Transcript
Page 1: transforming love of Jesus Christ and his Church. · 9:30 a.m. 11:30 a.m 7:00 p.m. Roselyn Stenzi Frances Castorina Elizabeth Chirdo Annunziata and Joe Fasolo All Parishioners Sunday,

Our mission is to be warm and welcoming community acknowledging our unique gifts from God and being ready to share them so that we continue to grow in ministry, we strive to embrace those who have left our family of faith, care for our brothers and sisters in need, promote respect,

peace, and justice for all people and strengthen unity within our parish community within diversity. Through the celebration

of the Sacraments, Prayer, and Action, we seek to grow in transforming love of Jesus Christ and his Church.

Pastor Fr. Reinerio B. Agaloos

[email protected] — Phone ext. 203

Parochial Vicar Fr. Diego Navarro

[email protected] — Phone ext.202

Director of Faith Formation William Schulenburg

[email protected] Phone ext. 204

Pastoral Assistant Sr. Alice Nagl, FSP

[email protected]—Phone ext. 204

Business Manager Donna Berg

[email protected] Phone ext. 201

Musical Director Asta Narmontaite

Cantor Kevin Grace

St. Leo’s Parish School — Principal Elizabeth Ventola

Masses

Saturdays 5:00 p.m. Sundays 7:30 a.m.,

9:30 a.m., 11:30 a.m. Spanish Mass 7:00 p.m.

Weekdays 12:10 p.m.

Weekdays Livestream Mass 12.10 p.m

Sundays Livestream Mass Spanish 7:00 p.m.

English 9:30 a.m., 11:30 a.m.

Spanish Prayer Group Tuesdays 7:30 p.m.

Holy Hour First Friday of each month 7:00p.m.

Matrimony Please contact one of our priests

one year in advance of the desired date.

RCIA/Christian Initiation & Baptism

All Sacraments are giving with some limits and restrictions, please contact

the parish for more information.

324 Market Street, Elmwood Park, NJ 07407

Rectory 201-796-3521

Fax: 201-703-8408 www. stleosep.org

Convent

201-797-6993

School 201-796-5156

Fax: 201-796-2092 www.stleosschool.org

Twenty –Sixth Sunday in Ordinary Time September 27, 2020

Page 2: transforming love of Jesus Christ and his Church. · 9:30 a.m. 11:30 a.m 7:00 p.m. Roselyn Stenzi Frances Castorina Elizabeth Chirdo Annunziata and Joe Fasolo All Parishioners Sunday,

REFLECTIONN

THE HEART IS STEADY For the deeply prayerful person and those intent by the power of God to attain holiness, the ever-persistent problem seems to be fighting distractions in prayer. Distraction is exactly what the Creator has allowed for most of us. It is precisely what makes us human. The fact that our minds drift away so easily from the intended object of our thought and our heart demonstrates our humanity. St. Therese of Lisieux, known as the “Little Flow-er,” handled distraction this way: Any person or problem that becAme her distraction at prayer was immediately lifted up in her prayer before God. In this way, she quickly supernaturalized a natural hap-pening. It is a wonderful lifelong intention to make. When we come to prayer there are two parts of us that we should understand. One is the mind, which is naturally inclined to distraction and the other is the heart, which remains steadfast in its loving attitude. Oftentimes people get terribly disturbed about these distractions. What we must understand, however, is that distraction is a marvelous opportunity to show the Lord Jesus that we love him by disciplining our thoughts to focus on Him alone. Let us take, for example, the man who calls the rectory to go to confession on a hot summer day. He drives a half hour in stifling heat. He arrives at the rectory and kneels on both knees, hands folded with head bowed, tears gently falling from his eyes, at the end of which I ask, “Are you truly sorry for your sins?” He answers humbly, “I don’t think I really am enough.” Well, the answer is that anyone who would do what he did after much time and sacrifice, and is in such a physical posture of reverence, humility, and sincerity, is unquestionably sorry. – In the same way the person who is in a physical posture of prayer is already demonstrating the attitude of his heart. The mind may wander, but the heart remains steadfast. Thus, we should not get so depressed over distrac-tions, because God looks at the steadfastness of our heart and its intent to keep Him first. The road to sanctity is not level. It is a mountain and it is all uphill. May I share some of my personal distractions with you while attempting devoutly to say the rosary? “Hail Mary, full of grace . . . I wonder if I’m going to have that wonderful Italian toast for breakfast?” “The Lord is with you . . . I must not for

get that funeral Mass at 9:30. It will take up my whole morning. No wonder I never get anything done.” “Blessed are you among women . . . You might think that the great love of God would draw more people to the weekday Masses. What do people think about anyway?” “Blessed is the fruit of thy womb Jesus” . . . Did I return my book to the li-brary?” “Holy Mary, Mother of God . . . I’ve got to get my car inspected. Would you please keep your mind on your prayers!?” Thank God, even though my mind is not steady, my heart is. I think many people do not pray because they say, “Oh well, with my continuous distractions my prayer cannot be worth anything.” But it is worth much! So, what should we do about distraction at prayer? Just always remember that something remains perma-nent – the heart. Our determination, therefore, must be “Don’t lose heart!”

