![Page 1: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/1.jpg)
1
Lee HoodInstitute for Systems Biology, Seattle
National Conference of PharmaceticalOrganizations
1-10-15
Systems Medicine and Proactive P4 Medicine: Catalyzing a Revolution
in Healthcare
Predictive, Preventive, Personalized and Participatory
![Page 2: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/2.jpg)
2
Take home lessons
• Systems medicine is key to dealing with the complexities of disease leading to new strategies and technologies for diagnostics and therapeutics
• Systems medicine has reach a tipping point and is enabling a medicine that is predictive, preventive, personalized and participatory (P4 medicine)—that is very different from contemporary medicine
• P4 medicine can transforming healthcare through the initiation of a Framingham-like, longitudinal, digital-age study of 100,000 well people for which we are seeking Congressional support
![Page 3: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/3.jpg)
3
The grand challenge for biology and medicine is deciphering biological complexity
![Page 4: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/4.jpg)
4
6 Blind Men and an Elephant
![Page 5: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/5.jpg)
5
Paradigm Changes Drive Radical Changes in Science
![Page 6: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/6.jpg)
6
I Participated in Five Paradigm Changes in Biology over 45 YearsLeading to Systems Medicine and P4 Medicine
• Brought engineering to biology– Developed 6 instruments that led to high-throughput biology: big data in
biology (1970 - present)• The Human Genome Project
– Invented enabling technology, advocate, participant, applying genomics to P4 medicine (1990-2003)—complete parts list human genes
• Cross-disciplinary biology– Created 1st cross-disciplinary department: enabled technology development
to be driven by biology (1992-2000)• Systems biology
– Created 1st systems biology institute: deciphering the complexities of biology and disease (2000 – present)
• Systems medicine / emergence of proactive P4 medicine– Early advocate and pioneer of a P4 medicine that will transforming healthcare
(2001 – present)– Pioneered systems driven technologies and strategies for P4– 100,000 person wellness project (2013—present)
![Page 7: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/7.jpg)
7
Big data is one essence of systems medicine: Soon each individual will be surrounded by a virtual cloud of billions of multi-scale data points—big data
Transactional
11010100010101010110101010100100
0
Phenome
Na143 K 3.7 BP 110/70
HCT32 BUN 12.9 Pulse 110 PLT150 WBC 92
GCGTAGATGCGTAGGCATGCATGCCATTATAGCTT
CCA
Genome
Proteome
arg‐his‐pro‐gly‐leu‐ser‐thr‐ala‐trp‐tyr‐val‐met‐phe‐
Transcriptome
UUAGUGAUGCGUCUAGGCAUGCAUGCC
Epigenome
110101000101010101101010101001000101101010001
Single Cell
11010100010101010110101010100100
iPS Cells
11010100010101010110101010100100
Social Media
110101000101010101101010101001000101101010001
TeleHealth
110101000101010101101010101001000101101010001
![Page 8: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/8.jpg)
8
Systems Medicine Systems biology andd isease-perturbed network of networks
• Integration of patient data will reveal biological networks that specify health and are altered in disease
• Understanding differences in normal and disease-perturbed networks will provide fundamental insights into disease mechanisms
• These insights are essential for developing more effective diagnostic and therapeutic approaches
![Page 9: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/9.jpg)
9
Why is the Institute for Systems Biology (ISB) uniquely positioned to transform systems medicine and catalyze a revolution in healthcare?
![Page 10: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/10.jpg)
10
Evolution of the Vision for Systems Medicine (and P4 Medicine) 2001 - Present• By 2005, the vision of Systems Medicine/P4 medicine had
been clearly articulated by ISB– Key question: How to bring P4 to the healthcare system?
