 0 38 4.2 5 10 .500 0 0 .000 2 2 1.000 5 5 10 1.1 5 0 0 2 1 1 12 1.301 Bell,Brittany 6 0 27 4.5 1 6 .167 0 0 .000 3 4 .750 1 3 4 0.7 6 0 0 3 1 0 5 0.851 Moritz,Alisha 5 0 12 2.4 1 1 1.000 0 0 .000 0 0 .000 0 4 4 0.8 3 0 0 1 0 0 2 0.4TM TEAM................ 30 31 61 4.1 0 6 Total.......... 15 374 873 .428 101 303 .333 162 236 .686 191 351 542 36.1 234 2 221 265 50 156 1011 67.4 Opponents...... 15 321 823 .390 68 223 .305 168 234 .718 183 343 526 35.1 248 - 179 298 38 103 878 58.5

2008-09 Regular Season Non-Conference Games (10-5)

2008-09 Statistics

Page 22: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2222

DATE TIME OPPONENT SCORE RECORD ATTEND HIGH POINTS HIGH REBOUNDS11/14/08 7:00 p.m. at NJIT W 70-63 1-0 873 (11) Jackson,Talicia (7) Nusseibeh,Sahar11/16/08 2:00 p.m. DREXEL W 74-65 2-0 515 (20) Kirk,Michelle (7) Jackson,Talicia11/19/08 7:00 p.m. HOWARD W 77-50 3-0 136 (13) Jackson,Talicia (5) Stanfi eld,Pam (13) Kirk,Michelle 11/22/08 1:00 p.m. at Minnesota L 79-62 3-1 4768 (18) Ryan,Nicole (6) Leer,Liz11/23/08 11:00 a.m. vs North Carolina State L 73-63 3-2 N/A (16) Kirk,Michelle (6) Leer,Liz11/28/08 5:30 p.m. at Morgan State L 57-54 3-3 269 (18) Leer,Liz (14) Leer,Liz11/30/08 2:00 p.m. CLEVELAND STATE W 77-59 4-3 238 (16) Ryan,Nicole (7) Leer,Liz (7) Jackson,Talicia (7) Stanfi eld,Pam 12/02/08 6:00 p.m. at Maryland Eastern Shore W 66-40 5-3 869 (14) Leer,Liz (5) Jackson,Talicia (5) Leer,Liz 12/07/08 2:00 p.m. RHODE ISLAND W 77-58 6-3 244 (17) Ryan,Nicole (5) Stanfi eld,Pam12/19/08 7:00 p.m. PRINCETON W 59-44 7-3 218 (17) Leer,Liz (7) Kirk,Michelle12/21/08 2:00 p.m. GEORETOWN L 69-54 7-4 232 (12) Leer,Liz (13) Leer,Liz12/28/08 2:00 p.m. at Radford W 68-45 8-4 200 (17) Leer,Liz (8) Jackson,Talicia (17) Kirk,Michelle 12/30/08 7:00 p.m. at VCU L 67-63 8-5 414 (17) Kirk,Michelle (8) Leer,Liz1/04/09 2:05 p.m. COLUMBIA W 87-66 9-5 262 (18) Leer,Liz (8) Kirk,Michelle1/06/09 7:00 p.m. BROWN W 60-43 10-5 156 (21) Ryan,Nicole (8) Kirk,Michelle1/10/09 7:05 p.m. at Lehigh * L 77-69 10-6 569 (21) Kirk,Michelle (8) Kirk,Michelle1/14/09 7:00 p.m. at Bucknell * W 61-55 11-6 386 (16) Leer,Liz (11) Jackson,Talicia1/17/09 2:00 p.m. COLGATE * W 63-47 12-6 318 (17) Ryan,Nicole (9) Jackson,Talicia1/21/09 7:00 p.m. at Army * W 53-42 13-6 382 (20) Kirk,Michelle (7) Jackson,Talicia1/24/09 2:00 p.m. HOLY CROSS * W 64-58 14-6 845 (18) Kirk,Michelle (10) Kirk,Michelle1/28/09 7:00 p.m. NAVY * L 68-61 14-7 153 (27) Kirk,Michelle (11) Kirk,Michelle1/31/09 1:05 p.m. at Lafayette * W 72-61 15-7 472 (17) Ryan,Nicole (9) Kirk,Michelle2/07/09 4:00 p.m. LEHIGH * W 65-56 16-7 1177 (16) Ryan,Nicole (7) Jackson,Talicia2/11/09 7:00 p.m. BUCKNELL * W 71-63 17-7 188 (15) Ryan,Nicole (6) Kirk,Michelle (6) Edwards,Ebony 2/14/09 2:00 p.m. at Colgate * W 60-38 18-7 623 (19) Kirk,Michelle (5) Leer,Liz (5) Jackson,Talicia 2/18/09 7:00 p.m. ARMY * L 60-58 (OT) 18-8 255 (20) Kirk,Michelle (7) Stanfi eld,Pam2/21/09 1:00 p.m. at Holy Cross * L 58-55 18-9 2012 (12) Jackson,Talicia (6) Coles,Kristin (6) Jackson,Talicia 2/25/09 7:00 p.m. at Navy * L 59-56 18-10 882 (21) Ryan,Nicole (8) Kirk,Michelle (8) Leer,Liz 2/28/09 2:00 p.m. LAFAYETTE * W 75-54 19-10 825 (16) Ryan,Nicole (8) Kirk,Michelle3/07/09 5:00 p.m. vs Lafayette $ L 58-56 19-11 N/A (17) Kirk,Michelle (8) Stanfi eld,Pam3/20/09 7:00 p.m. at James Madison ^ L 61-59 19-12 1187 (18) Kirk,Michelle (7) Stanfi eld,Pam

* indicates Patriot League game$ indicates Patriot League Tournament game^ indicates WNIT game

ATTENDANCE SUMMARY GAMES TOTALS AVG/GAMEHOME 15 5762 384AWAY 14 13906 993NEUTRAL 2 N/A N/ATOTAL 31 19668 678

Overall: 19-12 • Patriot League: 9-5 • Home: 12-3 • Away: 7-7 • Neutral: 0-2

2008-09 Schedule and Results

Page 23: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2323

Matt Corkery is his second season as the head women’s basketball coach at American University.

In 2008-09, Corkery led American to a 19-12 record, which included the

program’s second consecutive postseason appearance. The Eagles’ 10-5 non-conference record was the best in school history, and their 19 total victories were the most since the 1997-98 campaign. The Eagles defeated two NCAA Tournament teams, Drexel and Lehigh, during the season.

Additionally, Corkery coached three All-Patriot League selections in 2008-09, including First Team performer Michelle Kirk and All-Rookie Team honorees Ebony Edwards and Lisa Strack. Corkery oversaw the largest women’s basketball crowd in school history when 1,177 fans attended the home game against Lehigh on February 7, 2009.

“We are pleased with the progress that Matt and his staff have made with our women’s basketball program over the last year both on and off the court,” commented Director of Athletics and Recreation Keith Gill. “He is a great teacher of the game and his passion for this team will translate into continued success for this program. We’re excited for what this season and the future will bring.”

Corkery was named to his current position on May 19, 2008 after serving as AU’s associate head coach during the 2007-08 campaign. In total, Corkery has been on the AU staff for fi ve seasons. In 2007, he was elevated from assistant coach and recruiting coordinator to associate head coach. With the promotion, Corkery assumed additional responsibilities both on and off the court.

Corkery joined the Eagles in 2004 after spending three seasons as the associate head coach at Division II Emporia State (Kan.). During his tenure with the Hornets, Corkery helped guide the squad to a 63-25 record and No. 2 rankings nationally in both the 2001-02 and 2003-04 seasons.

Corkery served as an assistant coach at Stephen F. Austin University from 1999-2001. During his tenure, the Ladyjacks won consecutive Southland Conference titles and made successive appearances in the NCAA Tournament. In 2000, the Ladyjacks advanced to the second round of the NCAA Division I Tournament as a 12-seed. Corkery’s squad recorded a 54-11 record during his tenure at Stephen F. Austin.

From 1996 to 1999, as head coach at Howard College (Texas), he led the Lady Hawks to three top 10 rankings in the National Junior College Athletic Association polls and an overall record of 90-12. In 1998, Corkery was named the NJCAA Region V Coach of the Year, as his squad compiled a 34-3 record and fi nished in third-place in the NJCAA National Tournament.

Corkery earned a Bachelor’s degree in education in 1993 and a Master’s of sports and exercise sciences in 1996 from West Texas A&M University. While with the Lady Buffs, Corkery worked his way up from student assistant coach to graduate assistant and eventually earned a full-time assistant coaching position. As an assistant, Corkery mentored a Buffs squad that went 28-3, won the Lone Star Conference title and was ranked as high as No. 4 in the NCAA Division II national rankings in the 1995-96 campaign. The team’s record during Corkery’s tenure as an assistant at West Texas A&M was 120-32.

