Download - Tranfer Report Final 12.11
-
8/3/2019 Tranfer Report Final 12.11
1/63
DPhil Transfer Report
Allele-specific silencing of proteinsof the neuromuscular junction
Angie BibaOctober 2007
Supervisor: Prof. David Beeson
-
8/3/2019 Tranfer Report Final 12.11
2/63
Contents
Page
Abbreviations 3
Introduction 4
Aims 10
Results 1 11
Results 2 24
Results 3 34
Discussion 47
Future Experiments 51
Appendix 57
References 61
2
-
8/3/2019 Tranfer Report Final 12.11
3/63
Abbreviations
ACh Acetylcholine
AChR Acetylcholine receptor AD Autosomal dominantCMS Congenital myasthenic syndromemiRNA Micro RNApri-miRNA Primary micro RNAqRT-PCR Quantitative real-time PCRRISC RNA induced silencing complexRNAi RNA interferenceRT-PCR Reverse transcription PCRSCCMS Slow channel congenital myasthenic syndrome
shRNA Short hairpin RNAsiRNA Small interfering RNA
3
-
8/3/2019 Tranfer Report Final 12.11
4/63
Introduction
RNA interference (RNAi) is a mechanism of gene regulation mediated
by RNA. In nature, RNAi is initiated with the transcription of relative small non-
coding DNA sequences in the nucleus named primary microRNAs (pri-
miRNAs) (Lee et al. 2002). These are then cleaved in the nucleus by the
nuclear RNase III Drosha to produce ~70 nt long pre-miRNAs (Lee et al.
2003), the secondary structure of which is characterised by bulges and hairpin
forms. Pre-miRNA is exported from the nucleus to the cytoplasm by Exportin 5
(Yi et al. 2003; Bohnsack et al. 2004). Once in the cytoplasm pre-miRNA is
cleaved by the RNase III Dicer to produce 21-22 nt long double stranded
miRNAs (Bernstein et al. 2001; Provost et al. 2002). The antisense strand of
miRNAs is then used as a guide by the cytoplasmic protein RNA-induced
silencing complex (RISC) to identify cognate mRNA (Hammond et al. 2000;
Ameres et al. 2007). Partial complementarity between miRNA and target
mRNA leads to translational suppression while absolute complementarity
results in degradation of the target mRNA by RISC (Figure 1).
It is widely hypothesized that RNAi has evolved as an intracellular
defence mechanism against infections and transposons (Fire 2005). In this
instance, it is the presence of long double stranded RNA (dsRNA) during viral
replication that activates RNAi machinery. Although post-transcriptional gene
silencing (PTGS) has previously been described in plants (Ratcliff et al. 1997),
RNAi was first observed in invertebrate animals in C.elegans (Fire et
al.,1998). In mammalian cells, however, the introduction of long dsRNA
4
-
8/3/2019 Tranfer Report Final 12.11
5/63
triggers interferon response leading to non-specific mRNA degradation and
cell death (Stark et al. 1998). Interferon response in mammalian cells was
evaded when chemically synthesized 21 nt short interfering RNA duplexes
(siRNAs) were used, without compromising the specificity and the efficiency of
endogenous and heterologous gene silencing (Elbashir et al. 2001). The
effects of siRNas may be short-lived due to their fast degradation in the
cytoplasm. Plasmid or viral vectors expressing short hairpin RNAs (shRNAs)
often under polymerase III (Pol III) promoters, that are then processed by
Dicer, may provide longer term gene silencing (Paddison et al. 2002) (Figure
1).
5
-
8/3/2019 Tranfer Report Final 12.11
6/63
The specificity and the efficiency of RNAi have enabled it to be used as
6
Figure 1
Figure 1 Graphic representation of the miRNA pathway of gene regulation. At each
stage of RNAi experimental molecules can be introduced and exploit the RNAi
machinery.
-
8/3/2019 Tranfer Report Final 12.11
7/63
a new tool for studying gene function, especially for genes where knock-outs
produce a lethal phenotype. RNAi also holds a promise as a potential therapy
for human disease. One possible application could be in the treatment of
dominant diseases. RNAi technology can potentially be employed to silence
specifically the pathogenic allele at post-trancriptional level while maintaining
expression from the normal allele. Dominantly inherited diseases such as
Huntingtons disease, familial Alzheimers disease and frontotemporal
dementia caused by tau mutations could potentially be treated with allele-
specific RNAi (Miller et al. 2004). Given that use of RNAi in vivo still faces a
series of limitations including delivery, off target effects and safety, targeting
the CNS is a challenging goal. By contrast, diseases of the neuromuscular
junction, such as congenital myasthenic syndromes, provide a more readily
accessible model for study.
Slow channel congenital myasthenic syndrome (SCCMS) is a primarily
autosomal, dominantly inherited disorder of the neuromuscular transmission
caused by mutations in the acetylcholine receptor (AChR) (Croxen et al.
2002). AChR is a pentameric ligand gated cation channel located in the
post-synaptic muscle cell membrane (Figure 2a). It consists of four
homologous subunits at a ratio of 2 :1 :1 :1 for adult AChR and
2 :1 :1 :1 for foetal AChR (Figure 2b).Each subunit has 4
transmembrane domains; mutations in each of these subunits can cause
prolonged opening of the channel leading to focal endplate myopathy,
prolonged decay of the miniature endplate potentials/currents and clinical
fatiguable muscle weakness (Sine et al. 1995; Engel et al. 1996; Croxen et al.
1997; Shen et al. 2006) (Figure 3). Chemically synthesized siRNAs and in
7
-
8/3/2019 Tranfer Report Final 12.11
8/63
vitro synthesized shRNAs using the T7 promoter have been successfully used
to silence a point mutation in the -subunit in transiently transfected HEK
293T cells in a sequence specific manner, establishing the proof of principle
for use of RNAi in the disorder (Abdelgany et al. 2003; Shen et al. 2006)
8
Figure 3
Figure 3 Mutations causing slow-channel congenital myasthenic syndrome have been
found in all the AChR subunits. Many of them are located in the M2 transmembrane
domain that lines the channel lumen, but mutations in other domains have also been
described.
Figure 2
Figure 2 a) Simplified representation of the neuromuscular junction. ACh is released in the
synapse cleft by the presynaptic nerve terminal. ACh binding to AChR opens the ion
channel leading to muscle contraction. ACh remaining in the synapse is inactivated by
acetylcholinesterase (AChE). b) Foetal and adult forms of ACh receptor. -bungarotoxin
binds to the interface between the - and - subunits and - and - (adults) or -
subunits (foetal).
A) B)
-
8/3/2019 Tranfer Report Final 12.11
9/63
Aims
9
-
8/3/2019 Tranfer Report Final 12.11
10/63
1. Replicate previous findings of allele-specific silencing of a pathogenic
mutation of AChR using a tissue culture model and investigate the
ability of modified siRNA with increased stability to silence the same
mutation.
2. Characterise an animal model of SCCMS using weight and strength
measurements.
3. Investigate the ability of RNAi to silence in an allele-specific way a
previously not targeted pathogenic mutation in a tissue culture model in
vitro.
Results 1
10
-
8/3/2019 Tranfer Report Final 12.11
11/63
Comparison of down regulation of AChR expression by siRNA
and stabilised siRNA.
At least 22 different mutations have been identified that can cause the slow
channel myasthenic syndrome. Previously, in our laboratory RNAi was used
to demonstrate allele-specific gene silencing of the mutation S226F in
transiently transfected HEK 293T cells (Abdelgany et al. 2003). In the light of
the objective of testing siRNA technology in an in vivo animal model, I first
wanted to establish that allele specificity would be retained by siRNA species
that had been modified to increase in vivo stability.
The S226F slow channel missense mutation is the result of a C to T
transition at nucleotide 677 in the -subunit of AChR, 677C>T. siRNA
19mers were designed that perfectly matched the mutant sequence (si226)
but had a single nucleotide mismatch with the wild-type sequence (Figure 4).
