-
7/30/2019 The Use of Macroarrays for the Identification of MDR
1/7
The use of macroarrays for the identification of MDR
Mycobacterium tuberculosis
T.J. Brown a,*, L. Herrera-Leon b, R.M. Anthony c, F.A. Drobniewski a
a Health Protection Agency Mycobacterium Reference Unit, Kings College Hospital (Dulwich), East Dulwich Grove, London SE22 8QF, UKb
Laboratorio de Referencia de Micobacterias, Servicio de Bacteriologia, Centro Nacional de Microbiologia, Instituto de Salud Carlos III,
Madrid, Spainc Biomedical Research, KIT (Royal Tropical Institute), Meibergdreef 39, 1105 AZ, Amsterdam, The Netherlands
Received 7 June 2005; received in revised form 5 August 2005; accepted 15 August 2005Available online 8 September 2005
Abstract
The emergence of Mycobacterium tuberculosis (Mtb), resistant to both isoniazid (INH) and rifampicin (RIF) (MDR-TB), is an
increasing threat to tuberculosis control programs. Susceptibility testing of Mtb complex isolates by phenotypic methods requires a
minimum of 14 days from a primary specimen. This can be reduced significantly if molecular analysis is used. Low density
oligonucleotide arrays (macroarrays) have been used successfully for the detection of RIF resistance in Mtb. We describe the use of
macroarray technology to identify Mtb complex isolates resistant to INH and/or RIF. The macroarray MDR-Mtb screen has been
designed to detect mutations in the RIF resistance determining region (RRDR) of Mtb rpoB and loci in katG and mabA-inhA
associated with INH resistance. A panel of Mtb isolates containing 38 different RRDR genotypes, 4 different genotypes withincodon 315 of katG and 2 genotypes at mabA-inhA was used to validate the macroarray. The wild type (WT) genotype was
correctly identified at all three loci. Of the 37 mutant rpoB genotypes, 36 were correctly detected; the single mutant not detected
contained a 9 base insertion. All mutations within katG and mabA-inhA were correctly identified. We conclude that this low cost,
rapid system can usefully detect the mutations associated with the vast majority of MDR-Mtb.
D 2005 Elsevier B.V. All rights reserved.
Keywords: Macroarray; MDR; Mycobacterium tuberculosis
1. Introduction
The WHO estimates that up to a third of the worldspopulation is infected with Mycobacterium tuberculosis
and globally someone dies of tuberculosis (TB) every
1 5 s . (www.who.int/gtb/publications/globrep). Where
TB is diagnosed in a timely manner a highly effective
multiple drug treatment regimen can be used, the two
most important constituents being isoniazid (INH) and
rifampin (RIF). Multidrug-resistant (MDR) strains,which are defined as being resistant to at least INH
and RIF, are emerging and worryingly can retain their
virulence as demonstrated by reports of their involve-
ment in several institutional and community outbreaks
(Bifani et al., 1996; Davies, 2003; Narvskaya et al.,
2002). The development of resistance to these two
drugs reduces the efficacy of standard anti-TB treat-
ment, increasing the rate of treatment failure (Quy et al.,
2003) and by inference the risk of transmission. Iden-
tification of these strains allows initiation of modified
0167-7012/$ - see front matterD
2005 Elsevier B.V. All rights reserved.doi:10.1016/j.mimet.2005.08.002
* Corresponding author. Health Protection Agency Mycobacterium
Reference Unit, Clinical Research Centre, Barts and The London,
Queen Marys School of Medicine and Dentistry, 2 Newark Street,
London E1 2AT, UK. Tel.: +44 20 7377 5895.
E-mail address: [email protected] (T.J. Brown).
Journal of Microbiological Methods 65 (2006) 294 300
www.elsevier.com/locate/jmicmeth
http:///reader/full/www.who.int/gtb/publications/globrephttp:///reader/full/www.who.int/gtb/publications/globrephttp:///reader/full/www.who.int/gtb/publications/globrep -
7/30/2019 The Use of Macroarrays for the Identification of MDR
2/7
treatment regimens, which should improve both patient
outcome and public health by minimizing the transmis-
sion of drug-resistant strains. A variety of culture based
methods for the determination of mycobacterial drug
susceptibilities provide definitive results but take at
least 14 days from primary isolation to produce (Collinset al., 1997). This can be reduced to a matter of hours
using DNA analysis techniques, but only where specific
markers have been identified.
