![Page 1: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/1.jpg)
Draft
Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune
Responses against Hepatitis B Surface Antigen in Mice
Journal: Canadian Journal of Physiology and Pharmacology
Manuscript ID cjpp-2015-0528.R1
Manuscript Type: Article
Date Submitted by the Author: 03-Jan-2016
Complete List of Authors: Yuan, Ding; China Three Gorges University Yuan, Qin; China Three Gorges University, College of Medical Science Cui, Qianqian; China Three Gorges University Liu, Chaoqi; China Three Gorges University Zhou, Zhiyong; China Three Gorges University Zhao, Haixia; China Three Gorges University
Dun, Yaoyan; China Three Gorges University Wang, Ting; China Three Gorges University Zhang, Changcheng; China Three Gorges University
Keyword: Ginsenosides Rg1, Hepatitis B surface antigen (HBsAg), immune adjuvant, humoral immunity, cell immunity
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 2: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/2.jpg)
Draft
Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses
against Hepatitis B Surface Antigen in Mice
Ding Yuan,1,2
Qin Yuan,1 Qianqian Cui,
1 Chaoqi Liu,
1 Zhiyong Zhou,
1 Haixia
Zhao,1Yaoyan Dun,
1 Ting Wang,
1 Changcheng Zhang
1 *
1College of Medical Science, Three Gorges University, Yichang, Hubei 443002,
China
2Renhe Hospital, The second College of Clinical Medical Science, Three Gorges
University, Yichang, Hubei, 443001, China
*Authors to whom correspondence should be addressed; E-mail:[email protected]
Abstract
The adjuvant effect of ginsenoside Rg1 on immune responses against Hepatitis B
surface antigen (HBsAg) in mice was investigated. Female BALB/c mice were
subcutaneously (s.c.) injected with saline or HBsAg antigen with or without Rg1 on 7
days and 21 days. Samples were collected 2 weeks after the boosting for the detection
of anti-HBsAg immunoglobulin G (IgG) isotypes in sera and gamma interferon ( IFN-
γ) and interleukin-4 (IL-4) produced in splenocytes. The innate and adaptive
immune responses were measured in mice immunized as described above. The results
showed that ginsenosides Rg1 had adjuvant properties in stimulating IgG, splenocyte
proliferation, and mRNA expression of cytokines IFN-γ and IL-4 as well as the
expression of cell surface marker TLR4 in the HBsAg-immunized mice. These results
indicate that Rg1 enhances both Th1 (IgG2b, IFN-γ) and Th2 (IgG1 and IL-4)
responses. In addition, TLR4 signaling pathway is involved in the adjuvant activities
Page 1 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 3: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/3.jpg)
Draft
of ginsenosides Rg1.
Keywords Ginsenosides Rg1, Hepatitis B surface antigen (HBsAg), immune adjuvant,
humoral immunity, cell immunity
Introduction
Vaccination is the most effective and valuable tool in the prevention of pathogenic
organisms and tumors. Adjuvant is an important component of an effective vaccine.
Aluminum adjuvant is the most widely and representatively commercial vaccine
adjuvant approved clinically. Unfortunately, increasing studies in human and animals
showed that aluminum is a relatively poor adjuvant for antibody induction to
recombinant protein antigens, such as HBsAg vaccine. Furthermore, aluminum
effectively enhances a Th2-type humoral immune response, and is not highly effective
at stimulating Th1-type cell-mediated immune responses which contributes to
antiviral and anti-tumor immunity (Jeong et al. 2012; Mahboubi et al. 2012). So it has
been developed more potent and reliable immune adjuvants for vaccines over the past
decades. Novel adjuvants such as AS04 (Levie et al. 2002) and CpG oligonucleotides
(Cooper et al. 2004) have been studied, but have a generally unacceptable and adverse
effects including the expense of increased reactionogenicity (Levie et al. 2002) or
uncertain safety (Cooper et al. 2004). Hence, developing suitable adjuvants become
one of the most significant challenges in vaccination.