Monsignor Felix A. Losito

Page 3: transforming love of Jesus Christ and his Church. · 9:30 a.m. 11:30 a.m 7:00 p.m. Roselyn Stenzi Frances Castorina Elizabeth Chirdo Annunziata and Joe Fasolo All Parishioners Sunday,

Ashley Rahill, Alyssa Obispo, Jean Lombardo, James LaPorte, Patti Lacitignola, Fran Sheridan, Loretta Komsa, Julius Tourso, Mike Loscalzo, Gianna Cruz, Brandon Higgins, Irene Glode, Ruth Kamm, Richard Hommel, Orlando Escobar, Aura Lozano, Rosa Cintron, Erica Guy, Carmelina Sanchez. Gloria Funes, Aida Dalandan, Frank Polglaze, Darlene Kola-kovic, Fannie Escobar, José Barrios, Frances Gould, Karen Gambert, Beatrice Chirdo, Baby Archer Val-dez, Gordon Sabol, Pauline De Stefano, Dolores Rybi-cki, Irene Alexander, Wadriana Dumanovski, William McKenzie, Frank Puglis, Richard Cioffi, Inez Roberts, Daniela Bongiovani, Sylvia Covella If someone in your immediate family is hombebound or hospitalized and would like a visit from a priest, and would like communion on a weekly basis (Sunday a.m.), please contact the Rectory. (If you want to be removed from this list, please call the rectory office).

Sunday, September 27, 2020 7:30 a.m. 9:30 a.m. 11:30 a.m 7:00 p.m.

Betty La Porte Frank Benati Grace & Pat LaGreca Richard Plecs Michael Buffalino All Parishioners

Monday, September 28, 2020 12:10 p.m. Giuseppe Incorvaia

Sandra Niforos Tuesday. September 29, 2020 12:10 p.m. Halina and Jerry Kaczmarek Wednesday, September 30, 2020 12:10 p.m. Enrico Esguerra

Remedios Esguerra Aida Buhian

Thursday, October 1, 2020 12:10 p.m. George and Dorothy Meade Friday, October 2, 2020 12:10 p.m. Carmela Nicosia Saturday, October 3, 2020 5:30 p.m.

Perpetual Society

Flavio Antonio de la Cruz Joseph Marrone

Leticia Yaptangco Soledad A. Etanislao Rimando MD Camille Rohn Eileen McCann Guclielma Zisa Carmenla Corallo Sandra Niforos Carmela Corallo

7:30 a.m. 9:30 a.m. 11:30 a.m 7:00 p.m.

Gene Della Vecchia Tony Jakubek and grandson June Mooney Salvatore, Guglielmo and Orazio Candelaria Chang

Sunday, October 4, 2020

Reading I: Ezekiel 18: 25-28 In a question and answer format, the author deals both with people who repent of their evil, and those who turn to it. He provides his responses to both.

Reading II: Philippians 2: 1-11, or 2: 1-5 The scholars tell us this beautiful passage Paul quotes is actually from an early Church hymn. The first part sings of the Lord’s abasement; the second of His earned exaltation.

The Gospel: Matthew 21: 28-32 This parable continues earlier stories in Matthew about the people who actually are part of God’s kingdom. Jesus tells the religious leaders in his audience that “tax collectors and prostitutes are going into the kingdom of God ahead of you.” The folks who look the least religious will enter God’s kingdom ahead of religious leaders, because in the end they do God’s will.

Page 4: transforming love of Jesus Christ and his Church. · 9:30 a.m. 11:30 a.m 7:00 p.m. Roselyn Stenzi Frances Castorina Elizabeth Chirdo Annunziata and Joe Fasolo All Parishioners Sunday,

Religious Education/CCD

With the advent of the Covid-19 virus, in person CCD classes are not deemed safe or wise. Therefore, our regular CCD classes have been moved to the internet and are now virtual. Textbooks for grades one(1) through six(6) are available in the rectory for those who have made CCD tuition pay-ments. It is still necessary for students to be registered for classes. Should you have any questions – feel free to contact Bill at 201-796-3521 ex204 or at [email protected].

