![Page 1: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/1.jpg)
1/7/2009 1
Supervised and Unsupervised Learning
Kwok-Leung TsuiIndustrial & Systems EngineeringGeorgia Institute of Technology
![Page 2: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/2.jpg)
1/7/2009 2
Data Mining (KDD) Process
Determine Business
Objectives
Data Preparation
Mining & Modeling
Consolidation and
Application
![Page 3: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/3.jpg)
1/7/2009 3
Data Mining and Modeling
![Page 4: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/4.jpg)
1/7/2009 4
Start
Data Mining & Modeling
Choose Models
Build/Fit Model
Refine / Tune Model(model size & diagnosis)
Evaluate Model(e.g. Prediction error)
Prediction Make Decisions
Collect more data
ConsiderAlternateModels
Test Data(Evaluation Data)
Score DataYES
NO
Sample Data
Train Data
Validation Data
Meet accuracy reqt.
![Page 5: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/5.jpg)
1/7/2009 5
• Descriptive statistical measures– Central tendency/ location– Dispersion/spread– Shape & symmetry
• Class Characterization and Comparisons– Analytical characterization– Attribute relevance analysis– Class discrimination and comparisons
• Data Visualization– Scatter-plot matrix & density plot– 3-D stereoscopic scatter-plot– Parallel coordinate plot
Data Description & Visualization
![Page 6: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/6.jpg)
1/7/2009 6
• Supervised learning: – Learning with a teacher
– Classification, e.g. online shoppers (buyers Vs. non-buyers)
• Unsupervised learning: – Learning without a teacher
– Clustering, e.g. online shoppers (segmentation of non-buyers)
• Other related terms:– Machine Learning (analogies to human receiving)
– Neural Networks (biological analogies to brain)
Supervised & Unsupervised Learning
![Page 7: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/7.jpg)
1/7/2009 7
• Inputs: (Predictors, independent variables, y)– A set of variables which are measured or preset.
• Outputs: (Responses, dependent variables, x)– A set of measurable variables which are influenced by the
inputs
• Steps:– Establish models / systems(y hat) based on collected inputs
& outputs (x and y). – Predict the values of outputs based on the established
models / systems and a new set of specified inputs.
Supervised Learning
![Page 8: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/8.jpg)
1/7/2009 8
• Learning with a teacher (generalization)– Student presents answer ( given xi)
– Teacher provides the correct answer yi or an error for student’s answer
– The result is characterized by some loss function:
– Objective: Minimize the expected loss
• Function approximation: Y=f(x, ε)
iy)
(L
Supervised Learning
), yy )
![Page 9: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/9.jpg)
1/7/2009 9
Problems in Supervised Learning
• (Application/Problem Oriented)– Classification problem:
Output is categorical / qualitative.
– Prediction (Regression) problem: Output is continuous / quantitative.(also called prediction problem.)
– Forecasting problem: Output in future domain.
![Page 10: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/10.jpg)
1/7/2009 10
Supervised Learning Methods
X Y
Continuous
Categorical
Prediction (Regression)
Classification
![Page 11: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/11.jpg)
1/7/2009 11
Statistical Problems and Decision Theory
![Page 12: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/12.jpg)
1/7/2009 12
Formulation of Statistical Problems
• Estimation (Point and Interval)• Hypothesis Testing• Ranking and Selection• Prediction and Forecasting• Decision Making• Etc.
![Page 13: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/13.jpg)
1/7/2009 13
Statistical Decision Theory
![Page 14: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/14.jpg)
1/7/2009 14
Statistical Decision Theory
![Page 15: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/15.jpg)
1/7/2009 15
Statistical Decision TheoryLeast Squares Estimation
![Page 16: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/16.jpg)
1/7/2009 16
Statistical Decision Theory
Classification & Bayes Classifier
![Page 17: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/17.jpg)
1/7/2009 17
Statistical Decision TheoryClassification & Bayes Classifier
Bayes Classifier: Choose the class with maximum probability
![Page 18: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/18.jpg)
1/7/2009 18
Model Complexity and Prediction/Classification Error
![Page 19: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/19.jpg)
1/7/2009 19
Datasets
Training Set
Testing Set
Dataset used for creating classifiers
Dataset used for validating classifier obtained from training set.