A native of Whitharral, Texas, Corkery currently resides in Washington, D.C.

matt CORKERYHead Coach • 2nd Season • West Texas A&M, ‘93 • 35-20

Corkery’s Coaching ResumeYears Position School Record2008-Pres. Head Coach American 35-20

2007-08 Associate Head Coach American 18-14

2004-07 Assistant Coach/Recruiting Coordinator American 32-56

2001-04 Associate Head Coach Emporia State 63-25

1999-01 Assistant Coach Stephen F. Austin 54-11

1996-99 Head Coach Howard (Texas) 90-12

1990-94, 96 Assistant Coach West Texas A&M 120-32

Total Record for Corkery-Coached Teams 412-170

Page 24: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2424

2009-10 (Senior): Recorded a career-best 10 points on 4-6 FG in victory over Colgate ... chipped in eight points and eight rebounds in win at Bucknell (2/10) ... grabbed a game-high 10 rebounds and added eight

points in victory over Lafayette (1/30) ... recorded seven rebounds in back-to-back wins over Holy Cross (1/24) and Navy (1/27) ... grabbed nine rebounds in win against Army (1/20) ... scored nine points and grabbed fi ve rebounds in victory at Colgate (1/16) ... led team with seven rebounds in win over Bucknell (1/13) ... recorded career-bests with nine points and 13 rebounds in career-high 33 minutes in overtime victory over Lehigh (1/9) ... grabbed seven rebounds in victory over Maryland-Eastern Shore (1/4) ... notched fi ve points and fi ve rebounds at Columbia (1/2) ... recorded three points, six rebounds and a career-high three assists vs. St. Francis (Pa.) (12/29) ... Scored seven points and tied her career-high with nine rebounds in victory over Morgan State (12/16) ... matched her career-high with eight points against Wagner (11/28) ... set a new career-best with nine rebounds against East Carolina (11/22) ... made fi rst-career start at Howard (11/13), recording career-highs with eight points and 25 minutes of game action.

2008-09: Did not play on the team.

2007-08 (Junior): Appeared in 20 games … played a season-high 12 minutes versus Wagner on 11/19 … tallied a career-high fi ve points on two-of-three shooting against Brown on 11/24 … snagged personal-high seven rebounds in only seven minutes of action against Lehigh (1/12) … recorded six blocked shots … contributed three steals … averaged 1.1 points and 2.2 rebounds in campaign.

2006-07 (Sophomore): Played in a career-high fi ve games in her second season ... scored her fi rst career basket against Furman (12/5) ... grabbed a career-high four rebounds vs. Lafayette (2/24) ... totaled four points in fi ve games played.

2005-06 (Freshman): Walked on to the team in mid-year ... played in her fi rst game against Bucknell (2/7) ... grabbed two rebounds against the Bison.

High School: Four year letterwinner in basketball ... three-year captain of basketball team ... earned Friends School League All-Conference honors as a junior and senior ... also played volleyball and ran track, where she captained both teams ... holds record in shotput and was a two time all-conference selection.

Personal: Daughter of Ohene and Naa Nyanin ... has three siblings, Natasha (24), Nana (20) and Paapa (15) ... majoring in justice and public policy.

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2005-06 1 0 2 2.0 0 1 .000 0 0 .000 0 2 .000 1 1 2 2.0 0 0 0 1 0 0 0 0.02006-07 5 0 6 1.2 1 2 .500 0 0 .000 2 3 .667 1 5 6 1.2 1 0 0 1 0 0 4 0.82007-08 20 0 112 5.6 7 21 .333 0 0 .000 7 15 .467 18 26 44 2.2 17 0 3 12 6 3 21 1.12009-10 24 23 474 19.8 50 120 .417 0 0 .000 15 29 .517 72 72 144 6.0 40 1 17 22 5 5 115 4.8TOTAL 50 23 594 11.9 58 144 .403 0 0 .000 24 49 .490 92 104 196 3.9 58 1 20 36 11 8 140 2.8

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard * 4-8 0-0 0-1 4/1/5 3 8 1 2 0 0 2511/16 at Princeton * 0-2 0-0 0-0 1/2/3 0 0 1 1 0 0 1911/18 at Brown * 2-3 0-0 0-3 2/1/3 2 4 1 1 0 0 1011/22 ECU * 3-7 0-0 2-2 3/6/9 3 8 0 1 0 0 23 11/24 NJIT 2-3 0-0 1-2 0/2/2 1 5 0 1 0 0 1511/28 at Wagner * 4-8 0-0 0-0 2/1/3 1 8 0 1 0 0 16 12/2 at Drexel * 1-5 0-0 0-0 3/2/5 3 2 1 2 0 0 2412/6 HIGH POINT * 1-3 0-0 0-0 1/4/5 2 2 1 2 0 1 1312/16 MORGAN ST. * 3-7 0-0 1-2 4/5/9 0 7 0 0 1 0 1612/20 MARYLAND * 1-2 0-0 2-2 2/1/3 1 4 1 0 0 0 2112/28 vs. Buffalo * 0-2 0-0 0-0 2/0/2 5 0 1 2 0 0 1112/29 vs. St. Fran (Pa) * 1-3 0-0 1-2 2/4/6 2 3 3 1 0 0 211/2 at Columbia * 2-6 0-0 1-3 3/2/5 2 5 0 3 1 0 151/4 UMES * 1-3 0-0 0-0 3/4/7 2 2 1 0 1 1 231/9 LEHIGH * 3-4 0-0 3-4 4/9/13 2 9 0 1 0 0 331/13 BUCKNELL * 1-7 0-0 1-3 5/2/7 2 3 1 0 0 0 201/16 at Colgate * 4-7 0-0 1-2 3/2/5 0 9 0 0 0 0 221/20 ARMY * 2-6 0-0 0-0 4/5/9 1 4 1 0 0 0 221/24 at Holy Cross * 1-6 0-0 0-0 5/2/7 1 2 2 0 0 0 181/27 at Navy * 1-3 0-0 0-0 6/1/7 0 2 0 0 0 0 121/30 LAFAYETTE * 4-9 0-0 0-0 6/4/10 1 8 0 2 0 1 222/6 at Lehigh * 1-2 0-0 0-0 1/5/6 2 2 0 0 1 0 212/10 at Bucknell * 4-8 0-0 0-1 4/4/8 1 8 1 2 1 1 282/13 COLGATE * 4-6 0-0 2-2 2/3/5 3 10 1 0 0 1 24

Nyanin’s Career HighsCategory .......................................................Career-HighPoints...........................................10 vs. Colgate (2/13/10)Rebounds ........................................13 vs. Lehigh (1/9/10)FG Made..................... 4, six times, last vs. Colgate (2/13/10)FG Atts ........................................9 vs. Lafayette (1/30/10)3 FG Made....................................................................... --3 FG Atts ......................................................................... --FT Made ............................................3 vs. Lehigh (1/9/10)FT Atts ...............................................4 vs. Lehigh (1/9/10)Assists ........................... 3 vs. St. Francis (Pa.) (12/29/09)Blocks .................... 1, eight times, last at Bucknell (2/10/10)Steals........................1, nine times, last vs. Colgate (2/13/10)Minutes ............................................33 vs. Lehigh (1/9/10)

ohemaa NYANIN, #00Senior • Center • 6-2

Accra, Ghana • Westtown School • Justice & Public Policy

62009-10 Game-by-Game

Page 25: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2525

2009-10 (Senior): Scored 14 points against Wagner while dishing out four assists (11/28) ... grabbed a career-high 10 rebounds in win at Brown (11/18) ... recorded game-high 16 points, including four-of-six

from three-point range, at Princeton (11/16).

2008-09 (Junior): Named team’s most valuable player … played in all 31 games, starting in the fi nal 26 contests … averaged 11.3 points and 2.1 rebounds per game … second on team with 349 points …set single-season school record with 87.8 free throw percentage (65-74) … currently holds career record for free throw percentage at 82.1 … owns two of six best single-season free throw shooting seasons in program history … converted 62 three-pointers, third highest single-season total in AU history … currently holds two of four highest single-season converted three-point fi eld goals in school history … 144 career three-pointers is currently tied for third in program history.

2007-08: Received a medical redshirt after suffering a season-ending injury.

2006-07 (Sophomore): Named to the Patriot League All-Tournament Team ... the only player to start in all 32 games played in the season ... averaged 11.6 points and 2.2 rebounds per game … second on the team in points with 372 on the season ... had an 81.8 free throw percentage...single-season free throw percentage was fi fth highest in AU history …61 three-pointers was third most in single-season in program history.

2005-06 (Freshman): Played in 17 games as a freshman, including eight starts ... tallied double-digit scoring in four games during the season.

High School: Earned four letters in basketball at Clearwater High School ... team captain from sophomore to senior year ... three-time member of the Pineallas All-County Team ... earned All-Suncoast Player of the Year and Pineallas County Player of the Year honors as a junior .. led her team in assists three consecutive years ... was a two-time Third Team All-State selection ... earned team MVP honors her fi rst three seasons ... named most outstanding athlete as a senior ... missed her senior season due to injury

Personal: Daughter of JoAnne and Tim Ryan ... both parents played basketball at Wilkes University ... has two brothers, Tim (23) and Tommy (17), and one sister, Veronica (14) ... graduated in May 2009 ... currently getting her Masters in psychology.

nicole RYAN, #10RS Senior • Guard • 5-7

Ocala, Fla. • Clearwater High School • Psychology

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2005-06 17 8 346 20.4 44 129 .341 21 62 .339 5 11 .455 14 21 35 2.1 27 0 17 22 2 23 114 6.72006-07 32 32 895 28.0 117 336 .348 61 184 .332 77 94 .819 23 47 70 2.2 60 0 32 64 5 51 372 11.62008-09 31 26 880 28.4 111 307 .362 62 183 .339 65 74 .878 14 51 65 2.1 33 0 40 38 5 34 349 11.32009-10 7 7 198 28.3 16 54 .296 9 31 .290 9 15 .600 2 15 17 2.4 8 0 16 17 2 6 50 7.1TOTAL 87 73 2319 26.7 288 826 .349 153 460 .335 156 194 .804 53 134 187 2.1 128 0 105 141 14 114 885 10.2