In recent years, a large number of clinical and experimental studies had shown
that natural products have been a rich and reliable source of compounds for immune
adjuvants such as saponins. Previous studies on the immune adjuvant activity of
Page 2 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 4: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/4.jpg)
Draft
saponins primarily focused on QuilA extracted from the bark of the tree Quillaja
saponaria Molina. QS-21 is a representative of QuilA. QS-21 and QuilA
(saponin-type adjuvants) induce strong humoral and cellular immune responses. But
due to the unstable and easily hydrolyzed nature of QuilA with severe hemolytic and
toxic side effects, QuilA thereby limited its use in human vaccines.
Hence, these reason have led to research for alternative adjuvants. Increasing
studies have revealed that ginsenoside Rg1 extracted from the root of Panax
ginseng C. A. Meyer was the most active saponin to have a adjuvant effect (Qu et al.
2011; Su et al. 2015). Although many studies have been revealed about the adjuvant
effect of ginsenoside Rg1, the potential mechanisms remain unclear. Toll-like
receptors (TLRs) are pattern recognition receptors and play a critical role in the innate
and adaptive inflammatory responses to host defense against microbial infection.
Recent studies indicate that vaccine adjuvants activate the antigen-presenting cells
(APCs) via TLRs signaling pathway (Shima et al. 2013). TLR4 and TLR9 were
highly expressed in different immune cells, such as B cells, dendritic cells,
macrophages, and specific types of T cells. TLR4 localized in the cell membrane
recognizes bacterial lipopolysaccharide (LPS) and plant-derived molecules such as
taxol (Yan et al. 2015). The CpG oligonucleotide is recognized by TLR9 in
endo/lysosome compartments and triggers the production of Th1-promoting
cytokines(Shima et al. 2013).
In the present study, HBsAg was used as a recombinant antigen and we
Page 3 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 5: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/5.jpg)
Draft
investigated the effect of ginsenoside Rg1 as an adjuvant of HBsAg vaccine. Hepatitis
B is still one of the vaccine- preventable diseases that threaten human health.
Nevertheless, the number of persons who develop protective antibody (anti-HBsAg)
against HBV surface antigen (HBsAg) is lower, and the antibody titres of those who
mount an antibody response are reduced and declined logarithmically with time. So
we explored whether TLRs activation involved in immune responses to the adjuvant
of HBsAg vaccine.
Materials and methods
Chemicals and Reagents
Ginseng saponin Rg1 ( purity > 98% ) was purchased from Chengdu
Purechem-Standard Co.,Ltd. (Sichuan, China) (Fig. 1). Hepatitis B surface
antigen(HBsAg) was purchased from Center For Disease Control of Hubei province
( Hubei, China). RPMI 1640 and fetal bovine serum (FBS) were ordered from Gibco
(Grand Island, NY, USA). IgG、IgG1and IgG2b antibody was purchased from
eBioscience (USA). Tris-base, Tween-20, potassium carbonate、trypan blue、ConA
were purchased from Wuhan kori biotechnology (Wuhan City, Hubei, China). CCK-8
assay kit was ordered from Shanghai East-Chemical Technology Co., Ltd (Jiangsu,
China). CD284 (TLR4) (PE labeled) and CD289 (TLR9) (FITC labeled) were
purchased from eBioscience (USA). TMB color reagent (A, B color liquid) was
purchased from Yichang Baiao Biotechnology (Yichang City, Hubei, China). cDNA
reverse transcription and PCR amplification kit were purchased from Takara Co., Ltd.
Page 4 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 6: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/6.jpg)
Draft
The polymerase chain reaction (PCR) primers of GAPDH, IFN-γ and IL-4 were
synthesized by Sangon Biotech Co., Ltd. (Shanghai, China)(Table 1).
Animals
BALB/C mice (female, 6 weeks of age) weighing 18 to 22 g were purchased from the
Laboratory Animal Center of Hubei province (Hubei, China) and were kept in
polypropylene cages with sawdust bedding in specefic pathogen free (SPF) level
conditions. The mice were exposed to a 12 h/12 h light/dark cycle at 22 ± 2°C with 60
± 5 % of relative humidity. Food and water were supplied ad libitum. All animal
procedures used for the animals and their care followed the internationally accepted
principles as found in the Guidelines for Keeping Experimental Animals issued by the
government of China. The researchers received ethical training from Three Gorges
University.