Modified siRNA (modified si226) is composed of a sense strand containing 2-
fluoro substitutions on all pyrimidine positions, deoxyribose in all purine
positions, with 5 and 3 inverted abasic end caps. The antisense strand
contains 2-fluoro substitutions in all pyrimidine positions, all purines are 2-O-
methyl substituted, and the 3 terminal linkage is a single phosphorothioate
linkage. The above modifications dramatically increased the stability of siRNA
in human serum (Morrissey et al. 2005). Both unmodified and modified siRNA
were provided by SIRNA (Merck & co, NJ, USA). Positive control siRNA
(siGFP), that targets green fluorescence protein (GFP), and negative control
siRNA (siNeg), that has no significant sequence similarity to mouse, rat, or
human gene sequences, were bought from Ambion (Warrington, UK).
11
-
8/3/2019 Tranfer Report Final 12.11
12/63
Mammalian HEK 293T cells were transiently transfected with 3 ug/well
plasmid DNA expressing either the mutant S226F or WT subunit tagged
with EGFP (WT EGFP, S226FEGFP) and the -, -, and - subunits of
AChR at a ratio 2 :1 :1 :1 using PEI (Sigma). EGFP tagged -subunit
provided visualization of transfection efficiency. Additionally, EGFP was used
as target for siGFP (Figure 5). si226, Mod si226, siGFP or siNeg were co-
transfected with the AChR subunits at a 100 nM concentration using siPORT
(Ambion).
Visualization of EGFP expressing cells 48 h post transfection provided
an initial estimation of -subunit expression. si226 reduced the expression of
12
Figure 4
Figure 4 19nt long double stranded siRNA against the -subunit were designed to
perfectly match the mutated S226F sequence while having a mismatch with the
WT at position 10.
Figure 5
Figure 5 Graphic representation of the -subunit of the AChR transfected into HEK 293T
cells. The S226F mutation is located in the M1 trans-membrane domain. EGFP was
ligated into the intracellular loop between the M3 and M4 trans-membrane domains.
-
8/3/2019 Tranfer Report Final 12.11
13/63
the mutant allele while rendering the wild-type allele unaffected. Modified
si226 was less efficient in down regulating the expression of the -subunit.
siRNA against GFP most successfully decreased the expression of its target,
whereas negative control siRNA did not have an effect on AChR expression
(Figure 6).
Cell surface 125I- -bungarotoxin (125I- -BuTx) binding measurements
were used to estimate the cell surface AChR expression. 125I- -BuTx binds
specifically and with high affinity to AChR providing a highly sensitive assay
that allows cell surface AChR expression to be quantified. Total 125I- -BuTx
binding to the surface of HEK 293T cells was measured 48 h post-
transfection, with results normalized for125I- -BuTx binding to S226FEGFP
AChR or WT EGFP AChR respectively.
si226 down regulated the expression of S226FEGFP AChR by
approximately 60%, whereas it did not affect the expression of the wild type
receptor. In contrast modified si226 failed to decrease the expression of both
mutant and wild type AChR. The positive and negative controls behaved as
expected in both cases (Figure 7).
Next, the effect of siRNA concentration on the expression of AChR was
examined. HEK293T cells were transiently transfected with either
S226FEGFP mutant or WT EGFP AChR subunits and 12.5 nM, 25 nM, 50
nM or 100 nM of siRNA respectively using PEI and siPORT as before. si221
had a concentration effect on reducing the expression of S226FEGFP
AChR, although it reaches a plateau effect at 25-50 nM. By contrast, it did not
reduce the expression of wild type AChR (Figure 8). Modified si226 did not
affect the expression of WT EGFP in any concentration, whereas it reduced
13
-
8/3/2019 Tranfer Report Final 12.11
14/63
the expression of the mutant allele by up to approximately 25% at 25 nM.
However, this concentration effect was not linear and higher siRNA amounts
did not decrease mutant AChR expression (Figure 9). siGFP reduced the
expression of both S226FEGFP and WT EGFP AChR in a concentration
dependant way (Figure 10). siNeg did not affect the expression of either
S226FEGFP and WT EGFP AChR in a systematic way (Figure 11).
14
-
8/3/2019 Tranfer Report Final 12.11
15/63
15
Figure 6
Example fields of HEK 293T cells expressing EGFP-tagged AChR. HEK 293T cells were
transfected with 3 g of either mutant S226FEGFP or WT EGFP AChR subunits at a
2 :1 :1 :1 ratio and 100nM of the appropriate siRNA. Plasmid DNA was transfected
using PEI and siRNAs were transfected using siPORT. 48 h post transfection cells were
visualized with fluorescent microscopy.
-
8/3/2019 Tranfer Report Final 12.11
16/63
Figure 7
Figure 7 Surface 125 I- -BuTx binding of AChR containing S226F mutant and WT
subunits in HEK 293 cells co-transfected with 100 nM siRNA using PEI and siPORT.
Total 125 I- -BuTx binding to surface of HEK 293 cells was measured 48 h post-
transfection. Results are expressed as a percentage of 125 I- -BuTx binding to
S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3
experiments in triplicate.
No siR si226Mod si siGFP siNeg
0
50
100
150
WTEGFP AChR S226FEGFP AChR
16
-
8/3/2019 Tranfer Report Final 12.11
17/63
Figure 8
Figure 8 Surface 125 I- -BuTx binding of AChR containing S226F mutant and
WT subunits in HEK 293 cells co-transfected with increasing amounts of si226.
Results are expressed as a percentage of125 I- -BuTx binding to S226F AChR or
WT AChR, respectively. Bars represent mean ( SD) of 3 experiments in
triplicate.
0nM 12.5n 25n 50n 100n
0
50
100
150
WTEGFP AChR S226FEGFP AChR
17
-
8/3/2019 Tranfer Report Final 12.11
18/63
Figure 9
Figure 9 Surface 125 I- -BuTx binding of AChR containing S226F mutant and
WT subunits in HEK 293 cells co-transfected with increasing amounts of modified
si226. Results are expressed as a percentage of 125 I- -BuTx binding to S226F
AChR or WT AChR, respectively. Bars represent mean ( SD) of 3 experiments
in triplicate.
0nM 12.5n 25n 50n 100n0
50
100
150
WTEGFP AChR S226FEGFP AChR
18
-
8/3/2019 Tranfer Report Final 12.11
19/63
Figure 10
Figure 10 Surface 125 I- -BuTx binding of AChR containing S226F mutant and
WT subunits in HEK 293 cells co-transfected with increasing amounts of siGFP.
Results are expressed as a percentage of125 I- -BuTx binding to S226F AChR or
WT AChR, respectively. Bars represent mean ( SD) of 3 experiments in
triplicate.
0nM 12.5n 25n 50n 100n0
50
100
150
WTEGFP AChR S226FEGFP AChR
19
-
8/3/2019 Tranfer Report Final 12.11
20/63
Figure 11
Figure 11 Surface 125 I-BuTx binding of AChR containing S226F mutant and WT
subunits in HEK 293 cells co-transfected with increasing amounts of siNeg. Results
are expressed as a percentage of 125 I--BuTx binding to S226F AChR or WT
AChR, respectively. Bars represent mean ( SD) of 3 experiments in triplicate.
0nM 12.5n 25n 50n 100n0
50
100
150
WTEGFP AChR S226FEGFP AChR
20
-
8/3/2019 Tranfer Report Final 12.11
21/63
In conclusion with this first set of experiments the modified siRNA
obtained from SIRNA does not appear to reduce the expression of AChR.
SIRNA, the supplier of the siRNA, has been using Lipofectamine 2000
(Invitrogen) as a transfecting reagent, whereas PEI (Sigma) and siPORT
(Ambion) were used in this instance. To test if the transfection reagent and
method were affecting in any way the efficiency of siRNA in silencing AChR
expression, a second set of experiments was conducted.
Both plasmid DNA expressing AChR and siRNAs were transiently
transfected using Lipofectamine 2000 (Invitrogen) according to the
manufacturers instructions. The ratio of AChR subunits and the amounts of
siRNA were the same as in PEI and siPORT transfections (Figure 12).
When transfected with Lipofectamine 2000 si226 equally down regulate
both the WT EGFP AChR and the S226FEGFP AChR, thus abating its
ability to distinguish between wild type and mutant -subunit. In addition,
modified si226 also exhibited some efficiency in reducing the expression of
both the WT EGFP AChR and the S226FEGFP AChR, though less
successfully (Figure 13).
