(12) United States Patent Kucherlapati et al.
US006673986B1
US 6,673,986 B1 *J an. 6, 2004
(10) Patent N0.: (45) Date of Patent:
(54)
(75)
(73)
(*)
(21) (22)
(63)
(51)
(52)
(58)
(56)
GENERATION OF XENOGENEIC ANTIBODIES
Inventors: Raju Kucherlapati, Darien, CT (US);
Assignee:
Notice:
Appl. No.:
Filed:
Aya Jakobovits, Menlo Park, CA (US); Sue Klapholz, Stanford, CA (US); Daniel G. Brenner, Redwood City, CA (US); Daniel J. Capon, Hillsborough, CA (US)
Abgenix, Inc., Fremont, CA (US)
This patent issued on a continued pros ecution application ?led under 37 CFR 1.53(d), and is subject to the twenty year patent term provisions of 35 U.S.C. 154(a)(2).
Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 0 days.
This patent is subject to a terminal dis claimer.
08/031,801 Mar. 15, 1993
Related US. Application Data
Continuation-in-part of application No. 07/919,297, ?led on Jul. 24, 1992, now abandoned, which is a continuation-in part of application No. 07/610,515, ?led on Nov. 8, 1990, now abandoned, which is a continuation-in-part of applica tion No. 07/466,008, ?led on Jan. 12, 1990, now abandoned.
Int. Cl.7 .................. .. A01K 67/033; A01K 67/027;
C12N 15/87; C12N 15/63 US. Cl. ......................... .. 800/18; 800/13; 435/325;
435/455 Field of Search .............................. .. 800/2, 13, 18;
4,950,599 4,959,313 5,175,384 5,204,244 5,416,260 5,545,806 5,545,807 5,569,825 5,591,669 6,114,598
424/88; 435/455, 325
References Cited
U.S. PATENT DOCUMENTS
A A A A A A A A A A
8/1990 9/1990 12/1992 4/1993 5/1995 8/1996 8/1996 10/1996
* 1/1997
* 9/2000
Bertling ................. .. 435/1723
Taketo ........ .. 435/691
Krimpenfort . 820/2
Fell et al. .... .. 435/696
Koller ..... .. 820/2
Lonberg ..... .. 800/2
Surani et al. 800/2 Lonberg et al. 800/2 Krimpenfort ...... .. 800/2
Kucherlapati et al. ...... .. 800/18
**** FOREIGN PATENT DOCUMENTS
0 298 807 0 322 240 0 459 372 0 463 151
WO 90/04036 WO 91/10741 WO92/03918 WO 93/05165
6/1988 6/1989 5/1991 1/1992 4/1990 7/1991 3/1992 3/1993
WO 94/00569 1/1994 WO 94/02602 2/ 1994
OTHER PUBLICATIONS
Matsuda et al. (1993) Nat. Genetics, vol. 3, 88—94, 1993.* CoX Declaration, From USPN 5,545,806, Dec. 30, 1997.* Taki et al.* Morrison, Nature 368:812, 1994.* Green et al Nature Gentics 7:13, 1994.* Bruggeman et al PNAS 86:6709, 1989* Shin et al EMBO J 10(12): 3641, 1991.* Matsuda et al Nature Genetics 3: 88, 1993.* Thomas et al Cell 51: 503, 1987.* Jayner et al Nature 338: 153, 1989* Koller et al PNAS 86: 8932, 1989* Bruggeman et al PNAS 86:6712, 1989* Lorem et al NAR 15(23): 9667, 1987.* Bruggeman PNAS 86: 6709, 1989* Muls et al Nature 295: 428, 1982.* Dorfman, Nickolas A., 1985, “The Optimal Technological Approach to the Development of Human Hybridomas,” Journal of Biological Response Modi?ers 4:213—239 Taggart et al., 1983, “Stable Antibody—Producing Murine Hybridomas,” Science 219:1228—1230. Brinster et al., “Introns Increase Transcriptional Ef?ciency in Transgenic Mice”, Proc. Natl. Acad. Sci., USA 85:836—840 (1988). Kucherlapalati, R., “Homologous Recombination in Mam malian Somatic Cells”, Prog. Nucleic Acid Res. Mol. Biol. 36:301—310 (1989). ShimiZu et al., “Immunoglobulin Double—Isotype Expres sion by Trans mRNA in a Human Immunoglobulin Trans genic Mouse”, Proc. Natl. Acad. Sci., USA 86:8020—8023 (1989). Miller, J. et al. Nature(1982) 295:428—430. Yamaura et al., “Cell—Type—Speci?c and Regulated Expres sion of a Human Y1 Heavy—Chain Immunoglobulin Gene in Transgenic Mice”, Proc. Natl. Acad. Sci., USA 83:2152—2156 (1986).