Experimental groups and immunization
36 Female BALB/C mice were randomly divided into 4 groups: normal control,
HBsAg control, HBsAg + Rg1-low, HBsAg + Rg1-high. Each mouse were
subcutaneously injected twice at a 2-weeks interval with saline (200 µL) ( normal
control) or HBsAg (5 µg) in saline solution with or without (HBsAg control) Rg1 (50
µg or 100 µg). Two weeks after the boosting injection, blood samples were collected
from the orbital venous sinus for measurement of serum HBsAg-specific IgG. The
serum of the blood samples was separated by centrifuging at 3000g for 15 min and
stored at −20°C until use. Splenocytes were isolated for determination of lymphocyte
Page 5 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 7: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/7.jpg)
Draft
proliferation, cytokine expression.
CCK-8 assay for lymphocyte proliferation
Splenocytes prepared from the mice were transferred to RPMI 1640 medium
containing 100 IU/mL penicillin, 100 µg/mLstreptomycin and 10% fetal bovine serum.
Cell viability was estimated using the trypan blue exclusion and the concentration of
viable lymphocytes was more than 95%. 500 µL splenocytes were seeded into each
well in a 24-well flat-bottom microtiter plate at a concentration of 5.0 × 106
cells / ml,
thereafter complete medium (Negative control), HBsAg (final concentration 5
µg·mL-1
) or ConA (final concentration 5 µg·mL-1
) were added giving a final volume
of 1 mL to stimulate lymphocyte proliferation. After incubated at 37 ◦C in a humid
atmosphere with 5% CO2 for 72h, 100 µL of CCK-8 solution was added and
incubated for 2 h, and read immediately at OD450 nm by microplate reader ,
calculating the stimulation index (SI) based on the formula: SI = (OD experimental
group -OD blank) / (OD negative control -OD blank).
Determination of serum IgG , IgG1and IgG2b by ELISA
An indirect enzyme-linked immunosorbent assay (ELISA) was conducted to measure
the titers of anti-HBsAg antibodies in serum as previously described by Su et al. (Su
et al. 2012). Briefly, flat-bottomed 96-well microtiter plates were coated with 100
µL/well of diluted HBsAg (5 µg/mL) in PBST and were incubated at 4◦C for 16 h.
After washing with PBST for 5 min, the plates were blocked with 200 µL/well 1%
BSA diluted in PBST for 1h at 37 ◦C. Then, blocking buffer being removed, the wells
Page 6 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 8: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/8.jpg)
Draft
were washed three times(5 min/each) with PBST. To measure IgG, IgG1and IgG2b,
100 µL of diluted serum samples (1:9000) with 1% BSA was applied to the plates and
the plates were incubate for 1h at 37◦C. After another washing, 100 µL of biotinylated
goat anti-mouse secondary antibody (IgG, IgG1, or IgG2b) diluted in 1% BSA
(1:3000) was added and incubated for 50 min at 37◦C. Plates were washed again, and
100 µL of TMB color reagent was added to each well and further incubated for 15
min in dark. The reaction was stopped finally using 50 µL of 2M H2SO4. The optical
density (OD) of the plates was read immediately at 450 nm.
Quantification of IFN-γ and IL-4 genes by reverse transcription PCR( RT- PCR)
Splenocytes were prepared and treated as same as above, then cells were centrifuged
10 min (380g at 4 ◦C), and washed in ice-cold PBS, then subjected to RNA extraction.