The differences of the silencing efficiency of both si221 and modified
si221 when transfected with different transfection agents, namely siPORT
(Ambion) and Lipofectamine 2000 (Invotrogen), are hard to interpret. Co-
tranfection of plasmid DNA and si226 using PEI (Sigma) and siPORT
respectively resulted in allele specific silencing of the expression of the mutant
S226FEGFP AChR. When si226 and plasmid DNA were co-transfected
using Lipofectamine 2000 the allele specific effect was lost but the silencing
efficiency remained at similar levels. These discrepancies could be due to the
efficiency of the transfection agent to deliver siRNA into the cells. If
Lipofectamine is more efficient in delivering siRNA, flooding of the RNAi
system could decrease the specificity of the system for its target. Modified
siRNA, also, exhibited some silencing efficiency when transfected with
Lipofectamine but not when transfected with siPORT. Chemical modifications
of si221, that increase stability of siRNAs in vivo, could interfere with the
efficiency of PEI but not Lipofectamine to deliver them into cells.
The inherent difficulty of siRNA delivery in these experiments is
21
-
8/3/2019 Tranfer Report Final 12.11
22/63
additionally complicated by the need for co-transfection of plasmid DNA and
siRNA, two nucleic acid molecules with different properties. In both cases
fluorescein (FITC) conjugated si226 and modified si226 would provide a
useful tool for visualization and comparison of siRNA delivery efficiency.
22
-
8/3/2019 Tranfer Report Final 12.11
23/63
Figure 12
Example fields of HEK 293T cells expressing EGFP-tagged AChR. HEK 293T cells were
transfected with 3 g of either mutant S226FEGFP or WT EGFP AChR subunits at a
2 :1 :1 :1 ratio and 100nM of the appropriate siRNA. Both plasmid DNA and siRNA
were transfected using Lipofectamine 2000. 48 h post transfection cells were visualized
with fluorescent microscopy.
23
-
8/3/2019 Tranfer Report Final 12.11
24/63
24
Figure 13
Figure 13 Surface 125 I-BuTx binding of AChR containing S226FEGFP mutant and
WT EGFP subunits in HEK 293 cells co-transfected with 100 nM siRNA using
Lipofectamine 2000. Total125
I- -BuTx binding to the surface of HEK 293 cells was
measured 48 h post-transfection. Results are expressed as a percentage of 125 I- -
BuTx binding to S226F AChR or WT AChR, respectively. Bars represent mean
( SD) of 3 experiments in triplicate.
Figure 13 Surface 125 I-BuTx binding of AChR containing S226F mutant and WT
subunits in HEK 293 cells co-transfected with 100 nM siRNA using Lipofectamine
2000. Total 125 I- -BuTx binding to surface of HEK 293 cells was measured 48 h
post-transfection. Results are expressed as a percentage of125 I- -BuTx binding to
S226F AChR or WT AChR, respectively. Bars represent mean ( SD) of 3
experiments in triplicate.
No siRN UnM si2 Mod si2 siPos siNeg0
50
100
150
WTEGFP AChR S226FEGFP AChR
-
8/3/2019 Tranfer Report Final 12.11
25/63
Results 2
An animal model of slow channel congenital myasthenic
syndrome (SCCMS).
RNAi is widely used as a tool for studying gene function. In addition,
RNAi holds a promise as a potential therapy for human disease, especially
dominantly inherited diseases. Towards such a prospect, the use of diseases
of the neuromuscular junction, such as congenital myasthenic syndromes as
a disease model is highly appealing, because it provides a more readily
accessible model when compared to dominant diseases of the central
nervous system. In consequence, a well established animal model of SCCMS,
a dominantly inherited congenital myasthenia, will provide an appropriate in
vivo animal model for RNAi.
In this second chapter of results, measurements of weight and strength
were used to characterise a mice model expressing a human pathogenic
mutation causing SCCMS, previously generated in the laboratory. The weight
gain is a general marker of growth and well-being of mice, while strength is
used as a marker of fatiguable muscle weakness, a clinical symptom of
SCCMS. Preceding the characterization of SCCMS mice a brief description of
their generation is given.
Generation of L221F miceMice expressing the EGFP-tagged human -subunit of the AChR
harbouring the L221F were generated by Dr J. Cossins. Briefly, the purified
expression cassette (Figure 14) was microinjected into the pronucleus of the
25
-
8/3/2019 Tranfer Report Final 12.11
26/63
F2 hybrid oocytes from C57BL/6J x CBA/CA parents to generate mice
expressing one (heterozygous) copy of the human -subunit of the AChR
harbouring the L221F mutation along with two copies of the mouse -subunit
(h L221F+/-/m +/+). These mice were crossed with mice heterozygous for the
mouse AChR -subunit (m +/-) kindly provided by Prof. J.Sanes (Harvard
Medical School). Progeny with the genotype h L221F+/- +/- were crossed to
generate litters containing mice that were homozygous for the h L221F
transgene and heterozygous for the mouse AChR -subunit knock-out
mutation (h L221F+/+/m +/-). These were then mated either with siblings of
the same genotype or with m +/- mice, resulting in 6 distinct genotypes: i)
h +/+/m +/+, ii) h +/+/m +/-, iii) h +/+/m -/-, iv) h +/-/m +/+, v) h +/-/m +/-, vi)
h +/-/m -/-.
26
Figure 14
Figure 14. Graphic representation of the expression cassette used to create the
mice expressing human -subunit harbouring the L221F mutation that
causes congenital slow-channel myasthenic syndrome. The human genomic
DNA for -subunit contained the first ten exons and nine introns. EGFP was
inserted between the M3 and M4 membrane spanning domains of the -
subunit, resulting in expression of AChREGFP. Human cDNA encoding the last
two exons of the -subunit were ligated downstream of EGFP. Figure kindly
provided by Dr Judy Cossins.
human (genomic sequence)
EGFP
BGH pA
AChR -subunitpromoter
NheI SfiI SfiI
Expression cassette
human cDNA
-
8/3/2019 Tranfer Report Final 12.11
27/63
Functional expression of the h L221FEGFP-subunit in mice was
determined by tetramethylrhodamine -BuTx staining by Dr Judy Cossins.
Tetramethylrhodamine -BuTx binds to the interface between the - and
- subunits and - and - subunits and has been used as a highly sensitive
way to visualize AChR at the muscle endplate. Muscles from L221F mice
were incubated with tetramethylrhodamine -BuTx. Excess
tetramethylrhodamine -BuTx was removed and muscle mounted on slides
for fluorescent microscopy. The muscles used were fast-twitch extensor
digitorum longus (EDL), slow-twitch soleus (SOL) were from a he+/-/me-/- 20
week-old male and diaphragm muscle from a he+/+/me+/- 10 week-old female.
Red stained endplates were visualized with fluorescent microscopy to identify
cell surface -expressed AChRs. EGFP was localised to the endplates
confirming expression of h L221F-EGFP. Merge of the images shows
successful incorporation of h L221F-EGFP expressing AChRs in functional
AChRs in the endplates of L221F mice (Figure 15).
27
-
8/3/2019 Tranfer Report Final 12.11
28/63
28
Figure 15
Figure 15 Fluorescent microscope pictures of L221F mice endplates. Red= AChRs
stained with tetramethylrhodamine -bungarotoxin ( -BuTx) to identify cell surface
-expressed AChRs. Green= endplates expressing h L221F-EGFP (green). Yellow=
merge of red and green shows the incorporation of EGFP expressing AChR in functional
AChRs. Experiments were done by Dr Judy Cossins.
EDL
SOL
Diaphragm
-BuTx L221F-EGFP merge
-
8/3/2019 Tranfer Report Final 12.11
29/63
Phenotypic assessment of the transgenic mice focused on weight and
strength performance according to the inverted screen test. Data for the male
and female, and homozygous and heterozygous mice was analysed
separately in this preliminary analysis.
Weight
In order to assess the rate of growth and general well-being of L221F
mice, mice were weighted every two weeks up to six months of age. Mice with
no mouse AChR -subunit gained weight more slowly than littermates with
one or two copies of mouse subunit. Although they put on weight they did
not reach the weight of mice with one or two alleles of mouse -subunit. This
was observed for mice with one and with two copies of the transgene (Figures
16, 17). Mice homozygous for h put on more weight than heterozygous
mice. Female mice were lighter than male mice, as expected, but put on
weight in a similar way.
