![Page 1: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/1.jpg)
The ongoing battle between humans
and weeds
The ongoing battle between humans
and weedsWho is winning?Who is winning?
![Page 2: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/2.jpg)
![Page 3: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/3.jpg)
We have always had weeds, andWe have always had weeds, and……
we always will have weeds!we always will have weeds!
![Page 4: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/4.jpg)
Charles Darwin1809 - 1882
![Page 5: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/5.jpg)
Weed control and weed evolutionWeed control and weed evolutionWhy do weeds evolve?Glyphosate-resistant cropsStudying weed evolution with molecular biology• Resistance to PPO-inhibiting herbicides• Enter genomics
Implications and final thoughts
TakeTake--home messages:home messages:-- weeds provide great examples of evolutionweeds provide great examples of evolution-- lowly weeds merit sophisticated researchlowly weeds merit sophisticated research
![Page 6: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/6.jpg)
Why do weeds evolve?Why do weeds evolve?Because they have to!• Weeds are repeatedly subjected to strong selection
pressure.The objective of weed control is to kill the species.An individual plant possessing a genetic mechanism for surviving the weed control will have a tremendous advantage.Thus, that genetic mechanism will increase in frequency in the population.
![Page 7: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/7.jpg)
Rate of evolutionRate of evolution
Relativefitness
1 .9 1 .05
“Normal” speed Warp speed
![Page 8: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/8.jpg)
Herbicide resistanceHerbicide resistance
Atrazine1 kg ai ha-1
+ 1% COC
Lactofen175 g ai ha-1
+ 1% COC
Imazamox44 g ae ha-1
+ 1% COC+ 2.5% AMS
Atrazine+ Lactofen
+ Imazamox+ 1% COC
+ 2.5% AMS
Sensitive Resistant
![Page 9: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/9.jpg)
Herbicide resistanceHerbicide resistance
Atrazine Lactofen Imazamox
Atrazine + Lactofen+ Imazamox
Sensitive Resistant
10 days after treatment
![Page 10: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/10.jpg)
Examples of weed evolutionExamples of weed evolution
Courtesy S.C.H. Barrett
Evolution of crop mimicry in barnyardgrass (Echinochloa crus-galli).
![Page 11: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/11.jpg)
Examples of weed evolutionExamples of weed evolution
Illinois
98
NorthDakota
MissouriKentucky
Ohio
Michigan
Wisconsin
Iow a
Minnesota
Kansas
Nebraska
South Dakota
Indiana
Mid 80s
96
98
94
92
93
95
91
9495
The march of waterhemp (Amaranthustuberculatus) through the midwestern U.S.
![Page 12: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/12.jpg)
Our latest tool in the fight against weedsOur latest tool in the fight against weeds……
HerbicideHerbicide--resistant cropsresistant crops
Our latest tool for driving weed evolutionOur latest tool for driving weed evolution……
![Page 13: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/13.jpg)
Impacts of Impacts of glyphosateglyphosate--resistance technologyresistance technology%
of p
lant
ed a
rea
U.S. adoption of GR soybean
Dill et al. 2008
![Page 14: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/14.jpg)
Advantages of GR technologyAdvantages of GR technology
GlyphosateGlyphosate is a very effective herbicideis a very effective herbicide•• Broad weed spectrumBroad weed spectrum•• Systemic activitySystemic activity•• Flexible application timingFlexible application timingGlyphosateGlyphosate causes little or no crop injurycauses little or no crop injuryGlyphosateGlyphosate has favorable toxicological and has favorable toxicological and environmental propertiesenvironmental properties
![Page 15: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/15.jpg)
“Because of biotechnology and Roundup Ready soybeans …it helps me be a better husband and a better father, and that is important to me.”