Resistance to RIF in M. tuberculosis has been shown
to be associated with amino acid changes within the h-
subunit of RNA polymerase, encoded by M. tubercu-
losis rpoB (Telenti et al., 1993). Studies from diverse
countries have shown that more than 95% of RIF-
resistant isolates are associated with mutations within
an 81-bp rifampin-resistance determining region
(RRDR) region of rpoB (Herrera et al., 2003; Yue etal., 2003; Cavusoglu et al., 2002; Mani et al., 2001;
Bartfai et al., 2001; Telenti et al., 1993). Although these
mutations are seen throughout this RRDR approximate-
ly 6070% are found within two codons, 531 and 526.
(Tracevska et al., 2002; Huang et al., 2002; Cavusoglu
et al., 2002).
Mutations at a number of loci have been associated
with INH resistance in M. tuberculosis, these include
katG, mabA-inhA, oxyR-ahpC (Zhang et al., 1992;
Banerjee et al., 1994; Sreevatsan et al., 1997). Over
80% of INH-resistant isolates have been reported as
harbouring at least one of the two mutationsAGCNACC at codon 315 in katG and a CNT substi-
tution at15 at the mabA-inhA locus (Musser et al.,
1996; Martilla et al., 1998; Ahmad et al., 2002; Kim et
al., 2003; Bakonyte et al., 2003; Silva et al., 2003).
A variety of techniques have been used to detect
these limited loci (Garca de Viedma, 2003). Arrays,
which have found various applications in microbiology
(Anthony et al., 2001), can be used to analyse multiple
loci in parallel and have been previously described for
the analysis of mutations within M. tuberculosis rpoB
associated with RIF resistance (De Beenhouwer et al.,1995; Cooksey et al., 1997; Watterson et al., 1998).
In this paper we describe and validate a multiplex
PCR followed by hybridisation to low density DNA
oligonucleotide array that had been designed to detect
mutations associated with INH and RIF resistance.
2. Materials and methods
2.1. Bacterial isolates
A panel of 40 M. tuberculosis isolates was assembled
in order to give a wide range of genotypes at the rpoB
RRDR, katG315 and mabA-inh15 loci. These isolates
were cultured on LowensteinJensen (LJ) and drug
susceptibility testing was performed using the resistance
ratio method on LJ media (Collins et al., 1997).
2.2. Preparation of DNA extracts
Bacterial cells from LJ medium were suspended in
100 Al purified water and an equal volume of chloro-
form was added. The tubes were heated at 80 8C for
20 min, placed in the freezer for 5 min and mixed
briefly using a vortex mixer. Immediately before use
as PCR template tubes were centrifuged for 3 min at
12000 g.
2.3. PCR
Biotinylated target PCR products were generated
in a 20 Al multiplex PCR. This contained 1ammo-
nium reaction buffer (Bioline Ltd., London, UK),
dNTP at 0.2 mM each (Amersham Biosciences, Chal-
font St Giles, UK), MgCl2 at 1.5 mM (Bioline),
primers KatGP5IO (CGCTGGAGCAGATGGGCTTGG)
and KatGP6BIO (GTCAGCTCCCACTCGTAGCCG) at
0.25 mM, primers INHAP3BIO (CAGCCACGTTA-
CGCTCGTGG), TOMIP2BIO (CGATCCCCCGGTT-
TCCTCCGG), rpoBP1BIO (GGTCGGCATGTCGCQ
GGATGG) and BrpoB1420R (GTAGTGCGACGGQ
GTGCACGTC) at 1 mM (ThermoHybaid, Ulm, Ger-many), 1 U Taq-polymerase (Bioline) and 1 Al of
DNA template. All primers were biotinylated. Thermal
cycling was performed on a Perkin Elmer 9700 ther-
mocycler using a programme consisting of an initial
melting phase of 5 min at 95 8C followed by 30 cycles
of a 30 s melt at 95 8C and a combined annealing and
extension of 60 s at 65 8C, then a final extension hold
for 5 min at 72 8C.
2.4. Construction of MDR macroarray
Eleven probes as shown in Table 1 were used to
produce a macroarray. The first probe targeted an M.
tuberculosis complex specific locus of M. tuberculosis
rpoB. The next four probes were designed to analyse loci
associated with INH resistance. Two probes, K315WTC
and tomiwt, were designed to detect the wild type (WT)
genotypes atkatG315 and atmabA-inhA15 whilst two
further probes, K315GC and tomimut1, were designed to
detect the most frequently seen genotype at each locus,
katG315AGCYACC and mabA-inhA15CYT, respec-
tively. The remaining 6 probes, MRURP3, MRURP6,
MRURP9, MRURP12, MRURP17 and MRU1371A,
T.J. Brown et al. / Journal of Microbiological Methods 65 (2006) 294300 295
-
7/30/2019 The Use of Macroarrays for the Identification of MDR
3/7
formed a scanning array designed to detect the WT
genotype of the RRDR of M. tuberculosis rpoB. In
order to optimise probe performance within the arrayoligonucleotide probes were synthesised with 3V polyT
tails (Brown and Anthony, 2000). Oligonucleotide
probes (Invitrogen, Paisley, UK) were diluted to 20
AM in water containing 0.001% bromo phenol blue
and applied to nylon membrane (Magnagraph 0.22
AM, Osmonics, Minnetonka, USA) using a hand-held
arraying device (VP Scientific, San Diego, USA). In
addition to the probes a permanent ink spot was
applied to the membrane in order to orientate the
array and a spot of primer rpoBP1BIO at 2 AM as a
colour development control. Probes were UV-cross-
linked to the nylon membrane. The membranes werewashed in 0.5% 20SSC (Sigma, Poole, UK) then
dried, cut and placed in 2 ml polythene hybridisation
tube (Alpha Labs, Eastleigh, UK).