Splenocytes were lysed in 1 mL of Trizol reagent (Takara, Japane) and total RNA was
extracted from splenocytes according to the manufacture’s protocol. The cDNA was
synthesized from total RNA. Reverse-transcription reaction was performed by mixing
1 µg of RNA with 5 µL PrimeScript reagent (Takara) in a DEPC-treated tube,
thereafter the final volume was adjusted to 20 µL with RNase Free dH2O. The
reverse-transcription reaction was performed in a condition of 15 min at 37 ◦C, 5 sec
at 85 ◦C, stored at 4 ◦C. The polymerase chain reaction was performed using 1 µL
cDNA up to a final volume of 25 µL reaction in a Bio-Rad iQ5 96-well plate. 1 µL of
GAPDH、IFN-γ and IL-4 primer were amplified at a concentration of 12.5 µL TaKaRa
2×PCR Master Mix and 10.5 µL RNase Free dH2O. An initial activation at 94°C for 5
min was followed by an amplification target sequence of 29 cycles of 94°C for 30 s,
Page 7 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 9: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/9.jpg)
Draft
55°C for 30 s, 72°C for 30s and 72°C for 5 min in a thermocycler (Bio-RadMJ
MiniPCR, USA).
FCM assay for the expression of TLR4 and TLR9
The cell surface receptor staining was evaluated using flow cytometry (Sobol et al.
2011). Briefly, Splenocyte suspensions were collected as above, thereafter the
splenocytes were washed with PBS and stained for cell surface markers with
respective antibodies (TLR4, TLR9) for 30 min at 4 °C in dark according to the
instructions of manufacturer. 500 µL cells in PBS were analysed by flow cytometry
(Becton,Dickinson and Company,USA).
Statistical analysis
Results were expressed as means ± standard deviation (SD). All analysis was
performed with GraphPad Prism 5.0 (GraphPad Software, San Diego, CA, USA).
Multigroup comparisons were analyzed by one-way analysis of variance (ANOVA)
test with post hoc contrasts test. P value less than 0.05 were considered as statistically
significant.
Results and discussion
Ginsenoside Rg1 enhance the HBsAg antibody production of specific IgG , IgG1
and IgG2b
The effects of ginsenoside Rg1 on HBsAg -specific IgG, IgG1 and IgG2b antibody
production were examined using the methods as above. Different diluted serum
Page 8 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 10: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/10.jpg)
Draft
samples were detected for the HBsAg-specific IgG levels. As shown in Fig. 2A, the
OD value of serum samples were decreased with the increase of the dilution ratio of
serum samples. The positive correlation was demonstrated between the serum dilution
and its OD value. The results of Fig. 2B showed that the mean value of the HBsAg
antibody titre from the animals immunised with the vaccine. The mean value of IgG ,
IgG1 and IgG2b in HBsAg alone group were significantly higher than those of the
mice injected with the saline. The total levels of IgG antibody were elevated
significantly in the HBsAg/50 µg Rg1 group compared with the HBsAg alone group.
The IgG1 subtype is considered to be associated with Th2-dominated immune
responses, whereas IgG2b is reported to be a mediator of Th1-type immunity (Kawase
et al. 2011). The results in the Fig. 2B showed that the treatment with HBsAg/50 µg
Rg1 markedly increased the production of the HBsAg-specific IgG1 and IgG2b
isotypes compared with the HBsAg group, and significantly favoured the production
of IgG2 over IgG1 antibodies. It is because that the adjuvant switch isotype of the
antibodies via the appropriate cytokine milieu and that response may transform
according to the antigen and the species (Avramidis et al. 2002). These results indicate
that the Th1 and Th2 immune responses were induced by the HBsAg/ Rg1vaccine in
vivo and that the ginsenosides Rg1 used as an adjuvant of HBsAg vaccine exerted an
adjuvant effect on enhancing the secretion of its specific antibodies and improving the
immunogenicity of HBsAg by Th1-mediated cellular immunity and Th2-mediated
humoral immunity
Ginsenosides Rg1 significantly enhanced lymphocyte proliferation and IFN-γ
Page 9 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 11: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/11.jpg)
Draft
and IL-4 expression