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard * 1-7 1-4 1-2 0/2/2 3 4 3 0 0 0 2611/16 at Princeton * 6-11 4-6 0-0 0/0/0 0 16 1 3 0 0 2711/18 at Brown * 1-8 0-5 0-1 2/8/10 0 2 3 2 0 2 3611/22 ECU * 4-8 1-3 2-2 0/0/0 3 11 2 3 0 0 3811/24 NJIT * 1-6 1-4 0-3 0/3/3 0 3 3 4 0 0 3011/28 at Wagner * 3-7 2-6 6-7 0/2/2 2 14 4 4 2 2 3512/2 at Drexel * 0-7 0-3 0-0 0/0/0 0 0 0 1 0 0 1212/6 HIGH POINT --DNP--12/16 MORGAN ST. --DNP--12/20 MARYLAND --DNP--12/28 vs. Buffalo --DNP--12/29 vs. St. Fran. (Pa) --DNP--1/2 at Columbia --DNP--1/4 UMES --DNP--1/9 LEHIGH --DNP--1/13 BUCKNELL --DNP--1/16 at Colgate --DNP--1/20 ARMY --DNP--1/24 at Holy Cross --DNP--1/27 at Navy --DNP--1/30 LAFAYETTE --DNP--2/6 at Lehigh --DNP--2/10 at Bucknell --DNP--2/13 COLGATE --DNP--

2009-10 Game-by-Game

Ryan’s Career HighsCategory .......................................................Career-HighPoints...................................................25 at Navy (3/3/07)Rebounds ......................................10 at Brown (11/18/09)FG Made...................................8 vs. Holy Cross (1/20/07)FG Atts ......... 18, four times, last vs. Holy Cross (2/17/07) 3 FG Made............... 5, three times, last at Navy (2/25/09)3 FG Atts ................................16 at Monmouth (12/22/06)FT Made ........................................9 vs. Drexel (12/30/06)FT Atts .........................................10 vs. Drexel (12/30/06)Assists ..................4, two times, last at Wagner (11/28/09)Blocks ........................................... 2 at Wagner (11/28/09)Steals......................5, three times, last vs. Navy (1/24/07)Minutes ............................................39 vs. Army (2/18/09)

Page 26: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2626

michelle KIRK, #5Junior • Forward/Guard • 6-0

Painted Post, N.Y. • Corning-Painted Post West • Communications

2009-10 (Junior): Has led team in scoring in 19 of 24 games this season ... scored at least 18 points in 15 games ... currently leads the Patriot League in scoring at 18.5 ppg ... named Patriot League Player of the Week fi ve times this season (11/30, 12/21, 1/11 and 1/18, 1/25) ... also recognized as ECAC Division

I Co-Player of the Week on 12/22 ... scored game-high 19 points in win at Bucknell (2/10) ... recorded 1,000th career point on a fi rst-half three-pointer in win over Lafayette (1/30) ... scored game-high 17 points in victory at Navy (1/27) ... recorded game-highs with 21 points and eight rebounds in win at Holy Cross (1/24) ... scored game-high 26 points, along with six rebounds, four assists and career-high-matching four steals, in victory at Colgate (1/16) ... recorded game-high 20 points, matching career-high with fi ve-three pointers, in win over Bucknell (1/13) ... scored a career-high 32 points on 10-21 shooting from the fl oor, including a career-best fi ve three-pointers and 7-7 from the free throw line in overtime win over Lehigh (1/9) ... also played all 45 minutes in Lehigh game, a career-high ... recorded 19 points, eight rebounds and three assists in victory over Maryland-Eastern Shore (1/4) ... notched a career-high four steals at Columbia (1/2) ... named to the Hatter Classic All-Tournament Team after averaging 17 ppg and 7 rpg against Buffalo (12/28) and St. Francis (Pa.) (12/29) ... also went 12-of-12 from the free throw line in victory over Buffalo, becoming ninth Eagle in program history to shoot perfect from the charity stripe in a single-game (minimum of 10 attempts) ... recorded a team-high 18 points on seven-of-14 shooting against Maryland (12/20) ... scored a game-high 20 points on eight-of-13 shooting in win over Morgan State (12/16) ... recorded a game-high 22 points along with seven rebounds in 40 minutes of action in victory over High Point (12/6) ... scored a game-high 25 points against Wagner, including a perfect three-of-three from three-point range ... scored a game-high 24 points and grabbed seven rebounds in victory over NJIT ... had a team-high 19 points against East Carolina (11/22) ... recorded career-high with 27 points and grabbed eight rebounds in win at Brown (11/18) ... scored 25 points on 10-of-20 shooting at Howard and added seven rebounds ... Preseason All-Patriot League selection.

2008-09 (Sophomore): Named All-Patriot League First Team … started all 30 games in which she appeared … led team in scoring 14.0 points per game … netted 419 total points … scored in double fi gures in 23 of 30 contests … shot 79.3 percent from the free throw line (88-111), good for 11th highest single-season percentage in school history … currently fi fth in program history in career free throw percentage (77.3) … earned fi rst-career double-double (18 points, 10 rebounds) versus Holy Cross (1/24) … earned second-ever double-double in following game with career-highs in points (27) and rebounds (11) versus Navy (1/28) … made career-high 12 fi eld goals in contest against Midshipmen … knocked home a career-high four three-pointers versus North Carolina State (11/23) … converted career-best nine free throws in 10 attempts at Lafayette (1/31) … had career-high fi ve assists in back-to-back contests, versus Columbia (1/4) and Brown (1/6) … set career-high in steals with three in contests versus Drexel (11/16) and Navy (2/25) … shot 85.7 percent from the fi eld (six of seven) in game versus Rhode Island (12/7) … played career-high 40 minutes against Army (2/18)

2007-08 (Freshman): Played in all 32 games as a freshman, making six starts ... started fi rst-career game at George Mason (12/19) ... scored a career-high 16 points against Navy (2/27) ... tallied double-digits in seven games ... played a career-high 32 minutes twice ... recorded a personal-best nine rebounds against Radford (12/22) ... named Patriot League Rookie of the Week (12/27) ... averaged 5.8 points and 2.6 rebounds per game.

High School: Earned four varsity letters at Corning-Painted Post West ... named the Twin Tiers Player of the Year in junior and senior seasons ... two-time Leader Player of the Year ... member of the Class AA All-State Team ... holds all-time scoring record at Corning-Painted Post West with 1,964 points ... also fi rst in school history in blocked shots with 293 ... holds single-game scoring record at high schol with 43 points ... eighth-leading scorer in N.Y. State, Section IV ... led her squad in winning the STAC Conference and the STAC-West Division title.

Personal: Daughter of Karen and Bruce Kirk ... has one brother, Chris (26) ... majoring in communications with a minor in psychology.

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2007-08 32 6 559 17.5 63 163 .387 13 38 .342 45 61 .738 27 55 82 2.6 42 0 25 46 6 18 184 5.82008-09 30 30 864 28.8 152 338 .450 27 88 .307 88 111 .793 41 125 166 5.5 47 0 43 53 6 23 419 14.02009-10 24 24 883 36.8 141 329 .429 49 129 .380 113 136 .831 33 86 119 5.0 29 0 42 48 12 28 444 18.5TOTAL 86 60 2306 26.8 356 830 .429 89 255 .349 246 308 .799 101 266 367 4.3 118 0 110 147 24 69 1047 12.2

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard * 10-20 2-6 3-5 2/5/7 1 25 3 2 1 2 3711/16 at Princeton * 3-8 2-4 0-2 0/6/6 1 8 3 2 0 0 3011/18 at Brown * 6-14 4-8 11-14 1/7/8 2 27 0 5 2 0 3811/22 ECU * 6-16 1-6 6-6 3/6/9 3 19 2 4 0 0 3811/24 NJIT * 8-14 2-5 6-7 3/4/7 1 24 0 1 1 1 3911/28 at Wagner * 10-18 3-3 2-2 2/2/4 3 25 1 3 1 0 3712/2 at Drexel * 5-11 0-3 3-4 3/1/4 2 13 1 5 2 0 3212/6 HIGH POINT * 6-15 2-5 8-9 2/5/7 0 22 1 0 1 1 4012/16 MORGAN ST. * 8-13 2-4 2-2 0/3/3 0 20 1 2 0 2 3312/20 MARYLAND * 7-14 3-6 1-2 1/2/3 1 18 1 1 0 2 3912/28 vs. Buffalo * 2-14 2-7 12-12 4/4/8 1 18 3 1 0 3 3912/29 vs. St. Fran (Pa) * 5-18 2-7 4-4 0/6/6 4 16 2 2 1 1 381/2 at Columbia * 4-11 0-2 4-5 0/1/1 3 12 2 0 1 4 371/4 UMES * 5-12 1-3 8-11 0/8/8 0 19 3 1 0 0 381/9 LEHIGH * 10-21 5-9 7-7 1/3/4 0 32 0 2 0 0 451/13 BUCKNELL * 7-16 5-8 1-2 4/1/5 1 20 2 2 0 1 341/16 at Colgate * 8-15 3-5 7-7 2/4/6 0 26 4 3 1 4 381/20 ARMY * 4-10 1-4 5-6 0/2/2 0 14 2 0 1 2 361/24 at Holy Cross * 5-10 3-7 8-10 1/7/8 1 21 0 1 1 1 401/27 at Navy * 7-16 1-4 2-2 1/2/3 0 17 3 1 0 1 371/30 LAFAYETTE * 3-11 2-8 1-2 3/2/5 0 9 1 1 1 1 352/6 at Lehigh * 3-9 0-4 0-0 2/1/3 3 6 2 5 0 0 372/10 at Bucknell * 5-13 1-6 8-11 0/2/2 1 19 3 2 0 2 352/13 COLGATE * 4-10 2-5 4-4 0/3/3 1 14 2 2 0 0 31

2009-10 Game-by-Game

Kirk’s Career HighsCategory .......................................................Career-HighPoints...............................................32 vs. Lehigh (1/9/10)Rebounds ........................................ 11 vs. Navy (1/28/09)FG Made.......................................... 12 vs. Navy (1/28/09)FG Atts ............................................ 22 vs. Navy (1/28/09)3 FG Made...........5, two times, last vs. Bucknell (1/13/10)3 FG Atts ...........................................9 vs. Lehigh (1/9/10)FT Made ..................................... 12 vs. Buffalo (12/28/09)FT Atts ...........................................14 at Brown (11/18/09)Assists ...................... 5, two times, last vs. Brown (1/6/09)Blocks .....................2, two times, last at Brown (11/18/09)Steals......................4, two times, last at Colgate (1/16/10)Minutes ............................................45 vs. Lehigh (1/9/10)