2.5. Hybridisation and colour detection
The biotin labeled PCR products were denatured by
adding an equal volume of denaturation solution (0.4
M NaOH, 0.02 M EDTA) and incubating at room
temperature for 15 min. A 20 Al aliquot of the dena-
tured PCR was added to tube containing an array and500 Al hybridisation solution (5SSPE; 0.5% SDS)
that was agitated in a hybridisation oven at 60 8C for
15 min. The strips were then washed in wash buffer
(0.4SSPE, 0.5% SDS) at 60 8C for 10 min in the
hybridisation oven. The arrays were agitated in rinse
buffer (0.1 M Tris, 0.1 M NaCl, pH 7.5) at room
temperature (RT) for 1 min. This rinse step was re-
peated using the rinse buffer containing 0.1% blocking
reagent (Roche, Lewes, UK). The arrays were now
agitated at RT for 15 min in the rinse buffer with
0.1% blocking reagent and 1/200 dilution of concen-
trated streptavidin-alkaline phosphatase conjugate
reagent (BioGenex, San Ramon, USA). The mem-
branes were then washed twice in wash solution and
once in substrate buffer (0.1 M Tris, 0.1 M NaCl at pH9.5) before being incubated at RT for 5 min in sub-
strate buffer containing 0.34 mg/ml NBT (USB, Cleve-
land, USA) and 0.17 mg/ml BCIP (USB). The
membranes were washed in water before being air-
dried and the hybridisation patterns noted.
2.6. Interpretation of the macroarray
Hybridisation to any of the probes directed towards
rpoB is indicative of a WT genotype at that locus,
conversely lack of hybridisation with a given rpoB
probe is indicative of a mutant genotype at that locus.Hybridisation with K315WTC is indicative of a
katG315 WT genotype whereas absence indicates a
mutant genotype at this or surrounding this locus.
Absence of hybridisation with K315WTC and hybridi-
sation with K315GC is indicative of the katG315
AGCNACC genotype. Likewise, hybridisation with
TOMIWT is indicative of a mabA-inhA15 WT geno-
type whereas absence indicates a mutant genotype at
this or surrounding this locus. Absence of hybridisation
with TOMIWT and hybridisation with TOMIMUT1
suggests the mabA-inhA15CYT
genotype.
2.7. DNA sequencing
Single primer pairs (see PCR section above) were
used to generate single rpoB, katG or inhA PCR
products using the method given above. These were
diluted 1/100 in purified water and sequenced using
CEQ Quick Start sequencing kits and a CEQ 8000
instrument (Beckman Coulter, High Wycombe, UK)
according to the manufacturers instructions. The PCR
products were sequenced in both directions using the
amplification primers given above.
Table 1
DNA probes used in this study
Probe Array position Sequence
MRUMtb P1 CACCAGCCAGCTGAGCCAATTCATTTTTTTTTT
K315WTC P2 CTCGATGCCGCTGGTGATCGCTTTTTTTTTT
KAT315GC P3 GCGATCACCACCGGCATCGAGTTTTTTTTTTTOMIWT P4 GGCGAGACGATAGGTTGTCGGTTTTTTTTTT
TOMIMUT1 P5 GGCGAGATGATAGGTTGTCGGTTTTTTTTTT
MRURP3 P6 GCCAGCTGAGCCAATTCATGGACTTTTTTTTTT
MRURP6 P7 GCCAATTCATGGACCAGAACAACCTTTTTTTTTTTTTTT
MRURP9 P8 TGGACCAGAACAACCCGCTGTCTTTTTTTTTT
MRURP12 P9 ACAACCCGCTGTCGGGGTTGACTTTTTTTTTT
MRURP17 P10 GGTTGACCCACAAGCGCCGACTTTTTTTTTT
MRUR1371A P11 CGACTGTCGGCACTGGGGCCCGGTTTTTTTTTT
T.J. Brown et al. / Journal of Microbiological Methods 65 (2006) 294300296
-
7/30/2019 The Use of Macroarrays for the Identification of MDR
4/7
3. Results
The panel of 40 M. tuberculosis isolates contained
30 MDR isolates, 5 RIF-monoresistant isolates, 1 INH
monoresistant isolate and 4 isolates sensitive to RIF and
INH. Sequencing of the RRDR of rpoB of these iso-lates revealed 36 different genotypes in addition to the
WT. Analysis of the codons most commonly associated
with RIF resistance showed two different mutations at
codon 531, 6 different mutations at codon 526, and 4
different mutations at codon 516. Mutations in codons
509, 511, 513, 515, 522, 528, 529 and 533 were also
seen. Seven isolates contained two separate single base
substitutions, four isolates contained insertions and
three contained deletions. The katG315 and mabA-
inhA15 genotypes of 28 of the isolates were deter-
mined. Three genotypes in addition to the WT were
seen at katG315 and a C to T substitution at mabA-inhA15 was seen in addition to the WT. The genotypes
of these isolates are shown in Table 2.
