Transcript

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, researchlibraries, and research funders in the common goal of maximizing access to critical research.

Phylogenetic Relationships in the North American Genus Pseudemys (Emydidae)Inferred from Two Mitochondrial GenesAuthor(s): Thomas G. Jackson, Jr., David H. Nelson and Ashley B. MorrisSource: Southeastern Naturalist, 11(2):297-310. 2012.Published By: Eagle Hill InstituteDOI: http://dx.doi.org/10.1656/058.011.0211URL: http://www.bioone.org/doi/full/10.1656/058.011.0211

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, andenvironmental sciences. BioOne provides a sustainable online platform for over 170 journals and books publishedby nonprofit societies, associations, museums, institutions, and presses.

Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance ofBioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.

Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiriesor rights and permissions requests should be directed to the individual publisher as copyright holder.

SOUTHEASTERN NATURALIST2012 11(2):297–310

Phylogenetic Relationships in the North American Genus Pseudemys (Emydidae) Inferred from

Two Mitochondrial Genes

Thomas G. Jackson, Jr.1, David H. Nelson1, and Ashley B. Morris2,*

Abstract - Pseudemys turtles are an important component of southeastern North Ameri-can aquatic ecosystems, but the relationships within the genus are poorly understood. Convergent morphology and apparent hybridization have complicated the identifi cation of species boundaries and have resulted in numerous confl icting taxonomic treatments. We used mitochondrial DNA sequence data from the control region and cytochrome-bgene to address 1) the monophyly of currently recognized subgeneric clades (the cooters and the red-bellies), and 2) relationships within these two groups. A total of 91 specimens representing 8 Pseudemys and 3 outgroup taxa were sampled, and 36 distinct haplotypes were recovered. Pseudemys forms a well-supported monophyletic group, but relation-ships among species were not well resolved, such that support for the two subgeneric groupings was lacking. Furthermore, most taxa do not appear to be monophyletic, with the exception of P. gorzugi (Rio Grande Cooter) and P. texana (Texas Cooter), suggesting the possibility of mitochondrial introgression as a result of historic or continuing hybrid swarms across the range of the genus, or the lack of resolution may refl ect a pattern of recent speciation. In light of recent molecular surveys in turtles, the utility of mitochon-drial DNA in turtle systematics is also discussed .

Emydid turtles represent a signifi cant component of the fauna of the south-eastern US. The family has been characterized as the most abundant, speciose, and ecologically diverse group of turtles in eastern North America (Ernst and Lovich 2009, Ernst et al. 1994, Stephens and Wiens 2003). Pseudemys is the second largest genus of emydid turtles in the subfamily Deirochelyinae. Mem-bers of this genus range from southeastern New Mexico eastward throughout the Florida peninsula and as far north as Massachusetts (Fig. 1). Eight species and two subspecies are currently recognized (Ernst and Lovich 2009): P. alabamensis(Alabama Red-bellied Turtle), P. concinna (subspecies P. c. concinna [Eastern River Cooter] and P. c. fl oridana [Florida Cooter]), P. gorzugi (Rio Grande Cooter), P. nelsoni (Florida Red-bellied Turtle), P. peninsularis (Peninsula Coot-er), P. rubriventris (Northern Red-bellied Turtle), P. suwanniensis (Suwannee Cooter), and P. texana (Texas Cooter). Most of these species, with the exception of P. c. concinna, have restricted geographic distributions, and three are listed on the IUCN red list (2010) as either lower risk/near threatened (P. gorzugi and P. rubriventris) or endangered (P. alabamensis). The ability to properly plan for conservation and management practices is obviously dependent on a clear under-standing of phylogenetic relationships, which is currently lacking in this group.

1Department of Biology, University of South Alabama, Mobile, AL 36688. 2Department of Biology, Middle Tennessee State University, Murfreesboro, TN 37132. *Correspond-ing author - [email protected].

