Transcript
Page 1: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis

Sascha Willuweit & Lutz Roewer

Institut für Rechtsmedizin und Forensische WissenschaftenCharité – Universitätsmedizin Berlin

2000 2004 2008

2014©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 2: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Workshop schedule2015, September 1st, 2:30 pm – 6:30 pm

• Different frequency estimation methods implemented in the YHRD

• Mixture analysis using the YHRD• Kinship analysis using the YHRD• Ancestry information retrievable from YHRD• Subpopulation analysis (AMOVA) using YHRD• Discussion of casework examples

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 3: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

YHRD - Increasing numbers

Page 4: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut
Page 5: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Frequency estimation

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 6: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Frequency estimation methods

Constant estimators

• Augmented counting (1/n+1)

• Counting with database inflation (Brenner‘s κ)

Variable estimators

• Surveying method (Krawczak)• Coalescence based estimation

(Caliebe)• Discrete Laplace method

(Andersen)

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Enabled in YHRD

Page 7: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Frequency estimation for Y-STR profiles

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 8: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 9: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

23 loci

17 loci

9 loci

Frequency estimation for rare haplotypes with „Kappa inflation“(0 observations)

Count Singletons with kappa

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

19.593

71.246 55.675 3.0 x 10-6

19.593 n.a.

125.700 30.450 6.0 x 10-6

K=0.78

K=0.24

(1.4 x 10-5)*

(7.9 x 10-6)*

* counting

1N

1)hS|hT(P̂ 00

k- proportion of singletons estimator of the proportion of not sampled rare haplotypes in the database

Page 10: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 11: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Comparison of estimators for rare haplotypes

Discrete Laplace vs. counting, kappa and surveying methods using a simulated population of 1 million, with a database size of 1000 and a kappa proportion of singletons of =0.864

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Courtesy of M.M. Andersen (Copenhagen)

Page 12: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Fig. 1 Comparison of (1) the relative frequency of a haplotype (number of times it has been observed divided by the database size) and (2) the estimated haplotype frequency using the discrete Laplace method. Note, that for frequently observed haplotypes, t...

Mikkel Meyer Andersen , Poul Svante Eriksen , Niels Morling

Cluster analysis of European Y-chromosomal STR haplotypes using the discrete Laplace method

Forensic Science International: Genetics, Volume 11, 2014, 182 - 194

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 13: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Interpretation tools implemented in YHRD

• Mixture analysis (Frequency and LR based)• Kinship calculation (Frequency and LR based)• Population substructure (AMOVA, Fst/Rst, MDS) • Ancestry information (AI)

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 14: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Mixture analysis

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 15: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

• male mixture (major, minor component)• only component♀

• no admixture in AMELOGENIN♂

Autosomal analysis Y chromosomal analysis

Casework exampleDelict: sexual assault

Evidence: contact stain on clothing

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 16: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Analyse with Mixture analysis tool (partial Y23 profiles)

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 17: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Result for PowerPlex Y23 (20 loci)

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 18: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Reanalysis using reduced PPY12 profiles

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 19: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Result for PowerPlex Y12 (10 loci)

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 20: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Reanalysis using further reduced 9-locus minHt profiles

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 21: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Result for minHt (7 loci)

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 22: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Kinship

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 23: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

The Y chromosom - a linearly inherited, haploid marker system

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 24: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

For which cases?

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 25: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Likelihood Calculation (LR) / Brotherhood (Probability for observing the haplotypes given same fathers vs. probability for

observing the haplotypes given different fathers)

L (X) = µ/2 x [f(A) + f(B)]L (Y) = f(A) x f(B)

µ = mutation ratef = haplotype frequency (YHRD)

• Locus-spezific µ for one-step-mutations, see YHRD• For the X hypothesis for each locus the probability of „non-mutation“ (1- µ) is also considered• Rolf et al. (Int J. Legal Med. 2001); Buckleton et al. (CRC Press, 2005)

A B

Same ordifferent fathers?

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 26: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Brothers?

Related: L(X) = 1.4 x 10-4 x 1 x µ/2 + 2.3 x 10-5 x 1 x µ/2 = 2.9 x 10-7

Unrelated: L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 91

14, 13, 31, 24, 11, 13, 14, 11-11, 14, 13

14, 13, 31, 25, 11, 13, 14, 11-11, 14, 13

µ = 3.6 x 10-3 *

f B = 2.3 x10-5*

Meioses * YHRD

f A = 1.4 x 10-4*

A B

Same ordifferent fathers ?

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 27: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

L(X) = 1.4 x 10-4 x 1 x µ/2 = 1.5 x 10-7

L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 46.8

14, 13, 31, 24, 11, 13, 14, 11-11, 14, 13

14, 13, 31, 24, 11, 14, 14, 11-11, 14, 13

µ = 2.1 x 10-3 (moderate)*

f B = 1.4 x 10-4*

f A = 2.3 x10-5*

* YHRD

B

A

Father – son or unrelated ?

Influence of the local mutation rate on LR

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 28: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

L(X) = 1.4 x 10-4 x 1 x µ/2 = 8.4 x 10-7

L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 262.5

14, 13, 30, 24, 11, 13, 14, 11-12, 14, 13

14, 13, 30, 24, 11, 14, 14, 11-12, 14, 13

µ = 1.2 x 10-2 (rapid)*

B

A

f B = 1.4 x 10-4*

f A = 2.3 x10-5*

* YHRD

Father – son or unrelated ?

Influence of the local mutation rate on LR

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 29: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Common ancestor?