(List continued on neXt page.)
Primary Examiner—Anne M. Wehbe’ (74) Attorney, Agent, or Firm—Fish & Neave; James F. Haley, Jr.; Jane T. Gunnison
(57) ABSTRACT
The subject invention provides non-human mammalian hosts characterized by inactivated endogenous Ig loci and functional human Ig loci for response to an immunogen to produce human antibodies or analogs thereof. The hosts are produced by multiple genetic modi?cations of embryonic cells in conjunction with breeding. Different strategies are employed for recombination of the human loci randomly or at analogous host loci. Chimeric and transgenic mammals, particularly mice, are provided, having stably integrated large, Xenogeneic DNA segments. The segments are intro duced by fusion with yeast spheroplasts comprising yeast arti?cial chromosomes (YACs) which include the Xenoge neic DNA segments and a selective marker such as HPRT, and embryonic stem cells.
3 Claims, 24 Drawing Sheets
US 6,673,986 B1 Page 2
OTHER PUBLICATIONS
Ayares et al., “Sequence Homology Requirements for Inter molecular Recombination in Mammalian Cells”, Proc. Natl. Acad. Sci. USA 83:5199—5203 )1986). Thomas, et al., “Site—Directed Mutagenesis by Gene Tar geting in Mouse Embryo—Derived Stem Cells” (1987) Cell 51:503—512. Koller, et al., “Inactivating the [32—microglobulin locus in mouse embryonic stem cells by homologous recombination” (1989) Proc. Nat’l. Acad. Sci. 86:8932—8935. Berman, et al., “Content and organization of the human Ig VH locus: de?nition of three neW VH families and linkage to the Ig CH locus” (1988) EMBO J. 7:727—738. Burke, et al., “Cloning of Large Segments of Exogenous DNA into Yeast by Means of Arti?cal Chromosome Vectors” (1987) Science 236:806—812. GarZa, et al., “Mapping the Drosophila Genome With Yeast Arti?cial Chromosomes” (1989) Science 246:641—646. BroWnstein, et al., “Isolation of Single—Copy Human Genes from a Library of Yeast Arti?cal Chromosome Clones” (1989) Science 244:1348—1351. Sakano, et al., “Identi?cation and nucleotide sequence of a diversity DNA segment (D) of immunoglobulin heavy— chain genes” (1981) Nature 290:562—565. Tucker, et al., “Mouse IgA heavy chain gene sequence: Implications for evolution of immunoglobulin hinge exons” (1981) Proc. Nat’l. Acad. Sci. 78:7684—7688. Blankenstein, et al., “Immunoglobulin VH region genes of the mouse are organiZed in overlapping clusters” (1987) Eur J. Immunol. 17:1351—1357. Joyner, et al., “Production of a mutation in mouse En—2 gene by homologous recombination in embryonic stem cells” (1989) Nature 338: 153—155. Traver, et al., “Rapid screening of a human genomic library in yeast arti?cial chromosomes for single—copy sequences” (1989) Proc. Nat’l. Acad. Sci. 86:5898—5902. Pachnis, et al., “Transfer of a yeast arti?cal chromosome carrying human DNA from Saccharomyces cerevisiae into mammalian cells” (1990) Pro. Nat’l. Acad. Sci. 87:5109—5113. Briiggemann et al., “A repertoire of monoclonal antibodies With human heavy chains from transgenic mice” (1989) Proc. Nat’l. Acad. Sci. 86:6709—6713. Briiggemann et al., “Construction, Function and Immuno genicity of Recombinant Monoclonal Antibodies” (1990) Behring Inst. Mitt. 87:21—24. Briiggemann et al., “Human antibody production in trans genic mice: expression from 100 kb of the human IgH locus” (1991) Eur J. Immunolog. 21:1323—1326. Albertsen et al., “Construction and characteriZation of a yeast arti?cial chromosome library containing seven haploid human genome equivalents” (1990) Proc. Nat’l. Acad. Sci. 87:4256—4260. Pavan et al., “Modi?cation and Transfer into an Embryonal Carcinoma Cell Line of a 360—Kilobase Human—Derived Yeast Arti?cial Chromosome” (1990) Mol. and Cell. Biol. 10(8):4163—4169. Gnirke et al., “Cloning and in vivo expression of the human GART gene using yeast arti?cial chromosomes” (1991) EMBO Journal 10(7):1629—1634. Eliceiri et al., “Stable intergration and expression in mouse cells of yeast arti?cial chromosomes harboring human genes” (1991) Proc. Nat’l. Acad. Sci. 88:2179—2183.
