![Page 1: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/1.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Update on viruses affecting swine production systems
Porcine Epidemic Diarrhea Virus (PEDv)Porcine Reproductive and respiratory syndrome virus (PRRSv)
Seneca Virus A (SVA)
Pablo Pineyro, DVM, MVSc, DVSc, PhDAssistant professor, Veterinary Diagnostic and Production Animal Medicine
Iowa State University, Ames, IA
Iowa Swine DayIowa State University
June 29th, 2017
![Page 2: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/2.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Swine Disease Topics of Interest
• Porcine Epidemic Diarrhea Virus (PEDv)
• Porcine Reproductive and respiratory syndrome virus
(PRRSv)
• Seneca Virus A (SVA)
![Page 3: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/3.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Coronavirus
• Positive sense RNA virus
• 7 open Reading frames 4 structural proteins
• Spike protein (S gene )• Membrane (M)• Envelope (E)• Nucleoprotein (N)
http://wwwuser.cnb.csic.es/~webcoron/research.html
![Page 4: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/4.jpg)
Veterinary Diagnostic LaboratoryIowa State University
CoVs detectados en murciélagos son el origen de los géneros Alphacoronavirus y Betacoronavirus, y los CoVs detectados en aves son el origen de los géneros Gammacoronavirus y Deltacoronavirus (Woo et al. 2012)
![Page 5: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/5.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Porcine epidemic diarrhea (PEDv)Porcine transmissible gastroenteritis (TGEv)Porcine respiratory coronavirus (PRCv)
Porcine Deltacoronavirus (PDCoV)
Porcine Hemagglutinating Encephalomyelitis (PHEV)
![Page 6: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/6.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Enteric • Porcine epidemic diarrhea (PEDv)• Porcine transmissible gastroenteritis (TGEv)• Porcine Deltacoronavirus (PDCoV)
• Porcine epidemic diarrhea (PEDv)• Porcine transmissible gastroenteritis (TGEv)• Porcine Deltacoronavirus (PDCoV)
Respiratory • Porcine respiratory coronavirus (PRCv)• Porcine respiratory coronavirus (PRCv)
SNC and gastro enteric
• Porcine Hemagglutinating Encephalomyelitis (PHEV))• Porcine Hemagglutinating Encephalomyelitis (PHEV))
Clinical signs
![Page 7: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/7.jpg)
Veterinary Diagnostic LaboratoryIowa State University
PEDV current situation
![Page 8: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/8.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Emergency of PEDV in the US
![Page 9: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/9.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Emergency of PEDV in the US
![Page 10: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/10.jpg)
Veterinary Diagnostic LaboratoryIowa State University
29/4/13 12/5/13 15/5/1310/5/13 17/5/13 21/5/13
First case description April 30May 6May 8
TGE PCR (‐)Rotavirus PCR (‐)
Pancoronavirus PCR (+)
Viral sequencingISU + NVSL
First official report of PEDV in United State
ISU sequencing = PEDV (China 2012)
ISU‐VDLSpike‐gen PCR (S‐gene)
Dr. Matt Ackermann
Emergency of PEDV in the US
![Page 11: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/11.jpg)
Veterinary Diagnostic LaboratoryIowa State University
USDA. (SECD) Situation Report – Jun 22, 2017www.aphis.usda.gov/animal‐health/secd.