- William Horan, Rockwell City, IA
![Page 16: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/16.jpg)
![Page 17: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/17.jpg)
Courtesy S. Culpepper, Univ. of GeorgiaCourtesy S. Culpepper, Univ. of Georgia
![Page 18: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/18.jpg)
GlyphosateGlyphosate--resistant weeds worldwideresistant weeds worldwide1.1. AmaranthusAmaranthus palmeripalmeri Palmer amaranthPalmer amaranth USAUSA2.2. AmaranthusAmaranthus tuberculatustuberculatus Common Common waterhempwaterhemp USAUSA3.3. Ambrosia Ambrosia artemisiifoliaartemisiifolia Common ragweedCommon ragweed USAUSA4.4. Ambrosia Ambrosia trifidatrifida Giant ragweedGiant ragweed USAUSA5.5. ConyzaConyza bonariensisbonariensis Hairy fleabaneHairy fleabane 5 countries5 countries6.6. ConyzaConyza canadensiscanadensis HorseweedHorseweed 5 countries5 countries7.7. DigitariaDigitaria insularisinsularis SourgrassSourgrass Paraguay, BrazilParaguay, Brazil8.8. EchinochloaEchinochloa colonacolona JunglericeJunglerice AustraliaAustralia9.9. EleusineEleusine indicaindica GoosegrassGoosegrass Malaysia, ColumbiaMalaysia, Columbia10.10. Euphorbia Euphorbia heterophyllaheterophylla Wild poinsettiaWild poinsettia BrazilBrazil11.11. Lolium Lolium multiflorummultiflorum Italian ryegrassItalian ryegrass 5 countries5 countries12.12. Lolium rigidumLolium rigidum Rigid ryegrassRigid ryegrass 6 countries6 countries13.13. PlantagoPlantago lanceolatalanceolata Buckhorn plantainBuckhorn plantain South AfricaSouth Africa14.14. Sorghum Sorghum halepensehalepense JohnsongrassJohnsongrass USA, ArgentinaUSA, Argentina15.15. UrochloaUrochloa panicoidespanicoides LiverseedgrassLiverseedgrass AustraliaAustralia
![Page 19: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/19.jpg)
SoSo……. are GR crops really an . are GR crops really an effective weed management tool? effective weed management tool?
YesYesActually, Actually, tootoo effective!effective!
![Page 20: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/20.jpg)
Num
ber o
f a.i.
Young, 2006
OverOver--reliance on reliance on glyphosateglyphosate in U.S. soybeanin U.S. soybean
Number of herbicide active ingredients used on > 10% of soybean area
![Page 21: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/21.jpg)
So should we have expected glyphosate resistance?
Of course!
Modeling herbicide resistance
![Page 22: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/22.jpg)
Modeling herbicide resistanceModeling herbicide resistanceR
esis
tanc
e (%
)
Years
- Initial R frequency = 10-6
- 95% control of S biotype- No seed dormancy- Simple genetics
![Page 23: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/23.jpg)
Modeling herbicide resistanceModeling herbicide resistanceR
esis
tanc
e (%
)
Years
Initial R frequency = 10-9
![Page 24: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/24.jpg)
Modeling herbicide resistanceModeling herbicide resistanceR
esis
tanc
e (%
)
Years
With a 30% fitness penalty
![Page 25: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/25.jpg)
Modeling herbicide resistanceModeling herbicide resistanceR
esis
tanc
e (%
)
Years
20% annual seedbank germination
![Page 26: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/26.jpg)
Modeling herbicide resistanceModeling herbicide resistanceR
esis
tanc
e (%
)
Years
![Page 27: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/27.jpg)
1 trillion 1 trillion waterhempwaterhemp plants exposed plants exposed to weed control each year in Illinois!to weed control each year in Illinois!
![Page 28: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/28.jpg)
Herbicide resistance worldwideHerbicide resistance worldwideR
esis
tant
spe
cies
Data from Heap, www.weedscience.org
![Page 29: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/29.jpg)
Weed control and weed evolutionWeed control and weed evolutionWhy do weeds evolve?Glyphosate-resistant cropsStudying weed evolution with molecular biology• Resistance to PPO-inhibiting herbicides• Enter genomics
Implications and final thoughts
![Page 30: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/30.jpg)
PPO herbicidesPPO herbicides
Inhibit the enzyme, protoporphyrinogen oxidaseAbout 20 different herbicidesPrimary use is broadleaf weed control in soybeanWeed resistance to these herbicides has been rare• Currently documented in only three species• First case was waterhemp in 2001
![Page 31: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/31.jpg)
Mechanism of resistanceMechanism of resistance
Differences in absorption, translocation, and metabolism ruled out• Shoup and Al-Khatib (2005) Weed Sci. 53:284
Reduced protoporphyrin IX accumulation in R biotype• Li et al. (2004) Weed Sci. 52:333
Broad cross resistanceSingle, incompletely dominant gene• Patzoldt et al. (2004) NCWSS Abstr. 59:26• Shoup and Al-Khatib (2005) NCWSS Abstr 60:160
Results from initial investigations pointed to an altered target site as the resistance mechanism:
![Page 32: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/32.jpg)
PPO genesPPO genes
Two different PPO genes in plants• PPX1 - encodes protein targeted to plastids• PPX2 - encodes protein targeted to mitochondria
Share limited sequence identity• 27% at protein level
Some species (e.g., spinach) have a “long form”of PPX2• PPX2L also identified in waterhemp• Targeted to both mitochondria and plastids
![Page 33: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/33.jpg)
PPX2LPPX2L mutationmutation
TTTGTTGATTATGTTATCGACCCTTTTGTTGCGGGTACATGTGGTGGAGATCCTCGATCGCTTTCC
TTTGTTGATTATGTTATCGACCCTTTTGTTGCGGGTACATGT___GGAGATCCTCGATCGCTTTCC
E1 E2 E3 E4 E5 E6 E7 E8 E9
SR
PheValAspTyrValIleAspProPheValAlaGlyThrCysGlyGlyAspProGlnSerLeuSer
WaterhempWaterhemp genomic genomic PPX2LPPX2L
![Page 34: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/34.jpg)
+ Lactofen+ Hematin
Complementation of Complementation of hemGhemG E. coliE. coli
LB only
C
C
-G
wt
wt
-G
-G
wt
wt
-G
-G
-G
C
C
wt
wtC
C
![Page 35: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/35.jpg)
Next stepNext step……Biochemical characterization of the R and S enzymesSubstrate of the reaction is not commercially available• Can be made, but requires a small explosion
![Page 36: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/36.jpg)
![Page 37: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/37.jpg)
Collaboration with Dr. Franck Dayan
![Page 38: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/38.jpg)
Dose-response curves on S-PPO (white) and R-PPO (black), lactofen ( ), acifluorfen ( ) and MC15608 (∇).