29
-
8/3/2019 Tranfer Report Final 12.11
30/63
30
Figure 16
h L221F+/+
Figure 16 Mice were weighed every two weeks up to six months of age. Points
represent average weight at each time point ( STD). a) Graph of growth of male
mice homozygous for L221F transgene. b) Graph of growth of female mice
Male
1 1 1 1 1 2 2 2 215
20
25
30
35
40
45
h221+/+/m+/+(n=3) h221+/+/m+/-(n=7) h221+/+/m-/-(n=7)
Age in weeks
Female
1 1 1 1 1 2 2 2 215
20
2530
35
40
45
h221
+/+
/m+/+
(n=3) h221
+/+
/m+/-
(n=7) h221
+/+
/m-/-
(n=7)
Age in weeks
A)
B)
-
8/3/2019 Tranfer Report Final 12.11
31/63
31
Figure 17
h L221F+/-
Figure 17 Mice were weighed every two weeks up to 6 months of age. Points
represent average weight at each time point ( STD). a) Graph of growth of male
mice heterozygous for L221F transgene. b) Graph of growth of female mice
heterozygous for L221F transgene.
Male
1 1 1 1 1 2 2 2 215
20
25
30
35
40
45
h221+/-/m+/+(n=6) h221+/-/m+/-(n=7) h221+/-/m-/-(n=8)
Age in weeks
A)
Female
1 1 1 1 1 2 2 2 215
20
25
30
35
40
45
h221+/-/m+/+(n=5) h221+/-/m+/-(n=7) h221+/-/m-/-(n=6)
Age in weeks
B)
-
8/3/2019 Tranfer Report Final 12.11
32/63
Strength
Fatigable muscle weakness, a clinical symptom of SCCMS, was
evaluated in mice using an inverted screen test (Contet, Rawlins and Deacon
2001). The inverted screen was a 50 cm2 screen of wire mesh consisting of
12 mm2 squares of 1 mm diameterwire surrounded by a 4 cm deep wooden
frame. Themouse was placed in the centre of the wire mesh screen and the
screen was rotated to the inverted position over 2 s, with the mouse's head
decliningfirst. The stopwatch was started and the time at which the mouse fell
was recorded, to a maximum of 5 min.
h +/+/m -/- mice were not able to hold onto the inverted screen for 5
minutes at any age tested. In contrast, h+/+
/m+/+
and h+/+
/m+/-
mice
remained on the inverted screen for the full 5 minutes. However, one male
h +/+/m +/+ mouse failed the inverted screen test at 16 weeks of age and
continued deteriorating thereafter (Figure 18a). In general, similar results were
obtained for both male and female mice (Figure 18b).
Both male and female h +/-/m +/+ mice held on to the inverted screen
for the full 5 minutes. The strength of male h +/-/m +/- mice varied highly and
started deteriorating progressively from 14 weeks of age onwards, unlike
female h +/-/m +/- mice that always reached the target of 5 minutes,
suggesting a gender effect. When looked closer, however, the male data
revealed that 3 of the 7 mice deteriorated; therefore the gender difference was
not further pursued. These three male mice are currently been used for
32
-
8/3/2019 Tranfer Report Final 12.11
33/63
breeding in order to test if their offspring will also be characterised by
fatiguable muscle weakness. Both male and female h +/-/m -/- mice did not
reach the 5 minutes limit at any given age (Figure 19a, b).
33
Figure 18h L221F+/+
Figure 18 Mice were tested on the inverted screen every two weeks up to 6
months of age. The time they hung on the inverted screen was recorded up to 5
minutes a) Graph of male homozygous mice strength. b) Graph of female
homozygous mice strength.
Male
1 1 1 1 1 2 2 2 20
50
100
150
200
250
300
h221+/+/m+/+ (n=3) h221+/+/m+/- (n=7) h221+/+/m-/-(n=7)
Age in weeks
A)
Female
1 1 1 1 1 2 2 2 20
50
100150
200
250
300
h221
+/+
/m+/+
(n=3) h221
+/+
/m+/-
(n=7) h221
+/+
/m-/-
(n=7)
Age in weeks
B)
-
8/3/2019 Tranfer Report Final 12.11
34/63
34
Figure 19h L221F +/-
Figure 19 Mice were tested on the inverted screen every two weeks up to 6
months of age. The time they hung on the inverted screen was recorded up to
5 minutes a) Graph of male heterozygous mice strength. b) Graph of female
heterozygous mice strength.
Male
1 1 1 1 1 2 2 2 20
50
100
150
200
250
300
h221+/-
/m+/+
(n=6) h221+/-
/m+/-
(n=7) h221+/-
/m-/-
(n=8)
Age in weeks
A)
Female
1 1 1 1 1 2 2 2 20
50
100150
200
250
300
h221+/-/m+/+(n=3) h221+/-/m+/-(n=7) h221+/-/m-/-(n=4)
Age in weeks
B)
-
8/3/2019 Tranfer Report Final 12.11
35/63
Results 3
Can L221F-EGFP AChR expression be down regulated bysiRNA?
RNAi has been used to successfully down regulate the S226F mutant allele
while preserving the expression of the wild type (WT ) allele in transiently
transfected HEK 293T cells, providing the proof of principal for the use of
RNAi in allele-specific gene silencing (Abdelgany et al. 2003). The aim of this
set of experiments is to apply RNAi for allele-specific silencing of a different
pathogenic mutation of SCCMS, namely L221F, which is present in our
transgenic disease model. L221F is a pathogenic mutation resulting from a
C to T transition at nucleotide position 661 of the -subunit of the AChR,
661C>F. Pathogenicity of the mutation was confirmed by electrophysiology
studies, by Dr R. Webster. HEK 293 cells were transiently transfected with
either wild type AChR cDNA or with wild type and L221F
AChR cDNA. EGFP was also transfected as a marker of transfection. 48 h
after transfection green cells were studied using cell-attached patch
technique. Patch pipette contained 100 nM ACh to produce AChR activations
in bursts. Downward deflections are brief openings of individual channels.
Bursts of openings were separated by a critical closed duration, which defined
them as closures within a burst. Bursts from L221F AChR (lower
35
-
8/3/2019 Tranfer Report Final 12.11
36/63
trace) were longer than those from wild type transfected cells (Figure 20).
Transient expression of AChR
21mer siRNA against the -subunit of AChR were designed to
perfectly match the mutant sequence L221F (si221), therefore harbouring a
mismatch with the WT protein (Figure 21). Modified siRNA (Mod si221) is
composed of a sense strand containing 2-fluoro substitutions on all pyrimidine
positions, deoxyribose in all purine positions, with 5 and 3 inverted abasic end
caps. The antisense strand contains 2-fluoro substitutions in all pyrimidine
positions, all purines are 2-O-methyl substituted, and the 3 terminal linkage is
a single phosphorothioate linkage. The above modifications dramatically
36
Figure 20
Figure 20 Single-channel activity of HEK 293 cells transfected with either wild-type or
L221F-EGFP AChR. Channel openings, represented by downward deflections,
demonstrate that L221F-EGFP AChR have longer opening times compared to wild type
AChR. Electrophysiology experiments were done by Dr Richard Webster.
Normal
Slow channel( L221F-EGFP)
-
8/3/2019 Tranfer Report Final 12.11
37/63
increased the stability of siRNA in human serum (Morrissey et al. 2005). Both
unmodified and modified siRNA were provided by SIRNA (Merck & co, NJ,
USA). Positive control siRNA (siGFP), that targets GFP, and negative control
siRNA (siNeg), that has no significant sequence similarity to mouse, rat, or
human gene sequences, were bought from Ambion (Warrington, UK).