PEDV: Cumulative confirmed and presumptive PEDV positive premises since June 5, 2014
![Page 12: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/12.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Number of Confirmed Positive Premises by Week
![Page 13: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/13.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Material and Methods
• Inoculation and housing• Inoculation and housing• CDCD piglets• Groups separated by room
• Pigs individually housed in plastic totes
• No contact between pigs• Oro‐gastric inoculation
• 3 hrs post delivery• Challenge 1x10^3 virus• Gastric tube fed milk replacer 3x daily
• Sample collection• Sample collection• Fecal swabs
• Prior to inoculation• Every 12 hrs thereafter
• Necropsy• 12, 24, 48 and 72 hours post infection
• Necropsy samples• Colonic contents• 5 sections of small intestine
• Duodenum, proximal, mid, and distal jejunum and ileum
![Page 14: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/14.jpg)
Veterinary Diagnostic LaboratoryIowa State University
PEDD Clinical signs in experimentally infected animals
• 12 hrs post infection• 30% of animals• Diarrhea and lethargy
• 24, 46, 72 hrs post infection• 100% of piglets• Watery diarrhea and vomiting
dehydration, emaciation
![Page 15: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/15.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Challenge piglets
Gross lesions
Control
![Page 16: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/16.jpg)
Veterinary Diagnostic LaboratoryIowa State UniversityKwonil Jung, et al. 2014
Histological changes associated with PEDV infection
PEDV infects all villi and sporadically infects crypt enterocytes
![Page 17: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/17.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Histological changes associated with PEDV infection
PEDV infects all villi and sporadically infects crypt enterocytes
Necrosis of intestinal mucosa
![Page 18: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/18.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Histological changes associated with PEDV infection
PEDV infects all villi and sporadically infects crypt enterocytes
Necrosis of intestinal mucosa
Atrophy of villi with attenuation, swelling or loss of epithelium on tips of villi,
lateral bridging of villi
![Page 19: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/19.jpg)
Veterinary Diagnostic LaboratoryIowa State University
• Severe diarrhea and vomiting• All ages affected – Older pigs less severe• No response to antibiotic treatment
• High morbidity, variable mortality• Death = 100% if < 7 d, near 100% < 10 d• Older animals survive but may grow slower, breed less
successfully, and shed virus for an extended time
• 24 hour to 4 day incubation period• Affected pigs observed very quickly• Spreads through herds very fast
PEDV Clinical signs in naturally infected animals
![Page 20: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/20.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Dr. Matt Ackermann
![Page 21: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/21.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Dr. Matt Ackermann
![Page 22: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/22.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Diagnostics
• PCR – ready quickly
• Immunohistochemistry
• Serology• IFA• ELISA
• No VI – virus is difficult to grow
• Bioassay to prove infectivity/viability• Time consuming• Expensive• Lacks sensitivity
![Page 23: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/23.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Take home message
• PEDv infection
• Severe malabsorptive and maldigestive diarrhea
• Starting clinical signs at 12 hours post infection (hpi)
• Affecting 100% of piglets at 24 hpi
• Severe villi blunting and atrophy in neonate piglets
• At 12 hpi – lesions duodenum and ileum
• 24 t 72 hpi - lesions are diffuse throughout small intestine
![Page 24: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/24.jpg)
Veterinary Diagnostic LaboratoryIowa State University
PRRSV$664
Million USD /year
PEDV$304
Million USD /year
Dr. Holtkamp‐ ISU
Economic implication of PEDV
![Page 25: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/25.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Swine Disease Topics of Interest
• Porcine Epidemic Diarrhea Virus (PEDv)
• Porcine Reproductive and respiratory syndrome
virus (PRRSv)
• Seneca Virus A (SVA)
![Page 26: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/26.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Swine Respiratory Pathogens
38%
26%
8% 7% 7%3% 3% 2% 2% 2% 1% 1% 1% 0.16% 0.12% 0.07% 0.01%
0%
10%
20%
30%
40%
50%
PERC
ENT OF RE
SPIRAT
ORY
ACC
ESSIONS
![Page 27: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/27.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Number of Bronchointerstitial Pneumonia. Caused by PRRSV Diagnosed at ISU-VDLN
umbe
r of c
ases
/ ye
arN
umbe
r of c
ases
/ ye
ar
![Page 28: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/28.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Clinical Presentations