The crude DNA extracts from each of the isolates in
the panel were analysed using the MDR array, the
design of which is shown in Fig. 1 as are representative
examples of the developed arrays. All isolates produced
Table 2
Summary of phenotype and genotype of the isolates used in this study
Isolate Susceptibility by
phenotype
katG315/mabA-inhA15
genotype
rpoB genotype Probes showing
no hybridisation
Susceptibility
by array
INH RIF INH RIF
01/07786 R R 1302CNG/S509R+1351CNT/H526Y P2 P5 P10 R R
236-02 R R AGCNACC/WT 1307TNC/L511P+1322ANG/D516G P2 P5 P8 P7 R R
98/05219 S R 1307TNC/L511P+1351CNG/H526D P3 P5 P6 P10 S R
2936-99 R R WT/WT 1312CNA/Q513K P3 P5 P6 P7 S R
Is20043 R R 1313ANC/Q513P P2 P5 P6 P7 R R
98/05844 R R AGCNAAC/WT 1313ANT/Q513L P2 P3 P5 P6 P7 R R
02/07435 R R 1314 CCAACT ins 513 P2 P5 P6 P7 R R
2651-96 R R AGCNACC/WT 1315 TTC ins 514 P2 P5 P6 P7 R R
Is14373 R R 13151323 Del TTCATGGAC 514516 P2 P5 P6 P7 R R
Is11195 R R WT/WT 13161318 Del TCA 514515 P3 P5 P6 P7 S R
Is14786 R R 1318ANG/M515V+1351CNA/H526N P3 P4 P6 P7 P10 R R
1763-97 R R AGCN
AAC/WT 1318Ins ATTCAT 515 P2 P3 P5 P6 P7 R R 98/07530 R R 1320GNA/M515I P2 P5 P7 P8 R R
2883-97 R R AGCNACC/WT 132126 Del GACCAG 516517 P2 P5 P6 P7 P8 R R
Is11125 R R AGCNACC/WT 13212GANTT/D516F P2 P4 P7 R R
1579-96 S R WT/WT 1321GNT/D516Y P3 P5 P7 S R
Is14027 R R 1322ANG/D516G P3 P4 P7 P10 R R
1004-01 R R AGCNACA/WT 1322ANT/D516V P5 P7 R R
1071-98 R R AGCNACC/WT 1322ANT/D516V+1351CNG/H526D P2 P5 P6 P7 P8 P10 R R
98/00699 R R 1334 AGAACAACC ins 520 P3 P4 R S
1992-00 R R WT/WT 133940TCNCA/S522Q P3 P5 P9 S R
1445-01 R R AGCNACC/WT 1340CNG/S522W P2 P5 P9 R R
395-98 R R AGCNACC/WT 1340CNT/S522L P2 P5 P9 R R
03/02007 R R WT/WT 13501CCNTT/T525T+1351CNT/H526Y P3 P5 P10 S R
2323-02 R R AGCNACC/WT 13512CANTG/H526C P2 P5 P10 R R
1828-00 R R WT/ inhA C15T 1351CNG/H526D P3 P4 P10 R R 2031-02 S R WT/WT 1351CNT/H526Y P3 P5 P10 S R
3381-97 R R AGCNACC/WT 1352 ANG/H526R P2 P5 P10 R R
740-97 R R AGCNACC/WT 1352ANC/H526P P2 P5 P10 R R
1810-96 R R AGCNAAC/WT 1352ANT/H526L P2 P3 P5 P10 R R
01/03682 S S 1359CNT/R528R P3 P5 P10 S R
02/06539 S R 1361GNC/R529P P3 P5 P10 S R
1255-98 R R WT/ inhA C15T 1363CNA/L530M+1367CNT/S531L P3 P4 P6 P7 P11 R R
01/11196 R R 1367CNG/S531W P2 P5 P11 R R
Is5 R R WT/WT 1367CNT/S531L P3 P5 P11 S R
02/03056 S R WT/WT 1373TNC/L533P P3 P5 P11 S R
03/06044 S S WT/WT WT P3 P5 S S
03/04307 S S WT/WT WT P3 P5 S S
03/05269 S S WT/WT WT P3 P5 S S
1182-01 R S AGCNACA/WT WT P5 R S
T.J. Brown et al. / Journal of Microbiological Methods 65 (2006) 294300 297
-
7/30/2019 The Use of Macroarrays for the Identification of MDR
5/7
interpretable hybridisation patterns with the array and
39 of the 40 different mutations present in the panel
were correctly detected when present. The one isolate
that failed to give a mutant genotype using the array
contained a nine base insertion in the rpoB RRDR. All
other isolates were correctly identified as mutant or
wild type. A mutation was detected in 35 of the RIF-
resistant isolates. A mutation was also detected in a RIF
susceptible isolate that did indeed carry a synonymous
mutation. The array detected mutations at katG315 or
mabA-inhA15 in twenty seven out of the 31 INH-
resistant isolates, the remaining four were wild type atthese loci (Table 2).
Amino acid codons 516, 526 and 531 are the most