Huxley et al., “The Human HPRT Gene on a Yeast Articial Chromosome Is Functional When Transferred to Mouse Cells by Cell Fusion” (1991) Genomics 9:742—750. Mortensen et al., “Production of HomoZygous Mutant ES Cells With a Single Targeting Construct” (1992) Mol. and Cell. Biol. 12(5):2391—2395. Davies et al., “Targeted alterations in yeast arti?cial chro mosomes for inter—species gene transfer” (1992) Nucl. Acids Res. 20:2693—2698.
Zachau, “The Human Immunoglobulin k Locus and Some of its Acrobatics” (1990) Biol. Chem. 371:1—6. Matsuda et al., “Structure and physical map of 64 variable segments in the 3’0.8—megabase region of the human immu noglobulin heavy—chain locus” (1993) Nature Genetics 3:88—94. Shin et al., “Physical map of the 3’ region of the human immunoglobulin heavy chain locus: clustering of autoanti body—related variable segments in one haplotype” (1991) EMBO 10:3641—3645.
Ayares, et al., “Sequence Homology Requirements for Inter molecular Recombination in Mammalian Cells,” Proc. Natl. Acad. Sci. USA 83:5199—5203 (1986). Berman, et al., Content and Organization of the Human Ig VH Locus: De?nition of Three NeW VH Families and Linkage to the Ig CH Locus, EMBO J. 7:727—738 (1988). Brinster, et al., “Introns Increase Transcriptional Ef?ciency in Transgenic Mice,” Proc. Natl. Acad. Sci., USA, 85:836—840 (1988). Buttin, et al., “Exogenous Ig Gene Rearrangement in Trans genic Mice: A NeW Strategy for Human Monoclonal Anti body Production,” Trends in Genetics 3(8):205—206 (1987). Capecchi, et al., “Altering The Genome By Homologous Recombination,” Science 244:1288—1292 (1989). Choi et al., “RNA Splicing Generates a Variant Light Chain from an Aberrantly Rearranged k Gene,” Nature 286:776—779 (1980). Doetschman, et al., “Targeted Mutation of the Hprt Gene in Mouse Embryonic Stem Cells,”Proc. Natl. Acad. Sci. USA 85:8583—8587 (1988). Green, et al., “Antigen—Speci?c Human Mnonoclonal Anti bodies from Mice Engineered With Human Ig Heavy and Light Chain YACs,” Nature Genetics 7:13—21 (1994). Hooper et al., “HPRT—De?cient (Lesch—Nyhan) Mouse Embryos Derived from Gemline ColoniZation by Cultured Cells,” Nature 326:292—295 (1987). J akobovits, et al., “Germ—Line Transmission and Expression of a Human—Derived Yeast Arti?cial Chromosome,” Nature 362:255—258 (1993). Johnson, et al., “Targeting of Nonexpressed Genes in Embryonic Stem Cells Via Homologous Recombination,” 245:1234—1236 (1989). Kucherlapati, R., “Homologous Recombination in Mamma lian Somatic Cells,” Prog. Nucleic Acid Res. Mol. Biol. 36:301—310 (1989). Mansour, et al., “Disruption of the Proto—Oncogene Int—2 In Mouse Embryo—Derived Stem Cells: A General Strategy for Targeting Mutations to Non—Selectable Genes,” Nature 336—352 (1988). Max, et al., “Sequences of Five Potential Recombination Sites Encoded Close to an Immunoglobulin k Constat Region Gene,”Proc. Natl.Acad. Sci., USA 76(7):3450—3454 (1979).