![Page 20: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/20.jpg)
1/7/2009 20
Classification Example
Linear Regression Method for Classification
![Page 21: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/21.jpg)
1/7/2009 21
![Page 22: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/22.jpg)
1/7/2009 22
Classification Example
Nearest Neighbor Method for Classification
![Page 23: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/23.jpg)
1/7/2009 23
![Page 24: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/24.jpg)
1/7/2009 24
![Page 25: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/25.jpg)
1/7/2009 25
![Page 26: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/26.jpg)
1/7/2009 26
Training error
Test error
Model ComplexityLow High
Pre
dict
ion
Err
orPrediction or Classification Error
Overfitting
![Page 27: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/27.jpg)
1/7/2009 27
Training Error, Cross-Validation Error, Testing Error
Training error based on training data
Testing data Training data
1 2 3 K. . .
Cross-Validation
Testing error based on testing data
Fitted model using training data
![Page 28: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/28.jpg)
1/7/2009 28
Cross-Validation Method
1 2 3 10. . .1st round
1 2 3 10. . .2nd round
1 2 3 10. . .
…
10th round
![Page 29: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/29.jpg)
1/7/2009 29
(Methodology/Model Oriented)• Regression Type Models:
– Linear Models, GLM, Logistic Regression– Generalized additive models (Hastie & Tibshirani, 1990)
– Classification and Regression Tree (CART)(Breiman, Friedman, Olson, Stone, 1981)
– Multivariate Adaptive Regression Spline (MARS) – Multiple Additive Regression Tree (MART)– Neural Networks
Models for Supervised Learning
![Page 30: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/30.jpg)
1/7/2009 30
• Segmentation Type Models– Support vector machines (SVM)– Generalized linear discriminant analysis (DA)– Flexible DA, Penalized DA, Mixture DA– K-Nearest Neighbors (NN), Adaptive k-NN– Bayesian Classification– Genetic Algorithms– Fuzzy Set Classification– Classification and Regression Tree (CART)
Models for Supervised Learning
![Page 31: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/31.jpg)
1/7/2009 31
• Not clear how to categorize the regression and segmentation type models.
• Most regression models can be used for both classification and prediction (regression) problems.
• Segmentation models can also be useful for regression problem, e.g., Regression tree, SVR.
• Computer scientists focus on problem while statisticians focus on models(algorithms Vs. models, e.g. boosting Vs. MART)
Supervised Learning
![Page 32: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/32.jpg)
1/7/2009 32
Some Characteristics of Different Learning Methods (Hastie et al.)
Characteristics Neural Net SVM Trees MARS K-NN, Kernel MART
Natural handling of data of “mixed” type
Handling of missing values
Robustness to outliers in input space
Insensitive to monotone transformations of inputs
Computational scalability (large N)
Ability to deal with irrelevant inputs
Ability to extract linear combinations of features
Interpretability
Predictive power
= good = fair = poor
![Page 33: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/33.jpg)
1/7/2009 33
• Learning without a teacher• Statistical Definition
– Observe N vectors from the population distribution– Directly inference on the properties (e.g. relationship, grouping)
on the population distribution• Dimension of the observation (# of variables or
attributes) is often very high (much higher than that in supervised learning)
• No clear measure of success– The success is often judged (subjectively) by the value of
discovery knowledge or the effectiveness of the algorithm
Unsupervised Learning
![Page 34: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/34.jpg)
1/7/2009 34
• Association Rule:– Single-Dimensional Association Rule from
Transaction Database– Multi-Level Association Rule from Transaction
