Download - What can your dog teach you about Genetics?
What can your Dog teach you about Molecular Genetics?
April 16 2009
Intended to supplement Genetics Class lectures Posted with additional information and ppt on
website: http://sites.google.com/site/
eleaningmodulesinbiology/ Material was assembled for a project for Harvard
Extension “The Cognitive Dog” Class
This is what I want you to know Why are geneticists interested in dogs? What is a QTL? What is the relationship between QTL’s and
phenotypic change? Why is a SNP an effective Genetic Marker? Explain how a gene pool becomes bottlenecked. What is the effect of inbreeding on SNP
differences between individual breeds? Why does both a pedigree family chart and
genetic markers combine for a powerful tool for gene investigation?
Why have dogs become very interesting to molecular geneticists?
Dogs on the cutting edge of genetic research
Dog breeds represent a genetic bottleneck that decrease recombinant variability
Genetic diseases are problematic with inbred dogs. (At least 350 that are found in humans have been
identified in different breeds)
Many breeds have many generations of breeding documentation
Canine Genetic Screening Progressive Retinal Atrophy (
PRA) Hypothyroidism with Goiter (
HTG)(Congenital Hypothyroidism)
Cystinuria (CYST) Globoid Cell Leucodystrophy (
GCL) Neuronal Ceroid
Lipofuscinosis (NCL) Phosphofructosokinase
Deficiency (PFK) Von Willebrand Disease (vWD
) Narcolepsy (NARC) Cone degeneration (CD)
Canine Leucocyte Adhesion Deficiency (CLAD)
Hemophilia B (HmB) Muscular Dystrophy (MD) Myotonia Congenita (MC) GMI Gangliosidosis (GMIG) Retinal Dystrophy (prad) SCID (DNA-PKc & DNA
PKc2) Mucopolysaccharidosis Type
VII (GUSB_NOSVVIII) Thrombasthenic
Thrombopathia ( THROM) Congenital Cardiac Defects OFA Elbow & Hip Dysplasia
High quality map of Dog Genome Tasha the boxer 2005 map of her genome at the
Broad Institute.
Map of 2,400 million bases
ATTTACGGATTACACGGAGG
representing 18,846 genes
http://www.biologycorner.com/bio1/DNA.htmlhttp://www.broad.mit.edu/media/2004/doggenome_0714.html
Quick Review of Genetic Terms and Principles
Review of Genetics Terms and Principles
Review - Big Ideas in Genetics
One gene – One phenotypic trait
Recessive genes can hide under Dominant
Dominant phenotype
One phenotype – different genotypes!
orBB Bb
Review - Big Ideas in Genetics
* http://en.wikipedia.org/wiki/Qtl
QTL – Quantitative Trait Loci1908 Nilson-Ehle
Many genes +
environmentOne quantitative trait =
Review - Big Ideas in GeneticsSingle Nucleotide Polymorphism
* http://en.wikipedia.org/wiki/Qtl
Animation http://www.dnai.org/text/mediashowcase/index2.html?id=1083
only P1 and P4 have the DNA from grandparents G1 and G4 and thus, it is possible that the disease gene might be somewhere near ?. ~85% probability of finding a simple recessive trait.
Review - Gene Markers for Beginners
Now imagine that grandparents G1 and G4 and puppies P1 and P4 have the disease and we're looking at a recessive mode of inheritance. We would then look at the DNA markers we have and see that at position ?
Let’s go to the Movies
Look for the following Perfect Population Bottleneck Regulatory Gene
Describe the 3 sets of data necessary for this experimental design?
http://watch.discoverychannel.ca/daily-planet/february-2009/daily-planet-february-26-2009/#clip144136
Original Population Survivors are selected for
breeding
New Population
Founders Effect
PopulationBottleNeck
Bottlenecked Gene Pool
Wolf Dog
AKC Breeds
Wade “The Dog Genome:Sequence, Evolution, and Haplotype Structure” Broad Institute MIT
The Georgie Project
Karl G Lark University of Utah Biology Depart
Georgie 1986-1996
Why is PWD population perfect for a genetics study?
Inbreeding results in less recombination Less recombination results in fewer SNPs Fewer SNPS make it easier to identify
genetic locations Documented phenotype of size, disease,
hair, color in pedigree charts from breeders
Easier to uncover loci for base sequences responsible for phenotype
Documented PWD breeding lines
Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
Who’s your Daddy’s Daddy’s Daddy?
With high level of inbreeding all dog would look the same?