Southeastern Naturalist Vol. 11, No. 2298

Seidel (1994) recognized two species complexes on the basis of morphological and protein data: the red-bellies (P. rubriventris, P. nelsoni, and P. alabamensis)and the cooters (P. c. concinna, P. c. fl oridana, P. gorzugi, P. peninsularis,P. suwanniensis, and P. texana). Although Siedel and Ernst (1996) acknowledged that these two lineages (i.e., red-bellies and cooters) are distinct, historical problems with taxonomic nomenclature led them to avoid defi ning these two groups as subgenera. The red-bellies are characterized as having orange-reddish

Figure 1. Geographic distribution of turtles in the genus Pseudemys: the red-bellies (subge-nus Ptechemys; upper map) and the cooters (subgenus Pseudemys; lower map), as defi ned by Seidel (1994). Maps are redrawn from Ernst et al. (1994) and Conant and Collins (1998).

T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris2012 299

plastrons and a terminal maxillary notch bordered by tooth-like cusps. Turtles in this group also have a prefrontal arrow formed by the meeting of the sagittal head stripe with the supratemporal stripes (Carr and Crenshaw 1957, Ernst et al. 1994, Leary et al. 2003). While members of the cooter species complex may display some of the aforementioned characteristics of the red-bellies complex, no one species exhibits all of these characteristics entirely. Lydeard (1996) stated that “Pseudemys has been confounded by marked intra- and interspecifi c varia-tion in morphological features often used to delineate a species.” Hence, there is considerable debate among many herpetologists as to the relationships among the taxa in the genus. Additionally, multiple researchers have found evidence for extensive hybrid swarms among species of the genus (Crenshaw 1965, Seidel and Palmer 1991), which could explain the extensive history of taxonomic revision described in Siedel and Ernst (1996). While there have been several molecular studies that have included one or more members of Pseudemys (Lydeard 1996, Stephens and Wiens 2003, Spinks et al. 2009, Wiens et al. 2010), no study has yet included all recognized taxa in the genus, nor has any study included more than one or a few accessions of each sampled taxon. Lydeard (1996) used mitochondrial DNA (mtDNA) cytochrome-bsequence data to determine if Mississippi individuals (n = 5) of P. alabamensisshould be recognized as a distinct lineage from those in Alabama (n = 2). He included a small number of P. concinna (n = 6), P. c. fl oridana (n = 1), and P. nelsoni (n = 1) for comparison, but failed to resolve any relationships among the sampled taxa. Stephens and Wiens (2003) used morphology and the mtDNA cytochrome-b and control region to address phylogenetic relationships across Emydidae. They included seven Pseudemys taxa (P. alabamensis, P. concinna, P. gorzugi, P. nelsoni, P. peninsularis, P. rubriventris, and P. texana) but only had complete data for P. concinna. When all sampled taxa were included in a com-bined morphological and molecular analysis, relationships within the genus were poorly supported, with red-bellies (P. nelsoni, P. rubriventris, and P. alabamen-sis) supported by only 53% bootstrap support (BS) using maximum parsimony (MP), nested within the rest of the genus, which was only supported by 51% BS. Spinks et al. (2009) used mtDNA cytochrome-b and seven nuclear loci (nucDNA) to address relationships across the family, and they included four Pseudemystaxa (P. c. concinna, P. c. fl oridana, P. nelsoni, and P. peninsularis). Each data set (mtDNA and nucDNA) provided strong support for a monophyletic genus ( 0.95 bayesian posterior probability [BPP] and 90% BS for both MP and maxi-mum likelihood [ML] analyses), but both were insuffi cient to address questions regarding infrageneric taxonomy due to the limited number of taxa included. Wiens et al. (2010) also used a combined mtDNA and nucDNA approach to the family, and included seven Pseudemys taxa (P. concinna, P. gorzugi, P. nelsoni, P. peninsularis, P. rubriventris, and P. texana). Their combined analysis showed strong support (BPP 1.00) for the red-bellies (P. rubriventris and P. nelsoni; P. alabamensis was not sampled), which were nested within the rest of the clade, as was suggested by Stephens and Wiens (2003). Considering the ecological importance and conservation concerns associated with Pseudemys, additional molecular work is warranted. Our primary objective