Porcine Reproductive and Respiratory Syndrome Virus (PRRSv) Background Information
http://www.elsenburg.com/vets/prrs
Abortions Respiratory Disease
http://www.cvm.umn.edu/sdec/prod/groups/cvm/@pub/@cvmhttp://www.elsenburg.com/vets/prrs
Increase Mortality
![Page 29: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/29.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Histological Lesions
![Page 30: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/30.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Commercially Available
• Modified live-attenuated virus (MLV) vaccines
• Inactivated virus vaccine or killed virus vaccine (KV)
Experimental Vaccines
• Viral vector vaccines
• DNA vectors vaccines
• Subunit vaccines
Current Status and Future Direction of PRRSV Vaccine
![Page 31: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/31.jpg)
Veterinary Diagnostic LaboratoryIowa State University
PRRSV diagnosis
![Page 32: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/32.jpg)
Veterinary Diagnostic LaboratoryIowa State University
PRRS Information
16
2 4 26
1317
22
715
19
30
9
76
3745
56 56
101
114
96
81
94
6368
0
20
40
60
80
100
120
May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May
Qtr2 Qtr3 Qtr4 Qtr1 Qtr2
2015 2016
1‐3‐4
1‐7‐4
Total cases analyzed 10401-3-4 pattern: 1441-7-4 patter: 896
![Page 33: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/33.jpg)
Veterinary Diagnostic LaboratoryIowa State University
PRRS MLV PCR
PCR - PRRSV BIVI MLV-likeAnimal ID Specimen Ct / Result CommentB, OF, Tube #2 Oral fluid >40 / Negative
Sequencing and Analysis - PRRSVAnimal ID Specimen Target Gene RFLP CommentB, OF, Tube #2 Oral fluid ORF5 1-3-4 Wild type
Sequence HomologyReference VirusInglevac ATP Lelystad Prime Pac Inglevac MLV FosteraPercent Identity 84.6% 62.7% 85.4% 84.8% 85.6%
NucleotideATGTTGGGGAAATGCTTGACCGCGGGTTATTACTCGCAATTGCTTTTTTTGTGGTGTATCGTGCCATTCTGTCTTGTTGCGCTCGCCAACGCCAACAACGGCAGCAGCTCTCATTTACAGTTGATTTATAACCTGACGATATGTGAGCTGAACGGCACAGATTGGCTGAACGATCATTTCAGCTGGGCGGTGGAGACTTTCGTCATCTTCCCTGCGTTGACCCACATTGTCTCTTATGGCGCCCTCACCACTAGCCATTTTCTTGACACGGTCGGCCTGATCACTGTGTCCACCGCCGGATATTATCACAAGCGGTATGTATTGAGCAGCATTTACGCTGTTTGTGCCCTGGCTGCGTTGGTTTGCTTCGCCATTAGGTTGGCGAAAAATTGCATGTCCTGGCGCTACTCGTGTACTAGATATACCAATTTTCTCCTGGACACTAAGGGCAAACTCTACCGCTGGCGGTCACCCGTCATCATAGAGAAGGGGGGTAAAGTTGATGTTGAGGGCCATTTGATTGACCTCAAAAGAGTTGTGCTTGATGGTTCCGCGGCAACTCCTGTAACCAAAGTTTCAGCGGAACAATGGGGTCGTCCTTAG
PCR Applied Biosystems - PRRSVAnimal ID Specimen US Ct / Result EU Ct / Result CommentB, OF, Tube #2 Oral fluid 25.3 / Positive >=37 / Negative
PCR has primers to MLV vaccine virusPositive indicates vaccine virus
Note:Can’t rule out wild‐type infection in addition to vaccine virus
Slide courtesy of Dr. Darin Madson
![Page 34: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/34.jpg)
Veterinary Diagnostic LaboratoryIowa State University
PRRS Sequencing
• Can there be more than 1 PRRS isolate within a clinical sample?• When you sequence the PCR product, which isolate do you get?• Is the most predominate (highest titered sample) sequenced?• Is that virus the issue?
• PRRS sequencing primers are close to MLV vaccine virus; preferential will sequence this virus even if there are other present
• If near somewhat equal quantities
• May need to use Next Generation Sequencing(NGS) to determine
Slide courtesy of Dr. Darin Madson
![Page 35: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/35.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Swine Disease Topics of Interest
• Porcine Epidemic Diarrhea Virus (PEDv)
• Porcine Reproductive and respiratory syndrome virus
(PRRSv)
• Seneca Virus A (SVA)
![Page 36: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/36.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Swine Vesicular disease
Foot and mouth disease (FMD)
Picornaviridae, Aphthovirus
Swine Vesicular disease
Foot and mouth disease (FMD)
Picornaviridae, Aphthovirus
Swine vesicular disease (SVD)
Picornaviridae, Enterovirus
Swine Vesicular disease
Foot and mouth disease (FMD)
Picornaviridae, Aphthovirus
Swine vesicular disease (SVD)
Picornaviridae, Enterovirus
Vesicular Stomatis(VS)
Rhabdoviridae, Vesiculovirus
Swine Vesicular disease
Foot and mouth disease (FMD)
Picornaviridae, Aphthovirus
Swine vesicular disease (SVD)
Picornaviridae, Enterovirus
Vesicular Stomatis(VS)
Rhabdoviridae, Vesiculovirus
Vesicular exanthema of swine(VESV)
Calicivirdae, Vesivirus
Swine Vesicular disease
![Page 37: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/37.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Foot and Mouth Disease Swine Vesicular Disease
Vesicular ExanthemaVesicular Stomatitis
Clinical Comparison: Snout
Center for Food Security and Public Health, Iowa State University, 2011
![Page 38: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/38.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Idiopathic vesicular disease and neonatal mortality associated (Seneca Virus A)
![Page 39: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/39.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Introduction- Clinical Signs & Lesions
• Vesicular lesions of the snout and feet of sows, lameness• No additional lesions found on necropsy
Canning et al. 2016.