• In 2008, ISB formed a 5 year $100M strategic partnership with Luxembourg – Developed about 10 new systems-driven technologies and
strategies– Placed P4 medicine at a tipping point for transforming the
practice of healthcare
• In 2013, ISB first proposed the P4 pilot project to study 100,000 well people– Bringing the power of P4 medicine to the contemporary
healthcare system
![Page 11: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/11.jpg)
11
Three systems-driven strategies supported by Luxembourg
![Page 12: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/12.jpg)
12
Dynamic network approaches to prion-induced neurodegeneration in mice
![Page 13: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/13.jpg)
13
Global and Subtractive Brain Transcriptome Analysis—Differentially Expressed Genes (DEGs)
Uninfected brain
Prion infected brain
Inoculate w/ Prions
Time‐course array analysis:subtrative analyses to DEGs
Mouse Genome array:45,000 probe sets
~22,000 mouse genes.
RNAfrom brain
homogenate
Prion strains:• RML• 301V
Mouse strains: C57BL/6J FVB/NCr BL6.I FVB/B4053
C57BL/6J‐RML: 12 time points
FVB/NCr‐RML: 11 time points
BL6.I‐301V: 9 time points
FVB/B4053‐RML: 8 time points
‐300 DEGs encode the prion neurodegenerative response
![Page 14: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/14.jpg)
14
Neuropathology Identifies 4 Major Disease-Perturbed Networks for Prion DiseasePrP replication/accumulation Microglia/astrocyte
activation
Synaptic degeneration
Normal Infected
Nerve cell death
![Page 15: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/15.jpg)
15
Prionaccumulation
GlialActivation
SynapticDegeneration
Neuronal Cell Death
Cholesteroltransport
Sphingolipidsynthesis
Lysosomeproteolysis
ReactiveAstrocytesLeukocyte
extravasation
Na+channelsCargo
transport
Caspases
*Arachidonatemetab./Ca+ sig.
Clinical Signs
Sequential Disease-Perturbation of the Four Major Networks of Prion Disease
0 wk 18~20 wk 22 wk7 wk
![Page 16: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/16.jpg)
16
10 Disease-Perturbed Dynamical Networks in Prion Disease Explain Virtually all of the Pathophysiology of
the Disease in Mice
![Page 17: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/17.jpg)
17
A systems-driven network approach to glioblastoma in humans and mouse models—developing a network approach to the identification of new drug targets
![Page 18: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/18.jpg)
18
A computational approach to cancer drug target identification through network analysis
BALIGA, Aitchison, Hood LABs
Halobacterium
Yeast peroxisome biogenesis
Host‐pathogen interactions
Cancer
![Page 19: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/19.jpg)
19
Strategy--Glioblastoma• Mine omics and clinical data to generate disease-perturbed network
signatures to:– Stratify disease into different subtypes
• Discover how networks are disease-perturbed within each patient to predict (identify) unique sets of druggable targets
• Use network architecture of druggable targets to prioritize drug combinations that are most likely to work on a given patient
• Use patient tumor-derived differentiated stem cells to perform high throughput screening to:– generate dose response-curves for individual drugs – perform combinatorial drug screens on network-predicted
phenotypes
![Page 20: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/20.jpg)
20
Possible outcomes for computational approaches to cancerMethodology to reverse engineer disease-perturbed network dynamics directly from patient cohort data
– Biomarkers:• Stratify Disease• Analyze Individual Patients for Unique Features• Predict Clinical Outcomes• Predict Drug Responsiveness
– Rational Drug Discovery:• Identification of New Drug Targets• Drug Repurposing for New Indications• Combinatorial Drug Formulations
![Page 21: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/21.jpg)
21
Making blood a window into health and disease
![Page 22: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/22.jpg)
22
Dynamics of prion-induced neurodegeneration in mice as seen through the blood with brain-specific blood proteins
![Page 23: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/23.jpg)
23
APLP1,SNAP25,LGI1,NACM1, CLSTN2
KINESIN,MAP1B,SYT3,CT
NND1