Southeastern Naturalist Vol. 11, No. 2300

was to signifi cantly improve sampling within and among taxa in this group to better address questions of relatedness. Previous molecular studies, which have largely focused on broad-scale systematics in turtles, have yet to include all recognized Pseudemys taxa and have typically included only one or two acces-sions per taxon. As a fi rst attempt at assessing phylogenetic relationships within the genus, we chose to use mitochondrial DNA sequence data. In particular, we were interested in assessing the monophyly of currently recognized infrageneric groups (i.e., the red-bellies and the cooters), and relationships among taxa within these two groups. Here we present the results of two mtDNA genes for 86 acces-sions representing all recognized Pseudemys taxa, including subspecies, based on the taxonomy of Ernst and Lovich (2009).

Materials and Methods

Taxon sampling Samples were obtained through fi eld trapping and from museum vouchers (Table 1). Field samples were collected between May and August 2008. Four sites in Alabama (Magnolia River [AL1], Blakeley River [AL2], Tensaw River [AL3], and Fowl River [AL4]) and one site in Mississippi (West Pascagoula River [MS1]) were chosen for sampling because they represented the full geo-graphic range of P. alabamensis (Fig. 2), which is a federally endangered species and for which the authors have ongoing projects. With the exception of at the Blakeley River site, turtles collected during this study were captured using aquatic hoop traps. The traps were checked three days each week until a mini-mum of 8–10 specimens of P. alabamensis were collected from each site. Any other species of turtle trapped during this time were also sampled. Tail snips were taken from captured specimens, along with physical measurements and voucher photographs, and the turtles were released at the point of capture. The Blakeley River samples were obtained from previously frozen specimens from an ongoing highway mortality survey focused on P. alabamensis. Pseudemys species not ob-tained through fi eld sampling at the fi ve sites described above were obtained from museum voucher specimens. Bone fragments of P. nelsoni, P. peninsularis, P. ru-briventris, and P. suwanniensis were obtained from the collections of the Florida Museum of Natural History (FLMNH), Gainesville, FL. Genomic DNA samples for P. texana and P. gorzugi were obtained from M.R.J. Forstner at Texas State University (TSU), San Marcos, TX. Blood samples of Chrysemys picta (Painted Turtle) and Trachemys scripta (Pond Slider) were obtained from S. Graham and G. Sorrell, Department of Biological Sciences, Auburn University, Auburn, AL, and these species were used as outgroups for phylogenetic reconstruction. An additional outgroup, Graptemys fl avimaculata (Yellow-blotched Map Turtle), was obtained through the fi eld sampling described above. Collection data for all samples included in phylogeny reconstruction are provided in Table 1.

DNA extraction, amplifi cation, and sequencing Total genomic DNA was extracted from tail snips and blood samples using the Qiagen DNeasy Blood and Tissue Kit (QIAGEN, Valencia, CA) following the manufacturer’s instructions. Bone sample preparation and DNA extraction were

T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris2012 301

Table 1. Specimens of each species surveyed for at two mitochondrial gene regions for phyloge-netic reconstruction.

Collection data n Haplotype

Subgenus Ptechymys (red-bellies) Pseudemys alabamensis Baur, 1893 (Alabama Red-bellied Turtle) Magnolia River, Baldwin County, AL (AL1) 9 2, 4 Tensaw River, Baldwin County, AL (AL2) 6 3, 4 Blakely River, Baldwin County, AL (AL3) 7 4 Fowl River, Mobile County, AL (AL4) 6 4 Pascagoula River, Jackson County, MS (MS1) 11 1, 4

Pseudemys nelsoni Carr, 1938‡ (Florida Red-bellied Turtle) Monroe County, FL (FL1) 1 19 Alachua County, FL (FL2) 2 20

Pseudemys rubriventris (LeConte, 1830)‡ (Northern Red-bellied Turtle) York County, VA (VA1) 1 26 Virginia County, VA (VA2) 1 26 St. Mary’s County, MD (MD1) 1 27

Subgenus Pseudemys (cooters) Pseudemys concinna concinna (LeConte, 1830) (Eastern River Cooter) Magnolia River, Baldwin County, AL (AL1) 6 6, 7, 9, 11 Fowl River, Mobile County, AL (AL4) 2 5, 8 Pascagoula River, Jackson County, MS (MS1) 2 10