Page 27: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2727

2009-10 (Junior): Has scored in double fi gures in 20 out of 24 games this season ... scored career-high 27 points on 9-15 FG including 4-5 from three-point range, while registering game-highs with eight rebounds, fi ve assists and two blocks in victory over Colgate (2/13) ... recorded 16

points and fi ve rebounds in win at Bucknell (2/10) ... became school’s career blocked shots leader, surpassing Kirstin Keller’s 152, with fi ve blocks at Lehigh (2/6) ... also added game-high 13 points in Lehigh game ... recorded a game-high 15 points in win over Lafayette (1/30) ... scored game-high 17 points in victory at Navy (1/27), along with six rebounds and career-best-matching six blocked shots ... six blocks ties her own program record for single-game blocks ... contributed 15 points in win at Holy Cross (1/24) ... earned fi rst double-double of season (14 points and 13 rebounds) in win over Army (1/20) ... recorded 13 points, seven rebounds, three assists and three blocks in victory at Colgate (1/16) ... had 12 points and four blocked shots in win over Bucknell (1/13) ... recorded 12 points, seven rebounds, three blocks and three steals in win over Maryland-Eastern Shore (1/4) ... registered a team-high 17 points on eight-of-16 shooting, as well as fi ve rebounds, a career-high fi ve assists, three blocked shots and a career-best-matching three steals, at Columbia (1/2) ... scored 12 points in win over Buffalo (12/28) ... notched 11 points, fi ve rebounds, and three steals, including a career-high three made three-pointers against Maryland (12/20) ... scored 10 points and chipped in seven rebounds, including a career-high two three-pointers (on two attempts) in win over Morgan State (12/16) ... recorded 16 points, nine rebounds and a season-high four blocks in win over High Point (12/6) ... scored 10 points and had eight rebounds against Wagner (11/28) ... recorded 10 points, seven rebounds, four blocks and three assists in win over NJIIT (11/24) ... had 14 points on seven-of-nine shooting from the fl oor against East Carolina (11/22) ... notched a career-high 19 points and added eight rebounds and three blocks in win at Brown (11/18) ... matched career-best with 18 points in victory over Howard (11/13) ... also recorded eight rebounds and career-high four assists.

2008-09 (Sophomore): Appeared in all 31 games, starting the fi nal 26 … set single-season program record with 62 blocks … currently third in school history with 102 blocked shots … third on team with 11.1 points per game … led team with 5.5 rebounds per contest … shot 85.1 percent from the free throw line (40-47) … scored 18 points on three different occasions, matching career-high … recorded fi rst career double-double with 18 points and a career-high 14 rebounds at Morgan State (11/28) … accumulated career-high six blocked shots in Morgan State game, which matched single-game program record … had 12 points and 13 rebound effort against Georgetown (12/21) … shot 80 percent from the fi eld (eight for 10) in game versus Colgate (1/4) … was a perfect eight-for-eight from the free throw line at Lafayette (1/31) … named to Patriot League Academic Honor Roll for the fi rst time ... also recognized on Dean’s List.

2007-08 (Freshman): Played in all 32 games for the Eagles ... scored a career-high 18 points twice, against Morgan St. (12/6) and at Bucknell (2/13) ... had a season-best 10 rebounds against Radford (12/22) ... had fi ve blocks at Lehigh (2/9) ... played a season-high 31 minutes at Lafayette (3/1) ... was named to the Patriot League All-Rookie Team ... Named Patriot League Baden Rookie of the Week four times ... cracked into the program record books after blocking 40 shots, ranking sixth-best for a season ... shot 54.9 percent from the fi eld, good for 10th best in a season ... averaged 6.9 ppg and 5.1 rpg.

High School: Four-year for varsity letterwinner in basketball for Abington high school ... named First Team All-Area ... earned a spot on the First Team All-East Pennsylvania squad ... First Team All-League honors ... named Rookie of the Year ... also played volleyball ... was a member of the Varsity A Club ... member of the National Honor Society ... was an Abingtonian ... participated in the Spanish club ... also helped out with the CYO (Catholic Youth Organizations).

Personal: Daughter of Anne and John Leer ... father played basketball at

East Stroudsburg ... has one sister, Emily (17) ... Emily will be a freshman on Villanova’s basketball team ... majoring in public communications.

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2007-08 32 0 663 20.7 95 173 .549 0 3 .000 32 42 .762 69 95 164 5.1 80 2 31 76 40 15 222 6.92008-09 31 26 879 28.4 152 274 .555 0 2 .000 40 47 .851 68 104 172 5.5 83 3 37 78 62 28 344 11.12009-10 24 24 819 34.1 128 270 .474 19 42 .452 45 53 .849 50 93 143 6.0 62 0 40 98 57 18 320 13.3TOTAL 87 50 2361 27.1 375 717 .523 19 47 .404 117 142 .824 187 292 479 5.5 225 5 108 252 159 61 886 10.2

EaEaEaEaEaaaaaastststsstststssstststsssstttt S SSS S SSSSS SSS SSSSSSSSSSSSSSSSStrtrtrtrtrtrtrtrtrrttttrrtrtrttttrrrrrrtrtrtrtttrrrrrouououououoooououououououooououououououououuuoooooooouououuudsdsdddsdsdsddddsdsdsdsdsdsdssssdsdsdsdsddddsbubbbbububbbbb rg ... has one sister, Emily (17) ... Emily will be a a aaa frfrfrfrrfrfrrfrfrfrfrfrfrfrfrfrffffrfffresesesesesesseseseseseseseseesesessseseseseseseseseessssshmhmhmhmhmhmhmhmhmmhmhmhmhmmmhmhmhmhmhmhmhmhmhmhmhmhmhmmhhhhhhhmh anananananananananananananananaaaaaaoonononononnnnnnnonnoooo VVVVVVVVVVVVVVVVVVVVVV VVililiiilliliiiillllili allllaaaaalalalaaaaaaallalalaaalaaaaaalaaanonnnnnnoooonononnnnnnononnooooonoooooooooovavvvvvvvvaaaaaaaaavavaavvvvaaaaavvvvvv ’s’s’’s’s’s’’sssssssssssss bbbbbbbbbbbbbbbbbbbbbbbasaaaaaassaaaaa ketball team ... majoring in public communicicicccccccccatatatatatataatatataatatatatatatatatatttttaa ioioiooioiooooioioioioioioioioioioioioioooooiooooooonnnnnnnsssnsnsnsnsnsnnnnsnsnsnsnsnsnsnsnnsnsnsnsnssss..

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard * 8-13 1-1 1-1 1/7/8 1 18 4 5 1 0 3811/16 at Princeton * 3-6 0-0 0-0 0/3/3 4 6 0 7 0 0 2711/18 at Brown * 8-15 0-1 3-3 6/3/9 2 19 2 2 3 0 3511/22 ECU * 7-9 0-0 0-0 2/3/5 3 14 1 4 0 0 3611/24 NJIT * 4-9 0-0 2-2 2/5/7 3 10 3 2 4 1 3511/28 at Wagner * 3-8 0-0 4-5 4/4/8 4 10 1 3 1 0 2912/2 at Drexel * 3-6 1-1 2-3 2/5/7 3 9 1 6 0 1 3412/6 HIGH POINT * 5-13 0-0 6-7 4/5/9 2 16 1 5 4 1 3812/16 MORGAN ST. * 4-9 2-2 0-0 2/5/7 2 10 1 6 2 1 3612/20 MARYLAND * 4-14 3-7 0-0 3/2/5 2 11 1 4 1 3 3512/28 vs. Buffalo * 4-9 1-1 3-4 0/2/2 2 12 0 6 0 0 3912/29 vs. St. Fran (Pa) * 4-7 0-0 0-0 2/1/3 2 8 0 6 3 1 381/2 at Columbia * 8-16 0-1 1-2 0/5/5 2 17 5 5 3 3 401/4 UMES * 5-13 0-0 2-2 3/4/7 2 12 1 5 3 3 401/9 LEHIGH * 3-9 0-3 0-0 1/4/5 2 6 3 2 1 1 431/13 BUCKNELL * 5-14 0-1 2-2 1/2/3 2 12 0 2 4 2 381/16 at Colgate * 6-10 1-2 0-0 1/6/7 4 13 3 2 3 0 251/20 ARMY * 5-9 2-3 2-2 4/9/13 3 14 3 7 3 0 311/24 at Holy Cross * 6-15 0-2 3-4 2/2/4 2 15 2 1 2 0 291/27 at Navy * 6-13 1-2 4-4 2/4/6 4 17 2 4 6 0 241/30 LAFAYETTE * 6-10 1-3 2-2 2/0/2 4 15 0 3 1 0 292/6 at Lehigh * 5-12 2-7 1-1 2/3/5 3 13 1 5 5 0 332/10 at Bucknell * 7-16 0-0 2-3 2/3/5 1 16 0 3 3 1 372/13 COLGATE * 9-15 4-5 5-6 2/6/8 3 27 5 3 2 0 30

2009-10 Game-by-Game

Leer’s Career HighsCategory .......................................................Career-HighPoints...........................................27 vs. Colgate (2/13/10)Rebounds .......................... 14 at Morgan State (11/28/08)FG Made............... 9, two times, last vs. Colgate (2/13/10)FG Atts ................16, two times, last at Columbia (1/2/10) 3 FG Made.....................................4 vs. Colgate (2/13/10)3 FG Atts ...................................7 vs. Maryland (12/20/09)FT Made ....................................... 8 at Lafayette (1/31/09)FT Atts .......................................... 8 at Lafayette (1/31/09)Assists .................. 5, two times, last vs. Colgate (2/13/10)Blocks .................................. 6 at Morgan State (11/28/08)Steals......................... 3, six times, last vs. UMES (1/4/10)Minutes ............................................43 vs. Lehigh (1/9/10)

liz LEER, #22Junior • Center • 6-2

Glenside, Pa. • Abington • Public Communications

Page 28: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2828

2009-10 (Junior): Scored 11 points and grabbed a season-high three rebounds in win over Maryland-Eastern Shore (1/4) ... scored six points on two-of-three shooting from three-point range at Columbia (1/2) ... in fi rst

start of season, recorded career-highs with 15 points, fi ve assists, six made fi eld goals, three made three-pointers and 40 minutes played against St. Francis (Pa.) (12/29) ... scored a season-high fi ve points and recorded a career-best three steals against Maryland (12/20) ... tied a career-high with two steals in only six minutes of action in win over Morgan State (12/16) ... matched season-high output with four points and recorded season-bests with two rebounds and assists in victory over High Point (12/6) ... played 14 minutes at Princeton (11/16), scoring four points ... made appearance at Howard (11/13), scoring a bucket on only shot attempt.