Dose-response curves on S-PPO (white) and R-PPO (black), lactofen ( ), acifluorfen ( ) and MC15608 (∇).
Inhibitor (-logM)Control 10 9 8 7 6 5 4 3
Rel
ativ
e ac
tivity
(%)
0
20
40
60
80
100
Inhibitor (-logM)Control 10 9 8 7 6 5 4 3
Rel
ativ
e ac
tivity
(%)
0
20
40
60
80
100
![Page 39: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/39.jpg)
1/[substrate] (uM)
1/ra
te (n
M/m
in)
S PPO R PPO
+ herbicide
- herbicide
![Page 40: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/40.jpg)
PPO
Lactofen Wild-type Resistant
Vmax (nmol/mg/min) 239.1±15.5 25.3±1.5
Km (µM) 1.06±0.14 0.96±0.14
Kcat (s-1) 0.240 0.025
I50 (µM) 0.06±0.01 12.5±2.9
Ki (µM) 0.009±0.001 0.50±0.09
Type of inhibition Competitive Mixed
Vmax is 10 times lower in the R-PPOVmax is 10 times lower in the R-PPO
Km is not affectedKm is not affected
I50 is several fold greater in the R-PPOI50 is several fold greater in the R-PPO
Ki is greater in the R-PPOKi is greater in the R-PPO
S-PPO - competitive inhibitionR-PPO - mixed inhibition S-PPO - competitive inhibitionR-PPO - mixed inhibition
![Page 41: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/41.jpg)
PPO crystal structurePPO crystal structureCrystal structure of bacterial PPO with bound herbicide is availableCrystal structure of tobacco PPO with bound inhibitorSequence of waterhemp PPO knownDeveloped homology model of S and R waterhemp PPO
![Page 42: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/42.jpg)
Overlay of crystal structure and homology modelOverlay of crystal structure and homology modelOverlay of crystal structure and homology model
![Page 43: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/43.jpg)
Catalytic domain of plant PPOCatalytic domain of plant PPO
Glycine serves as pivot for substrateFAD serves as roof of catalytic domainArginine stabilizes the substrate
![Page 44: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/44.jpg)
Position of substratePosition of substrate
Distance between N5 of FAD and C20 of substrate
Distance between N5 of FAD and C20 of substrate
Hydrogen bonds between Arg and the carboxylic group of substrate
Hydrogen bonds between Arg and the carboxylic group of substrate
![Page 45: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/45.jpg)
Overlay of S and R-PPOOverlay of S and R-PPO
Protein fold of R-PPOProtein fold of R-PPO
Protein fold of S-PPOProtein fold of S-PPO
![Page 46: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/46.jpg)
The change in distance may impede the sequential hydride abstraction at C20 of Protogen by N5 of the isoalloxazine ring of FAD
The change in distance may impede the sequential hydride abstraction at C20 of Protogen by N5 of the isoalloxazine ring of FAD
Vmax is decreasedVmax is decreased
Km is not changedKm is not changed
![Page 47: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/47.jpg)
Architectural changesArchitectural changes
S PPO active site
R PPO active site
2633 Å3
3297 Å3
Inhibitors no longer bind tightly in the pocket
![Page 48: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/48.jpg)
Single point mutations were simulated at Gly210Single point mutations were simulated at Gly210
Any amino acid other than Ala would cause steric clashes with the hydrophobic side-chains of other amino acids
Any amino acid other than Ala would cause steric clashes with the hydrophobic side-chains of other amino acids
Based on PPO sequence from other species, this mutation would not cause resistance
Based on PPO sequence from other species, this mutation would not cause resistance
![Page 49: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/49.jpg)
Origin of deletion mutationOrigin of deletion mutation
..ACA TGT GGT GGA GAT..