HEK 293T cells were transfected with 3 g of AChR and 100 ng of
dsRed expressing vector per well of a 6-well plate. DsRed expressing vector
was used as efficiency of transfection control. Plasmid DNA expressing WT ,
WT and WT subunits was transfected along with either WT or L221F
subunit at a ratio 2 :1 :1 :1 . Plasmid DNA expressing the epsilon
subunit was tagged with EGFP between the M3 and the M4 transmembrane
spanning domains (Figure 22) in order to visualize the AChR in transfected
cells. Expression of similar levels of dsRed in each condition demonstrated
that plasmid DNA transfection was equally successful (Figure 23). Expression
of EGFP was used as an initial estimation of AChR expression. Both
WT EGFP and L221FEGFP expressing AChR were efficiently transfected.
siRNA against the L221F mutation were co-transfected with the plasmid
DNA at 50 nM concentration. si221 and Mod si221 were used. si221 reduced
37
Figure 22
Figure 21 21nt long double stranded siRNA against the -subunit were design to
perfectly match the mutated L221F sequence while having a mismatch with the WT
at position 11.
-
8/3/2019 Tranfer Report Final 12.11
38/63
the expression of both the wild type and the mutant allele. Modified si221 was
less efficient in down regulating the expression of the -subunit. siRNA
against GFP most successfully decreased the expression of its target,
whereas negative control siRNA did not have an effect on AChR expression
(Figure 24).
38
Figure 22
Figure 22. AChR -subunit was tagged with EGFP expressed in the intracellular
loop between the M3 and M4 trans-membrane domains. The L221F mutation is
located at the M1 trans-membrane domain.
-
8/3/2019 Tranfer Report Final 12.11
39/63
Figure 23
HEK 293T cells were transfected with 3 g of AChR subunits at a 2 :1 :1 :1 , 10ng
of dsRed expressing plasmid and 50 nM of the appropriate siRNA. 48 h after transfection
cells were visualized with fluorescent microscopy. dsRed expressing cells suggests
successful transfection for each condition.
39
-
8/3/2019 Tranfer Report Final 12.11
40/63
Figure 24
HEK 293T cells were transfected with 3 g of AChR subunits at a 2 :1 :1 :1 , 10
ng of dsRed expressing plasmid and 50nM of the appropriate siRNA. 48 h after
transfection cells were visualized with fluorescent microscopy. Down regulation of EGFP
expressing cells shows successful knock down of WT EGFP and L221FEGFP
AChR.
40
-
8/3/2019 Tranfer Report Final 12.11
41/63
Previously, quantitative analysis of the silencing of the S226F mutant
subunit was based on surface binding 125I-BuTx assays. Given that the -
subunit, unlike the -subunit, is not essential for surface expression of AChR
in transiently transfected HEK cells, this assay would not provide an accurate
measurement of -subunit silencing. Thus, fluorescence of whole protein cell
extract and western blots were used for the evaluation of silencing at protein
level and qRT-PCR for evaluation at mRNA level. Fluorescence of whole
protein extract was measured as an initial quantitative estimation of -subunit
down regulation by siRNA. si221 reduced the expression of the mutant -
subunit by approximately 50 percent, while reducing wild type expression
by 30 percent. Modified si221 did not affect the expression of the either
WT EGFP or L221FEGFP AChR. Positive and negative control siRNA
affected the expression of both WT and 221 as expected (Figure 25).
No siRNA si221 Mod si221 siGFP siNeg0
50
100
150
WTEGFP AChR L221FEGFP AChR
Figure 25
Figure 25 Graph of fluorescence of whole cell protein extract measured in a fluorescent
plate reader. Results are expressed as a percentage of fluorescence of 221FEGFP
AChR or WT EGFP AChR, respectively. Bars represent mean ( SD) of 7 experiments in
tri licate.41
-
8/3/2019 Tranfer Report Final 12.11
42/63
In order to estimate the subunit down-regulation by siRNA at protein
level more accurately, western blots of whole cell protein were performed.
Antibodies against both the epsilon AChR subunit and the fluorescent marker
EGFP were used. anti-GFP (ab6556, Abcam, Cambridge, UK) antibody
successfully identified the AChR -subunit EGFP fusion at the correct
molecular weight of ~82kDa , although there was also high unspecific binding
of the antibody. si221 reduced the density of the band for both WT and
L221F, while modified si221 appears to not have a major effect on protein
band density. Positive control siRNA minimized the protein expression of
EGFP-subunit and negative control siRNA did not affect the expression of
EGFP subunit (Figure 26a). For quantification of protein bands both
proteins ware normalized against the amount of -tubulin. Quantification of
the band densities shows that si221 reduced that expression of 221EGFP
by ~60% and the expression of WT EGFP by ~35%. Modified si221 does
not appear to affect the expression of WT EGFP (though its effect varies
highly from experiment to experiment as indicated by the SD bar) and reduces
the expression of 221EGFP by ~25% (Figures 26b).
42
-
8/3/2019 Tranfer Report Final 12.11
43/63
Figure 26
Figure 26 a) Western blots with antibody against GFP. GFP antibody recognised the -
EGFP fusion protein for both WT EGFP and 221EGFP. When HEK 293T cells are
transfected with the AChR subunits, a band appears at ~81.5 kDa (arrow) (epsilon subunit
54.697 Da, GFP 26.886 Da). b) Graph of density quantification of western blot bands
recognised by anti-GFP antibody. Results were normalized against the density of -tubulin
bands. Bars represent the mean ( SD) of 3 experiments.
GFP antibody
No siRN UnM siR Mod siR siPos siNeg0
50
100
150
WTEGFP AChR
221EGFP AChR
B)
A)
43
-
8/3/2019 Tranfer Report Final 12.11
44/63
Anti- antibody (goat polyclonal, Santa Cruz, CA, USA), with an
epitope within the last 50 amino acids of the C-terminus of AChR -subunit
of human origin, also identified the AChR -subunit EGFP fusion at ~82kDa
(Figure 27a). si221 noticeably reduced the density of the band for both WT
and 221, while modified si221 had a weaker effect on protein band density.
Positive control siRNA minimized the protein expression of EGFP-subunit
and negative control siRNA did not affect the expression of EGFP subunit.
Quantification of the band densities shows that unmodified si221 reduced that
expression of both WT EGFP and 221EGFP by ~50 %. Modified si221
down regulated the expression of WT EGFP by ~20% (though its effect
varies highly from experiment to experiment as indicated by the SD bar) and
reduced the expression of 221EGFP by ~40% (Figure 27b).
44
-
8/3/2019 Tranfer Report Final 12.11
45/63
Figure 27
Figure 27 a) Antibody against the -subunit recognised the -EGFP fusion protein for both
WT EGFP and 221EGFP. When HEK 293T cells were transfected with the AChR subunits,
a band appeared at ~81.5 kDa (arrow) (epsilon subunit 54.697 Da, GFP 26.886 Da). b) Graph
of density quantification of western blot bands recognised by anti- antibody. Results were
normalized against the density of -tubulin bands. Bars represent the mean ( SD) of 3
experiments.
A)
anti- antibody
No siRN UnM siR Mod siR siPos siNeg0
50
100
150
WTEGFP AChR221EGFP AChR
B)
45
-
8/3/2019 Tranfer Report Final 12.11
46/63
Quantitative estimations for the effect of siRNA on the expression of
-subunit on mRNA level were provided from real-time quantitative PCR (RT-
qPCR). Both probes against EGFP (Figure 28) and the -subunit (Figure 29)
were used to quantify the expression of -subunit EGFP fusion. GAPDH
expression was the reference gene used to normalize the EGFP and -
subunit data.
Figure 28
Figure 28 si221 reduced the expression of L221F by ~65%, but modified
si221 did not affect the expression of L221F. In contrast, both si221 and
modified si221 reduced expression of WT by ~40 %.
Real Time PCR
EGFP
0
20
40
60
80
100
120
no siRNA si221 UnM si221 Mod siPos siNeg
WTeEGFP AChR
e221EGFP AChR
46
-
8/3/2019 Tranfer Report Final 12.11
47/63
In general unmodified si221 appears to be more successful in reducing
the expression of -subunit than modified si221, although it does not appear
to strongly differentiate between WT and 221 alleles.
Figure 28
Figure 29 Unmodified si221 reduced the expression of 221 by ~65%, but
modified si221 did not affect the expression of 221. In contrast, both
unmodified and modified si221 reduced expression of WT by ~ 50% and~60% respectively.
Real Time PCR
Human Epsilon
0
20
40
60
80
100
120
140
no siRNA si221 UnM si221 Mod siPos siNeg
WTeEGFP AChR
e221EGFP AChR
47
-
8/3/2019 Tranfer Report Final 12.11
48/63
Discussion
The aim of this project is to use RNAi in an allele-specific way to
silence dominantly inherited mutations of the AChR causing SCCMS.