2008-09 (Sophomore): Appeared in 28 games, making one start … made start against Holy Cross (1/24) … averaged 2.0 points per game … scored career-high 10 points versus Rhode Island (12/7) … was a perfect four-for-four from the fl oor, including two-for-two from three-point range, in contest against Rhode Island … set career-high with four assists on three different occasions, versus Columbia (1/4), at Lehigh (1/10) and against Lafayette (2/28).

2007-08 (Freshman): Played in 25 games, making one start ... made fi rst-career start against Fordham (12/9) ... scored a career-best eight points on two different occasions, against Monmouth (12/3) and at Colgate (1/19) ... played a career-high 28 minutes at Cleveland State (12/29) ... pulled down a season-best four rebounds at Drexel (12/31) ... dished out three assists at Cleveland State (12/29) ... averaged 3.2 ppg and 1.2 rpg.

High School: Four-year letter winner at Parkland ... senior co-captain ... averaged 13.3 ppg and fi nished as fourth leading scorer in school history with 1110 points ... set school 3-point record in a single season (50) and in a career (140) ... helped lead team to 2006 PIAA AAAA State Championship and 2005 and 2007 District XI Titles ... was the 2007 Parkland High School High School Outstanding Basketball Player of the Year ... selected to LVIAC All-Star team in 2006 and 2007 and Allentown Morning Call All-Area Team ... was a 2007 VIA Classic All-Star and Lehigh Valley Hoop Festival MVP ... 2006 Coatesville Tournament MVP ... played AAU for the Philadelphia Lady Runnin Rebels and fi nished in the sweet 16 at the 2006 AAU Nationals ... also lettered one year in track ... graduated with high honors and was a member of the National Honor Society as well as was a student tutor and participated in Leo Club.

Personal: Daughter of Cheryl and Gary Yencho ... has one sister, Kim (24) ... majoring in business administration with specialization in marketing.

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2007-08 25 1 302 12.1 26 78 .333 13 47 .277 16 26 .615 15 16 31 1.2 21 0 10 16 0 10 81 3.22008-09 28 1 241 8.6 21 64 .328 6 33 .182 8 10 .800 3 18 21 0.8 12 0 26 30 0 11 56 2.02009-10 22 3 327 14.9 30 66 .455 17 42 .405 12 16 .750 4 19 23 1.0 16 0 22 30 0 11 89 4.0TOTAL 75 5 870 11.6 77 208 .370 36 122 .295 36 52 .692 22 53 75 1.0 49 0 58 76 0 32 226 3.0

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard 1-1 0-0 0-0 0/0/0 0 2 0 1 0 0 211/16 at Princeton 1-2 0-0 2-4 0/0/0 1 4 0 1 0 0 1411/18 at Brown 1-1 1-1 0-0 0/0/0 1 3 0 1 0 0 911/22 ECU --DNP--11/24 NJIT 1-1 1-1 0-0 0/0/0 0 3 1 2 0 0 911/28 at Wagner 0-0 0-0 0-0 0/0/0 0 0 0 0 0 0 212/2 at Drexel 1-3 1-1 0-0 0/1/1 0 3 0 0 0 0 1312/6 HIGH POINT 1-3 0-1 2-2 0/2/2 0 4 2 4 0 0 1412/16 MORGAN ST. 0-0 0-0 2-2 0/0/0 0 2 1 2 0 2 612/20 MARYLAND 2-5 1-4 0-0 1/0/1 0 5 3 2 0 1 1112/28 vs. Buffalo 1-3 1-2 0-0 0/0/0 0 3 0 2 0 0 1312/29 vs. St. Fran (Pa) * 6-9 3-6 0-0 0/1/1 2 15 5 7 0 2 401/2 at Columbia * 2-3 2-3 0-0 0/1/1 1 6 1 1 0 1 281/4 UMES * 4-9 2-6 1-1 0/3/3 2 11 1 2 0 1 341/9 LEHIGH --DNP--1/13 BUCKNELL 1-1 0-0 0-0 0/1/1 1 2 1 0 0 0 81/16 at Colgate 1-4 1-4 0-0 1/0/1 1 3 1 0 0 0 141/20 ARMY 2-2 2-2 0-0 1/1/2 0 6 0 1 0 0 71/24 at Holy Cross 1-5 1-5 0-0 0/0/0 0 3 1 1 0 1 171/27 at Navy 0-3 0-0 0-0 0/3/3 1 0 2 0 0 1 281/30 LAFAYETTE 2-4 0-1 2-3 0/1/1 3 6 0 0 0 1 192/6 at Lehigh 1-4 0-2 2-2 1/1/2 1 4 0 1 0 0 152/10 at Bucknell 0-0 0-0 0-0 0/3/3 1 0 1 2 0 0 132/13 COLGATE 1-3 1-3 1-2 0/1/1 1 4 2 0 0 1 25

2009-10 Game-by-Game

Yencho’s Career HighsCategory .......................................................Career-HighPoints........................... 15 vs. St. Francis (Pa.) (12/29/09)Rebounds ........................................4 at Drexel (12/31/07)FG Made........................ 6 vs. St. Francis (Pa.) (12/29/09)FG Atts .......................... 9 vs. St. Francis (Pa.) (12/29/09) 3 FG Made..................... 3 vs. St. Francis (Pa.) (12/29/09)3 FG Atts ..................6, three times, last vs. UMES (1/4/10)FT Made ......4, two times, last at Cleveland St. (12/29/07)FT Atts ................................. 5 at Cleveland St. (12/29/07)Assists ........................... 5 vs. St. Francis (Pa.) (12/29/09)Blocks .............................................................................. --Steals.........................................3 vs. Maryland (12/20/09)Minutes ........................ 40 vs. St. Francis (Pa.) (12/29/09)

ashley YENCHO, #13Junior • Guard • 5-7

Schnecksville, Pa. • Parkland • Business Administration

Page 29: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances2929

2009-10 (Sophomore): Registered game-high fi ve steals in victory vs. Colgate (2/13) ... scored team-high 14 points in win over Army (1/20) ... grabbed career-high eight rebounds while adding 10

points, fi ve assists and four steals in victory at Colgate (1/16) ... scored nine points and recorded career-highs with seven rebounds, six assists and 43 minutes played in overtime win over Lehigh (1/9) ... matched career-best with six rebounds and added nine points on three trifectas in win over Maryland-Eastern Shore (1/4) ... recorded eight points and three rebounds in a career-high 35 minutes at Columbia (1/2) ... tied career-bests with 11 points, six rebounds and three made three-pointers in a career-high 33 minutes vs. St. Francis (Pa.) (12/29) ... matched a career-best with six rebounds and chipped in seven points in a career-high 30 minutes of action in win over Morgan State (12/16) ... scored a season-high eight points in win over High Point (12/6) ... recorded a career-high six steals versus Wagner (11/28) ... had three steals against East Carolina (11/22) ... made fi rst-career start, logging career-high 29 minutes, in win at Brown (11/18) ... played 14 minutes at Howard (11/13), recording fi ve points.

2008-09 (Freshman): Named to Patriot League All-Rookie Team … shot 44.2 percent (23-52) from three-point range, setting single-season school record … appeared in 30 games … sixth on team with 4.2 points per game … averaged 1.9 rebounds per contest … scored a career-best 11 points against Howard (11/19) … grabbed six rebounds against Lafayette (2/28) … recorded lone blocked shot versus Columbia (1/4) … converted four fi eld goals on two different occasions (both times out of six total attempts), versus Howard (11/19) and against Bucknell (2/11) … netted three three-pointers (in four attempts each game) against Howard (11/19) and versus Columbia (1/4) … named to Patriot League Academic Honor Roll.

High School: A four-year letterwinner in basketball at Bishop McNamara ... was captain as senior ... named Student-Athlete of the Year ... team was WCAC Champions senior year ... was a two-time WCAC Honorable Mention selection ... named to Third Team WCAC as a senior ... averaged 14.0 ppg, 6.0 spg 4.0 rpg and 5.0 assists as a senior ... also lettered one year in soccer ... had a 4.1 GPA as a senior ... member of the National Honor Society ... played in the wind ensemble as a junior and a senior, the symphonic band as a sophomore and concert band as a freshman.

Personal: Daughter of Alfreda Kelly ... has one sister, Monet (16) ... majoring in elementary education with a minor in health promotion.

