Transcript
Page 1: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Slides to Accompany “Artful Prior Art”

Page 2: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Derwent GENESEQ Database

Collection of patented DNA sequences– 10 or more base pairs

Coverage from 1981 Feb. 2001: 1,000,000 sequences Feb. 2002: 2,000,000 sequences Oct. 2003: 3,900,000 sequences

Page 3: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

U.S. Patent No. 6,074,816

12. The purified preparation of claim 1 wherein the oligonucleotide comprises a contiguous sequence of at least 8 nucleotides complementary to either strand of the nucleotide residue sequence depicted in FIG. 62.

Page 4: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Figure 62

Strand A has 9,185 bases, beginning with:

5’-CACTCCACCATGAATCACTCCCCTGTG AGGAACTACTGTCTTCACGCAGAAAGCGTCTAG….

Strand B is Strand A’s reverse complement.

Claim covers 18,356 oligonucleotides (minus duplicates)

But there are only 48 = 65,536 possible oligonucleotides with 8 bases!

Page 5: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

What is Patented?

An isolated and purified DNA molecule.

Page 6: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Why is it Patentable?

Statutory law Case law

– Patent Office Guidelines

Page 7: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

35 U.S.C. § 101 (1952)

Whoever invents or discovers any new and useful process, machine, manufacture, or combination of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.

Page 8: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

35 U.S.C. § 103 (1952)

(a) A patent may not be obtained … if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art …

(c) Patentability shall not be negatived by the manner in which the invention was made.

Page 9: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Patent-Defeating Disclosures

A patent may not claim subject matter that was described in a printed publication– before the date of invention; or

– more than one year before the application filing date.

35 U.S.C. § 102(a)

Page 10: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Some DNA Disclosure Programs Immediate publication of DNA

sequences in public databases– Human Genome Project (Genbank)

– Merck Gene Index (ESTs)

Filing of statutory invention registrations: 35 U.S.C. § 157– SNP Consortium

Page 11: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Limitations

Publication of sequence information does not invalidate claims to subsequences per se

Publication of ESTs does not invalidate claims to full-length genes or subsequences thereof– In re Deuel; In re Bell

Page 12: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Another Approach:Quiet PublicationIs a doctoral thesis a printed publication under

102(b)?Yes, if it is publicly accessible. In re Hall.

General library practice may be relied upon to establish an approximate time for thesis accessibility.

Library director’s affidavit: “The dissertation ‘most probably was available for general use toward the beginning of the month of December, 1977.”

Page 13: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

In re Hall

An applicant has constructive knowledge of all properly indexed, cataloged and shelved library materials worldwide.

Page 14: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

“Described in a Printed Publication” To anticipate a claim to one or more chemical

compounds, a single printed publication must: specifically describe a compound within the scope of

the claim disclose a method of making the compound that

enables one of ordinary skill in the art to do so recite at least one significant useful property

(§ 101 utility requirement need not be met) It is not necessary that the disclosed compound

actually have been made

Page 15: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Previous Work

General methods of making and using oligonucleotides of arbitrary sequence are well known and described in the literature.

But specific oligonucleotides are not described in this literature, so there is no § 102(a) bar

Page 16: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

§ 102(a) Requirements A § 102(a) reference must include:

– A specific description of the subject matter and– Instructions that will enable an ordinary

practitioner to make and use the subject matter Not necessary to have actually made or used the

subject matter A single copy in a public library counts as

“publication” Solution: Describe 11 million DNA sequences,

and general methods of making and using them, on a single CD-ROM

Page 17: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

The CD-ROM On the Preparation and Utilization of Isolated and Purified Oligonucleotides 

As described in U.S. Patent No. 5,808,022 (issued Sept. 15, 1998) (William D. Huse), oligonucleotide synthesis proceeds via linear coupling of individual monomers in a stepwise reaction. The reactions are generally performed on a solid phase support . . .

Page 18: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

The CD-ROM

Based on the the disclosures herein and the knowledge of a person of ordinary skill in the art, it will be apparent to such a person how to make and use an isolated and/or purified oligonucleotide characterized by any of the following nucleotide sequences:

Page 19: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

The CD-ROM

5'-AAACACCC-3'5'-AAACACCG-3'5'-AAACACGC-3'5'-AAACACGG-3'5'-AAACAGCC-3'5'-AAACAGCG-3'5'-AAACAGGC-3'5'-AAACAGGG-3'5'-AAACCACC-3'. . .

Page 20: Slides to Accompany Artful Prior Art. Derwent GENESEQ Database Collection of patented DNA sequences –10 or more base pairs Coverage from 1981 Feb. 2001:

Anticipation of Oligonucleotide Patents

# of 8-to-12 base oligonucleotides claimed

% of possible claims anticipated

1 49.6%

2 74.6%

3 87.2%

10 99.9%

25 99.99999+%


Top Related