SATURDAY, OCTOBER 3, 2020 AT 12 PM – 12:30 PM

We will be giving the Blessing of Animals on the occasion of the Memorial of St. Francis.

All God's Creatures are welcome at St Leo. We ask St. Francis' intercession for our pets.

Bring your Dogs, Cats, Hamsters, Birds, Snails, Turtles, Fish, Rabbits, Mice, Snakes, Lizards,

Ants, Spiders, Tarantulas, Guinea Pigs, Parrots, Horses, etc

We will meet in front of the rectory on the lawn. At 12:00 pm

Weekly Cash Statement 9/16/2020-9/23/2020

Cash In

Beginning Cash Balance $61,972

Weekly Offertory Envelopes $6,139

Weekly Offertory-E Giving $1,135

Other Income $434

Candles $403

Total Cash In $8,111

Cash Out

Bills Paid $4,951

Benefits (from School for shared services) -$1,075

Ending Cash Balance $62,633

Unpaid Bills $76,480

Payroll $3,574

TOTAL CASH OUT $7,450

** NOTE - Bills Paid Include: priests car allowance ($1,080), ADP fees ($67), empanadas ($883 [amount raised $2,267 previously reported]), can-dles ($1,227), hand disinfecting supplies ($263), ho-ly water containers ($114), office supplies ($42), boiler repair ($1,000 ($2,000 still owed]), The Advo-cate ($74), misc ($200).

Page 5: transforming love of Jesus Christ and his Church. · 9:30 a.m. 11:30 a.m 7:00 p.m. Roselyn Stenzi Frances Castorina Elizabeth Chirdo Annunziata and Joe Fasolo All Parishioners Sunday,

St Leo’s RC Church, Elmwood Park, NJ September 27, 2020 0

Dedication of Gifts Consider a dedication to honor a loved

one, living or deceased, through the donation of the Gifts to be used during the Celebration of Mass. $25.00 each.

If you would like to make your giving easy and consistent, then please

consider our electronic giving. If you would like to learn more, please contact our parish office: 201-796-3521 or go to

our website: www.stleosep.org and click on the Parish Giving logo, located on the home page and follow the easy

registra on instruc ons.

It’s Simple, It’s Secure, It’s Convenient, it has Tax Benefits, as well as Parishioners’ Benefits, and it keeps God at the top of

your giving list even when you are away.

Wednesday, September 30, 2020 7:00 PM In the Church (Facemask required)

Come and have a break from your daily rou ne. Please contact The rectory to let us

know if you are a ending. Prayer - Music - Medita on. Led by Fr. Jim Worth,

Pastor of St Joseph's Church in Maplewood, NJ

COST: Free Will offering.

All Souls Day Remembrance AAAAAAAAAAAAAAAAAAllllllllllllllllllllllllllllll SSSSSSSSSSSSSSSSSSoooooooooooooooooouuuuuuuuuuuuuuuuullllllllllllllssssssssssssssssss DDDDDDDDDDDDDDDDDDaaaaaaaaaaaaaaaaaayyyyyyyyyyyyyyyyyy RRRRRRRRRRRRRRRRRReeeeeeeeeeeeeeeeeemmmmmmmmmmmmmmmmmmeeeeeeeeeeeeeeeeeemmmmmmmmmmmmmmmmmmmbbbbbbbbbbbbbbbbbbrrrrrrrrrrrrrrrrrraaaaaaaaaaaaaaaaaannnnnnnnnnnnnnnnncccccccccccccccccceeeeeeeeeeeeeeeeee eeee Candle Offering

ouuuuuuuuulllllllssssssssssss DDDDDDDDaaaaaaaayyyyyyyyyyyyyyyyy RRRRRRRRRRRRReeeeeemmmmmmmmmmmmmmeeeeeeemmmmmmmmmmmbbbbrrrryyyCCCCCCCCCCCCCCCCCCaaaaaaaaaaaaaaaaaannnnnnnnnnnnddddddddddddddddllllllleeeeeeeeeeeeeeeee OOOOOOOOOOOOOOOOOOffffffffffffffffffeeeeeeeeeeeeeeeeeerrrrrrrrrrrrriiiiiiiiinnnnnnnnnnnnnnCCCCCCCCCCCCCCCCCCaaaaaaaaaaaaaaaannnnnnnnnnnnnnnnddddddddddddddddddlllllllllllllllleeeeeeeeeeeeeeee OOOOOOOOOOOOOOOOOOffffffffffffffffffffffffffffffffffeeeeeeeeeeeeeeeerrrrrrrrrrrrriiiiiiiiiiiiiiiinnnnnnnnnnnnnnn

aaaaaaaaambbbbbbbbbbrrrrrggggggggggggggggggggggggggggggggggg

Remember your deceased loved ones and friends with a vo ve candle in their memory.