CAMKII,PCLO,GRIA4,GLUR3,NSF,ANK2,ENO2,DOCK3
,SCG3,
L1CAM,CTF1, ARF3,ANK3,
MAP3K12,CTNNA2,KIF3A,GFAP,CNTN1,ENC1
, CRMP2, SYNAPSIN1
NEUROMODULIN,HUC,CAMKIIA,RIN,SYNAPSIN1,RGS4,PEA15,RASGRF1,NR1
GNAO1, GNA13, GABBR1, GLUR1,GRI
A1
MAP1A,SPTBN,
SPTBN4,FOXG1,EPHA5,N
CAM2, ELAVL3
TAU,MAP2, CAMKII, EPHA5,
UCHL1,NCAM1
RGS4,PEA15,CAMKII,RASGRF1,
NR1
Synaptic vesicle transport
Calcium mediated signaling
Synaptic Transmission
Neurogenesis
Cell surface receptor signaling
GPCR signaling
Cellular differentiation
Anatomical structure
development
Nerve growth factor signaling
200 Brain-Specific Blood Proteins Reflect Key Networks
![Page 24: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/24.jpg)
2424
Targeted MS Proteomics: Human Selective Reaction Monitoring (SRM)Atlas
ISB has developed SRM/MRM assays for most of the known 20,333
human proteins
Analyze 100‐200 proteins quantitatively in 1 hour
Heavy isotope peptides forQ3 analyses allow precise
quantification
![Page 25: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/25.jpg)
25
15 Brain-Specific Blood Proteins Reflect the Early Detection and Progression of Prion Disease-Perturbed Networks
Prionaccumulation
GlialActivation
SynapticDegeneration
Neuronal Cell Death
Cholesteroltransport
Sphingolipidsynthesis
Lysosomeproteolysis
ReactiveAstrocytesLeukocyte
extravasation
Na+channelsCargo
transport
Caspases
*Arachidonatemetab./Ca+ sig.
Apod* Scg3*
Cntn2* Ttc3*
Gria3*Gfap*L1cam*
Mapt*Snap25*Myo5a*Kif5a*
Gria1*Bcas1*
Grin1*Prkar1b*
Clinical Signs0 wk 18~20 wk 22 wk
* indicates brain-specific blood proteins
![Page 26: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/26.jpg)
26
Organ-specific blood proteins allow one to study the dynamics of human biological processes
• Development• Physiology• Aging• Wellness• Disease dynamics (diagnostics)• Drug toxicity (liver)• Multi-organ responses to disease
(Alzheimer’s)
![Page 27: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/27.jpg)
27
A second blood diagnostics approach: a systems approach to blood diagnostic for identifying benign lung nodules in human lung cancer
Integrated Diagnostics—Paul Kearney, Xiao-jun Li, etc.
X. Li et.al. Science Translation Medicine: 5, 207, 2013
![Page 28: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/28.jpg)
28
Indeterminate Pulmonary Nodules
Integrated Diagnostics
Is this cancer?
~3 million cases annually in the USA
Patrick Nana‐Sinkham, MD Ohio State University
![Page 29: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/29.jpg)
29
Lung Nodules Found by CT Scan in USA
PET Scan Needle Aspiration Bronchoscopic Biopsy
Repeat CT studies
Surgery for nodule removal
(Ost DE and Gould MK. Decision Making in the Patient with Pulmonary Nodules. Am. J. Respir. Crit. Care Med. October 6, 2011 as doi:10.1164/rccm.201104‐0679C)
Cancer Risk
lower intermediate higher
Watchful waiting for 2
years
Look for cancer
surgery threshold“watchful waiting” threshold
~0.8 – 2.0 cm
3 million cases/yr 600,000 in “dilemma zone”
![Page 30: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/30.jpg)
30
Systems Approach to Distinguishing Benign from Malignant Lung Cancer Nodules (with Integrated Diagnostics)
• 371 SRM assays for lung cancer tissue/190 detectable in the blood– Differentially secreted (normal vs. neoplastic)– Differentially shed from cell surface (normal vs. neoplastic)– Candidates captured from the literature
• Discovery samples—analyze all 190 detectable proteins– 72 cancer vs. 72 benign/from four sites
• Discovery algorithm for “cooperative” proteins– Select the 32 (out of 190) best proteins for distinguishing nodules– A million random panels of 10 of 32 best proteins were scored– Identified 13 proteins that were highly “cooperative”—generally in most
effective panels• Validation study—13-protein panel
– 52 cancer vs. 52 benign/from 4 old sites plus 1 new site• InDi commercialize the panel of 13 blood proteins in Q4 2013• Published in X. Li et.al. Science Translation Medicine: 5, 207, 2013
Red indicates systems approaches
![Page 31: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/31.jpg)
31
Lung cancer blood biomarker panel
• Rule out for surgery about 40% of the benign nodules with 90% specificity—prevent 1/3rd of unnecessary surgeries
• Save the healthcare system in US about $3.5 billion per year
