Valéria M. GodinhoFernanda M. S. NascimentoSilvana Q. SilvaMarcos von Sperling
Characterization of
pathogenic bacteria in a
UASB-polishing pond system
using molecular techniques Federal University of Minas Gerais – UFMGBrazil
8th IWA Specialist Group Conference on Waste StabilizationPondsDATE: April 26 to 30, 2009 - VENUE: Belo Horizonte/MG
INTRODUCTION
Pathogenic bacteria in wastewater systems
• UASB-Polishing ponds
• Organic and inorganic matter removal
• Pathogenic bacteria decay
• pH, UV, T, DO ...
• Evaluation of pathogenic bacterial decay
• Indirectly by faecal (thermotolerant) coliforms and E. coli
INTRODUCTION
Pathogenic bacteria in sewage
INTRODUCTION
Pathogenic bacteria analysis
INTRODUCTION
Pathogenic bacteria analysis
• Traditional techniques
• Cultivation and Isolation
• Limitations:
• Specific culture media and growth conditions
• Similar physiology
• E. coli and Shigella
• Fastidious organisms
• Campylobacter and Helicobacter
INTRODUCTION
Pathogenic bacteria analysis
• Molecular techniques
• Polymerase Chain Reaction method (PCR)
INTRODUCTION
Pathogenic bacteria analysis
• Molecular techniques
• Fluorescent In situ hybridization (FISH)
INTRODUCTION
Pathogenic bacteria analysis
• Literature
• PCR and FISH have been applied to investigatepathogenic microorganisms in different types ofsamples, including water and wastewater samples
(Lee et al., 2006; Peng et al., 2002, Alonso et al., 2006).
AIM
To investigate the occurrence of potential pathogenic bacteria
(Escherichia coli, Salmonella enterica subsp. enterica-ser-
Typhimurium, Shigella spp., Enterococcus spp., Helicobacter
pylori, Staphylococcus aureus) in a wastewater plant
composed by a UASB reactor followed by polishing ponds
using molecular techniques.
METHODS
Description of the wastewater treatment plant
Center for Research and Trainning in Sanitation (CePTS)
UFMG - COPASA
Figure 1 – Flowsheet of the treatment system
WWTP – composed by UASB followed by serial ponds
METHODS
Pathogenic bacteria detection
Raw sewage UASB Pond 1
Pathogenic bacteriacharacterization DNA extraction (Egli et al. 2003)
PCR amplification (specific primers)
Samplesconcentration 4,000 rpm for 20 min filtered at 8 µm and 1.2 µm
2L centrifuged at 4,000 rpm for 20 min
Resuspended in PBS
Oligonucleotides (primers) used for pathogenic bacteria investigation
Target bacteria Name Sequence 5’ 3’
Amplicon size(bp)
Reference
Primers for PCR
E. coliL-uid739 tggtaattaccgacgaaaacggc
840 Bej (2004)Bej et al. (1991)R-uid578 gtggcgaaatattcccgtgcact
S. enterica subsp. enterica
L-himA cgtgctctggaaaacggtgag123 Bej et al. (1994)
R-himA cgtgctgtaataggaatatcttca
Enterococcus spp.Ent1 tactgacaaaccattcatgatg
112 Ke et al. (1999)Ent2 aacttcgtcaccaacgcgaac
Shigella dysenteriaeL-phoBR attgaagccgcgccgacgcaa
152 Bej (2004)R-phoBR cgttgcctgacaccttgaggg
Helicobacter pylori16SHP1 gcaatcagcgtcagtaatgttc
521 Lu et al. (2002)16SHP2 gctaagagatcagcctatgtcc
Staphylococcus aureus
nuc1 gcgattgatggtgatacggtt270 Burtscher and
Wuertz (2003)nuc2 agccaagccttgacgaactaaagc
METHODS
Pathogenic bacteria detection
PCR Strategy
PositiveOK
Negative• ↑ [sample• ↓ [sample] dilution••
“Nested PCR”,
Positive, butinespecific
• ↓ [sample] dilution
METHODS
Escherichia coli quantification
Raw sewage Pond 1
FISH 200 mL 4,000 rpm for 20 min filtered at 8 µm andcentrifuged at 4,000 rpm for 20 min
Resuspended in PBS
Fixation in 4% paraformaldehyde (Amann et al.1990)
Hybridization conditions with probe ECO 1167: 30% formamide, 46oC 2h (Hann et al. 2001)
Epifluorescence visualization of 15 microscopic fields
Colilert 100 mL IDEXX Quanti-Tray®/2000 - Colilert® system
RESULTS
Detection of pathogenic bacteria
DNA extraction
DNA extractions from samples and pure culture of a) Escherichia coli, b) Salmonella spp. c) Enterococcus spp., d) Shigella dysenteriae, e) Staphylococcus aureus
DNA from Helicobacter pylori was obtained from Hospital das Clínicas - UFMG
RS UASB P1
a b C d e
RESULTS
Detection of pathogenic bacteria by PCR
Optimization of PCR conditions for each pairof primers with positive and negative controls