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2008-09 30 0 368 12.3 48 96 .500 23 52 .442 8 11 .727 19 39 58 1.9 41 0 18 25 1 30 127 4.22009-10 24 19 610 25.4 39 120 .325 21 63 .333 19 24 .792 25 54 79 3.3 48 0 42 22 2 43 118 4.9TOTAL 54 19 978 18.1 87 216 .403 44 115 .383 27 35 .771 44 93 137 2.5 89 0 60 47 3 73 245 4.5

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard 2-4 1-3 0-0 1/0/1 0 5 2 0 0 1 1411/16 at Princeton 0-0 0-0 0-0 0/3/3 0 0 0 1 0 1 1211/18 at Brown * 1-6 0-3 0-0 0/1/1 2 2 1 0 0 2 2911/22 ECU * 2-4 0-1 2-2 1/1/2 1 6 1 1 0 3 22 11/24 NJIT * 1-2 1-1 0-2 0/1/1 3 3 3 1 0 0 2011/28 at Wagner * 1-2 0-0 0-0 0/3/3 4 2 1 3 0 6 2512/2 at Drexel * 1-1 0-0 1-1 0/1/1 1 3 0 0 0 1 1612/6 HIGH POINT * 3-5 1-2 1-2 0/1/1 3 8 0 0 0 1 2112/16 MORGAN ST. * 2-7 1-2 2-2 1/5/6 3 7 2 1 0 3 3012/20 MARYLAND * 1-4 1-3 0-0 0/1/1 4 3 0 0 0 1 1912/28 vs. Buffalo * 2-4 1-1 0-0 0/1/1 3 5 0 0 0 1 2612/29 vs. St. Fran (Pa) * 3-5 3-4 2-2 3/3/6 4 11 2 2 0 1 331/2 at Columbia * 3-8 2-5 0-0 0/3/3 4 8 1 3 0 2 351/4 UMES * 3-7 3-7 0-0 0/6/6 1 9 1 2 0 2 361/9 LEHIGH * 2-10 1-5 4-5 2/5/7 2 9 6 0 0 1 431/13 BUCKNELL * 2-7 2-3 0-0 1/0/1 2 6 3 1 0 2 281/16 at Colgate * 3-6 2-3 2-2 2/6/8 1 10 5 1 0 4 271/20 ARMY * 5-11 2-6 2-2 1/0/1 1 14 1 0 0 1 321/24 at Holy Cross * 1-5 0-4 1-2 5/2/7 3 3 3 1 0 0 341/27 at Navy * 0-7 0-2 0-0 3/2/5 1 0 2 0 0 0 221/30 LAFAYETTE * 0-5 0-5 0-0 1/5/6 2 0 4 1 0 3 232/6 at Lehigh 1-5 0-1 0-0 2/3/5 2 2 1 2 0 1 162/10 at Bucknell 0-4 0-1 0-0 2/0/2 0 0 0 0 2 1 222/13 COLGATE 0-1 0-1 2-2 0/1/1 1 2 3 2 0 5 25

2009-10 Game-by-Game

Edwards’ Career HighsCategory .......................................................Career-HighPoints............................................... 14 vs. Army (1/20/10)Rebounds ........................................8 at Colgate (1/16/10)FG Made............................................ 5 vs. Army (1/20/10)FG Atts ............................................ 11 vs. Army (1/20/10)3 FG Made................3, four times, last vs. UMES (1/4/10)3 FG Atts .............................................7 vs. UMES (1/4/10)FT Made ............................................4 vs. Lehigh (1/9/10)FT Atts ...............................................5 vs. Lehigh (1/9/10)Assists ...............................................6 vs. Lehigh (1/9/10)Blocks ............................................ 2 at Bucknell (2/10/10) Steals.............................................6 at Wagner (11/28/09)Minutes ............................................43 vs. Lehigh (1/9/10)

ebony EDWARDS, #12Sophomore • Guard • 5-8

Forestville, Md. • Bishop McNamara • Elementary Education

Page 30: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances3030

2009-10 (Sophomore): Registered eight points, four assists, four steals and three rebounds in victory vs. Colgate (2/13) ... recorded six points, four rebounds, three steals and two assists in win at Bucknell

(2/10) ... had seven points and fi ve assists at Lehigh (2/6) ... Recorded career-high 15 points and added three rebounds, three assists and three steals in win at Holy Cross (1/24) ... scored eight points on career-high two made three-pointers and also had fi ve assists in win over Army (1/20) ... matched career-high with six assists while contributing six points and four steals in victory at Colgate (1/16) ... Scored career-best-matching 10 points, dished out fi ve assists and had four steals in win over Bucknell (1/13) ... recorded nine points, four assists, four rebounds and four steals in a career-high 42 minutes in overtime win versus Lehigh (1/9) ... notched a career-best fi ve steals at Columbia (1/2) ... recorded a career-high with 10 points and matched career best with four steals in win over Buffalo (12/28) ... matched a career-high with four rebounds and chipped in seven points and fi ve assists against Maryland (12/20) ... tied career-bests in points (eight) and assists (six) in career-high 37 minutes of action in victory over Morgan State (12/16) ... matched a career-best with six assists in a career-high 37 minutes in win over High Point (12/6) ... dished out a season-high fi ve assists in games against NJIT (11/24) and Wagner (11/28) ... recorded season-high four assists at Princeton (11/16) ... made fi rst-career start at Howard (11/13) and scored six points.

2008-09 (Freshman): Played in 22 games … averaged 2.9 points and 1.6 rebounds per contest … scored eight points at Maryland-Eastern Shore (12/2) … dished out six assists and grabbed four rebounds versus Holy Cross (1/24), playing a season-high 28 minutes … recorded a blocked shot versus Princeton (12/19) … had three steals in games at Minnesota (11/22) and against Rhode Island (12/7).

High School: A four-year letterwinner at Princess Anne High School ... a McDonald’s All-American nominee ... was a named a team captain as a junior and a senior ... was team most valuable player and second team all-state in 2008 ... named to First Team Beach District as a junior and senior ... Second Team Beach District as a sophomore ... scored over 1,000 career points ... team was state champions in 2004 and district champions 2004-08 ... squad was ranked ninth in the nation in USA TODAY in 2005 ... regional champions in 2004-05 ... named Ms. Princess Anne ... averaged 19 points, six assists and three steals per game in senior season ... graduated with honors.

Personal: Daughter of Michelle and Robert Harris ... has one brother, Robert Jr. (20) ... majoring in public communications.

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2008-09 22 0 232 10.5 20 73 .274 4 21 .190 19 28 .679 10 25 35 1.6 28 0 37 40 1 18 63 2.92009-10 23 16 658 28.6 48 138 .348 8 35 .229 31 42 .738 6 47 53 2.3 42 0 82 56 1 53 135 5.9TOTAL 45 16 890 19.8 68 211 .322 12 56 .214 50 70 .714 16 72 88 2.0 70 0 119 96 2 71 198 4.4

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard * 2-4 0-0 2-2 0/3/3 2 6 1 2 0 0 2211/16 at Princeton * 1-5 0-1 0-0 0/3/3 3 2 4 5 0 2 2711/18 at Brown 0-2 0-1 0-0 0/1/1 0 0 1 0 0 0 411/22 ECU 1-4 0-1 0-0 0/0/0 2 2 4 3 0 0 1611/24 NJIT 2-3 0-0 0-1 0/2/2 2 4 5 1 0 1 1711/28 at Wagner 0-3 0-1 0-0 0/2/2 1 0 5 1 0 2 1512/2 at Drexel 1-7 0-2 2-4 0/3/3 4 4 3 1 0 4 2912/6 HIGH POINT * 1-6 0-2 1-2 0/3/3 3 3 6 3 0 1 3712/16 MORGAN ST. * 3-5 0-1 2-3 0/3/3 2 8 6 4 0 2 3412/20 MARYLAND * 3-9 0-2 1-1 0/4/4 1 7 5 1 0 3 3412/28 vs. Buffalo * 2-4 0-0 6-8 0/2/2 1 10 0 1 0 4 3212/29 vs. St. Fran. (Pa) --DNP--1/2 at Columbia 2-5 0-1 0-0 1/1/2 2 4 3 6 0 5 291/4 UMES 1-3 0-1 2-2 0/0/0 2 4 3 3 0 0 191/9 LEHIGH * 4-10 1-4 0-1 2/2/4 4 9 4 6 0 4 421/13 BUCKNELL * 3-8 1-2 3-3 1/1/2 0 10 5 4 0 4 351/16 at Colgate * 3-6 0-1 0-0 1/0/1 1 6 6 1 0 4 311/20 ARMY * 3-7 2-2 0-2 1/2/3 1 8 5 5 0 2 331/24 at Holy Cross * 5-8 2-3 3-3 0/3/3 1 15 3 3 1 3 381/27 at Navy * 1-6 1-2 2-2 0/1/1 1 5 1 1 0 3 341/30 LAFAYETTE * 2-8 0-1 3-4 0/3/3 1 7 1 1 0 2 342/6 at Lehigh * 3-13 1-4 0-0 0/1/1 4 7 5 0 0 0 312/10 at Bucknell * 2-6 0-2 2-2 0/4/4 3 6 2 1 0 3 312/13 COLGATE * 3-6 0-1 2-2 0/3/3 1 8 4 3 0 4 34

2009-10 Game-by-Game

Harris’ Career HighsCategory .......................................................Career-HighPoints....................................... 15 at Holy Cross (1/24/10)Rebounds .............. 4, three times, last vs. Lehigh (1/9/10)FG Made.................................... 5 at Holy Cross (1/24/10)FG Atts ............................................. 13 at Lehigh (2/6/10)3 FG Made.........................................2 vs. Army (1/20/10)3 FG Atts ................... 4, two times, last at Lehigh (2/6/10)FT Made ....................................... 6 vs. Buffalo (12/28/09)FT Atts .......................................... 8 vs. Buffalo (12/28/09)Assists ................... 6, four times, last at Colgate (1/16/10)Blocks ................1, two times, last at Holy Cross (1/24/10)Steals..............................................5 at Columbia (1/2/10)Minutes ............................................42 vs. Lehigh (1/9/10)

raven HARRIS, #23Sophomore • Guard • 5-7

Virginia Beach, Va. • Princess Anne • Public Communications

Page 31: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances3131

2009-10 (Sophomore): Recorded career-high six points on three-of-four shooting along with three rebounds in victory at Navy (1/27) ... Scored two points and grabbed two rebounds against St. Francis

(Pa.) (12/29) ... recorded four points and fi ve rebounds in 17 minutes at Princeton (11/16) .. played 10 minutes in season-opener at Howard (11/13).