• Bring “peace of mind” to many patients• Panel is independent of 3 classical criteria
for lung cancer—age, smoking history and size of lung nodule
![Page 32: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/32.jpg)
32
Three Lung Cancer Networks Monitored: 12/13 biomarkers map to these networks
![Page 33: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/33.jpg)
33
Performance of biomarker panels on 66 PTSD samples (36negatives and 30 positives) #
Characteristics Panel of 8 (train)
Panel of 8 (Cross-
validation)
Panel of 2 plasma only
(train)
Panel of 2 plasma only
(Cross-validation)
Sensitivity 0.97 0.90 0.83 0.79
Specificity 0.92 0.81 0.91 0.86
Accuracy 0.94 0.85 0.87 0.82Panel of 8: one blood protein, five circulating miRNAs and two PBMC miRNAs#66 out of 140 samples have results for all the measurements
ROC curve of a training result based on the panel of 8
Posttraumatic stress disorder—quantitative blood biomarkers for a neuropsychiatric disease—discovery phase
1. Panel was build based on the results from 46 measurements (1 protein +45 miRNAs) over 140 samples, 66 samples have results from all the measurements
2. Cross‐validation was performed by leave‐one‐out approach.
3. Adding different measurements on the panel improves the performance of the diagnostic model
![Page 34: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/34.jpg)
34
How Blood Biomarker Panels for Detecting Disease-Perturbed Networks Are Effective
• Distinguish normal individuals from diseased individuals
• Early diagnosis• Follow progression• Follow response to therapy• Follow the reoccurrence of disease• Reveal disease-perturbed networks which suggest
mechanisms of disease and candidate drug targets• Stratification of disease into different subgroups for
impedance match against effective drugs—and proper prognosis
![Page 35: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/35.jpg)
35
Systems Medicine Is at a Tipping Point and Is Transforming Healthcare through Systems-Driven Strategies and Technologies
• Providing fundamental insights into the early dynamics of disease and disease-perturbed networks—using orthologous animal models
• Family genome sequencing -- identifying disease genes• Transforming blood into a window to distinguish health
from disease with a systems approach to blood diagnostics• Stratifying diseases into their distinct subtypes for an
impedance match against proper drugs• Using disease-perturbed networks to identify new drug
target candidates and repurpose old drugs.• Pioneering peptide protein-capture agents that will replace
monoclonal antibodies over the next 10 years.• Large-scale, longitudinal studies for the digital age—a
dynamical understanding of wellness and disease– Longitudinal clinical trials for preterm birth, wellness, and Lyme Disease
![Page 36: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/36.jpg)
36
The Emergence of P4 MedicinePredictive, Preventive, Personalize, Participatory
Converging Megatrends Driving the transformation of healthcare for patients
Systems Biology & Systems Medicine
Consumer‐Driven Social Networks
P4 MEDICINE
Digital RevolutionBig Data
![Page 37: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/37.jpg)
37
P4 Medicine vs. Contemporary Medicine• Proactive• Focus on Individual• Focus on Wellness• Generate, mine and integrate individual patient dynamical
data clouds– Produce predictive and actionable models of wellness /
disease• Clinical trials -- large patient populations analyzed at single
individual level (not population averages!) – Generate quantized stratification of patient populations and
create the predictive medicine of the future. N=1 experiments
Patient-driven social networks are a key to driving the acceptance of P4 medicine
![Page 38: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/38.jpg)
38
Conceptual Themes of P4 Medicine
Disease DemystifiedWellness Quantified
P4 MedicinePredictivePreventivePersonalizedParticipatory
Wellness Industry Disease Industry
![Page 39: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/39.jpg)
39
Understanding Wellness is KeyDeveloped World
If the trend of the last 10 years of increases in life
expectancy continue, more than half of all children
born today in developed countries can expect to
celebrate their 100th birthday.