a) Escherichia coli, b) Enterococcus faecallis,
c) Helicobacter pylori, d) Salmonella sppe) Shigella sonnei
f) Staphylococcus aureus,
Negative controls:Salmonella (a, b),
E. coli (c, d, f), Yersiniaenterocolítica (e).
RESULTS
Detection of pathogenic bacteria by PCR
d
RSP1RS
d
RS
RS
P1RS
P1RS
d
ca db
RS P1 RS P1 P1P1
RSRS
PCR products from amplification of DNA from: a) Escherichia coli, b) Salmonella entericasubsp. enterica, c) Enterococcus spp., d) Shigella dysenteriae.
Bacteria RS UASB P1Escherichia coli + + +S. enterica subsp. enterica + + +Enterococcus spp. + + -Shigella dysenteriae + + -Helicobacter pylori - - -Staphylococcus aureus - - -
Detection of pathogenic bacteria
DISCUSSION
Detection of pathogenic bacteria by PCR
Limit of detection for PCR: 102 or 103 cells/mL (Sharma and Carlson, 2000).
RESULTS
E. coli quantification by FISH
Control experimentPure culture of Escherichia coli visualized under a) phase contrast microscopy
b) Epifluorescence with DAPI, c) Epifluorescence with probe Eco1167.
a b c
RESULTS
E. coli quantification by FISH
RS – E. coli + probe ECO 1167
P1 – E. coli + probe ECO 1167
Statistics Sampling Raw sewage Pond 1
Mean(cells/100mL)
1 3.92x107 3.82x106
2 9.78x107 4.17x106
3 2.46x107 3.56x106
Standard deviation (cells/100mL)
1 9.50x106 3.52x105
2 1.91x107 6.73x105
3 7.07x106 1.05x106
Coefficient of variation
1 0.24 0.09
2 0.20 0.16
3 0.29 0.29
Quantification of E. coli by FISH technique
RESULTS
E. coli quantification by FISH
Sampling Raw sewage Pond 1
Mean(MPN/100mL)
1 3.1 x107 4.6 x105
2 3.2 x108 1.8 x106
3 2.1 x107 9.8 x104
Quantification of E. coli by Colilert
DISCUSSION
E. Coli quantification
• Estimated removal efficiency of E. coli – 85 to 95% for FISH – 98 to 99% for Colilert®– Ponds in series are able to reduce considerably the number of E. coli cells during the
treatment. • Previous data based on Colilert® showed that the complete WWT plant was able
to reduce 99.99% of E. coli cells (103 to 104 MPN/100mL in the final effluent (von Sperling and Mascarenhas, 2005; von Sperling, 2008).
• Difference in the efficiency of E. coli removal methodological– FISH - quantification is based on counting individual cells – Colilert® - based in MPN table.
• It is believed that counting individual cells is more precise for estimating microorganisms than cultivation techniques
– however ….
DISCUSSION
E. Coli quantification
• FISH bias (regarding to polishing ponds effluent samples)– Presence of autofluorescent algae overestimation of cell
number.• Exclusion by cell size
– Morphology of bacterial cells may change in response of low levels of available substrate present in polishing ponds.
• In this study the cells of E. coli in the P1 effluent were smaller than E. coli cells from the RS
– Algae removal and sample concentration• Need to satisfy the detection limit of the technique (103 to 104
cells/mL, Amann et al., 1995). – Probes based on ribosomal RNA
• Fluorescent signal is proportional on ribosome content
CONCLUSIONS
• E. coli and Salmonella enterica subsp. enterica, present in the RS were not completely removed in the investigated system
• Enterococcus spp. and Shigella dysenteriae were not detected in the P1 effluent, suggesting that the number of cells were considerably reduced along the treatment.
• Helicobacter pylori and Staphylococcus aureus were not detected in the RS neither in UASB and P1 effluents
– the number of cells from these species is probably not high enough to be detected by PCR (102 or 103 cells/mL, Sharma and Carlson, 2000).
• E. coli measurements by FISH (RS:107 and P1:106 ) were up to 2 log units higher than the Colilert technique
CONCLUSIONS
• PCR is a good method for pathogenic bacteria detection but gives only qualitative results
• FISH technique for evaluating E. coli decay …– low levels of pathogenic bacteria in polishing pond effluents
(usually is in the range of the detection limit of the technique)– Probe signal depends on the amount of ribosomal RNA inside the
cells, which is proportional to the cell activity• Are they active enough to be detectable?
• Future studies: Real Time PCR (quantitative PCR)
ACKNOWLEDGEMENTS
• UFMG
• PROSAB
• FINEP
• CNPq
• FAPEMIG