..ACA TGT ___ GGA GAT..
..Thr Cys Gly Gly Asp..
ACA TGT GGT GGA GAT ACA TGT GGA GAT-GTG
ACA TGT GGT GGA GAT ACA TGT GGA GAT-TGG
Net result is loss of GGT codon!
SR
![Page 50: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/50.jpg)
Plastid
Mitochondria
PPX1
PPX2
Significance of mutation in PPX2LSignificance of mutation in PPX2L
PPX2L
****
****
******
![Page 51: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/51.jpg)
All the stars were alignedAll the stars were aligned……An unusual mutation was needed• Deletion rather than substitution
Needed resistant enzyme in both chloroplasts and mitochondriaPresence of nucleotide repeat at the right place in the right gene enabled resistance
Weeds find a way!
![Page 52: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/52.jpg)
Molecular marker for PPO resistanceMolecular marker for PPO resistance
Henderson ACR WCS ACR:WCS
R 1:8R S S R R R R S S 1:0
1:1
1:2
1:4
Deletion present in all PPO-resistant waterhempevaluated (several IL plus KS and MO populations)Tool for rapid decision making in waterhemp re-spray scenarios
![Page 53: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/53.jpg)
Taking research back to farmersTaking research back to farmers
Rapid assay for resistance to
PPO inhibitors
To the lab
Back to the field
![Page 54: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/54.jpg)
Weed control and weed evolutionWeed control and weed evolutionWhy do weeds evolve?Glyphosate-resistant cropsStudying weed evolution with molecular biology• Resistance to PPO-inhibiting herbicides• Enter genomics
Implications and final thoughts
![Page 55: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/55.jpg)
What makes a What makes a plant a weed?plant a weed?
![Page 56: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/56.jpg)
Analysis of weedy Analysis of weedy HelianthusHelianthus populationspopulations
Kane and Rieseberg, 2008
About 5% of genome under selectionWeediness evolved multiple timesGenes advantageous to weediness also advantageous in native habitats• Genetic variability for weediness
already exists
==> Weediness can evolve relatively easily
![Page 57: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/57.jpg)
Examples of weed evolutionExamples of weed evolution
Illinois
98
NorthDakota
MissouriKentucky
Ohio
Michigan
Wisconsin
Iow a
Minnesota
Kansas
Nebraska
South Dakota
Indiana
Mid 80s
96
98
94
92
93
95
91
9495
The march of waterhemp (Amaranthustuberculatus) through the midwestern U.S.
![Page 58: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/58.jpg)
Genomic scanning for selective sweepsGenomic scanning for selective sweepsG
enet
ic d
iver
sity
am
ong
indi
vidu
als
Genome (DNA marker position)
Indicates a locus (gene) under selection – a “weediness” gene
![Page 59: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/59.jpg)
Using genomics to address this questionUsing genomics to address this questionDNA sequencing technologies becoming increasingly accessible
Sanger 454 Illumina
Sequences/run 96 1 million 70 million
Read length 750 bases 400 bases 36 bases
Cost/run $144 $11,000 $7,000
Cost for 1x coverage of 3GB genome $6.4 million $80,000 $8,000
![Page 60: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/60.jpg)
Weed control and weed evolutionWeed control and weed evolutionWhy do weeds evolve?Glyphosate-resistant cropsStudying weed evolution with molecular biology• Resistance to PPO-inhibiting herbicides• Enter genomics
Implications and final thoughts
![Page 61: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/61.jpg)
Final thoughtsFinal thoughts
Their definition aside (“a plant not wanted”), weeds are nature’s best plants - they are plants we can’t get rid of despite years of trying.So… if you want to study plants, study the best ones.
Weeds are fascinating models for studying plant biology and evolution.
Study weeds!
Because of weed evolution, we will continually need new tools to control weeds.
![Page 62: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/62.jpg)
My predictionsMy predictionsGlyphosate-resistant weeds will continue to increase.Glyphosate will become ineffective as a stand-alone herbicide in large regions.We will learn more about weeds in the next five years than we have learned to date.A gene from a weed will be used to improve crop yields.
![Page 63: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/63.jpg)
![Page 64: The ongoing battle between humans Who is winning? and weeds · • Shoup and Al-Khatib (2005) NCWSS Abstr 60:160 ... Collaboration with Dr. Franck Dayan. ¾Dose-response curves on](https://reader031.vdocuments.us/reader031/viewer/2022022118/5cce128888c993b5058c6202/html5/thumbnails/64.jpg)
Thank you!Thank you!