Christensen, Ageing Populations: The Challenges Ahead, Lancet , 2009
![Page 40: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/40.jpg)
40
A Framingham-like digital-age study of wellness in 100,000 (100K Project) patients longitudinally -- 20-30 years
2014 P4 Pilot ProjectHundred Person Wellness Project(March 2014)
![Page 41: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/41.jpg)
41
Assays / Measurements
Gut Microbiome 3xContinual self‐tracking & lifestyle monitoring
Whole Genome Sequencing Detailed lab tests 3x(blood, urine, saliva)
Database of actionable possibilities that will grow exponentially over time
![Page 42: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/42.jpg)
42
Health: What do we really want to understand from 100,000 well patients?
Wellness
Time
Wellness
Disease transition
![Page 43: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/43.jpg)
43
The Wellness Well
• Information will bring individuals from minimal to maximum wellness
• The dimensions of the wellness well are unique for each individual: presumably determined genetically
Minimum
Maximum
![Page 44: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/44.jpg)
44
Health: What do we really want to understand from 100,000 well patients?
Wellness
Time
Wellness
Disease transition
![Page 45: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/45.jpg)
45
Actionable Traits, Coaches and Positive Reinforcement
• Actionable possibilities from individual data types
• Actionable possibilities from integrated data types
• Coaches with MD advisors– Bringing actionable opportunities to each individual– Nourish relationship based accountability for participants
• Positive reinforcement / immediate gratification– Individuals can see improvement within a three-month period
(from one blood draw or other sample to the next)
![Page 46: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/46.jpg)
46
Scaling Up RapidlyISB 100KWELLNESS PROJECT
10K
1K
![Page 47: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/47.jpg)
47
Nature, Feb 2014
107 Individuals
![Page 48: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/48.jpg)
48
Hundred Person Wellness Project Tests Blood, Urine, Saliva, Stool
1. Blood• Whole genome sequence – 50x coverage• Comprehensive clinical chemistries focusing on
nutrition, inflammation and metabolic function • Metabolomics targeting 600 metabolites—15% from gut microbiome• Organ-specific proteins for heart, brain and liver• 96 well ELIZA panels for inflammation and cardiovascular disease
2. Urine• Amino acid profile • Oxidative stress – lipid peroxidases
3. Saliva• Adrenal stress markers – cortisol and DHEA
4. Stool• 16S bacterial variable region 4 ribosomal RNA
![Page 49: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/49.jpg)
49
Hundred Person Wellness Project Tests Personal Health and Self-Tracking
1. Personal Health Status• Personal health history• Familial health history• Personality assessments
2. Self-Tracking• Activity (Fitbit)• Sleep (Fitbit)• Weight• Blood Pressure (Omron)• Heart Rate (Omron)
![Page 50: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/50.jpg)
50
Knowledgebase—graph database
• There are currently 227,979 nodes in the graph database, and 2,375,362 edges—connecting genes, environment and actionable possibilities
• What information being incorporated into our analytics pipeline?– Database of human phenotypes (OMIM)– Database of human clinical variants (ClinVar, ACMG)– Database of GWAS studies / traits (GWAS Catalog)– Database of actionable genetic variants (ISB
resource)– Database of human metabolites (HMDB)– Database of pharmacogenomics (PharmGKB)– Literature for actionable variants
![Page 51: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/51.jpg)
51
Preliminary stories about actionable possibilities for the 107 Pioneers
![Page 52: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/52.jpg)
52
Actionable possibilities from single data types
![Page 53: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/53.jpg)
53
Baseline Blood Results