To measure the effect of ginsenosides Rg1 on HBsAg-immunized mice, the
lymphocyte proliferation analyzed in the HBsAg-immunized mice. The spleen is vital
part of the lymphatic system. Immune function (through phagocytosis, but also
through T cell-mediated immunity and B cell-mediated humoral immunity) is the
most important function of the spleen(Tarantino et al. 2011). The splenocytes from
the immunized mice were prepared to assess the proliferative immune responses to
ConA or HBsAg (Fig. 3A). It was observed that the splenocytes from the mice
immunized with HBsAg/Rg1 showed a signigicant proliferative response to ConA or
HBsAg. After ConA or HBsAg stimulation lymphocyte proliferation in the mice
immunized with HBsAg/Rg1 was significantly higher than in the HBsAg groups (P <
0.05). In addition, we determined that the mRNA expression of IFN-γ, IL-4 cytokines
of the splenocytes by reverse transcription PCR. Naive helper T cells differentiate into
Th1 and Th2, when stimulated with cognate antigens by APCs. Th1 cells secrete
IFN-γ and primarily promote cellular immunity. Th2 cells mainly produce IL-4 and
promote humoral immunity. As can be seen in Fig. 3B and C, no significant
differences in the mRNA expression of cytokines IFN-γ and IL-4 between the mice
immunized with saline and HBsAg alone. But the mRNA expression of IFN-γand
IL-4 cytokines were up-regulated in HBsAg/Rg1 stimulation compared with HBsAg
alone group, indicating that ginsenosides Rg1 simultaneously induced the gene
expression of the Th1 and Th2 cytokines in splenocytes upon stimulation of HBsAg,
and had immuno-adjuvant activities capable of boosting both cellular (Th1) and
Page 10 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 12: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/12.jpg)
Draft
humoral (Th2) immune responses.
Influences of surface receptor TLR4 and TLR9
In order to detect the mechanism about the adjuvant effect of ginsenoside Rg1, we
hypothesized that the adjuvant effects of Rg1 may be related to TLR signaling
pathways. It had been found that many vaccine adjuvants through the activation of
TLRs can induce the body to produce interferon and other inflammatory cytokines
(Oh et al. 2014; Orr et al. 2014). Therefore we evaluated that the expression of TLR4
and TLR9 to determine if ginsenosides Rg1 had an adjuvant effect on HBsAg by
activating TLR4 and TLR9 receptor. In Fig. 4, HBsAg enhanced the expression of cell
surface receptor TLR4 and TLR9 in the mice immunized with HBsAg alone
compared with the control group. Besides, HBsAg plus ginsenosides Rg1 had
significant effect on the expression of TLR4 compared with the HBsAg alone,
suggestting that ginsenosides Rg1 had an immuno-adjuvant activities by activating
TLR4 receptor. Several studies have reported that the combinaion of multiple TLR
ligands synergistically stimulated APCs and exerted adjuvant effects. Biologically
derived oligodeoxynucleotides (ODNs) containing unmethylated CpG sequences
(CpG ODNs) are known as an immune adjuvant that are recognized by TLR9 in
endo/lysosome compartments. The recognition of CpG ODN by TLR9 triggers the
secretion of Th1-promoting cytokines, and finally induces Th1-biased cellular innate
and adaptive immunity. Cooper CL and co-workers (Cooper et al. 2004) observed that
addition of CpG oligonucleotides (ODN) to stimulate TLR9 signaling increased
Page 11 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 13: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/13.jpg)
Draft
hepatitis B virus-specific Ab titers in Engerix-B vaccinated humans. In addition to
TLR9 ligands, several studies describe the evaluation of TLR4 ligands used either
alone or in combination with other adjuvant formulations. Fei Su et al. (Su et al. 2012)
reported that the adjuvant activities of ginsenosides Rg1 and Re extracted from the
root of Panax ginseng C.A. Meyer were TLR4-dependent in the OVA-immunized
mice. Pouliot K, et al. (Pouliot et al. 2014) also suggested TLR4 and MyD88 were
necessary for a strong humoral and cell-mediated immune response in mice
immunized with DP6-001 vaccine adjuvanted with MPLA. These results showed that
TLR4 activation in the vaccine adjuvant was same as our results.