US 6,673,986 B1 Page 3
Miller, et al., “Structural Alterations in J Regions of Mouse Immunoglobulin )» Genes are Associated With Differential Gene Expression,” Nature 295:428—430 (1982). Morrison, “Success in Speci?cation,” Nature, 368:812—813 (1994). Orkin, et al., “Mutation in an Intervening Seguence Splice Junction in Man,” Proc. Natl. Acad. Sci. USA 78(8):5041—5045 (1981). RajeWsky, et al., “Evolutionary and Somatic Selection of the Antibody Repertoire in the Mouse,” Science 238:1088—1094 (1987). RamireZ—Solis, et al., “Chromosome Engineering in Mice,” Nature 378:720—724 (1995). Sakano, et al., “Sequences at the Somatic Recombination Sites of Immunoglobulin Light—Chain Genes,” Nature 280:288—294 (1979). Sakano, et al., “TWo Types of Somatic Recombination are Necessary for the Generation of Complete Immunoglobulin Heavy—Chain Genes,” Nature 286:676—683 (1980). Schedl, et al., “Transgenic Mice Generated By Pronuclear Injection of aYeast Arti?cal Chromosome,” Nucl. Acids Res. 20:3073—3077 (1992). Schedl, et al., “A Method for the Generation of YAC Transgenic Mice by Pronuclear Microinjection,” Nucleic Acids Research 21(20):4783—4787 (1993). SchWartZberg et al., “Germ—Line Transmission of a c—abl Mutation Produced by Targeted Gene Disruption in ES Cells,” Science 246:799—803 (1989). Seidman et al., “A Mutant Immunoglobulin light Chain is Formed by Aberrant DNA—and RNA—Splicing Events,” Nature 286:779—783 (1980).
ShimiZu, et al., “Immunoglobulin Double—Isotype Expres sion by Trans—mRNA in a Human Immunoglobulin Trans genic Mouse,” Proc. Natl. Acad. Sci., USA 86:8020—8023 (1989). Straus, et al., “Germ Line Transmission of a Yeast Arti?cial Chromosome Spanning the Murine (x1(1) Collagen Locus,” Science 259:1904—1907 (1993).
Taki, et al., “Targeted Insertion of a Variable Region Gene into the Immunoglobulin Heavy Chain Locus,” Science 262:1268—1271 (1993).
Treisman, et al., “Speci?c Transcription and RNA Splicing Defects in Five Cloned [3—thalassaemia Genes,” Nature 302:591—596 (1983). Yamamura, et al., “Cell—Type—Speci?c and Regulated Expression of a Human yl Heavy—Chain Immunoglobulin Gene in Transgenic Mice,” Pr0c. natl. Acad. Sci. USA 83:2152—2156 (1986). Yancoupoulos, et al. “Developmentally Controlled and Tis sue—Speci?c Expression of Unrearranged VH Gene Seg ments,”, Cell 40:271—281 (1985).
Yancoupoulos, et al., “Reconstruction of an Immune Sys tem,” Science 241:1581—1583 (1988).
Zijlstra, et al., Germ—Line Transmission of a Disrupted [32—microglobulin Gene Produced by Homologous Recom bination in Embryonic Stem Cells, Nature 342—435—438 (1989).
