The 454 and Ion PGM at the Genomics Core Facility
Dr. Deborah Grove, Director for Genetic Analysis
Genomics Core Facility Huck Institutes of the Life Sciences
Penn State University
Services•DNA Sequencing•Illumina, 454 and Ion PGM Next Gen Sequencing•Microarray•Genotyping – VNTRs, SNPs, Open Array•qPCR by Real-Time•DNA Synthesis•DNA Extraction and Storage of DNA from Buccal Swabs
Sequencing at PSU Over the Years
Method ManualGel
377 Gel 3100 –16Capillary
Bases per Day
1200? 20,000 100,000
Sequencing at PSU Over the Years
Method ManualGel
377 Gel 3100 –16Capillary
3730--96Capillary
Bases per Day
1200? 20,000 100,000 0.5 to 1 million
Sequencing at PSU Over the Years
Method ManualGel
377 Gel 3100 –16Capillary
3730--96Capillary
SOLiDNext-Gen
Bases per Day
1200? 20,000 100,000 0.5 to 1 million
1 to 2 Billion
Next-Generation Sequencers:Massively Parallel Platforms
• Roche 454FLX+ v2.8 – 500 million bases per run, 800 to 1000 bases
• Ion PGM 318 chip – 2 to 4 billion bases per run, 400 base length
• (Ion Proton)
Roche 454 – Next Generation Sequencer
• Pyrosequencing
• FLX+ v2.8 has 800 to 1000 bp read
• 160 million bases per
full slide
454 FLX +
454 Titanium Sequencing Applications
• Transcriptome RNA
• Whole Genome -- Paired-End (3kb, 8kb,
20kb) 15 to 30 ugs dsDNA
• Whole Genome – Shotgun
500 ngs dsDNA
• Amplicon/Metagenomics 5 ngs
DNA Fragmentation by nebulization
Fragment End Repair
AMPure Bead Clean up
Adaptor-Ligation
Small Fragment Removal
Library Quality Assessment and Quantification
Primer Sets for Metagenomics
•16s Bacteria
•ITS for Fungus
•18s set for Fungus and other Eukaryotes, targeting Protists
•Archaea targeting both Crenarchaeota and Euryarchaeota
Amplicon Preparation
27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG 907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT
16S Variable Regions
27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG 907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT
Approximate Cost from Genome Library thru Sequencing
314 Chip 160 million bases, 400,000 reads
318 Chip 3 billion bases, 6 to 8 million reads
$1500 to $2000
Coverage
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
http://www.youtube.com/embed/yVf2295JqUg
Coverage
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
Full Plate = 1 million reads, 300 million bases
½ plate = 500,000 reads, 150 million bases
1 Quad = 200,000 reads, 60 million bases
Ampliseq Cancer Panel
•Only 10 ngs or less
•FFPE tissues
•Single Cells
•Libraries take 3.5 hours
•2800 hot spots
P1 Chip 80 million reads, 10 to 15 billion bp
PII Chip 300 million reads, 500 to 800 billion bp
314 Chip 160 million bases, 400,000 reads
318 Chip 3 billion bases, 6 to 8 million reads
Pac Bio
•No amplification required
•Single molecule
•Several thousand base reads (4 to 20 kb)
• Least GC-biased sequencing
•Run time 30 minutes
•Genomes: Finish Genomes and improve assembly with extra long reads (4000bp average and up to 20,000)
• Genomic Complexity: Allow haplotype expansion, full length transcripts and splice variants, repeat expansions, minor variants •Epigenome: Detects base modifications using kinetics
Applications