Polymorphic
Genetic Resource
“Analyzing the genotypes of dogs in the PWD population is the most important aspect of the Georgie Project. By this we mean defining a set of 500 to 1000 DNA markers for each of the dogs in the population we are analyzing. These genotypes, when combined with diff erent phenotypes allow us to analyze the genetics of each phenotype. Thus the genotyping of the population provides an UMBRELLA under which a number of specific genetic projects can be carried out.”
Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
Zero Correlation
00.10.20.30.40.50.60.70.80.9
1
0 20 40 60 80 100
Pedigree
Markers
Is there a correlation between genetic markers in PWD and breeding lineage?
Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
Results - QTL linking the skull, legs ,hip
Courtesy Sanger Inst
http://www.georgieproject.com/x-ray/x-ray.htm
Results - QTL Size IGF1
Chrom 15
http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid=9615&build=current&advsrch=off&query=igf1
Elegance of the Georgie experiment
Free living population of animalsversus a colony of laboratory dogsthat are inbred.
Georgie and my dog
Are there similar DNA sequences in my dog that willmake him susceptible to autoimmune disease?
Georgie McGyver
If you can find a population
If you can build a database of BioMarkers
Sample Preparation
Biomarker ResearchBiomarker Research
DataInterpretation
& Storage
Sample Analysis
Robotics
Centrifuges Concentrators
Liquid Chromatography/Mass Spectrometry
Protein Identification
Protein Digest Sample Handling
Data Analysis
Peptide Separation
Data Storage
LabInformation
ManagementSystem
Microplate Readers
SoftwareXcaliburXcalibur
ProteinFractionation Freezers
Cells or Tissue
BiomarkerIdentified
Thermo Scientific Laboratory Workflow
You can crack the code of life’s form and function
Genetic regulation of osteoarthritis: A QTL regulating cranial and caudal acetabular osteophyte formation in the hip joint of the dog (Canis familiaris). Amer. J. Med. Genet. 135A(3):334-335. http://www3.interscience.wiley.com/cgi-bin/jtoc/33129/ Carrier DR, Chase K, Lark KG.
Genetics of canid skeletal variation: size and shape of the pelvis. Genome Res. 2005 Dec;15(12):1825-30. PMID: 16339381 [PubMed - indexed for
MEDLINE] Chase K, Carrier DR, Adler FR, Ostrander EA, Lark KG. Interaction between the X chromosome and an autosome
regulates size sexual dimorphism in Portuguese Water Dogs. Genome Res. 2005 Dec;15(12):1820-4. PMID: 16339380 [PubMed - indexed for MEDLINE] Lark, K.G., Chase, K., Carrier, D.R. and F.R. Adler (2005)
Wealth of research Genetic analysis of the canid skeleton: Analysis of
morphological loci (QTLs) in the Portuguese Water Dog population. In: "The Genome of the Domestic Dog" (Cold Spring Harbor Monograph Series 44). pp. 67-80. Editors: E.A. Ostrander, U.
Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Trut, L.N., Kharlamova, A.V., Carrier, D.R., Chase, K., Kukekova, A.V., Acland, G.M. and K.G. Lark (2005)
Morphology and behavior: Are they coupled at the genome level? In: "The Genome of the Domestic Dog² (Cold Spring Harbor Monograph Series 44). pp. 81-93. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Lark KG, Chase K, Sutter
NB. Genetic architecture of the dog: sexual size dimorphism
and functional morphology. Trends Genet. 2006 Oct;22(10):537-44.
Epub 2006 Aug 24 PMID: 16934357 [PubMed - in process
Wealth of research Chase K, Lawler DF, Adler FR, Ostrander EA, Lark KG.Bilaterally
asymmetric effects of quantitative trait loci (QTLs): QTLs that affect laxity in the right versus left coxofemoral (hip) joints of the dog (Canis familiaris).Am J Med Genet A. 2004 Jan 30;124(3):239-47. PMID: 14708095 [PubMed - indexed for MEDLINE]Chase K, Carrier DR, Adler FR, Jarvik T, Ostrander EA, Lorentzen TD, Lark KG.
Inherited infantile dilated cardiomyopathy in dogs: genetic, clinical, biochemical, and morphologic findings.Am J Med Genet. 2000 Nov 6;95(1):57-66. PMID: 11074496 [PubMed - indexed for MEDLINE]Chase K, Adler FR, Miller-Stebbings K, Lark KG.
Teaching a new dog old tricks: identifying quantitative trait loci using lessons from plants.J Hered. 1999 Jan-Feb;90(1):43-51. PMID: 9987902 [PubMed - indexed for MEDLINE]