* cited by examiner
U.S. Patent Jan. 6, 2004 Sheet 1 0f 24 US 6,673,986 B1
EUEI ll EEom li Eoou IF Eouw
I‘ 500m :41
|<—- 2800 bp
28“
FIG. IB
U.S. Patent Jan. 6, 2004 Sheet 5 0f 24 US 6,673,986 B1
“3 .2... ommm *9 no. N8 F9 on. 3 a: 6%
+9 m8 N2 .2 69
<<Q ‘_ i 5,“
200 <-—~--—-—-—
NUMBER OF cELLs
m4 .2“. 6 , 629 +9. n9 N9 F9 09
0
Ro+ m4 6E 62 “E NE E. in.
3 ,2“. #9 “9 N9 For o9
w
200 ‘--—--'-----_-__ ' -
NUMBER OF ems NUMBER OF CELLS
U.S. Patent Jan. 6, 2004 Sheet 7 0f 24 US 6,673,986 B1
gagié?ésgogg?zgéé 3 g 255 5 a5 52%
~82 .
» , . wow $06 "as" 2.5m “gm
U.S. Patent Jan. 6, 2004 Sheet 8 0f 24 US 6,673,986 B1
NATMZ ES CELL LOCUES
EcoRIEIcoWBgmEcoRI Hindlll B9111 B9111 BomHll E1911]
I |’/ l : 2 : :l 1220 hp
BomH [ EH PROBE -_ /Bg) 2,310 bp 59] H DlGESTiON .._.__.__.___.+
1700 bp Hind m/Bgl I! PROBE _
15000 ‘bp EcoR I DQGESHON 4 ,’
TARGEYED ES CELL. LOCUS 39m " EcoRI
EcéaRI ‘ BgmEcoRI Handm 8g!!! E 38mm BomHlBgllI co 1 c 1R“ i L:::::'' .- ~__-L-_J
1220 bp 1 -
II PROBE Bum“ V89’ 5730 bp 891 I1 msesnou ¢ #
.' 1700 bp Hind Ill/8g] I! PROBE.
5040 bp <—
EcoR I DlGESTION 11 40 up Neo PROBE _
5730 bp 4 H»
8g] 1! 01015511014
FIG. 7
U.S. Patent Jan. 6, 2004 Sheet 9 0f 24 US 6,673,986 B1
J REGION KNIOCKOUT VECTOR BgIII Xbol EcoR] EcoRI
I / PGK {It DSH MCI N00
J‘I J2 J3 J4
TARGEI'ING ‘SCHEME
BomI-II EcoR! EcoRI EcoRl B911] B911] BclmHl
uLaz J5 J4 $395M //f8'g<m\ EcoRI EcoRI
‘Lam; MCI N60
1 I 1 1 | I I I I J1J2 J3 J4 PGK tk
HOMOLOGOUS l 6418 REMOMBINA'I'ION SELECTION
xbol EcoRi/Xb?l I EcoRI Bglll IXboI EcoRI EcoRI BumHI W ETHI l v 08H; L, I
Eli" " "- J1J2 613614 PGK tk N01 N90
CYCLOVIR EXCISION 1 $01106: BcmHI Xboi EcoRl EcoRI BomHI
I IIJEI ' MCI
Neo
FIG. 8
U.S. Patent Jan. 6, 2004 Sheet 12 0f 24 US 6,673,986 B1
Hindml EcoRl KpnI BomHI Soc! Not! MGC'ITATAGAATTCGGTACCTGGATCCTGAGCTCATAGCGGCCG‘CAGCT
CAJGTTCGAATATCTTAAGCCATGGACCTAGGACTCQGTATCGCC GGCG
,A-lindm , II‘EcoRI
SCOL -'KpnI -—BomHI
115w pSK,Ct NQtI
i coRI
Seal ind!!! KpnI BomHI
Soc!
pSK.C:/3'K F‘ G“ 9-3
BomHI
pSKC/Ia'K/DT
U.S. Patent Jan. 6, 2004 Sheet 13 0f 24 US 6,673,986 B1
EcoRI
FIG. l0
\‘Xhol . EcoR'l EcoRI QBMEA N60
Kappa
U.S. Patent Jan. 6, 2004 Sheet 17 0f 24 US 6,673,986 B1
Fl :5. HA FIG. 73B