![Page 40: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/40.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Senecavirus A in neonatal pigs
Slide courtesy of Dr. Chris Rademacher
• Piglets- death of weakness, lethargy, diarrhea, hyperemia
![Page 41: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/41.jpg)
Veterinary Diagnostic LaboratoryIowa State University
(Case 4) South Dakota, Finishing herd, 7/29/15. Gross findings
![Page 42: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/42.jpg)
Veterinary Diagnostic LaboratoryIowa State University
(Case 4) South Dakota, Finishing herd, 7/29/15. Gross findings
![Page 43: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/43.jpg)
Veterinary Diagnostic LaboratoryIowa State University
(Case 4) South Dakota, Finishing herd, 7/29/15. Market Pig Shedding Study
![Page 44: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/44.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Senecavirus A diagnosis
![Page 45: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/45.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Detection Methods
• RT‐PCR of vesicular fluid, nasal swabs, serum, oral fluids, tissue• Found in tissues with no pathologic changes
![Page 46: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/46.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Detection Methods
• RT‐PCR of vesicular fluid, nasal swabs, serum, oral fluids, tissue• Found in tissues with no pathologic changes
• Immunohistochemistry (IHC)
• In situ hybridization (ISH)
• Virus isolation
• Electron microscopyJianqiang Zhang, et al
![Page 47: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/47.jpg)
Veterinary Diagnostic LaboratoryIowa State University
• ELISA
• IFA
• Virus neutralization
Detection Methods
![Page 48: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/48.jpg)
Veterinary Diagnostic LaboratoryIowa State University
(Case 5) Neonatal mortality in a sow farm, 9/17/15.
Reports of high neonatal morbidity and increment in mortality rate in pigs less than 7 days.
With or without diarrhea (more common with diarrhea)No significant diagnostic lesions Occasional smooth/mucoid E. Coli isolated and rotavirus detected
![Page 49: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/49.jpg)
Veterinary Diagnostic LaboratoryIowa State University
11 Clinically affected sows 22 piglets11 Clinically normal sows 11 piglets
18%36%
55%9%
18%
27%
0%
20%
40%
60%
80%
100%
Serum Feces Tonsil
Percentage of positive sows
Clinically affetcted Clinically normal
33% 33% 33%
18%36% 27%
0%
20%
40%
60%
80%
100%
Serum Feces Tonsil
Percentage of positive piglets
Clinically affetcted Clinically normal
Field investigation
![Page 50: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/50.jpg)
Veterinary Diagnostic LaboratoryIowa State University
SVA
det
ectio
n ra
te b
y R
T-qP
CR
(%)
Detection of Senecavirus A (SVA) by RT-qPCR in a SVA-affected swine breeding farm
![Page 51: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/51.jpg)
Veterinary Diagnostic LaboratoryIowa State University
IgG
S/P
ratio
Senecavirus A recombinant VP1 protein ELISA sample-to-positive (S/P) IgG antibody response
![Page 52: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/52.jpg)
Veterinary Diagnostic LaboratoryIowa State UniversitySlide courtesy of Jordan Kraft
Senecavirus A PCR Positive Cases by Farm Type
0
2
4
6
8
10
12
14
# SV
A PC
R PO
SITIVE
CAS
ES
DATE BY WEEK
Senecavirus A PCR Positive Cases by Farm Type
Sow Growing Pig Unknown/Other
![Page 53: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/53.jpg)
Veterinary Diagnostic LaboratoryIowa State University
• Increment in cases of Idiopathic Vesicular Disease associate with the presence of SV-A in show and finisher pigs
• Increment in cases of PWM associated with Idiopathic Vesicular Disease in sow and associate with the presence of SV-A
• We identified a new SV-A contemporary strain genetically different from the historical SV-A US strain
Summary
![Page 54: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/54.jpg)
Veterinary Diagnostic LaboratoryIowa State University
• Viral mutation origin
• Host-pathogen interaction
• Predisposing factors
• Clinical, serological and viral prevalence
• Viral persistence in the environment
• Viral inactivation
Question to be answered
![Page 55: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/55.jpg)
Veterinary Diagnostic LaboratoryIowa State University
Thanks for your attention
Questions?
![Page 56: Update on viruses affecting swine production systems ... · (SVD) Picornaviridae, Enterovirus Foot and mouthdisease ... (SV A) by RT-qPCR in a SVA-affected swine breeding farm. Veterinary](https://reader031.vdocuments.us/reader031/viewer/2022011807/5c25112709d3f289468b9dc3/html5/thumbnails/56.jpg)
Veterinary Diagnostic LaboratoryIowa State University