Cardiovascular
59%
Inflammation68%
NutrientAbnormalities
91%
Diabetes Risk54%
Baseline Health (Blood Draw #1)Prevalence of Actionable Results in Pioneer 100 Labs
High rate of actionable lab results impacting various physiological systems, even in this supposedly healthy cohort
![Page 54: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/54.jpg)
54
Actionable possibilities: toxic metals
• High mercury from tuna• High lead
![Page 55: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/55.jpg)
5555
Only change between blood draw #1 and blood draw #2:
• 8 weeks of having salmon sushi vs. tuna sushi (3x a week)
Participant Action: Reducing Toxicity
![Page 56: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/56.jpg)
56
Searching for novel correlations: lead vs. age
![Page 57: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/57.jpg)
57
Actionable possibilities from two or more integrated data types
![Page 58: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/58.jpg)
58
Vitamin D deficiency
• Vitamin D—90/108 Pioneers are low– Six genetic variants from 3 genes block
Vitamin D absorption– Risks associated with low Vitamin D
• Ricketts—improper bone mineralization• Increased risk of death from cardiovascular
disease• Cognitive impairment in older adults• Severe asthma in children• Cancer
![Page 59: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/59.jpg)
59
Presence of risk alleles in vitamin D binding proteins is negatively correlated with vitamin D levels
28.75
31.64
35.7136.25
41.07
43.85
25.00
30.00
35.00
40.00
45.00
50.00
Vitamin D vs. risk alleles in GC, DHCR7, CYP2R1Round1 Round2
Wang, TJ et al. Common genetic determinants of vitamin D insufficiency: a genome-wide association study. Lancet 2010. 376(9736): 180-8.
4 or 5 risk alleles8 participants
3 risk alleles15 participants
1 or 2 risk alleles15 participants
25‐OH D Co
ncentration (ng/mL)
![Page 60: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/60.jpg)
60
Vitamin D is significantly increased across our participants
Round 1
Roun
d 2
μR1 = 33.6 ng/mLμR2 = 44.0 ng/mLpsignedrank = 1.45E‐9
Vitamin D
0
10
20
30
40
50
60
70
80
90
100
0 10 20 30 40 50 60 70 80 90 100
Vitamin D was the most significantly changed metabolite out of 189 for which data are available.
![Page 61: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/61.jpg)
61
Common genetic variants—very small disease effects
![Page 62: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/62.jpg)
62
Discovery and refinement of frequent genetic variants associated with lipid levels
Global Lipids Genetics Consortium. Discovery and refinement of loci associated with lipid levels. Nat Genet. 2013. 45(11): 1274-83.
• Study examined 188,577 individuals using genome-wide and custom genotyping arrays. – 94,595 in initial discovery set– 93,982 in validation set
• The study associates 72 loci with total cholesterol levels.
![Page 63: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/63.jpg)
63
Individuals contain different subsets of variants that affect cholesterol levels
Variantrs68275
Variantrs8572
Variantrs68883
Variantrs099485
Variantrs97693 Variant
rs14445
Variantrs65313
Variantrs111393
Variantrs86837
Variantrs6837
Variantrs583785 Variant
rs68279
Variantrs59583
Variantrs13523
Each individual harbors a subset of the universe ofpossible variants that affect a trait. Although eachvariant alone has only a small effect, the cumulativeeffect of an individual’s variant set can add up tosignificant differences between individuals.
Small increase in overall cholesterol levels
Small decrease in overall cholesterol levels
![Page 64: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/64.jpg)
64
Correlating cholesterol levels with 72 single nucleotide variants
The cumulative effect of the individual genetic profile of an individual for cholesterol‐related variants strongly correlates with HDL concentrations, for all participants for which we have genetic data. Reference ranges are shown as red (inappropriately hi), orange, and green (healthy) shadings.