Database– Multi-Dimensional Association Rule from Relational
Data Base and Data Warehouse– Correlation Analysis
Problems in Unsupervised Learning
![Page 35: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/35.jpg)
1/7/2009 35
• Examples :– Multi-Level Association Rule :
• Computer: desktop (IBM, Dell), laptop (Toshiba, Sony)• Software: educational (Microsoft, …), financial (…, …)• Printer: color (HP, Epson), B/W (HP, Sony)• Rule e.g.: {IBM desktop computer => B/W printer}
– Multi-Dimensional Association Rule :• buys(X, “IBM desktop computer”)
=> buys(X, “Sony B/W printer”)• Age(X, “20 to 29”)& Occupation(X,”students”) =>
buys(X, “laptops”)
Association Rules
![Page 36: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/36.jpg)
1/7/2009 36
• Clustering – Partitioning methods:
• K-means, K-medoids– Hierarchical Methods:
• BIRCH, CURE, chameleon, algorithms– Density-Based Methods:
• DB SCAN, OPTICS, DENCLUS– Grid-based methods:
• STING, Wave cluster, CLIQUE– Model-Based Clustering:
• CoBWEB (tree-model)• Neural Network model
Algorithms in Unsupervised Learning
![Page 37: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/37.jpg)
1/7/2009 37
• Association Rules– Market basket analysis– Generalized association rules
• Cluster Analysis– K-mean algorithms– Clustering algorithms– Combinatorial algorithms
• Other Multivariate Methods– Principle components– Factor analysis and latent variables– Projection pursuit– Multi-dimensional scaling
Models for Unsupervised Learning
![Page 38: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/38.jpg)
1/7/2009 38
Application Examples
![Page 39: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/39.jpg)
1/7/2009 39
Learn a method for predicting the instance class from pre‐labeled (classified) instances
Classification
Classification Models
![Page 40: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/40.jpg)
1/7/2009 40
Find “natural” grouping of data given un‐labeled data
Clustering
![Page 41: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/41.jpg)
1/7/2009 41
Classification problem
SensingFeature extractionWidth, length, lightness, etc.
salmon
bass
lightness
width
Classification Problem
![Page 42: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/42.jpg)
1/7/2009 42
• Given a query functional data and some similarity measure (e.g., Euclidean distance), find the nearest matching functional data in DB.
Query Q(template)
C6 is the best match
Database C
2
1
4
3
5
7
6
9
8
10
Index Problem (Query by Content)
![Page 43: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/43.jpg)
1/7/2009 43
• Find a natural groups (clusters) of the functional data in database
1
2
7
6
3
5
4
Clustering Signals
![Page 44: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/44.jpg)
1/7/2009 44
• Given a faulty signal from the monitoring procedure, how to classify it to one of known classes
0 50 100 150-2
-1
0
1
2
3Fault 1
0 50 100 150-2
-1
0
1
2
3Fault 2
0 50 100 150
-2
0
2
4
Fault 3
0 50 100 150-2
-1
0
1
2
3Fault 4
0 20 40 60 80 100 120 140-2
-1.5
-1
-0.5
0
0.5
1
1.5
2
2.5
Fault 4
0 20 40 60 80 100 120 140-1
-0.5
0
0.5
1
1.5
2
Faulty Signal Detection
![Page 45: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/45.jpg)
1/7/2009 45
Hand Writing Recognition
![Page 46: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/46.jpg)
1/7/2009 46
From Normal From Disease
Bioinformatics ‐Microarray
• Microarray (e.g., 50,000 spots)
![Page 47: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/47.jpg)
1/7/2009 47
Bioinformatics ‐Microarray
• Clustering problem
– Partition the genes into groups or clusters based on their expression patterns.
![Page 48: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/48.jpg)
1/7/2009 48
Bioinformatics – Gene Finding
Input: An DNA string (nucleotide) over the alphabet {A,C,G,T}Output: An annotation of the string showing for every
nucleotide whether it is coding (gene) or non‐coding.
AAAGCATGCATTTAACGAGTGCATCAGGACTCCATACGTAATGCCG
Gene finder
AAAGCATGCATTTAACGAGTGCATCAGGACTCCATACGTAATGCCG
Gene !!