Pseudemys concinna fl oridana (LeConte, 1830) (Florida Cooter) Magnolia River, Baldwin County, AL (AL1) 5 13, 14, 16 Fowl River, Mobile County, AL (AL4) 2 12, 15

Pseudemys gorzugi Ward, 1984† (Rio Grande Cooter) Val Verde County, TX (TX1) 7 17, 18

Pseudemys peninsularis Carr, 1938‡ (Peninsula Cooter) Marion County, FL (FL3) 4 21, 22, 23, 24 Manatee County, FL (FL4) 1 25

Pseudemys suwanniensis Carr, 1937‡ (Suwannee Cooter) Suwannee County, FL (FL5) 1 28 Citrus County, FL (FL6) 2 29

Pseudemys texana Baur, 1893† (Texas Cooter) Hays County, TX (TX2) 8 30, 31

Outgroup taxa Chrysemys picta (Schneider, 1783)* (Painted Turtle) Macon County, AL (AL5) 3 32, 33

Graptemys fl avimaculata Cagle, 1954 (Yellow-blotched Map Turtle) Pascagoula River, Jackson County, MS (MS1) 1 34

Trachemys scripta (Schoepff, 1792)* (Pond Slider) Macon County, AL (AL5) 2 35, 36

*Blood samples from S. Graham and G. Sorrell, Department of Biological Sciences, Auburn Uni-versity, Auburn, AL.

†Total genomic DNA samples from M.R.J. Forstner Tissue Collection, Department of Biology, University of Texas at San Marcos, TX.

‡Bone samples from Florida Museum of Natural History, University of Florida, Gainesville, FL.

Southeastern Naturalist Vol. 11, No. 2302

completed at the University of Florida Interdisciplinary Center for Biotechnol-ogy Research (UF ICBR). Prior to DNA extraction, bone samples were prepared in a laminar fl ow hood to reduce any chance of cross-contamination of samples. All samples were fi rst washed in a 6% bleach solution, followed by two washes in DNA-free water to remove any external contaminants. Samples were then placed in 2-ml of 0.5M EDTA (pH 8.0) on a rocking mixer for 3–6 days until there were signs of a gelatinous residue and opaqueness. Once the decalcifi cation process was complete, DNA was extracted using a phenol/chloroform protocol (Kemp and Smith 2005) modifi ed by B. Kimura (UF ICBR, unpubl. data). Two mitochondrial regions, the 5’ end of the control region and cytochrome-b,were selected for phylogenetic reconstruction. The primers selected for amplifi -cation of the control region (CR-DES1 and CR-DES2) were initially developed by Starkey et al. (2003) to study Chrysemys picta, a close relative of Pseudemys.Cytochrome-b primers (mt-A and CR-12H) were originally designed by Lenk and Wink (1997) for Emys orbicularis (L.) (European Pond Turtle; Emydidae).PCR amplifi cation of the two regions followed the methods of Kozak et al. (2005) and Lenk et al. (1998), respectively. Annealing temperature was typically 55 °C, although 47 °C was used for poor quality DNA samples with problematic ampli-fi cations. Final concentrations for PCR reactions were the same for both regions: 1X PCR Buffer (Promega Corporation, Madison, WI), 3mM MgCl2, 200 M each

Figure 2. Trapping locations for the present study. Selected locations were designed to cover the full geographic range of Pseudemys alabamensis. Sites are as follows: 1) Mag-nolia River, AL, 2) Blakeley River, AL, 3) Tensaw River, AL, 4) Fowl River, AL, and 5) Pascagoula River, MS.

T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris2012 303

dNTP, 200nM of each primer, and 1.25 U GoTaq polymerase (Promega Corpora-tion, Madison, WI). Degradation of DNA from some bone samples required the development of internal primers (Table 2) and lower annealing temperatures (47 °C) for amplifi cation of both gene regions. PCR cleanup and DNA sequencing were performed by High-Throughput Sequencing Solutions, a service of the High-Throughput Genomics Unit, Department of Genome Sciences, University of Washington, Seattle. All sequence data were deposited in GenBank (Acces-sions GQ395699-GQ395770).