2008-09 (Freshman): Played in 17 games … averaged 1.3 points and 1.2 rebounds per contest … scored six points on season-best three made fi eld goals against Bucknell (1/14) … also played season-high 19 minutes against the Bison … recorded blocked shot against NJIT (11/14) … grabbed three rebounds in games versus NJIT (11/14), Cleveland State (11/30), Bucknell (1/14) and Colgate (1/17) … recorded two steals against Navy (1/28).

High School: Earned four varsity letters in basketball at Notre Dame Academy ... team ranked in the top-5 in the nation two-straight years ... ranked No. 1 in the nation over the 2007-08 season ... went undefeated in the D.C. Metro from 2006-08 ... won WCAC Tournament at Bishop Walsh two years in a row.

Personal: Daughter of Melissa and William McDonald ... has a twin, Jason (18), along with two other siblings, Brian (15) and Moriah (7) ... majoring in psychology.

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2008-09 17 0 90 5.3 10 24 .417 0 0 .000 2 4 .500 7 14 21 1.2 12 0 2 3 1 4 22 1.32009-10 19 0 108 5.7 11 25 .440 0 0 .000 1 2 .500 6 15 21 1.1 16 0 2 14 1 2 23 1.2TOTAL 36 0 198 5.5 21 49 .429 0 0 .000 3 6 .500 13 29 42 1.2 28 0 4 17 2 6 45 1.3

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard 0-2 0-0 0-1 0/0/0 4 0 1 1 0 1 1011/16 at Princeton 2-6 0-0 0-0 2/3/5 3 4 0 2 1 0 1711/18 at Brown 1-1 0-0 0-0 1/1/2 0 2 0 1 0 0 511/22 ECU 1-1 0-0 0-0 0/0/0 0 2 0 1 0 0 511/24 NJIT 1-2 0-0 0-0 0/1/1 0 2 0 1 0 0 811/28 at Wagner --DNP--12/2 at Drexel 0-0 0-0 0-0 0/0/0 0 0 0 0 0 0 412/6 HIGH POINT 0-0 0-0 0-0 0/1/1 2 0 0 0 0 0 112/16 MORGAN ST. 0-0 0-0 0-0 0/0/0 0 0 0 0 0 0 112/20 MARYLAND --DNP--12/28 vs. Buffalo 0-0 0-0 0-0 1/0/1 1 0 0 0 0 0 112/29 vs. St. Fran. (Pa) 1-2 0-0 0-0 1/1/2 1 2 0 5 0 0 111/2 at Columbia 0-0 0-0 0-0 0/1/1 0 0 0 1 0 0 31/4 UMES --DNP-- 1/9 LEHIGH 1-3 0-0 0-0 1/0/1 0 2 1 0 0 0 61/13 BUCKNELL --DNP--1/16 at Colgate 1-1 0-0 0-0 0/1/1 1 2 0 0 0 0 31/20 ARMY 0-0 0-0 0-0 0/1/1 2 0 0 0 0 0 51/24 at Holy Cross 0-0 0-0 0-0 0/0/0 0 0 0 0 0 0 0+1/27 at Navy 3-4 0-0 0-0 0/3/3 2 6 0 0 0 0 91/30 LAFAYETTE 0-1 0-0 0-0 0/0/0 0 0 0 0 0 0 72/6 at Lehigh 0-0 0-0 0-0 0/0/0 0 0 0 2 0 0 42/10 at Bucknell --DNP--2/13 COLGATE 0-1 0-0 1-2 0/2/2 0 1 0 0 0 1 8

2009-10 Game-by-Game

McDonald’s Career HighsCategory .......................................................Career-HighPoints..........................6, two times, last at Navy (1/27/10)Rebounds .............3, four times, last vs. Colgate (1/17/09)FG Made.....................3, two times, last at Navy (1/27/10)FG Atts .......................................... 7 at Bucknell (1/14/09)3 FG Made....................................................................... --3 FG Atts ......................................................................... --FT Made ............................................ 2 at NJIT (11/14/08)FT Atts ..................... 2, two times, last at Lehigh (1/10/09)Assists ................2, two times, last vs. Lafayette (2/28/09)Blocks ................1, two times, last at Princeton (11/16/09)Steals................................................. 2 vs. Navy (1/28/09)Minutes ........................................ 19 at Bucknell (1/14/09)

janelle McDONALD, #42Sophomore • Forward • 6-1

Ashburn, Va. • Notre Dame Academy • Psychology

Page 32: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances3232

2009-10 (Sophomore): Registered 14 points on 6-8 FG in victory over Colgate (2/13) ... scored nine points and grabbed six rebounds at Lehigh (2/6) ... Recorded career-best 15 points on six-of-nine shooting,

matched career-high with eight rebounds and added four assists in win at Navy (1/27) ... scored nine points and grabbed three rebounds in victory at Colgate (1/16) ... recorded six points, three rebounds, two assists, two steals and a career-high two blocked shots in win over Buffalo (12/28) ... scored a career-best 14 points on a career-high six made fi eld goals against Maryland (12/20) ... matched a career-high with eight rebounds in victory against Morgan State (12/16) ... recorded career-highs with 12 points and four steals in win over High Point (12/6) ... went six-for-six from the free throw line with 10 points against Wagner (11/28) ... made fi rst start of season and recorded career-highs with 11 points and seven rebounds in victory against NJIT (11/24) ... played a career-high 31 minutes in win at Brown ... had fi ve points and four boards at Princeton (11/16) ... recorded three points, three rebounds and three assists in season-opener at Howard (11/13).

2008-09 (Freshman): Named to Patriot League All-Rookie Team … played in all 31 games, including six starts … played 13.2 minutes per game, the sixth-most on team … averaged 3.2 points and 1.9 rebounds per contest … recorded eight assists versus Howard (11/19) … netted career-high nine points against Lafayette (2/28) … pulled down fi ve rebounds versus Holy Cross (1/24) … accumulated three steals against Columbia (1/4) … named to Patriot League Academic Honor Roll.

High School: Earned four letters in basketball at Archbishop Wood High School ... captain as a senior ... team was 2007-08 North PCL Champions and 2007 PCL Runner-up ... earned 2007 Jim Paul Memorial Heart & Hustle Award ... two-time Philadelphia Catholic League Scholar Athlete ... All-Philadelphia Catholic League and First Team Bucks County Courier Times All-Area Team in 2007 and 2008 ... two-time All-Intel Girls Team ... averaged 10.4 ppg, 4.0 rpg, 2.7 apg and 2.5 spg ... was a 2007 AAU quarterfi nalist at nationals and semifi nalist at USJN ... semifi nalist at Nike Nationals. .. also played two years on varsity soccer team ... member of National Honor Society.

Personal: Daughter of Joanne and Ron Strack ... has one brother, Daniel (21) ... majoring in business administration.

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2008-09 31 6 410 13.2 32 101 .317 7 38 .184 27 51 .529 28 30 58 1.9 37 0 35 27 5 30 98 3.22009-10 20 4 490 24.5 52 121 .430 8 39 .205 32 40 .800 42 47 89 4.5 38 1 34 30 4 23 144 7.2TOTAL 51 10 900 17.6 84 222 .378 15 77 .195 59 91 .648 70 77 147 2.9 75 1 69 57 9 53 242 4.7

Date Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard 1-3 1-1 0-0 2/1/3 2 3 3 0 0 2 2111/16 at Princeton 2-4 1-1 0-0 3/1/4 2 5 1 2 0 1 2311/18 at Brown 0-4 0-2 3-4 2/2/4 1 3 2 0 0 1 3111/22 ECU 0-2 0-0 2-2 1/1/2 0 2 0 1 0 0 1311/24 NJIT * 4-6 1-2 2-3 4/3/7 3 11 0 4 0 0 2511/28 at Wagner 2-4 0-1 6-6 1/3/4 2 10 1 0 0 0 2712/2 at Drexel 2-7 0-2 0-0 3/5/8 1 4 1 2 1 1 1812/6 HIGH POINT 4-7 0-1 4-6 4/3/7 5 12 3 2 0 4 2612/16 MORGAN ST. 2-8 0-3 0-0 3/5/8 2 4 2 4 0 0 3012/20 MARYLAND 6-11 0-4 2-4 0/1/1 1 14 2 1 0 3 2812/28 vs. Buffalo 1-5 0-2 4-4 1/2/3 3 6 2 2 2 2 2712/29 vs. St. Fran. (Pa) --DNP--1/2 at Columbia --DNP--1/4 UMES --DNP--1/9 LEHIGH --DNP--1/13 BUCKNELL 1-4 0-2 4-5 1/1/2 0 6 2 0 0 1 201/16 at Colgate 4-8 1-2 0-0 2/1/3 1 9 0 1 0 1 221/20 ARMY 1-5 0-0 0-0 2/3/5 1 2 1 4 0 0 171/24 at Holy Cross 2-6 1-3 0-0 2/2/4 2 5 2 0 0 0 211/27 at Navy 6-9 1-2 2-2 3/5/8 2 15 4 2 0 2 341/30 LAFAYETTE 3-8 0-4 2-3 2/3/5 2 8 3 0 0 0 302/6 at Lehigh * 4-9 1-4 0-0 4/2/6 3 9 1 4 1 2 282/10 at Bucknell * 1-3 0-1 0-0 0/1/1 1 2 2 0 0 1 282/13 COLGATE * 6-8 1-2 1-1 2/2/4 4 14 2 1 0 2 27