Conclusion
In summary, our data illustrate that ginsenosides Rg1 exhibits a range of
immunological adjuvant effects on a number of cell types in the HBsAg-immunized
mice. It has been seen that the adjuvant activity of ginsenosides Rg1 produces a high
degree of IgG2 antibody and elicits Th1 and Th2 immune response via TLR4 signal
pathway. Therefore, these results provide promising road in the future for the
development of a novel immune adjuvant aagainst HBV. Ginsenosides Rg1will be
used in future HBsAg vaccination trials to enhance the immune response in human.
Declarations
Conflicts of Interest
The authors report no conflicts of interest
Fundings
This study was financed by the grants from the National Natural Science Foundation
Page 12 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 14: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/14.jpg)
Draft
of China (NSFC) ( No. 81473461) to Chaoqi Liu , (No. 81273895) to Ding Yuan , (No.
81373881) to Changcheng Zhang and the Foundation for Innovative Research Groups
of the Hubei Province Natural Science Foundation of China (No. 2013CFA014) to
Ding Yuan.
Acknowledgments
We thank College of Medical Science of Three Gorges University for Laboratory
Animal Center good facilities and all the laboratory workers who has helped with
methods and materials.
References
Avramidis, N., Victoratos, P., Yiangou, M., and Hadjipetrou-Kourounakis, L. 2002.
Adjuvant regulation of cytokine profile and antibody isotype of immune responses
to Mycoplasma agalactiae in mice. Vet. Microbio. 88:325-338. PMID:12220808.
Cooper, C.L., Davis, H.L., Morris, M.L., Efler, S.M., Adhami, M.A., Krieg, A.M., et
al. 2004. CPG 7909, an immune-stimulatory TLR9 agonist oligodeoxy nucleotide,
as adjuvant to Engerix-B HBV vaccine in healthy adults: a double-blind phase I/II
study. J. Clin. Immunol. 24:693-701. PMID:15622454.
Jeong, E.J., Maeng, H.J., Lee, H.J., Kim, Y., and Kim, C.K. 2012. Effect of adjuvant
on pharmacokinetics, organ distribution and humoral immunity of hepatitis B
surface antigen after intramuscular injection to rats. Arch. Pharm. Res. 35:1621-
1628. doi:10.1007/s12272-012-0913-1. PMID:23054719.
Kawase, O., Goo, Y.K., Jujo, H., Nishikawa, Y., and Xuan, X. 2011. Starfish,
Asterias amurensis and Asterina pectinifera, as potential sources of Th1
Page 13 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 15: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/15.jpg)
Draft
immunity-stimulating adjuvants. J. Vet. Med. Sci. 73:227-229. PMID:20847539.
Levie, K., Gjorup, I., Skinhoj, P., and Stoffel M. 2002. A 2-dose regimen of a
recombinant hepatitis B vaccine with the immune stimulant AS04 compared with
the standard 3-dose regimen of Engerix-B in healthy young adults. Scand. J. Infect.
Dis. 34:610-614. PMID:12238579.
Mahboubi, A., Fazeli, M.R., Samadi, N., Dinarvand, R., and Azadi, S. 2012.
Evaluation of thimerosal removal on immunogenicity of aluminum salts
adjuvanted recombinant hepatitis Bvaccine. Iran. J. Pharm. Res. 11:39-46.
PMID:25317183.
Oh, D.R., Kang, H.W., Kim, J.R., Kim, S., Park, I.K., Rhee, J.H., et al. 2014. PMA
induces vaccine adjuvant activity by the modulation of TLR signaling pathway.
Mediators. Inflamm. 2014:406514. doi: 10.1155/2014/406514. PMID:24948847.
Orr, M.T., Beebe, E.A., Hudson, T.E., Moon, J.J., Fox, C.B., Reed, S.G., et al. 2014.
A dual TLR agonist adjuvant enhances the immunogenicity and protective
efficacy of the tuberculosis vaccineantigen ID93. PLoS One, 9:e83884.
doi: 10.1371/journal.pone.0083884. PMID:24404140.
Pouliot, K., Buglione-Corbett, R., Marty-Roix, R., Montminy-Paquette, S., West, K.,
Wang, S., et al. 2014. Contribution of TLR4 and MyD88 for adjuvant monophosp-
phoryl lipid A(MPLA) activity in a DNA prime-protein boost HIV-1 vaccine.