Phylogenetic analyses Sequences were edited and manually aligned by eye using Sequencher 4.2 (Gene Codes Corporation, 1991–2004). Bayesian analyses were conducted using Mr. Bayes 3.1.2 (Huelsenbeck and Ronquist 2001, Ronquist and Huelsenbeck 2003). Analysis of the combined data was performed, collapsing all individuals with the same haplotype to a single representative. To improve the fi t of the sub-stitution model to the data for Bayesian analysis, each gene region (control region and cytochrome-b) was treated as a separate partition. While the hierarchical likelihood ratio tests (hLRTs) are the most commonly employed model selec-tion strategy, Posada and Buckley (2004) suggest that the Akaike information

Table 2. Primers used to amplify two mitochondrial DNA regions (control region and cytochrome-b)for turtles used in this study.

Primer name Primer sequence (5’ to 3’)

Control region CR-DES 11 GCATTCATCTATTTTCCGTTAGCA R2822 TTAACTTGATGTGCCTGAAAAA L1612 CGAGAAATAAGCAACCCTTGTT R4102 AGGGCCTGAAGACACAGA L3442 TAACCTGGCATACGGTGGTT CR-DES 21 GGATTTAGGGGTTTGACGAGAAT CR-12H3 ATGAATGTACAATTATACATA

Cytochrome-b mt-A3 CAACATCTCAGCATGATGAAACTTCG R2542 GGCTGAGAGGAGGTTGGTAA L1232 TATAAAGAAACCTGAAACACAGGAA R4272 CCTGTTGGGTTGTTTGATCC L3082 AGACAACGCAACCTTAACCC R5942 GTGGGGTAGATAGGGGGTTG L4082 GGATCAAACAACCCAACAGG R7232 TATGTAGGGCGGGCATTAAG L5402 AACCTTTTAGGGGACCCAGA R8002 TACTAGAAGGTTGGCGGTGAA R9732 GCGGCAGGGATAAGGATTA1Primers from Starkey et al. (2003).2Primers developed in the present study for amplifi cation and sequencing of bone samples. L = left (or forward) primers, R = right (or reverse) primers; numbers refer to the nucleotide position of the primers start location in relation to CR-DES1 or mt-A.

3Primers from Lenk and Wenk (1997).

Southeastern Naturalist Vol. 11, No. 2304

criterion (AIC) is a superior approach. Therefore, the AIC was implemented in Modeltest v3.6 (Posada and Crandall 1998) to determine an appropriate model of evolution for each gene region. The TIM+I model of nucleotide substitution was selected for the control region and the best-fi t model of evolution for the cyto-chrome-b region was K81uf+I. Two independent runs were performed to evaluate the repeatability of estimating stationarity and convergence between runs. Each run was set for 5,000,000 generations, sampling one tree every 1000 generations. Stationarity was determined by plotting log likelihood scores against generation times, and sample points collected prior to stationarity were eliminated (i.e., as “burn-in”). The fi rst 500 trees (10%) were discarded as burn-in, and the remain-ing 4500 trees were combined in a 50% majority rule consensus tree to estimate posterior probabilities for supported nodes.