![Page 49: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/49.jpg)
1/7/2009 49
Secondary Structure
3D coordinates of atoms
AminoacidSequence
Bioinformatics – Protein Structure Prediction
![Page 50: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/50.jpg)
1/7/2009 50
Bioinformatics ‐Metabolomics
0123456780
0.01
0.02
0.03
0.04
0.05
0.06
chemical shift (ppm)
55 60 65 70 75 80 85-14
-12
-10
-8
-6
-4
-2
0
PC1
PC
2
8:30 9:30
10:30
11:30
12:30
13:30
14:30
15:30
16:30
17:30
18:30
19:30
20:30
21:30
22:30
23:30
00:30
1:30
2:30 3:30
4:30 5:30
6:30
7:30
8:30*
morning (7:30-12:30)
afternoon/evening(13:30-22:30)
night(23:30-6:30)
5560 65
70 7580 85
-15
-10
-5
0
2
4
6
8
10
PC2
00:30 23:30
5:30
2:30
4:30
1:30
14:30
3:30
16:30 17:30
15:30
6:30
18:30
13:30
20:30
19:30
22:30
PC1
21:30
8:30*
11:30
8:30
12:30
10:30
7:30 9:30
PC
3
Finding inherent metabolic patterns in response to pathophysiogical stimuli or genetic modification
![Page 51: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/51.jpg)
1/7/2009 51
• AT&T business data mining• Inventory management in military maintenance • Sea cargo demand forecasting• SMATRAQ project in transportation policies• Location problem of letterbox• Home improvement store shrinkage analysis • Hotels & Resorts chain data mining• Fast food drive through call center
Industrial Projects
![Page 52: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/52.jpg)
1/7/2009 52
Data Mining in Telecom. (Funded AT&T project)
• ~160 billion dollar per year industry (~70 B long distance & ~90 B dollars local)
• 100 million + customers/accounts/lines• >1 billion phone calls per day
– Book closing (Estimating this month price/usage/revenue)
– Budgeting (Forecasting next year price/usage/revenue)– Segmentation (Clustering of usage, growth, …)– Cross Selling (Association Rule)– Churn (Disconnect prediction & Tracking)– Fraud (Detection of unusual usage time series behavior)– Each of these problems worth hundreds
millions dollars
![Page 53: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/53.jpg)
1/7/2009 53
• A contractor manages parts inventory for aircraft maintenance
• Characterization and forecasting of demand and lead time distributions
• 60,000 different parts and 500 bench locations
• Data tracked by an automated system
• Demand data not available & stockout penalty
Inventory Management in Air Force (Funded project)
![Page 54: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/54.jpg)
1/7/2009 54
• Sea cargo network optimization
• Contract planning & booking control
• Characterize & forecast sea cargo demand distribution & cost structure
• Improve ocean carrier and terminal operation efficiency
Data Mining in Sea Cargo Application (Funded TLIAP project)
![Page 55: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/55.jpg)
1/7/2009 55
• Strategies for Metropolitan Atlanta’s Regional Transportation & Air Quality
• Five-year project sponsored by Transportation Dept., Federal Highway Admin., EPA, CDC, etc.
• Assess air quality, travel behavior, land use & transportation policies
• Reduce auto-dependence and vehicle emissions
• Highway Design based on detailed GPS data
SMARTRAQ Project for Transportation Policies
![Page 56: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/56.jpg)
1/7/2009 56
• Improve performance of express mail dropoff letter boxes
• 50,000 letter boxes & 8 month transaction data
• Relate performance with important factors, e.g. regions, demographic, adjacent competition, pick-up schedule
• Comparison with direct competitors
• Customer demand analysis and forecast
Mining of Letter Box Transaction Data
![Page 57: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/57.jpg)
1/7/2009 57
• Inventory shrinkage costs US retailers 32 billions
• Shrinkage = book inventory – inventory on hand
• Working with a home improvement store’s Loss Prevention Group
• Develop predictive model to relate shrinkage to important variables
• Extract hidden knowledge to reduce loss and improve operation efficiency
Data Mining for Shrinkage Analysis in Retail Industry
![Page 58: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/58.jpg)
1/7/2009 58
• Manage chain hotels and resorts in different scale
• Evaluate impact of promotional programs
• Forecasting of customer behavior in frequent stay program
• Monitor performance in customer survey
• Predict performance with important factors
Data Mining for Hotels and Resorts Chain Business
![Page 59: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/59.jpg)
1/7/2009 59
• Centralized call center for drive through order operated by an independent company
• Profit = Revenue (fixed rate per call) – cost (#operators)
• Constraint: 3 second response time and 20 second route back to store
• Objective: Reduce cost by optimizing operation time and scheduling
• Tools: data mining & forecasting, simulation, optimization
