![Page 1: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/1.jpg)
Reverse Genetics in Drosophila
I. P elements in reverse geneticsA. P element insertional mutagenesis projects
B. Using P elements to make mutations
II. RNA interferenceA. Basics of RNAi
B. RNAi methods in flies
III. Targeted gene replacement
![Page 2: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/2.jpg)
target geneenhancer
lacZ white
enhancer trap: expresses Gal in same pattern as target gene
P element constructs
![Page 3: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/3.jpg)
UASwhite
controlled misexpression: expresses target gene in Gal4-dependent manner
P element constructs
GAL4 white
GAL4 enhancer trap: expresses Gal4p in same pattern as target gene
![Page 4: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/4.jpg)
yellowwhite
insulators: block enhancers and position effects on expression
P element constructs
![Page 5: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/5.jpg)
P{PZ} enhancer trap 523
P{lacW} enhancer trap 1176
P{Gal4} Gal4 expression 141
P{EP} UAS-controlled expression
P{SUPor-P} insulator
263
2076
P{GT1} gene trap 511
Mapped P element Insertion Lines(Bloomington Stock Center, as of 11/12/02)
4690
![Page 6: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/6.jpg)
w P{w+}P element onX chromosome
Sb 2-3+
P transposase(chromosome 3)
dominantmarker
Transposition of P Elements
w
+;
Y
P{w+}
new insertion on autosome
w P{w+} Sb 2-3+
;Y
w
screen forred-eyed sons
![Page 7: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/7.jpg)
Spradling et al. (1995)
P elements rarely insert into coding sequences
![Page 8: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/8.jpg)
w ; P{w+} Sb 2-3+
P element onchromosome 3
P transposase(chromosome 3)
dominantmarker
w
Excision of P Elements
Sb 2-3
P{w+}w
Y;
w
+;
Y
P{w+}**
screen for loss of w+, indicating excision
![Page 9: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/9.jpg)
white
P transposase
...ATGCCAAACATGATGAAATAACATAAGGTGGTCCCGTCG...
...TACGGTTTGTACTACTTTATTGTATTCCACCAGGGCAGC...
31-bp P inverted repeat8-bp target site
P transposase
...ATGCCAAACATGATGAAATAACATA
...TACGGTTT17-nt 3’ overhang
![Page 10: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/10.jpg)
different products, depending on: template for repair
extent of repairgap widening before repair
non-homologousend-joining homologous
recombination
(double-strand break)
![Page 11: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/11.jpg)
whi
internal deletion of P element (w-)sometimes alters expression of target gene
A. Repair using sister chromatid as a template
white
restoration of P element (w+)
B. Repair using homologous chromosome as a template
precise excisionuseful for proving that phenotypes are due to P element insertion
![Page 12: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/12.jpg)
C. “Imprecise excision”
exonuclease
repair
deletion of flanking DNA
![Page 13: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/13.jpg)
RNA Interference
dsRNA
Dicer endonuclease
21-23 bp (or nt) siRNA
destroy mRNA
find complementary mRNA
(RISC complex)
![Page 14: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/14.jpg)
Functions for RNA Interference
Repression of repeated genes (e.g., transposable elements)Defense against viruses (plants)
Developmental control of gene expression (small temporal RNAs)
X chromosome inactivation (mammals)
Silencing of mating type loci and centromeric regions (S. pombe)DNA elimination in macronuclei (Tetrahymena)
Experimental manipulation of gene function.
![Page 15: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/15.jpg)
RNAi Methods in Drosophila
1. Addition of dsRNA to cell culture
2. Injection of dsRNA into embryos
3. Expression of hairpin RNA in vivo.
UAS
Gal4
RNA
dsRNA
![Page 16: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/16.jpg)
Gene Targeting Technologies
S. cerevisiaeGenerate linear targeting DNA by PCR
Transform suitable strain
Plate on medium for positive selection (10-
8?)M. musculus
Generate targeting DNA by cloning, cutting
Transform ES cells
Conduct positive and negative selections (typical = 10-7)
![Page 17: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/17.jpg)
Gene Targeting in Drosophila
ProblemsNo culture system for germline stem
cellsDNA introduced by injection in single embryos
Existence of DNA repair in early development questionable
Solution (Rong and Golic)Generate linear DNA in vivo:
Obtain stable transformants of donor construct
Use FLP – FRT system to excise donor DNA from chromosome
Use I-SceI to linearize donor DNA
Use visible marker gene to screen for potential homologous gene replacements
![Page 18: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/18.jpg)
FRT
FLP Recombinase Catalyzes Exchange BetweenTarget Sequences (FRTs)
FLP recombinase
crossover
![Page 19: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/19.jpg)
FRTFRT
Intrachromosomal Recombination Between Tandem FRTsResults in Excision from the Chromosome
extrachromosomal circlewith 1 FRT
chromosome with 1 FRT
![Page 20: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/20.jpg)
5' ATTACCCTGTTATCCCTAAATT 3'3' TAATGGGACAATAGGGATTTAA 5'
5' ATTACCCTGTTAT CCCTAAATT 3'3' TAATGGGAC AATAGGGATTTAA 5'
I-SceI
I-SceI makes a double-strand break at an 18-bptarget sequence
![Page 21: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/21.jpg)
FRTFRT
donor construct (integrated P element)
I-SceI site
FLP recombinase
extrachromosomal circular donor
![Page 22: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/22.jpg)
I-SceI endonuclease
DSB
*
*
integration
tandem duplication
![Page 23: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/23.jpg)
w+ *
FLP recombinaseI-SceI endonuclease
*
*w+
integration
![Page 24: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/24.jpg)
*w+
I-CreI endonuclease
*w+
DSB
I-CreI site
*
Repair of a DSB between direct repeats
Tandem Duplications can be Reduced to Single Copy
![Page 25: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II](https://reader035.vdocuments.us/reader035/viewer/2022062511/551435a2550346ec488b61ba/html5/thumbnails/25.jpg)
Reverse Genetics in Drosophila
I. P elements in reverse geneticsA. P element insertional mutagenesis projects
B. Using P elements to make mutations
II. RNA interferenceA. Basics of RNAi
B. RNAi methods in flies
III. Targeted gene replacement