Results

A total of 1450 bp from the control region and cytochrome-b gene region were amplifi ed for analyses. Ninety-one specimens from the eight different species of Pseudemys and three outgroup taxa were used for analysis in this study. Of the 91 samples used, 36 different mtDNA haplotypes were recovered for the combined mitochondrial data set (Table 1). Within the genus Pseudemys (n = 86), there were 31 unique haplotypes, with no haplotypes shared across taxa. Pseudemys concinna concinna exhibited the greatest variation in sequence data with seven haplotypes represented from ten samples. Pseudemys alabamensis exhibited four haplotypes from 39 specimens used for analysis. One haplotype (haplotype 4) was common among all the populations of P. alabamensis sampled. A single private haplotype was observed in each of three sites (Magnolia River and Ten-saw River in Alabama, Pascagoula River in Mississippi). Together, the outgroups accounted for fi ve different haplotypes from six individuals. Three major clades were recovered with Bayesian analyses (Fig. 3): Clade 1 contains P. gorzugi only; Clade 2 includes individuals from all species except P. gorzugi, P. nelsoni, and P. texana; and Clade 3 includes individuals from all species except P. rubriventris and P. suwanniensis. Each of these major clades is supported by a Bayesian posterior probability of 0.98 or greater. Only P. gorzugiand P. texana appear to be monophyletic, while all other species are polyphyl-etic on the basis of the mitochondrial data presented here. There are no apparent geographic trends with respect to distribution of haplotypes, with one exception. Within Clade 3, there is a well-supported clade (PP 0.97) that includes all acces-sions of P. nelsoni and all but one accession of P. peninsularis. These individuals were all sampled from North Central Florida (see Table 1). The remaining acces-sion of P. peninularis falls within a well-supported (PP 0.98) sub-clade of Clade 2 that also includes P. suwanniensis and P. concinna concinna. Missing data likely explains the inconsistent placement of this accession; 65 bp of the control region that exhibited variation in other members of the genus were missing in this acces-sion. One accession of P. rubriventris from Maryland (MD1, haplotype 27) was recovered as unresolved between Clades 2 and 3; this accession had 186 bp of missing data in an otherwise variable region of cytochrome-b. Removal of these

T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris2012 305

twos accession did not signifi cantly affect the positions of the remaining taxa in the reconstructed topologies (data not shown).

Discussion

Our results from two mtDNA regions show limited resolution among Pseude-mys turtles. Most taxa are not recovered as monophyletic, and there is no support provided for currently recognized infrageneric groupings (i.e., red-bellies and cooters). Pseudemys gorzugi and P. texana, which are the most geographically distinct of all of the taxa, are the only recognized species recovered here as mono-phyletic (BPP 1.00 in each case), although the position of P. texana nested within the rest of the genus (BPP 1.00) is curious. Of the museum specimens included

Figure 3. Results of Bayesian analysis showing the relationship among the 31 unique haplotypes of Pseudemys and the three outgroups. Numbers above each branch cor-respond to posterior probabilities greater than 0.90 for each recovered relationship. Parentheses contain haplotype codes (1–36), followed by sampling location, which cor-respond to those given in Table 1.

Southeastern Naturalist Vol. 11, No. 2306

here, most accessions of P. peninsularis and both accessions of P. nelsoni were recovered in a single sub-clade of Clade 3 (Fig. 3). These two taxa share an overlapping geographic distribution, making these accessions the only lineage in our data set that appears to conform to any geographic pattern. In some respects, these results are consistent with previous fi ndings (Spinks et al. 2009, Stephens and Wiens 2003, Wiens et al. 2010). However, our study is the fi rst to include substantial species-level sampling of all recognized members of the genus. The patterns (or lack thereof) that we have recovered may refl ect the potential pitfalls associated with using only mtDNA in this group (see recent review in Wiens et al. 2010). Alternatively, the lack of monophyly seen here may refl ect a long history of mtDNA introgression and widespread hybrid swarms. Ei-ther way, taxonomic relationships within Pseudemys remain complex and elusive and continue to warrant further work.