Vaccine, 32:5049-5056. doi: 10.1016/j. PMID:25045815.
Qu, D.F., Yu, H.J., Liu, Z., Zhang, D.F., Zhou, Q.J., Zhang, H.L., et al. 2011.
Page 14 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 16: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/16.jpg)
Draft
Ginsenoside Rg1 enhances immune response induced by recombinant toxoplasma
gondii SAG1 antigen. Vet. Parasitol. 179:28-34.
doi:10.1016/j.vetpar.2011.02.008. PMID:21439733.
Shima, F., Uto, T., Akagi, T., and Akashi, M. 2013. Synergistic stimulation of antigen
presenting cells via TLR by combining CpG ODN and poly(γ-glutamic
acid)-based nanoparticles as vaccine adjuvants. Bioconjug. Chem. 24:926-933.
doi:10.1021/bc300611b. PMID:23631730.
Sobol, P.T., Boudreau, J.E., Stephenson, K., Wan, Y., Lichty, B.D., and Mossman,
K.L. 2011. Adaptive antiviral immunity is a determinant of the therapeutic success
of oncolytic virotherapy. Mol. Ther. 19:335-344. doi:10.1038/mt.2010.264.
PMID:21119618.
Su, F., Xue, Y., Wang, Y., Zhang, L., Chen, W., and Hu, S. 2015. Protective effect of
ginsenosides Rg1 and Re on LPS-induced sepsis by competitive binding to
Toll-like receptor 4. Antimicrob. Agents. Chemother. 59:5654-5663.
doi: 10.1128/AAC.01381-15. PMID:26149990.
Su, F., Yuan, L., Zhang, L., and Hu, S. 2012. Ginsenosides Rg1 and Re act as
adjuvant via TLR4 signaling pathway. Vaccine, 30:4106-4112. doi:10.1016/j.
PMID:22472794.
Tarantino, G., Savastano, S., Capone, D., and Colao, A. 2011. Spleen: A new role for
an old player? World. J. Gastroenterol. 17:3776-3784.
doi: 10.3748/wjg.v17.i33.3776. PMID: 21987619.
Page 15 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 17: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/17.jpg)
Draft
Yan, X., Maixner, D.W., Yadav, R., Gao, M., Li, P., Bartlett, M.G., et al. 2015.
Paclitaxel induces acute pain via directly activating toll like receptor 4. Mol. Pain.
11:10. doi: 10.1186/s12990-015-0005-6. PMID:25868824.
Page 16 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 18: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/18.jpg)
Draft
Fig. 1 Chemical structure of ginsenoside Rg1 (C42H72O14; molecular weight,
801.02)
Fig. 2 Antibody titer dilution standard curve (A) and effect of ginsenosides Rg1 on
HBsAg-specific IgG, IgG1 and IgG2b antibody levels in serum (1:9000) in
HBsAg-immunized mice (B). Mice (n = 9/group) were s.c. immunized with saline or
HBsAg antigen with or without Rg1 on 7 days and 21 days. Sera were collected and
HBsAg-specific IgG, IgG1 and IgG2b antibody levels in serum were measured by an
indirect ELISA. The values were presented as mean ± SD . **P <0.01 vs normal
group, #P <0.05,
##P <0.01 vs HBsAg group.
Fig. 3 Effect of ginsenosides Rg1 on the lymphocytes proliferation treatment with
ConA and HBsAg stimulation by CCK-8 assay (A) and effect of ginsenosides Rg1 on
the mRNA expression of cytokines IFN-γand IL-4 by RT- PCR (B and C) in
splenocytes of HBsAg-immunized mice in vitro. Mice (n = 9/group) were
subcutaneously injected with saline or HBsAg with or without Rg1 on 7 days and 21
days. Splenocytes were prepared 2 weeks after the second immunization and cultured
with RPMI 1640 medium. Data were expressed as mean ± SD. *P <0.05 vs normal
group, #P <0.05,
##P <0.01 vs HBsAg group.