4000
6000
8000
10000
12000
14000
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6
HDL Large Particle Con
centratio
n (nmol/L)
Cumulative genetic effect for each individual (std. dev.)
HDL Large Particle Concentration vs.Individual Genetic Profile
Correlation = 0.56High risk
Low risk
![Page 65: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/65.jpg)
65
The multi-genome analysis paradigm
Individual genome
Multi‐genome reference models
2000 genomes Preliminary analysis
High‐quality analysis
![Page 66: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/66.jpg)
66
0
20
40
60
80
100
120
140
9.5 10
10.5 11
11.5 12
12.5 13
13.5 14
14.5 15
15.5 16
16.5 17
17.5 18
18.5 19
19.5 20
20.5 21
21.5 22
22.5
Gen
ome Co
unt
Cumulative Odds Ratio
Risk for high cholesterol levels
Cumulative sum for an individual can give an estimate of risk relative to a population of 2000 normal individual genomes
Variantrs099485
Variantrs97693
Variantrs111393
Variantrs6837
Variantrs583785
Variantrs68279
Variantrs14445
Calculate the effects of all common variants within an individual
Estimate the risk for high cholesterol relative to a population.
Below average
Above average
![Page 67: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/67.jpg)
67
Major diseases and related GWAS-identified variants
GWAS Trait # of variants
Lung Cancer 31
Obesity 139
COPD 55
Alzheimer’s Disease 230
Asthma 93
Breast Cancer 171
Stroke 21
Hypertension 35
Bipolar Disorder 126
Prostate Cancer 141
Multiple Sclerosis 182
Crohn’s Disease 220
Cholesterol (lipid) Levels 72
We have the capability to associate genetic variation with quantitative traits also being measured in the study. The NHGRI GWAS catalog provides a rich resource that can be mined for genetic‐phenotype associations.
![Page 68: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/68.jpg)
68
Wellness to disease transitions—an example--hemachromatosis
![Page 69: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/69.jpg)
69
Hereditary hemochromatosis causes the body to absorb too much iron, which can lead to cancer, heart arrhythmias, and liver cirrhosis. It is one of the most common genetic diseases in Caucasians, and is usually associated with a variant in the HFE gene—about 1/10 Caucasians carry this defect.
Hereditary hemochromatosis is associated with a variant in the HFE gene
![Page 70: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/70.jpg)
70
Hereditary hemochromatosis is associated with a rare variant in the HFE gene
Combining genome sequencing with our blood chemistry panel allows us to visualize the effect of this rare variant in only 100 individuals, and infer hemochromatosis in two participants after the first round of blood draws. Subsequent bloodletting treatment yielded a reduction in iron levels by the second round to healthy levels. Left untreated, this disorder can lead to liver cancer, diabetes, pancreatic disease and heart disease.
0
50
100
150
200
250
Zero copies of rare variant (86 individuals)
One copy of rare variant (12 individuals)
Two copies of rare variant (2 individuals)
ng/m
L Iron Levels in 100i Par cipants
First Blood Draw Second Blood Draw
![Page 71: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/71.jpg)
71
By examining only one data type, it was determined that 100% of the 107 Pioneers have actionable traits:
• Hence, virtually every person will have multiple, actionable traits as their data are aggregated and integrated
• These actionable possibilities will change as the environment changes, as reflected by dynamically changing personalized data clouds
Personalized Dynamical Data CloudsGrowing exponentially over time
![Page 72: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/72.jpg)
72
Project Leadership• Leroy Hood, PI
• Nathan Price, PhD, Co-PI
• Sean Bell, Business Director
ISB Hundred Person Wellness Project – Team
Data Analytics• Nathan Price, Analytics Lead
• Gustavo Glusman, Genomics
• Andrew Magis, Multi-Omics
Project Management• Sean Bell, Business Director
• Kristin Brogaard, Project Manager
• Sara Mecca, Project Assistant
• Mary Brunkow, Project Coordinator
Medical Advisory Board• Robert Green, M.D.