Previously, proof of principal for the use of RNAi has been provided by the
allele-specific down regulation of the S226F mutant allele while preserving
the expression of the wild type (WT) allele in transiently transfected HEK
293T cells (Abdelgany et al. 2003).
In this project we first replicated the above result and further tested the
ability of an siRNA, which has been modified in order to increase its stability to
allele specifically silence S226F. Modified siRNA did not silence either
WT or S226F expressing AChR when tranfected using PEI and siPORT.
However, it down regulated the expression of both WT and S226F AChR,
albeit moderately, when transfected using Lipofectamine 2000. Chemical
modifications of the siRNA molecule, which enable it to resist degradation in
vivo, appear to interfere with the transfection method and efficiency. These
modifications highly increase the stability of siRNA, which is essential for their
use in vivo. Further studies using different transfection agents will be essential
to test their efficient transfection and silencing capacities.
In vivo application of RNAi in dominantly inherited diseases requires a
robust animal model. As discussed above, RNAi still faces a series of
limitations related to effective delivery, off-target effects and specificity.
Therefore dominantly inherited disorders of the neuromuscular junction
48
-
8/3/2019 Tranfer Report Final 12.11
49/63
provide a more readily accessible model for allele-specific silencing when
compared with CNS dominantly inherited disorders. The second result
chapter of this project introduced a transgenic animal model of SCCMS,
previously generated in our lab. In addition a set of experiments was
performed to characterise the model at the level of general growth and well-
being and at the level of strength. Mice expressing the human L221F
transgene in a KO mouse -subunit grow more slowly and weigh noticeably
less than littermates expressing both the human transgene and the WT
subunit. However, mice survive and have normal life expectancy.
The strength of L221F transgenic mice was also monitored.
Fatiguable muscle weakness is a prominent clinical symptom of SCCMS.
General mice strength, as measured by the inverted screen test, was
employed as a marker of fatiguable muscle weakness. Mice expressing the
human L221F transgene in a KO mouse -subunit were significantly
weaker than littermates expressing both the human transgene and the WT
subunit. Additionally, a group of h L221F+/-/m +/- also exhibited weakness at
around 14 weeks and continued deteriorating thereafter, possibly mirroring
the dominantly inherited nature of the human disease. Our results suggest
that our model is in general a useful model for in vivo application of allele-
specific RNAi; human L221F is expressed and functionally integrated in
mouse AChR at the neuromuscular junction and mice exhibit a major
characteristic of the clinical picture of the disease while preserving their
general health.
The third part of this report focuses on in vitro silencing of the L221F
mutation. si221 against L221F down regulated L221F AChR by ~50% but
49
-
8/3/2019 Tranfer Report Final 12.11
50/63
also down regulated WT AChR by ~25%. Designing siRNAs with more than
one mutation against the WT appears to improve the discriminative ability of
siRNA and it will be used in the future to increase the specificity of si221. The
results from the modified siRNA are again more difficult to interpret. It appears
that the modified siRNA might act more slowly because it did not noticeably
decrease the expression -subunit at protein level but appeared to decrease
mRNA levels. However, no conclusions can be drawn from this set of
experiments for the effectiveness of modified siRNA against L221F.
Replication of qRT-PCR and transfections using PEI and siPORT are
essential before any conclusions can be made.
This project report is an account of three sets of experiments towards
RNAi use for allele-specific silencing of mutant AChR subunits causing
SCCMS. The future goal of this project will be to improve the effectiveness
and specificity of allele-specific silencing of L221F mutation in vitro and next
use optimized siRNA molecules in order to induce RNAi in vivo, using our
animal model of SCCMS.
50
-
8/3/2019 Tranfer Report Final 12.11
51/63
51
-
8/3/2019 Tranfer Report Final 12.11
52/63
Future Plans
S226F
Repeat dose response for si226 and mod si226 to obtain definitive
results on allele-specific silencing of S226F. In vitro transient
transfection of HEK cells using PEI and siPORT will approximately
require 2 weeks. Results will be assessed by surface binding of125I- -
BuTx.
The above experiments will further secure the finding that the S226Fmutation can be silenced in an allele specific way and that modified siRNA
does not produce silencing in vitro.
L221F
Transient co-transfection of HEK cells of plasmid DNA expressing
WT EGFP or L221FEGFP AChR and siRNA against L221F. Sofar si221 does not provide allele specific silencing of L221FEGFP
AChR. In order to increase both the specificity and silencing ability of
si221 an siRNA with an extra mismatch between the wild-type and
siRNA will be designed. The extra mismatches will be introduced either
at the 3-prime end/ or the 5-prime end of the anti-sense strand of
si221. The results will be assessed qualitatively using microscopy and
quantitatively using western blots (assessment at protein level) andqRT-PCR (assessment at mRNA level). These experiments should
approximately take a week and will be repeated three times (therefore
3 weeks total).
The siRNA species that will have the best allele-specific silencing
ability will be modified using the locked nucleic acid technology (LNA)
in order to improve its stability. Transient co-transfection of HEK cells
of plasmid DNA expressing WT EGFP or L221FEGFP AChR andLNA will demonstrate if the LNA modification interferes with the allele-
52
-
8/3/2019 Tranfer Report Final 12.11
53/63
specific silencing. The results will be assessed qualitatively using
microscopy and quantitatively using western blots (assessment at
protein level) and qRT-PCR (assessment at mRNA level). These
experiments should approximately take a week and will be repeated
three times (therefore 3 weeks total).
The above experiments will determine the most effective and allele specific
siRNA sequence that will then be used in further in vitro and in vivo
experiments.
L221F transgenic mice
In vitro:
1. Establish primary muscle cell culture from L221F+/+/m -/- mice.
Mouse muscle will be trypsinized and mechanically triturated. Muscle
cells and fibroblasts are initially grown together. After 5-6 divisions
muscle cells are separated using N-CAM antibody. This procedure is
easy but the establishment of the primary cells culture depends
primarily on the growth rate of the cells. However, 4 weeks is an
estimation based on the general experience of lab members with
primary muscle cell lines. Establishing a primary muscle cell line will
allow me to work on a cell model that most accurately mirrors the in
vivo condition of the L221F mouse.
2. The above cell model will be used to optimize the transfection method
for delivering siRNA molecules and shRNA expressing vectors into
primary muscle cells. A Cy3 conjugated siRNA and a dsRed
expressing vector will be used to monitor the efficiency of transfection
agents. These experiments should take approximately a week and will
pinpoint the most effective method for transfecting primary muscle
cells.
3. Transient transfection of L221F+/+/m -/-cells with siRNA against
GFP, and L221F. This experiment will show us if siGFP and si221
can effectively knock down the expression of L221FEGFP. The
53
-
8/3/2019 Tranfer Report Final 12.11
54/63
results will be assessed qualitatively using microscopy and
quantitatively using western blots (assessment at protein level) and
qRT-PCR (assessment at mRNA level). These experiments should
approximately take a week and will be repeated three times (therefore
3 weeks total).
4. Transient transfection of L221F+/+/m -/-cells with vectors expressing
shRNA against GFP and L221F. These experiments will show us if the
vectors are as efficient as the siRNA in silencing the mutant
L221FEGFP and the results will be assessed qualitatively using
microscopy and quantitatively using western blots (for protein knock
down) and qRT-PCR (for mRNA knock down). These experiments
should take a week and will be repeated three times (therefore 3 weeks
total).
5. Time course transient transfection of L221F+/+/m -/-cells with vectors
expressing shRNA against GFP and L221F. These experiments will
show us if the vectors provide more long lasting silencing of the mutant
L221FEGFP and the results will be assessed qualitatively using
microscopy and quantitatively using western blots (for protein knock
down) and qRT-PCR (for mRNA knock down). These experiments
should require a week and will be repeated three times (therefore 3
weeks total).
6. Establish immortal muscle cell culture from L221F+/+/m -/-. Primary
mouse muscle cells will be immortalized by infection with a
temperature-sensitive mutant of SV40, which will allow the cells to
grow undifferentiated at 33C and differentiate when grown at 40C.