Potential pitfalls of mtDNA in Pseudemys Mitochondrial DNA sequence data has long been the tool of choice for mo-lecular systematic and phylogeographic studies in animal taxa due to stability of genome order, relatively high mutation rate, uniparental inheritance, and ease of amplification (Avise 1994, 2000). In recent years, however, numerous studies have identified a growing number of exceptions to each of the reported advantages of mtDNA (see Galtier et al. 2009 for a recent review). As Galtier et al. (2009) acknowledged, even with these potential pitfalls, mtDNA continues to be the most practical first step to understanding molecular ecology of wild populations. The practical applications of mtDNA are the reason we chose these markers for addressing infrageneric relationships in Pseudemys, particularly given the lack of previously published molecular data on the group. Since the completion of the work presented here (Jackson 2009), Spinks et al. (2009) and Wiens et al. (2010) reported signifi cant confl ict between mtDNA and nucDNA in emydid turtles, suggesting that it would be inappropriate to depend on mtDNA alone. However, neither study included multiple accessions of all Pseud-emys taxa. Spinks et al. (2009) actually commented on the fact that several taxa, including Graptemys, Pseudemys, and Trachemys, are taxonomically problem-atic and will need “extensive taxon and data sampling” to resolve relationships in these groups. Wiens et al. (2010) suggested that their own results refl ected actual discrepancies between gene and species trees, but they were unable to invoke a specifi c mechanism to explain this. They were quick to exclude introgression as an option, but considering the limited sampling of Pseudemys taxa (single accessions of six taxa), the chances of any obvious signs of introgression being recovered in their molecular data set are limited. They also suggested that shorter-than-expected branch lengths in mtDNA of Graptemys and Pseudemys may be the result of numts, or mtDNA genes that have been transferred to the nuclear genome. However, they have no empirical data to support this hypothesis, and Spinks et al. (2009) found evidence for potential numts (polymorphisms within an individual mtDNA se-quence) in only four accessions out of approximately 70 taxa across the Emydidae and related outgroups. While we cannot positively rule out the possibility of numts in Pseudemys without extensive additional effort, we found no polymorphic se-quences within our accessions to suggest that this was an issue.

T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris2012 307

Evidence for introgression and hybrid swarms in Pseudemys? Given that the issues above do not explain the observed patterns in Pseudemysthat are presented here, an alternative is needed. We suggest that historical and potentially recent introgression as the result of widespread hybrid swarms may be viable explanations. Wiens et al. (2010) argued that “recent, homogenizing introgression across the genus” is unlikely, stating that many taxa sampled in their study (P. gorzugi, P. nelsoni, P. rubriventris, and P. texana) are allopatric and geographically distant from each other. While recent introgression may not explain patterns in these particular species, mutations documented in mtDNA sequences may actually refl ect historical introgression that occurred following glacial retreat in the Pleistocene, as has been hypothesized in many taxa across the southeastern US (see Avise 2000, Soltis et al. 2006 for recent reviews). As reviewed in Seidel and Ernst (1996), Pleistocene fossils of Pseudemys are categorized as one of three taxa: P. nelsoni (known from Florida, Georgia, Mississippi, and South Carolina), P. concinna (Georgia, Florida, South Carolina, Alabama, Indiana, Kansas, and possibly Oklahoma), and P. peninsularis (Flori-da). Additional reports of Pseudemys-like fossils from the Pleistocene of Texas are reported in Holman (1964). There are also reports of Pseudemys fossils from the Miocene and Pliocene of Florida (reviewed in Seidel and Ernst 1996). With the caveat that the fossil record is likely an incomplete representation of Pleisto-cene Pseudemys lineages, the existing records lead us to suggest that modern-day taxa may be relatively young, such that they are exhibiting patterns of incomplete lineage sorting of ancestral polymorphisms from their Pleistocene ancestors, which were partially sympatric. For example, given the disjunct geographic distributions of the three taxa included in the red-belly group (P. rubriventris,P. nelsoni, and P. alabamensis), it is possible to hypothesize that these three taxa may have arisen from a previously more widespread P. nelsoni as refl ected in the fossil record. A similar pattern is seen in the modern-day Sternotherus oderatus (Latreille) (Common Musk Turtle; Kinosternidae), where three sepa-rate phylogeographic assemblages (one in the Carolinas, one in Florida, and one more interior/Mississippi River Valley) were recognized on the basis of mtDNA restriction site data (Walker et al. 1997). Lamb et al. (1994) suggested that mem-bers of the genus Graptemys (Emydidae), because of their reduced propensity for terrestrial dispersal, may have experienced increased rates of allopatric specia-tion caused by vicariant events that affected river habitats during the Pleistocene. Similar events may be responsible for present-day distributions of Red-bellies in the southeastern US. A detailed phylogeographic approach coupled with fossil-based divergence time estimation (similar to that used in Spinks and Shaffer 2009 in Emys) may further clarify these patterns in Pseudemys. Recent introgression may also play a role in some of the patterns observed here. Crenshaw (1965) found evidence of extensive hybridization between P. rubriventris and P. fl oridana in a lake in Richmond County, NC based on an elec-trophoretic survey of serum protein and morphological analyses. Unfortunately, much of Crenshaw’s discussion of putative hybrid zones in other regions (e.g., pen-insular Florida) is diffi cult to follow due to major changes in turtle taxonomy since his publication in 1965. Arguments over the distinctiveness of P. c. concinna and P. c. fl oridana at different locations across their sympatric ranges also allude to the possibility of continuing or recent gene fl ow between these currently recognized