prevalent codons involved in rifampin resistance. These
three codons may be responsible for 80% of RIF-resis-
tant M. tuberculosis cases. All the isolates with muta-
tions in these positions were correctly identified. The
rpoB531, rpoB526 and rpoB516 mutant alleles
showed a negative hybridisation signal for the P17
(Fig. 1.B4), the P6 (Fig. 1.B1) and the P17 (Fig.
1.B7) probes, respectively.
Other less frequent mutations at the 511, 513, 515,522, 529 and 533 codons and 6 double single muta-
tions, 3 different deletions and two insertions were
correctly identified. Only the mutant with an unusual
insertion of 9 nucleotides (AGAACAACC) at codon
520 was not identified.
Four MDR-resistant isolates showed a wild type
pattern for INH resistance with positive hybridisation
signal for the katGwt and inhA probes: this is possible
as resistance to INH is caused by a variety of mutations
at several chromosomal loci of M. tuberculosis. Muta-
tions in the katG and the regulatory region of the
mabA-inhA operon have not been found in between
10% and 30% of the INH-resistant M. tuberculosis
isolates.
All the isolates with known sequences of the rele-
vant part of katG and the regulatory region of the
mabA-inhA operon were correctly identified. The
INH-resistant M. tuberculosis isolates with different
mutations in katG codon 315 were correctly identified.
The INH-resistant isolates with the S315T mutation had
a pattern with a negative hybridisation signal for the
katGwt and a positive hybridisation signal for the
katGmut probe (Fig. 1.B1B2). Others with different
mutations in katG (S315 ACA, S315 AAC or S315AGG) showed a pattern with a negative hybridisation
signal for both probes (Fig 1.B5). The INH-resistant M.
tuberculosis isolates with the inhAC15T mutation
showed a negative hybridisation signal for the inhAwt
probe and a positive hybridisation signal for the inhA-
mut probe (Fig. 1.B6).
4. Discussion
Detecting drug resistance in M. tuberculosis isolates
by determining genotype is an attractive alternative toconventional phenotypic susceptibility testing because
results can be generated within hours with minimal
manipulation of live organisms. Obviously this ap-
proach can only be used where genotypic markers
for drug resistance have been identified. This is the
case for MDRTB where a range of mutations in the
RRDR of rpoB is highly specific to RIF-resistant
isolates and point mutations, one in katG and one
associated with inhA are strongly associated with
INH-resistant isolates. By analysing these three loci
80% of the MDRTB isolates present in the panel could
be identified. Using macroarray analysis all these loci
A
P1 MtbC
P3 katG315ACC
P4 inhAWT
P5 inhAMUT-15T
P6
P7
P8
P9
P10
P2 katGWT
Ink spot
control
P11
B
7
6
5
4
3
2
1
Fig. 1. Schematic of the MDR macroarray (A) and patterns of the M. tuberculosis strains (B): pattern 1, strain with the katG315 AGC-ACC
mutation and rpoB526 mutant allele; pattern 2, strain with the katG315 AGC-ACC mutation and insertion in the rpoB531 gene (lns TTC at the 514
codon); pattern 3, strain wild type; pattern 4, strain with the rpoB531 mutant allele; pattern 5, strain with the katG315 AGC-ACA mutation; pattern
6, starin with the inhAC15T mutation in the regulatory region of the mabA-inhA operon; pattern 7; strain with the rpoB516 mutant allele.