The candles will burn in Church from November 2 un l November 8.

Fill out the form located in the Church. Or contact the rectory 201-796-3521 ext. 201, 202

One candle per person. $15 each. Checks payable to St Leo’s.

HOLY WATER is now HOLY WATER is nowavailable at the

w nowee available at thee

Baptismal font

WE ARE NOW

OFFERING SPECIAL

CANDLES FOR YOUR

LOVED ONES

FOR A DONATION

OF $3.OO EACH.

THANK YOU!

Page 6: transforming love of Jesus Christ and his Church. · 9:30 a.m. 11:30 a.m 7:00 p.m. Roselyn Stenzi Frances Castorina Elizabeth Chirdo Annunziata and Joe Fasolo All Parishioners Sunday,

St. Leo’s Food Pantry

Through your love and care, we will help those in most need. For Thanksgiving and Christmas Bas-kets, we need Beans, Chicken broth, Soup, Canned vegetables, Gravy, Cranberry sauce, Tuna, Cake mix, Mashed potatoes, Mac n cheese, Rice, Peanut butter, Jel-ly, Cereal.

We will accept frozen turkeys and monetary contributions to buy the fresh food.

The three Archangels Michael, Gabriel and Raphael are the only angels named in Sacred Scripture and all three have important roles in the history of salvation. Saint Michael is the "Prince of the Heavenly Host," the leader of all the angels. His name is Hebrew for "Who is like God?" and was the battle cry of the good angels against Lucifer and his followers when they rebelled against God. He is mentioned four times in the Bible, in Daniel 10 and 12, in the letter of Jude, and in Reve-lation. Michael, whose forces cast down Lucifer and the evil spirits into Hell, is invoked for protection against Satan and all evil. Pope Leo XIII, in 1899, having had a pro-phetic vision of the evil that would be inflicted upon the Church and the world in the 20th century, institut-ed a prayer asking for Saint Michael's protection to be said at the end of every Mass. Christian tradition recognizes four offices of Saint Mi-chael: (i) to fight against Satan (ii) to rescue the souls of the faithful from the power of the enemy, especially at the hour of death. (iii) to be the champion of God's people, (iv) to call away from earth and bring men's souls to judgment. "I am Gabriel, who stand before God." (Luke 1, 19) Saint Gabriel, whose name means "God's strength," is mentioned four times in the Bible. Most significant are Gabriel's two mentions in the New Testament: to an-nounce the birth of John the Baptist to his father Zach-arias, and the at Incarnation of the Word in the womb of Mary. Christian tradition suggests that it is he who appeared to St. Joseph and to the shepherds, and also that it was he who "strengthened" Jesus during his agony in the garden of Gethsemane. "I am the angel Raphael, one of the seven, who stand before the Lord" (Tob 12:15) Saint Raphael, whose name means "God has healed" because of his healing of Tobias' blindness in the Book of Tobit. Tobit is the only book in which he is men-tioned. His office is generally accepted by tradition to be that of healing and acts of mercy. Raphael is also identified with the angel in John 5:1-4 who descended upon the pond and bestowed healing powers upon it so that the first to enter it after it moved would be healed of whatever infirmity he was suffering.

Beautiful October!!

The beauty of fall with its cool temperatures and beautiful foli-age displays energizes most people. Would you be willing to

channel some of your energy to gather any unwanted clothing, shoes, small appliances, linens, sheets, towels, toys, stuffed

animals, and books (no reference books) for the Catholic Charities donation bin? Thank you.

St. Ann’s Council #2853 will be participating in the Fair Lawn Town Wide Garage Sale on Satur-day October 10 and Sunday Octo-ber 11 at the Knights of Columbus

Hall located at 16-16 Maple Avenue, Fair Kawn. All proceeds will go to the Columbiettes Fundrais-er Fund. Please come and support our Auxiliary.