L(X) = 1.4 x 10-4 x 7 x µ/2 + 2.3 x 10-5 x 5 x µ/2 = 1.1 x 10-6

L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 343

14, 13, 31, 24, 11, 13, 13, 11-12, 14, 13

14, 13, 31, 24, 11, 14, 13, 11-12, 14, 13

µ = 2.1 x 10-3 (moderate)*

f obs= 1.4 x 10-4*

fobs = 2.3 x10-5*

Meioses * YHRD

A

B

7

5

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 30: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Common ancestor?

L(X) = 1.4 x 10-4 x 7 x µ/2 + 2.3 x 10-5 x 5 x µ/2 = 6.6 x 10-6

L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 2053

14, 13, 31, 24, 11, 13, 13, 11-12, 14, 13

14, 13, 31, 24, 11, 14, 13, 11-12, 14, 13

µ = 1.2 x 10-2 (rapid)*

f obs= 1.4 x 10-4*

fobs = 2.3 x10-5*

Meioses * YHRD

A

B

7

5

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 31: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Loci Mutation Rate [95% CI] Meioses Position[MutRate] Group[MutRate]dys438 2,96E-04 10122 1 slowdys392 4,04E-04 14867 2 slowdys393 1,09E-03 13713 3 slowdys437 1,19E-03 10101 4 slowdys448 1,65E-03 6678 5 slowdys390 2,06E-03 15061 6 medium

dys385 mc 2,30E-03 25620 7 mediumdys19 2,32E-03 15539 8 medium

ygatah4 2,47E-03 7709 9 mediumdys391 2,54E-03 14935 10 mediumdys389i 2,68E-03 13788 11 mediumdys635 3,72E-03 7525 12 medium

dys389ii 3,78E-03 13759 13 mediumdys456 4,19E-03 6678 14 mediumdys481 4,97E-03 1744 15 mediumdys533 5.01E-03 1730 16 mediumdys439 5,35E-03 10096 17 mediumdys460 6,22E-03 1717 18 mediumdys458 6,74E-03 6677 19 mediumdys518 1,84E-02 1556 20 fast

dyf387S1ab mc 1,59E-02 1804 21 fastdys576 1,43E-02 1727 22 fastdys570 1,24E-02 1426 23 fastdys627 1,23E-02 1766 24 fastdys449 1,22E-02 1617 25 fast

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Ranking of Y-STR mutation rates

Page 32: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 33: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 34: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

D

Af (A) = 1/123*

f (D) = 1/388**

Likelihood Ratio (LR, KI) calculation for Y-STRs

* Program uses counting (Discrete Laplace extrapolation: 1/311)** Program uses counting (Discrete Laplace extrapolation: 1/821)

Page 35: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Population analysis(AMOVA)

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 36: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

YHRD: Test on population substructure (Fst, Rst)(Example: 17,278 Chinese individuals in 52 populations)

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 37: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Ancestry information

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 38: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Fast and slowly mutating Y markers

• Y-SNPsµ = 10-9 - 10-12

irreversible stable phylogeny

• Y-STRsµ = 10-3

recurrent networks

TCGAGGTATTAACTCTAGGTATTAACTCGAGGCATTAACTCTAGGTGTTAACTCGAGGTATTAGCTCTAGGTATCAAC * ** * *

17,13,30,25,10,11,13,10-1416,13,30,25,10,11,13,10-1417,13,31,25,10,11,13,10-1417,13,30,24,10,11,13,10-1417,13,30,25,10,11,13,11-1417,13,29,25,10,11,13,10-1517,13,30,26,10,11,13,10-1417,13,30,25,10,11,14,10-1417,13,30,25,11,11,13,10-14

Time

5

2

1

3

2

4

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 39: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Roewer et al. Hum Genet 2005©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Y-STR gradients (7 loci)

Page 40: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Y-SNP gradients (R1a)

Fechner et al., Am J Phys Anthropology 2008©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 41: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Semino et al. 2004 (n = 2400)

Haplogroup J2a

Haplotype: 14,13,30,22,10,11,12,13-16,...

Is ancestry prediction possible?

Biogeographical analysis using Y doesn‘t predictnationalityresidency orphenotype

Y markers infer very useful information the deep ancestry of a paternal lineage and its proliferation (radiation) over time until today

Skeleton in a trolley, 5g femur extracted©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

37 Y marker analysis (Geppert et al. 2010)

Page 42: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Unknown skeletonized person – extract, type, search and add „ancestry information“

Page 43: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Ancestry information – three features and heat map

Page 44: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Heat Map (searched haplotypes are reduced to the most representatively sampled minHt)

Page 45: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Searched haplotype is compared with a database of STR+SNP typed samples

Page 46: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Hg prediction is prone to IBS errors (as evidenced by YHRD)!Mandatory: Y-SNP analysis using (mini)sequencing

• SNaPshot method (Hierarchical Multiplex Analysis)

Geppert M & Roewer L (2012) SNaPshot® minisequencing analysis of multiple ancestry-informative Y-SNPs using capillary electrophoresis. Methods Mol Biol. 830:127-40.

J2a Turkey, Fertile Crescent, Caucasus,

Mediterranean

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 47: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

„Most frequent neighbour“ - 15,13,29,22,10,11,12,15-16 – 22 matches

15,13,30,22,10,11,12,15-16 – 2 matches to YHRD

Legende: Each dot is one population sample (on average 120 individuals) with matching populations marked in red©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

CAVE!

Page 48: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

But: SNaPshot analysis

• Haplogroup E-M2• highest frequency in West Africa (~ 80%) and Central Africa (~ 60%), not India• Discrepancy between YSTR and YSNP distribution!

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Page 49: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Part II: Casework examples

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

• Frequency estimation• Mixture• Kinship• Ancestry

Page 50: The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis Sascha Willuweit & Lutz Roewer Institut

Top Related