2009-10 Game-by-Game

Strack’s Career HighsCategory .......................................................Career-HighPoints.................................................15 at Navy (1/27/10)Rebounds ................ 8, three times, last at Navy (1/27/10)FG Made.............6, three times, last vs. Colgate (1/13/10)FG Atts ....................................11 vs. Maryland (12/20/09) 3 FG Made..............1, 14 times, last vs. Colgate (2/13/10)3 FG Atts ................... 4, two times, last at Lehigh (2/6/10)FT Made ........................................6 at Wagner (11/28/09)FT Atts ..............6, two times, last vs. High Point (12/6/09)Assists ......................................... 8 vs. Howard (11/19/08)Blocks ........................................... 2 vs. Buffalo (12/28/09)Steals.........................................4 vs. High Point (12/6/09)Minutes ..............................................34 at Navy (1/27/10)

lisa STRACK, #15Sophomore • Guard • 5-10

Langhorne, Pa • Archbishop Wood • Business Administration

Page 33: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances3333

2009-10 (Freshman): Recorded three points, fi ve rebounds and two steals at Lehigh (2/6) ... grabbed six rebounds in win versus Lehigh (1/9) ... scored a career-best four points on two-of-

three shooting at Columbia (1/2) ... grabbed a team-high seven rebounds and had career-best-matching two steals against St. Francis (Pa.) (12/29) ... recorded a career-high three points, seven rebounds, and two steals against Wagner (11/28) ... played a career-high 15 minutes against East Carolina, recording fi rst career rebounds (three) and an assist ... scored fi rst-career fi eld goal in win at Brown (11/18) ... recorded fi rst-career fi eld goal attempt at Princeton (11/16) ... made fi rst-career appearance at Howard (11/13), logging fi ve minutes of action.

High School: Played four years of varsity basketball at the Academy of the Holy Cross … served as captain last two seasons … averaged 11.3 points and 10 rebounds per game in senior season … named All-Washington Catholic Athletic Conference (WCAC) Second Team in 2007 and 2009 … also earned All-Gazette Honorable Mention in those seasons … led high school team to 2007 WCAC Championship … graduated high school with a 3.62 GPA, earning both fi rst and second honors.

Personal: Daughter of MaryAnne and Ben Anya ... has three siblings, Beejay (14), Renee (10) and Brooke (7) ... plans on majoring in biology with a minor in chemistry.

stephanie ANYA, #44Freshman • Center • 6-2

Germantown, Md. • The Academy of the Holy Cross • Biology

Anya’s Career HighsCategory .......................................................Career-HighPoints...................4, two times, last vs. Bucknell (1/13/10)Rebounds .. 7, two times, last vs. St. Francis (Pa.) (12/29/09)FG Made..............2, two times, last vs. Bucknell (1/13/10)FG Atts .......................5, six times, last vs. Army (1/20/10)3 FG Made....................................................................... --3 FG Atts ......................................................................... --FT Made ............... 2, two times, last vs. Colgate (2/13/10)FT Atts ................................4 vs. Morgan State (12/16/09)Assists ...1, two times, last vs. St. Francis (Pa.) (12/29/09)Blocks .....................1, six times, last at Bucknell (2/10/10)Steals.......................2, three times, last at Lehigh (2/6/10)Minutes .................18, two times, last at Colgate (1/16/10)

2009-10 Game-by-GameDate Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard 0-0 0-0 0-1 0/0/0 1 0 0 0 0 0 511/16 at Princeton 0-1 0-0 0-0 0/0/0 0 0 0 0 0 0 411/18 at Brown 1-2 0-0 0-0 0/0/0 1 2 0 0 0 0 311/22 ECU 0-1 0-0 1-2 0/3/3 3 1 1 2 0 0 1511/24 NJIT 0-0 0-0 0-0 0/0/0 0 0 0 0 0 0 211/28 at Wagner 1-5 0-0 1-3 2/5/7 2 3 0 0 1 2 1412/2 at Drexel 1-5 0-0 0-0 0/3/3 3 2 0 2 1 0 1812/6 HIGH POINT 0-1 0-0 0-0 2/1/3 1 0 0 1 0 0 1012/16 MORGAN ST. 0-1 0-0 1-4 1/2/3 0 1 0 1 1 0 1412/20 MARYLAND 1-3 0-0 0-0 1/0/1 4 2 0 0 0 0 1412/28 vs. Buffalo 0-0 0-0 0-0 0/4/4 2 0 0 2 1 1 1212/29 vs. St. Fran. (Pa) 0-1 0-0 2-2 3/4/7 0 2 1 1 0 2 191/2 at Columbia 2-3 0-0 0-0 0/1/1 1 4 0 0 0 0 131/4 UMES 0-10 0-0 0-0 0/2/2 1 0 0 1 0 0 101/9 LEHIGH 1-5 0-0 0-0 1/5/6 1 2 0 0 0 0 131/13 BUCKNELL 2-5 0-0 0-0 0/2/2 1 4 0 1 0 0 171/16 at Colgate 1-5 0-0 0-2 1/3/4 2 2 0 1 0 0 181/20 ARMY 1-5 0-0 0-0 4/1/5 4 2 0 2 0 1 171/24 at Holy Cross 0-1 0-0 0-0 0/0/0 1 0 0 0 0 1 31/27 at Navy --DNP--1/30 LAFAYETTE 0-0 0-0 0-0 0/0/0 1 0 0 1 0 0 12/6 at Lehigh 1-3 0-0 1-2 2/3/5 1 3 0 1 1 2 152/10 at Bucknell 1-2 0-0 0-0 0/1/1 2 2 0 1 1 0 122/13 COLGATE 0-2 0-0 2-2 0/5/5 1 2 0 0 0 0 10

Total 3-point ReboundsYear GP GS Min Avg FG FGA Pct FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO Ast TO Blk Stl Pts Avg2009-10 23 0 259 11.3 13 52 .250 0 0 .000 8 18 .444 17 45 62 2.7 33 0 2 17 6 9 34 1.5TOTAL 23 0 259 11.3 13 52 .250 0 0 .000 8 18 .444 17 45 62 2.7 33 0 2 17 6 9 34 1.5

Page 34: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances3434

High School: Competed in basketball program at Christ the King Regional High School, earning varsity letters in each of the last three seasons … served as team captain in senior season … recognized

as New York Daily News Second Team … named most improved player after sophomore campaign … team captured New York City Championship in 2006, 07 and 09 … competed in three straight Las Vegas Classics with AAU team, Positive Direction Lady Wildcats … team reached fi nals in 2006 … accumulated a 3.94 GPA, earning First Honors in math and Second Honors in English … named to Principals Honor Roll … member of National Honor Society.

Personal: Daughter of Yonette and Rodwick George ... has one sibling, Ginnelle (14) ... plans on majoring in psychology.

geleisa GEORGE, #4Freshman • Guard • 5-9

Jamaica, N.Y. • Christ the King Regional • Psychology

nnt

2009-10 Game-by-GameDate Opponent S FG 3P FT-A O/D/T PF TP A TO B S M11/13 at Howard --DNP--11/16 at Princeton --DNP-- 11/18 at Brown --DNP-- 11/22 ECU --DNP--11/24 NJIT --DNP--11/28 at Wagner --DNP--12/2 at Drexel --DNP--12/6 HIGH POINT --DNP--12/16 MORGAN ST. --DNP--12/20 MARYLAND --DNP--12/28 vs. Buffalo --DNP--12/29 vs. St. Fran. (Pa) --DNP--1/2 at Columbia --DNP--1/4 UMES --DNP--1/9 LEHIGH --DNP--1/13 BUCKNELL --DNP--1/16 at Colgate --DNP--1/20 ARMY --DNP--1/24 at Holy Cross --DNP--1/27 at Navy --DNP--1/30 LAFAYETTE --DNP--2/6 at Lehigh --DNP--2/10 at Bucknell --DNP--2/13 COLGATE --DNP--

Page 35: Women's Basketball 2009-10 Game Notes - at Army

American University Women’s BasketballAmerican University Women’s Basketball

Back-to-Back Postseason AppearancesBack-to-Back Postseason Appearances3535

Ohemma Nyanin Sr • C • 6-2

Accra, Ghana

Geleisa George Fr • G • 5-9

Jamaica, N.Y.

Michelle Kirk Jr • F/G • 6-0

Painted Post, N.Y.

Nicole Ryan Sr • G • 5-8

Safety Harbor, Fla.

Ebony Edwards So • G • 5-8

Forestville, Md.

Ashley Yencho Jr • G • 5-7

Schnecksville, Pa.

Lisa Strack So • G • 5-10

Langhorne, Pa.

Liz Leer Jr • F • 6-2

Glenside, Pa.

Raven Harris So • G • 5-7

Virginia Beach, Va.

Janelle McDonald So • F • 6-1

Ashburn, Va.

Stephanie Anya Fr • C • 6-2

Germantown, Md.

Matt CorkeryHead Coach2nd Season

LaTonya WatsonAssistant Coach

2nd Season

Erin LindrothAssistant Coach

2nd Season

Stephanie BlantonAssistant Coach

2nd Season

Tom CallanDir. of Basketball Ops.

2nd Season

2009-10 TV/Radio Roster

0000 44 55 1010 1212

1313 1515 2222

2323 4242 4444

Ohemma ... Oh-HEM-aNyanin ...............yeninGeleisa ...... Jill-EE-sahYencho ......YENCH-ohAnya .............. ahn-yah

Pronunciation Guide


Top Related