These cells are easier to maintain than primary cell lines, therefore
once establish they will be preferably used. This kind of immortalization
has not been done in our lab before therefore, estimating time required
for this experiment is precarious. However, the time required should be
similar to the time required for the establishment of a stably transfected
cell line, that depends primarily on the growth rate of the cells.
7. Immortal L221F+/+/m -/- cells will be used to optimize the
transfection method for delivering siRNA molecules and shRNA
54
-
8/3/2019 Tranfer Report Final 12.11
55/63
expressing vectors into primary muscle cells. A Cy3 conjugated siRNA
and a dsRed expressing vector will be used to monitor the efficiency of
transfection agents. These experiments should take approximately a
week and will pinpoint the most effective method for transfecting
immortalized muscle cells.
8. Transfection of immortalized L221F+/+/m -/- cells with siRNA against
GFP, and L221F. This experiment will show us if siGFP and si221
can effectively knock down the expression of L221FEGFP. The
results will be assessed qualitatively using microscopy and
quantitatively using western blots (assessment at protein level) and
qRT-PCR (assessment at mRNA level). These experiments shouldapproximately take a week and will be repeated three times (therefore
3 weeks total).
9. Transfection of immortalized L221F+/+/m -/- cells with vectors
expressing shRNA against GFP and L221F. These experiments will
show us if the vectors are as efficient as the siRNA in silencing the
mutant L221FEGFP and the results will be assessed qualitatively
using microscopy and quantitatively using western blots (for protein
knock down) and qRT-PCR (for mRNA knock down). These
experiments should take a week and will be repeated three times
(therefore 3 weeks total).
10. Time course transfection of immortalized L221F+/+/m -/- cells with
vectors expressing shRNA against GFP and L221F. These
experiments will show us if the vectors provide more long lasting
silencing of the mutant L221FEGFP and the results will be assessed
qualitatively using microscopy and quantitatively using western blots
(for protein knock down) and qRT-PCR (for mRNA knock down). These
experiments should require a week and will be repeated three times
(therefore 3 weeks total).
The above experiments are planned for primary and immortalized mouse
muscle cell lines. We do not expect to see differences between the results
from primary and immortalized cell lines of the same genotype. The
55
-
8/3/2019 Tranfer Report Final 12.11
56/63
reason for designing the same experiments on two different cell line
models depends on the success of immortalizing the primary muscle cells
and the amount of time it might require, which is unknown to me as this
way of immortalizing cells has not been used in our lab before.
In vivo:
1. Optimize the delivery of siRNAs and shRNA expressing vectors into
tibialis anterior (TA) muscle of transgenic mice. First inject TA with
negative control siRNA labelled with Cy3 or dsRed expressing vector.
Repeat the above with electroporation. The results will tell us if siRNA
and vectors can be delivered into the cells without electroporation and
if electroporation improves the delivery of nucleic acid into muscle
cells. The contra-lateral TA muscle in each mouse will be used as
control and will be injected with saline. Results will be assessed 24
hours post tranfection for siRNA and 48 hours post tranfection by
microscopy.
2. Demonstrate knock down of expression of EGFP expressed at the
neuromuscular junction by L221FEGFP AchR. Using the optimal
method as defined by the delivery optimization experiment, siGFP and
pRS-shGFP (commercial vector expressing a short hairpin against
GFP) will be delivered to the TA of L221F+/+/m -/- mice. The results
will be assessed 2 weeks post injection. The results of the first
experiment will be assessed by microscopy. If the first experiment is
successful protein and mRNA extracts from subsequent experiment will
be used to assess the knock down of EGFP at protein (with western
blots) and mRNA (qRT-PCR) levels. These experiments should take
approximately 6 weeks.
3. Demonstrate knock down of expression of L221F expressed at the
neuromuscular junction by L221FEGFP AchR. Using the optimal
method as defined by the delivery optimization experiment, si221 will
be delivered to the TA of L221F+/+/m -/- mice. The results will be
assessed 2 weeks post injection. The results of the first experiment will
be assessed by microscopy. If the first experiment is successful protein
56
-
8/3/2019 Tranfer Report Final 12.11
57/63
and mRNA extracts from subsequent experiment will be used to
assess the knock down of EGFP at protein (with western blots) and
mRNA (qRT-PCR) levels. These experiments should take
approximately 6 weeks.
57
-
8/3/2019 Tranfer Report Final 12.11
58/63
AppendixMaterials and Methods
Cell culture
Human embryonic kidney (HEK 293T) cells were grown in DulbeccosModified Eagle Medium (DMEM) without Phenol Red (GIBCO), supplemented
with 20mM L-Glutamine, 110 g/mL Sodium Pyruvate, 10% foetal calf serum(FCS), antibiotics (penicillin G 100 units/mL, streptomycin sulfate 0.1 mg/mL)
and an antimycotic (amphotericin 0.25 g/mL). Cells were incubated at 37 Cin 5% CO2.
siRNA design.
21mer siRNA against the -subunit of AChR were design to perfectly
match the mutant sequence L221F, therefore harbouring a mismatch withthe WT protein (Figure 1). Both unmodified and modified siRNA wereprovided by siRNA. siRNA against GFP and negative control siRNA werebought from Ambion.
Figure 2
Figure 1 21nt long double stranded siRNA against the -subunit were design to perfectly
match the mutated sequence while having a mismatch with the WT at position 11.
Figure 1
Figure 4 19nt long double stranded siRNA against the -subunit were design to
perfectly match the mutated S226F sequence while having a mismatch with the
WT at position 10.
58
-
8/3/2019 Tranfer Report Final 12.11
59/63
Transient Cell Transfection
24 h prior to transfection cells were plated in poly-l-lycine coated 6-wellplates at a concentration 4 x 105 per well. Cells were transiently transfected
with 3 g plasmid DNA and the desired amount of siRNA with Lipofectamine2000 (Invitrogen) per well according to the manufacturers instructions.Alternative plasmid DNA was transfected using PEI. 3ug of pDNA at aconcentration 0.8 ug/ul was mixed with 1.25ul/well 20% glucose and 1.5ul/well PEI. The mix was then added to 1mL of growing medium. siRNA wastranfected using siPORT (Ambion) according to manufacturers instructions.Plasmid and siRNA transfection mixes were combined before aliquoted toreplicate well.
Whole Cell Protein Extraction
48 h after transfection media was removed from the cells and 400 Lof extraction buffer (10mM Tris, 100mM NaCl, 1mM EDTA, 1% Triton-X, pH8.0) was added to each well of a 6-well plate. Proteolytic activity wasprevented by the addition of Protease Inhibitor Cocktail (Sigma-Aldrich) to the
protein extract (1:100 dilution), which was then incubated at 4C for 1 h withgentle rotation. The resulting homogenate was spun, the supernatant
removed and stored at -20C. A bicinchoninic acid (BCA) protein kit (Pierce)was used to measure whole cell protein concentration.
RNA extraction and cDNA preparation
RNA was extracted from HEK 293T cells using RNAeasy (Qiagen)according to the manufacturers instructions. Possible plasmid DNAcontamination of cell extracted RNA was removed by DNase treatment as
follows. 17 L RNA, 2 L 10 x DNAse Buffer (Ambion) and 1 L DNAse
(Ambion) were incubated at 37C for 30 min. The reaction was stopped with
addition of 2 L DNAse inactivation reagent (Ambion) and incubation at RTfor 15 min while flicking every couple of minutes to increase the DNAseinactivation reagent activity. After centrifugation at 13 krpm the supernatantcontaining the DNA-free RNA was removed in an RNAse-free tube. RNA wasthen quantified by OD assessment (Ultrospec 2100 pro, Amersham
Biosciences) and diluted to 1 g/ l. Reverse transcription of RNA was donewith RETROscript (Ambion) according to the manufacturers instructions. In
short, 1 g of RNA was mixed with 2 L 50uM OligodT and 9 L RNAse-
free water. The mix was heated at 80C for 3 min and then immediately
placed on ice for 2 min. After addition of 2 L 10 x RT Buffer, 4 L dNTPs
Mix (2.5 mM each dNTP), 1 L RNase Inhibitor (10 units/L) and 1 L
MMLV-RT (100 units/L), the reaction was incubated at 50C for 1 h and then
at 92C for 10 min. cDNA was stored at -20C.