T.J. Brown et al. / Journal of Microbiological Methods 65 (2006) 294300298
-
7/30/2019 The Use of Macroarrays for the Identification of MDR
6/7
can be analysed in parallel. We have described such a
macroarray based assay for the detection of MDRTB
above. The principle of the MDR array assay is that a
mutation should impede the hybridisation of the target
to the relevant WT probe or in the case of the katG315
or inhA loci permit the hybridisation to the cor-responding mutant probe. The implementation de-
scribed was capable of detecting 35/ 36 different
mutations in the RRDR of rpoB, 3/3 different muta-
tions at katG315 and 1/1 at inhA15. It has been
reported that the range of mutations seen within the
loci scrutinized by this assay may vary with geograph-
ical location (Nikolayvsky et al., 2004). The mutations
used to challenge the array were detected in isolates
seen in the UK and Spain. The efficiency of the array
when used to analyse isolates from other geographical
locations may vary although it is capable of detectingall the commonly reported mutations within rpoB,
inhA and katG.
When susceptibility is designated by genotype, there
are four sources of discrepancy with the more definitive
phenotypic testing. Firstly a resistant isolate may not
contain the marker or markers targeted. According to
the literature this is seen in b5% of RIF-resistant iso-
lates and between 10% and 30% of INH-resistant iso-
lates with the markers described in this study. This type
of discrepancy was seen in 4 INHresistant isolates in
the present study. These discrepancies could be reduced
if as further markers are identified they were includedin the assay. Secondly, a susceptible isolate may contain
a synonymous mutation which when detected would
lead to the isolate being designated resistant if the assay
detects but does not identify mutations. These muta-
tions are rarely described in the literature at the loci
used in this assay and discrepancies caused by them
could be reduced by identification of mutations seen
either by sequencing mutant loci or inclusion on the
macroarray of probes directed at all possible mutations.
One rpoB mutant such as this was seen in the present
study. Thirdly the assay may fail to correctly detectmutations that are actually present. This type of dis-
crepancy is minimised by careful selection of the
probes used in the array. Because the hybridisation
behaviour of a given probe and target combination is
difficult to predict it is essential to validate all probes
with potential targets. In the present study only one
mutation was not detected. This was a 9 base insertion
which had the effect of producing a 3 base mismatch at
the 5V end of the 22 base probe MRURP9 which
presumably did not destabilise the hybridisation duplex
sufficiently to prevent the detection of hybridisation.
Lastly, where a non-synonymous mutation occurs but
does not result in the drug-resistant phenotype. This
type of discrepancy was not seen in this study and is
likely to be seen rarely, the effect on the predictive
value of the array could be negated by the inclusion
of all possible genotypes on the array although high
density platforms may be more suitable for this ap-proach. The platform described in this paper is low
cost using unmodified clearly defined oligonucleotides
and no specialized equipment. This also makes it flex-
ible and so ideal for the development of expanded or
novel probe sets for oligonucleotide arrays addressing
local needs. Oligonucleotide arrays, as described here,
consist of a series of probes immobilized on a solid
support all of which must exhibit similar hybridisation
destabilisation properties when probed with mis-
matched target DNA under the same stringent wash
conditions. There is no method for reliably predictingthe hybridisation properties of a probe target pairing
and so probes within the array must be validated em-
pirically. Experimentation is minimized by choosing
probes of between 18 and 21 bp, with equal estimated
melting temperature, with potential mismatch pairs
greater than 2 bases from either end and with ten
thiamine bases added to the 3V end of the probe. If
possible complimentary runs of greater than two bases
and guaninethymine mismatches should be avoided. If
specificity is poor probes can be improved by moving
the potential mismatch along the probe (Anthony et al.,
2003). If hybridisation signal intensity is a problem, thiscan be increased by adding thymine bases to the 3V end
of the probe or reduced by removing thymine bases.
In summary, the MDR screen macroarray can
identify M. tuberculosis complex isolates resistant to
INH and/or RIF, the two most important drugs in the
treatment of tuberculosis although phenotypic testing
is required to definitively identify all MDR-TB iso-
lates. The assay is easy to perform and interpret, uses
multipurpose equipment available in a basic molecu-
lar biology laboratory and could be performed in
routine clinical microbiology laboratories, most use-fully in areas with a high prevalence of MDR M.
tuberculosis.
References
Ahmad, S., Fares, E., Araj, F., Chugh, T.D., Mustafa, A.S., 2002.