• Michael Raff, M.D.
• Sarah Speck, M.D.
Communications• Gretchen Sorenson, Consultant
• Hsiao-Ching Chou, Communications
Director
Participant Engagement• Jennifer Lovejoy, VP Clinical Affairs
• Sandi Kaplan, Wellness Coach
• Craig Keebler, M.D., Study Physician
![Page 73: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/73.jpg)
73
Most of the 107 Pioneers have learned two important concepts
![Page 74: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/74.jpg)
74
Your genome determines your potential but not your destiny. You can control your health.
![Page 75: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/75.jpg)
75
The Pioneers Realize that They Must Take Responsibility for their Own Wellness (and Disease)
P4 Medicine puts individuals at the epicenter of their own healthwhich will dramatically reduce the cost of healthcare
![Page 76: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/76.jpg)
76
Opportunities
![Page 77: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/77.jpg)
77
100K Project: Transforming Healthcare• Identify vast array of actionable possibilities• Analytics to optimize wellness and avoid (reduce) disease for each
individual patient—optimize human potential• Create a data base of wellness measurements to mine for the
“multiparameter wellness metrics”—define fundamental human features of wellness—physiological and psychological
• Generate a data base from individuals that will allow us to follow early disease mechanisms in the transitions from wellness to disease for major diseases—diabetes, cardiovascular, cancer and neurodegeneration—enable early transition back to wellness
• Drive the development of improved old and new assays and analytics—parallelize, miniaturize, increase throughput, reduce cost, point of contact—digitalization through smart phone format
• Database of wellness and disease transitions catalyze innovation for the wellness industry industry
• Bring P4 medicine into the healthcare system– Improving the quality of healthcare– Decreasing the cost of healthcare– Promoting innovation in Healthcare
![Page 78: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/78.jpg)
78
P4 medicine and the 100K project: Societal Implications
• Digitalize medicine for the individual patient—Leading to a lowering of healthcare costs and the democratization of healthcare—assays to smart phone.
• Innovation—100K database will create many opportunities for start ups and established healthcare industries.
• Wealth—the Wellness Industry will far exceed the current disease (healthcare) industry in market cap in 10-15 years. We are creating today the companies that will be the Google and Microsoft of the Wellness Industry.
• Competition—Economic advances generally arise from new technologies. Macro and micro inventions. P4 is a macroinvention and will span many microinventions and commercial opportunities.
• Financial crisis from healthcare—key is to have individuals take responsibility for their own health.—enormous savings from individuals becoming responsible for their own healthcare to
• Optimization of human capital—avoid loss of productivity due to absence from illness or presenteeism. Elevate all individuals to their highest level in their “wellness wells”.
![Page 79: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/79.jpg)
79
The ISB Wellness Project Is Taking Two Directions
• The 100,000 person wellness project—academic—discovery science—pioneer assays (to the smart phone) and pioneer the integrative and modeling analytics—open data--seek Congressional funding
• The company—Wellness Sciences—consumer directed—may really lead the large-scale adoption of P4 medicine and the democratization of healthcare
![Page 80: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/80.jpg)
80
Take home lessons
• Systems medicine is key to dealing with the complexities of disease leading to new strategies and technologies for diagnostics and therapeutics
• Systems medicine has reach a tipping point and is enabling a medicine that is predictive, preventive, personalized and participatory (P4 medicine)—that is very different from contemporary medicine
• P4 medicine can transforming healthcare through the initiation of a Framingham-like, longitudinal, digital-age study of 100,000 well people for which we are seeking Congressional support
![Page 81: Systems Medicine and Proactive P4 Medicine: Catalyzing a ... Medicine and Proactive P4 Medicine: Catalyzing a Revolution in Healthcare ... – Early advocate and pioneer of a P4 medicine](https://reader030.vdocuments.us/reader030/viewer/2022040406/5ea63b39e23c5b7dc320bdfa/html5/thumbnails/81.jpg)
81