Fig 4 Effect of ginsenosides Rg1 on the expression of TLR4 and TLR9 receptor in
splenocytes. Mice (n = 9/group) were s.c. immunized with saline or HBsAg with or
without Rg1 on 7 days and 21 days. Splenocytes were collected after boosting and
stained with FITC-conjugated anti-TLR4/anti-TLR9 antibodies for 30 min in the dark.
TLR4 and TLR9 receptor levels were examined by flow cytometry. The numbers
indicate the percentage of cells in the quadrant. The results were presented as mean ±
SD(n = 9). **P <0.01,*P <0.05 vs normal group, #P <0.05 vs HBsAg group.
Page 17 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 19: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/19.jpg)
Draft
Fig. 1 Chemical structure of ginsenoside Rg1 (C42H72O14; molecular weight, 801.02) 35x36mm (300 x 300 DPI)
Page 18 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 20: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/20.jpg)
Draft
Fig. 2 Antibody titer dilution standard curve (A) and effect of ginsenosides Rg1 on HBsAg-specific IgG, IgG1 and IgG2b antibody levels in serum (1:9000) in HBsAg-immunized mice (B). Mice (n = 9/group) were s.c. immunized with saline or HBsAg antigen with or without Rg1 on 7 days and 21 days. Sera were collected
and HBsAg-specific IgG, IgG1 and IgG2b antibody levels in serum were measured by an indirect ELISA. The values were presented as mean ± SD . **P <0.01 vs normal group, #P <0.05, ##P <0.01 vs HBsAg group.
250x93mm (300 x 300 DPI)
Page 19 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 21: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/21.jpg)
Draft
Fig. 3 Effect of ginsenosides Rg1 on the lymphocytes proliferation treatment with ConA and HBsAg stimulation by CCK-8 assay (A) and effect of ginsenosides Rg1 on the mRNA expression of cytokines IFN-
γand IL-4 by RT- PCR (B and C) in splenocytes of HBsAg-immunized mice in vitro. Mice (n = 9/group) were subcutaneously injected with saline or HBsAg with or without Rg1 on 7 days and 21 days. Splenocytes were
prepared 2 weeks after the second immunization and cultured with RPMI 1640 medium. Data were expressed as mean ± SD. *P <0.05 vs normal group, #P <0.05, ##
P <0.01 vs HBsAg group. 80x64mm (300 x 300 DPI)
Page 20 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 22: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/22.jpg)
Draft
Fig 4 Effect of ginsenosides Rg1 on the expression of TLR4 and TLR9 receptor in splenocytes. Mice (n = 9/group) were s.c. immunized with saline or HBsAg with or without Rg1 on 7 days and 21 days. Splenocytes were collected after boosting and stained with FITC-conjugated anti-TLR4/anti-TLR9 antibodies for 30 min in
the dark. TLR4 and TLR9 receptor levels were examined by flow cytometry. The numbers indicate the percentage of cells in the quadrant. The results were presented as mean ± SD(n = 9). **P <0.01,*P <0.05
vs normal group, #P <0.05 vs HBsAg group. 106x243mm (300 x 300 DPI)
Page 21 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology
![Page 23: Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune ... · Vaccine Adjuvant Ginsenosides Rg1 Enhances Immune Responses against Hepatitis B Surface Antigen in Mice Ding Yuan,1,2 Qin](https://reader033.vdocuments.us/reader033/viewer/2022041612/5e38e759a755936f5274bdb6/html5/thumbnails/23.jpg)
Draft
Table 1 PCR Primers
Primer Upstream primer sequence Downstream primer sequence Primer
Length (bp)
GAPDH AAATGGTGAAGGTCGGTGTG TGAAGGGGTCGTTGATGG 108
IFN-γ CGGCACAGTCATTGAAAGCCTA GTTGCTGATGGCCTGATTGTC 199
IL-4 GTTCTTCGTTGCTGTGAGGAC TGTACCAGGAGCCATATCCAC 200
Page 22 of 22
https://mc06.manuscriptcentral.com/cjpp-pubs
Canadian Journal of Physiology and Pharmacology