Prevalence of S315T mutation within the katG gene in isoniazid-
resistant clinical Mycobacterium tuberculosis isolates from Dubai
and Beirut. Int. J. Tuberc. Lung Dis. 6, 920926.
Anthony, R., Brown, T., French, G., 2001. DNA array technology and
diagnostic microbiology. Expert Rev. Mol. Med. 1, 89 97.
Anthony, R.M., Schuitema, A.R.L., Chan, A.B., Boender, P.J.,Klaster, P.R., Oskam, L., 2003. Effect of secondary structure
T.J. Brown et al. / Journal of Microbiological Methods 65 (2006) 294300 299
-
7/30/2019 The Use of Macroarrays for the Identification of MDR
7/7
on single nucleotide polymorphism detection with a porous
microarray matrix; implications for probe selection. Biotechni-
ques 34, 10821089.
Bakonyte, D., Baranauskaite, A., Cicenaite, J., Sosnovskaya, A.,
Satakenas, P., 2003. Molecular characterization of isoniazid-resis-
tant Mycobacterium tuberculosis clinical isolates in Lithuania.
Antimicrob. Agents Chemother. 47, 2009 2011.Banerjee, A., Dubnau, E., Quemard, A., Balasubramanian, U., Um,
K.S., Wilson, T., Collins, D., Lisle Jr., G., Jacobs, W.R., 1994.
inhA, a gene encoding a target for isoniazid and ethionamide in
Mycobacterium tuberculosis. Science 263, 227 230.
Bartfai, Z., Somoskovi, A., Kodmon, C., Szabo, N., Puskas, E.,
Kosztolanyi, L., Farago, E., Mester, J., Parsons, L.M., Salfinger,
M., 2001. Molecular characterization of rifampin-resistant isolates
of Mycobacterium tuberculosis from Hungary by DNA sequenc-
ing and line probe assay. J. Clin. Microbiol. 39, 3736 3739.
Bifani, P.J., Plikaytis, B., Kapur, V., Stockbauer, K., Pan, X., Lutfey,
M.L., Moghazeh, S.L., Eisner, W., Daniel, T.M, Kaplan, M.H.,
Crawford, J.T., Musser, J.M., Kreiswirth, B.N., 1996. Origin and
interstate spread of New York City multidrug-resistant Mycobac-
terium tuberculosis clone family. JAMA 275, 452457.Brown, T., Anthony, R., 2000. The addition of low numbers of 3V
thymine bases can be used to improve the hybridization signal of
oligonucleotides for use within arrays on nylon supports.
J. Microbiol. Methods 42, 203 207.
Cavusoglu, C., Hilmioglu, S., Guneri, S., Bilgic, A., 2002. Charac-
terization of rpoB mutations in rifampin-resistant clinical isolates
of Mycobacterium tuberculosis from Turkey by DNA sequencing
and line probe assay. J. Clin. Microbiol. 40, 4435 4438.
Collins, C.H., Grange, J.M., Yates, M.D., 1997. Tuberculosis Bacte-
riology, Organization and Practice, 2nd ed. Butterworth-Heine-
mann, Oxford.
Cooksey, R.C., Morlock, G.P., Glickman, S., Crawford, J.T., 1997.
Evaluation of a line probe assay kit for characterization ofrpo
B
mutations in rifampin-resistant Mycobacterium tuberculosis iso-
lates from New York City. J. Clin. Microbiol. 35, 12811283.
Davies, P.D., 2003. The worldwide increase in tuberculosis: how
demographic changes, HIV, infection and increasing numbers in
poverty are increasing tuberculosis. Ann. Med. 35, 235 243.
De Beenhouwer, H., Liang, Z., Jannes, G., Mijs, W., Machtelinckx,
L., Rossau, R., Traore, H., Portaels, F., 1995. Rapid detection of
rifampin resistance in sputum and biopsy specimens from tuber-
culosis patients by PCR and line probe assay. Tuberc. Lung Dis.
76, 425430.
Garca de Viedma, D., 2003. Rapid detection of resistance in Myco-
bacterium tuberculosis: a review discussing molecular
approaches. Clin. Microbiol. Infect. 9, 349359.
Herrera, L., Jimenez, M.S., Valverde, A., Garcia-Aranda, M.A., Saez-Nieto, J.A., 2003. Molecular analysis of rifampin-resistant M.
tuberculosis isolated in Spain (19962001). Description of new
mutations in the rpoB gene and review of the literature. Int. J.
Antimicrob. Agents 21, 403408.
Huang, H., Jin, Q., Ma, Y., Chen, X., Zhuang, Y., 2002. Characte-
rization of rpoB mutations in rifampin-resistant Mycobacterium
tuberculosis isolated in China. Tuberculosis 82, 7983.