Data Mining and Forecasting for Fast Food Call Center
![Page 60: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/60.jpg)
1/7/2009 60
A General Framework for Dynamic Modeling & Activity Monitoring (DMDA)
Actions
Segmentation & Model Selection
Monitoring
Dynamic Update
Problem
Profile Data–Time domain profile– Profile w. controllable predictors– Profile w. uncontrollable predictors
Model Selection– Global w/o segmentation– Global w. segmentation– Local within Segment
–Detection/Classification– Interpretation–Forecasting/Prediction Segmentation
– Known– Unknown
– Phase I: estimating unknown parameter– Phase II: monitoring and detecting– Anticipated drifts Vs. unanticipated
changes
Objective
![Page 61: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/61.jpg)
1/7/2009 61
Applications• Manufacturing Processes
– Stamping Tonnage Signal Data (functional data)– Mass Flow Controller (MFC) Calibration (linear
profile)– Vertical Density Profile (VDP) Data (nonlinear
profile)
• Service Operations– Telecom. Customer Usage– Sea Cargo Terminal Operation– Used Car Price Mining and Prediction– Hotel Performance Monitoring– Fast Food Drive Through Call Center Forecasting &
Scheduling
![Page 62: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/62.jpg)
1/7/2009 62
Manufacturing:Stamping Tonnage Signal Data
Figure 2: An Tonnage Signal and Some Possible Faults (Jin and Shi 1999)
![Page 63: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/63.jpg)
1/7/2009 63
Stamping Tonnage Signal Data
• Problem – Time domain profile (a tonnage signal represents the stamping force
in a process cycle).• Objective
– Fault detection and classification• Segmentation & Model Selection
– Known segmentation: most process faults occur only in specific working stages. Boundaries and sizes of segments are determined by process knowledge. (Jin and Shi 1999)
– Global model: wavelet transforms• Monitoring
– For each segment, use T2 charts based on selected wavelet coefficients to conduct monitoring. (Jin and Shi 2001)
• Dynamic Update– Classify a signal as normal, a known fault or a new fault as
abnormal, and update wavelet coefficients’ selection and parameter estimates (e.g. μ, ∑, etc.) using all available data.
• Actions– Identify and remove assignable causes.
![Page 64: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/64.jpg)
1/7/2009 64
Telecom. Customer Usage
• Problem – Profile with uncontrollable predictors
• Objective– Abnormal behavior detection and classification– Forecasting/prediction
• Segmentation & Model Selection– Unknown segmentation: segment customers based on demographic,
geographic, psychographic and/or behavioral information.– Local model: fit model for each customer segment, e.g. linear
regression.• Monitoring
– Use the model built for each segment to monitor customer behaviors, e.g. monitor linear regression parameter vector β using T2 chart.
• Dynamic Update– Update customer segmentation, segmental model fitting and/or
parameter monitoring, e.g. parameters update based on known trend.• Actions
– Service improvement, customer approval, etc.
![Page 65: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/65.jpg)
1/7/2009 65
Telecom. Customer Usage
Profile: profile with uncontrollable predictors
Objective– Abnormal behavior detection and classification– Forecasting/prediction
Segmentation– Unknown (segments are defined by customer information.)Model Selection– segmental (e.g. linear regression on uncontrollable predictors for each segment)
Monitoring – Phase I: unknown control chart parameters estimated from data– Phase II: monitoring by control charts, like T2 chart, EWMA chart, etc.
Actions: service improvement, customer approval, etc.
Dynamic Update– Update segmentation, model selection and/or parameter monitoring
![Page 66: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/66.jpg)
1/7/2009 66
Conclusions
Data Mining
Statisticians Computer Scientists
Support data mining by producing data, business problems, software & hardware equipment for testing and implementing results.
Support data mining by mathematical theory and statistical methods.
Support data mining by computational algorithm and relevant software.
Subject matter experts
![Page 67: Supervised and Unsupervised Learning€¦ · (Regression) Classification . 1/7/2009 11 Statistical Problems and Decision Theory . 1/7/2009 12 Formulation of Statistical Problems •](https://reader033.vdocuments.us/reader033/viewer/2022042319/5f083b2b7e708231d420fc05/html5/thumbnails/67.jpg)
1/7/2009 67
Conclusions
• It is not hard to obtain interesting and useful knowledge from data mining.
• The challenge is to transform and implement the interesting knowledge for business decisions making.
• Issues involved:– internal collaboration efforts (sales versus marketing),
– external collaboration efforts (competitors among the industry),
– privacy protection.