59
-
8/3/2019 Tranfer Report Final 12.11
60/63
Plate Readings
Typically 300 g of protein was made up to 200 l with proteinextraction buffer. Fluorescence was measured on Molecular Devices MaxGemini XS plate reader. The wavelengths used were as follows: EGFP
excitation: 472, emission: 512, dsRed excitation: 556, emission: 583. Eachexperiment was run in duplicate or triplicate.
Western blotting
20 g of protein from each sample was typically loaded in a pre-cast4-12% Bis-Tris NUPAGE gel and run in 1 x MES SDS running buffer for ~45min at 200V. The protein was transferred to Nitrocellulose (Protran)membrane for ~2 h at 30V. Successful transfer of protein was visualized withPonceau Red (0.1% in 5% acetic acid). Membranes were then blocked inPBS with 0.1 % Tween and 5% milk powder (Marvel) with agitation at RT for 1
h. The primary antibody (Table 1) was applied overnight at 4 C in PBS with0.1% Tween and 2% milk powder (Marvel). The membrane was washed (3 x5 min) in PBS with 0.1% Tween and the secondary antibody (Table 1) appliedfor 1 h at RT in PBS with 0.1% Tween and 2% milk powder (Marvel). ECLPlus Western Blotting Detection Reagents (Amersham) were used to detectHRP conjugated secondary antibodies. Pictures were taken with GDS-8000System (UVP Bioimaging Systems) and band optical density was quantifiedwith Labworks Analysis Software (UVP).
Table 1
Antibodies used in western blotting
Primary Antibodies Animalraised/clonality
Dilution
GFP antibody (ab6556, Abcam) Rabbit polyclonal 1:2,000
AChR antibody (sc-1454, Santa Cruz) Goat polyclonal 1:1,000
anti- -tubulin antibody (T-5168, Sigma) Mouse monoclonal 1:100,000
Secondary Antibodies Animalraised/clonality
Dilution
Anti-rabbit IgG-HRP (P0448, Dako) Goat polyclonal 1:2,000Anti-mouse IgG-HRP (P0447, Dako) Goat monoclonal 1:1,000Anti-goat IgG-HRP (P0449, Dako) Rabbit monoclonal 1:1,000
60
-
8/3/2019 Tranfer Report Final 12.11
61/63
Real-Time quantitative PCR (RT-qPCR)
RT-qPCR was used to quantify the mRNA levels of AChR -subunit.
Both EGFP and AChR -subunit were used as probe targets. Sequences for
primers and probes for EGFP and AChR -subunits are listed in table 2. For
both targets the TaqMan-based probe system was used with TAMRAquencher at the 5 and FAM dye at the 3 prime end of the probe. RT-qPCRreactions were run in the GeneAmp 5700 system (Applied Biosystems) andthe baseline and threshold were set manually. Human GAPDH(primers/probes from Applied Biosystems) was used as a reference gene forrelative quantification. Equal amounts of each sample were combined tocreate a standard curve for each probe/primer set (named pooled standardcurve).
Table 2Primers and Probes for Real-Time PCR
EGFP
Forward Primer 5 GGGCACAAGCTGGAGTACAACT 3Reverse Primer 5 CACCTTGATGCCGTTCTTCTG 3Probe 5 CCACAACGTCTATATCATGGCCGA 3
AChR -subunitForward Primer 5 CTTCGATTGGCAGAACTGTT 3Reverse Primer 5 TGTGTCGATGTCGATCTTGT 3Probe 5 CTCTCAGACGTACAATGCCGAAG 3
61
-
8/3/2019 Tranfer Report Final 12.11
62/63
References
Abdelgany A, Wood M, Beeson D (2003) Allele-specific silencing of apathogenic mutant acetylcholine receptor subunit by RNA interference.Human Molecular Genetics 12: 2637-2644
Ameres SL, Martinez J, Schroeder R (2007) Molecular basis for target RNArecognition and cleavage by human RISC. Cell 130: 101-112
Bernstein E, Caudy A, Hammond S, Hannon G (2001) Role for a bidentateribonuclease in the initiation step of RNA interference. Nature 409:363-366
Bohnsack M, Czaplinski K, Gorlich D (2004) Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 10: 185-191
Contet, C., J. N. P. Rawlins & R. M. J. Deacon (2001) A comparison of129S2/SvHsd and C57BL/6JOlaHsd mice on a test battery assessingsensorimotor, affective and cognitive behaviours: implications for the
study of genetically modified mice. Behavioural Brain Research, 124,33-46.
Croxen R, Hatton C, Shelley C, Brydson M, Chauplannaz G, Oosterhuis H,Vincent A, Newsom-Davis J, Colquhoun D, Beeson D (2002)Recessive inheritance and variable penetrance of slow-channelcongenital myasthenic syndromes. Neurology 59: 162-168
Croxen R, Newland C, Beeson D, Oosterhuis H, Chauplannaz G, Vincent A,NewsomDavis J (1997) Mutations in different functional domains of thehuman muscle acetylcholine receptor alpha subunit in patients with theslow-channel congenital myasthenic syndrome. Human MolecularGenetics 6: 767-774
Elbashir S, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T (2001)Duplexes of 21-nucleotide RNAs mediate RNA interference in culturedmammalian cells. Nature 411: 494-498
Engel AG, Ohno K, Milone M, Wang HL, Nakano S, Bouzat C, Pruitt JN,Hutchinson DO, Brengman JM, Bren N, Sieb JP, Sine SM (1996) Newmutations in acetylcholine receptor subunit genes reveal heterogeneityin the slow-channel congenital myasthenic syndrome. HumanMolecular Genetics 5: 1217-1227
Fire A (2005) Nucleic acid structure and intracellular immunity: some recentideas from the world of RNAi. Q Rev Biophys 38: 303-309
Fire A, Xu S, Montgomery M, Kostas S, Driver S, Mello C (1998) Potent andspecific genetic interference by double-stranded RNA inCaenorhabditis elegans. Nature 391: 806-811
Hammond S, Bernstein E, Beach D, Hannon G (2000) An RNA-directednuclease mediates post-transcriptional gene silencing in Drosophilacells. Nature 404: 293-296
Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Rdmark O,Kim S, Kim V (2003) The nuclear RNase III Drosha initiates microRNAprocessing. Nature 425: 415-419
Lee Y, Jeon K, Lee J, Kim S, Kim V (2002) MicroRNA maturation: stepwiseprocessing and subcellular localization. EMBO J 21: 4663-4670
Miller V, Gouvion C, Davidson B, Paulson H (2004) Targeting Alzheimer'sdisease genes with RNA interference: an efficient strategy for silencing
62
-
8/3/2019 Tranfer Report Final 12.11
63/63
mutant alleles. Nucleic Acids Res 32: 661-668Paddison P, Caudy A, Bernstein E, Hannon G, Conklin D (2002) Short hairpin
RNAs (shRNAs) induce sequence-specific silencing in mammaliancells. Genes Dev 16: 948-958
Provost P, Dishart D, Doucet J, Frendewey D, Samuelsson B, Rdmark O
(2002) Ribonuclease activity and RNA binding of recombinant humanDicer. EMBO J 21: 5864-5874
Ratcliff F, Harrison BD, Baulcombe DC (1997) A similarity between viraldefense and gene silencing in plants. Science 276: 1558-1560
Shen XM, Deymeer F, Sine SM, Engel AG (2006) Slow-channel mutation inacetylcholine receptor alpha M4 domain and its efficient knockdown.Annals of Neurology 60: 128-136
Sine SM, Ohno K, Bouzat C, Auerbach A, Milone M, Pruitt JN, Engel AG(1995) Mutation of the acetylcholine-receptor alpha-subunit causes aslow-channel myasthenic syndrome by enhancing agonist binding-affinity. Neuron 15: 229-239
Stark G, Kerr I, Williams B, Silverman R, Schreiber R (1998) How cellsrespond to interferons. Annu Rev Biochem 67: 227-264
Yi R, Qin Y, Macara I, Cullen B (2003) Exportin-5 mediates the nuclear exportof pre-microRNAs and short hairpin RNAs. Genes Dev 17: 3011-3016