Page 7: transforming love of Jesus Christ and his Church. · 9:30 a.m. 11:30 a.m 7:00 p.m. Roselyn Stenzi Frances Castorina Elizabeth Chirdo Annunziata and Joe Fasolo All Parishioners Sunday,

6001 Th e Catholic Community of St. Leo, Elmwood Park, NJ (inside) John Patrick Publishing Company, Inc. 1.800.333.3166 • www.jppc.net

ROOFING • SIDING • WINDOWS • MASONRY • BATHROOMSROOFING • SIDING • WINDOWS • MASONRY • BATHROOMS

973973--473473--48304830Or Call Jim’s Cell at 973-768-3432

140 Arlington Ave.CLIFTON

FREE IN-HOME ESTIMATESFREE IN-HOME ESTIMATESwww.AffordableHomeServicesNJ.com

NJ Lic # 13VH08315300

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chem-ical & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticiticiticiticticiticitictictiiticiticiticitical al al Mal Mal Mal Mal al al anufacturing - Chemalalalalalallallllll & H& H& H& H& H& H& H& H& H& H&&& azarzarzarzarzarzarzararararararararrddoddododododousddododododod Materials Financiaervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw Enw EnEnEnEnEnEnnffffforfoforforforcforcforcforforffo ement, Public Safety

To all thosenforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ement, Public Safetyc Safetythan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tettttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle to make sure it is the car they

are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you moneywith your monthly payments on your

commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos.

Can close in as little as 45 days! Four season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

Wedding Invitations Wedding Invitations & Holiday Cards& Holiday Cards

Log onto Log onto www.jppc.netwww.jppc.net conveniently from yourconveniently from your

home or office.home or office.Online Catalog • Online OrderingOnline Catalog • Online Ordering

Online Proo ngOnline Proo ngAll Major Credit Cards AcceptedAll Major Credit Cards AcceptedFREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!

B U I L DB U I L DY O U R Y O U R

C O M M U N I T YC O M M U N I T Y- Shop Local -

P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Community support worthy of patronizing!

©iS

tock

.com

/Joh

nPat

rick

Publ

ishi

ng

1.800.333.3166 ext.161 | www.JPPC.netFAMIL IAR • TRUSTED • PROVEN EFFECT IVE . . . NOW THAT’S ADVERTISING!NOW THAT’S ADVERTISING!

This happens for thousands every day with church bulletin advertising!The constant visual presence your business needs to succeed.

DOES YOUR ADVERTISING

CHURCH BULLETIN ADVERTISINGADVERTISING• Establish a relationship? • Build a friendship? • Earn referrals? • Generate a testimony? • Capture repeat business? Jp JOHN PATRICK

publishing company, inc.

Serving Lunch & DinnerOpen Seven Days

TEL: 201.791.0025FAX: 201.791.0039

205 Market StreetElmwood Park, NJ 07407

Page 8: transforming love of Jesus Christ and his Church. · 9:30 a.m. 11:30 a.m 7:00 p.m. Roselyn Stenzi Frances Castorina Elizabeth Chirdo Annunziata and Joe Fasolo All Parishioners Sunday,

6001 Th e Catholic Community of St. Leo, Elmwood Park, NJ (back) John Patrick Publishing Company, Inc. 1.800.333.3166 • www.jppc.net

Patrick J. Conte Funeral Home, Inc.Dignifi ed Service to the Community

Stephen P. Conte, Jr. Mgr. N.J. Lic. No. 3785

Robert Kassai N.J. Lic. No. 3306

Reg. Agent N.J. Prepaid Funeral Trust FundPatrick J. Conte, Sr. 1903-1993

Stephen P. Conte, Sr. 1934-2007

274 Market Street • Elmwood Park 201-796-0060

D&J Plumbing & Heating, Inc.Service Is Our Specialty

Water Heaters • BoilersPlumbing Repairs • Drain Cleaning

David Siedel, Master Plumber, Lic #9301

973-773-4328Clifton, NJ

Your Care Care Center

201.797.9809348 Market St, Elmwood Park

201.796.2054201.796.2054241 Market Street, Elmwood Park241 Market Street, Elmwood Park

www.GloriasFlorist.comwww.GloriasFlorist.com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send

your email address by text message: Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

THOMAS J. DUCHATTORNEY AT LAW

Estate Planning • Real EstateLand Use • Business Law201-794-7234

[email protected] Mola Blvd., Elmwood Park

Służymy Polonii oferując szeroki zakres usług fi nansowych: konta oszczędnościowe i czekowe, karty kredytowe i debetowe VISA®, kredyty hipoteczne, pożyczki personalne oraz pełny serwis bankowości Internetowej i mobilnej. Dla przedsiębiorców oferujemy kredyty biznesowe i konta bez opłat. Otwórz konto przez internet na stronie www.NaszaUnia.com lub odwiedź nasz oddział w Garfi eld (75 River Drive, Garfi eld, NJ 07026, tel. 973.777.4234).

1.855.PSFCU.4Uwww.NaszaUnia.com

UNIA KREDYTOWA TO WIĘCEJ NIŻ BANK!


Top Related