Kim, S., Park, Y., Kim, W., Lee, S., Ludgerus Chang, C., Kang, S.,
Kang, C., 2003. Molecular analysis of isoniazid resistance in
Mycobacterium tuberculosis isolates recovered from South
Korea. Diagn. Microbiol. Infect. Dis. 47, 497 502.
Mani, C., Selvakumar, N., Narayanan, S., Narayanan, P.R., 2001.
Mutations in the rpoB gene of multidrug-resistantMycobacterium
tuberculosis clinical isolates from India. J. Clin. Microbiol. 39,
29872990.
Martilla, H., Soini, H., Eerola, E., Vyshnevskaya, E., Vyshnevskiy, B.,
Otten, T., Vasilyef, A., Viljanen, M., 1998. A Ser315Thr substi-
tution in KatG is predominant in genetically heterogeneous mul-
tidrug-resistant Mycobacterium tuberculosis isolates originating
from the St. Petersburg area in Russia. Antimicrob. Agents Che-mother. 42, 24432445.
Musser, J.M., Kapur, D., Williams, D.L., Kreiswirth, B.N., Van
Soolingen, D., Van Embden, J.D., 1996. Characterization of the
catalase-peroxidase gene (katG) and inhA locus in isoniazid
resistant and susceptible strains of Mycobacterium tuberculosis
by automated DNA sequencing: restricted array of mutation as-
sociated with drug resistance. J. Infect. Dis. 173, 196 202.
Narvskaya, O., Otten, T., Limeschenco, E., Sapozhnikova, N.,
Graschenkova, N., Steklova, L., Nikonova, A., Filipenko,
M.L., Mokrousov, I., Vysnevskiy, B., 2002. Nosocomial
outbreak of multidrug-resistant tuberculosis caused by a
strain of Mycobacterium tuberculosis W-Beijing family in
St. Petersburg Russia. Eur. J. Clin. Microbiol. Infect. Dis.
21, 596 602.Nikolayvsky, V., Brown, T.J., Balabanova, Y., Ruddy, M.C., Fedorin,
F.A., Drobniewski, F.D., 2004. Detection of mutations associated
with isoniazid and rifampin resistance in Mycobacterium tuber-
culosis isolates from Samara region Russian Federation. J. Clin.
Microbiol. 42, 44984502.
Quy, H., Lan, N., Borgdorff, M., Grosset, J., Linh, P., Tung, L., van
Soolingen, D., Raviglione, M., Co, N., Broekmans, J., 2003. Drug
resistance among failure and relapse cases of tuberculosis: is the
standard re-treatment regimen adequate? Int. J. Tuberc. Lung Dis.
7, 631636.
Silva, M., Senna, S., Ribeira, M., Valim, A., Telles, M., Kritski, A.,
Morlock, G., Cooksey, R., Zaha, A., Rossetti, M., 2003. Muta-
tions inkat
G,inh
A andahp
C genes of Brazillian isoniazid restant
isolates of Mycobacterium tuberculosis. J. Clin. Microbiol. 41,
44714474.
Sreevatsan, S., Pan, X., Zhang, Y., Deretic, V., Musser, J.M., 1997.
Analysis of the oxyR-ahpC region in isoniazid-resistant and sus-
ceptible Mycobacterium tuberculosis complex organisms reco-
vered from diseased humans and animals in diverse localities.
Antimicrob. Agents Chemother. 41, 600606.
Telenti, A., Imboden, P., Marchesi, F., Lowri, D., Cole, S., Colston,
M.J., Matter, L., Schopfer, K., Bodmer, T., 1993. Detection of
rifampicin-resistance mutations in M. tuberculosis. Lancet 341,
647650.
Tracevska, T., Jansone, I., Broka, L., Marga, O., Baumanis, V., 2002.
Mutations in the rpoB and katG genes leading to drug resistance
in Mycobacterium tuberculosis in Latvia. J. Clin. Microbiol. 40,37893792.
Watterson, S.A., Wilson, S.M., Yates, M.D., Drobniewski, F.A., 1998.
Comparison of three molecular assays for rapid detection of
rifampicin resistance in Mycobacterium tuberculosis. J. Clin.
Microbiol. 36, 19691973.
Yue, J., Shi, W., Xie, J., Li, Y., Zeng, E., Wang, H., 2003. Mutations
in the rpoB gene of multidrug-resistant M. tuberculosis isolates
from China. J. Clin. Microbiol. 41, 22092212.
Zhang, Y., Heym, B., Allen, B., Young, D., Cole, S.T., 1992. The
catalase peroxidase gene and isoniazid resistance in Mycobacte-
rium tuberculosis. Nature 358, 501 593.
T.J. Brown et al. / Journal of Microbiological Methods 65 (2006) 294300300