Southeastern Naturalist Vol. 11, No. 2308

subspecifi c taxa (Jackson 1995, Seidel 1995). Microsatellite loci may prove more effective at teasing apart historical and recent hybridization events in this genus.

Conservation implications As previously mentioned, three Pseudemys species are listed on the IUCN red list (2010) as either lower risk/near threatened (P. gorzugi and P. rubriven-tris) or endangered (P. alabamensis). Of these, only P. gorzugi was recovered as monophyletic in the present study, although limited sampling and missing data likely prevent us from being able to assess monophyly in P. rubriventris. We do not, however, recommend changes to the taxonomy of these organisms on the basis of the data presented here. The complex nature of the relationships within Pseudemys remain diffi cult to resolve, and revisionary taxonomists should be particularly cautious as a result. We sampled extensively across the range of P. alabamensis, collecting a total of 39 accessions from four locations in Alabama and one in Mississippi (Fig. 2, Table 1). We found no support for the recognition of Mississippi populations as a distinct evolutionary lineage, which was consistent with the fi ndings of Lydeard (1996). Furthermore, we found limited variation across the accessions sampled, only recovering four distinct haplotypes within the species. This variation was far less than expected for the sampling effort given the number of haplotypes recovered within other sampled Pseudemys taxa (see Table 1). This result might be a refl ection of the extremely limited geographic range of the species and could indicate a relatively small effective population size. Additional work is underway to better understand reproductive ecology in this federally endangered species (Hieb et al. 2011).

Conclusions Phylogenetic relationships within Pseudemys are highly complex, likely as a result of retained ancestral polymorphism and possibly recent hybrid swarms. Such complexity warrants a battery of approaches, including multiple morphologi-cal and molecular markers. Future work to resolve questions of relatedness in this genus should focus their efforts on signifi cant fi ne-scale sampling of sympatric and allopatric populations of all recognized taxa. Furthermore, consideration of mo-lecular markers with different mutational rates (mtDNA/nucDNA sequences vs. microsatellites) coupled with fossil calibration points will be necessary to better comprehend underlying evolutionary processes from different points in time.

Acknowledgments

We thank K. Krysko for granting access to specimens from the FLMNH Osteologi-cal Collection, and G. Clark and A. Gomez (UF ICBR) for assistance with molecular work. We also thank M. Forstner and M. Gaston for contributing samples of P. gorzugiand P. texana from the M.R.J. Forstner Tissue Collection. Specimens of T. scripta and C. picta were provided by S. Graham and G. Sorrell. We would also like to thank J. Loo and P. Floyd for their contributions during trapping efforts. Finally, we thank B. Kreiser, G. Pauly, B. Thomson, P. Spinks, and several anonymous reviewers for their invaluable comments on previous versions of this manuscript.

T.G. Jackson, Jr., D.H. Nelson, and A.B. Morris2012 309

Literature Cited

Avise, J. 1994. Molecular Markers, Natural History, and Evolution. Chapman and Hall, New York, NY. 511 pp.

Avise, J. 2000. Phylogeography: The History and Formation of Species. Harvard Univer-sity Press, Cambridge, MA. 447 pp.

Carr, A.F., Jr., and J.W. Crenshaw, Jr. 1957. A taxonomic reappraisal of the turtle Pseud-emys alabamensis Baur. Bulletin of the Florida State Museum, Biological Science 2:25–42.

Conant, R., and J.T. Collins. 1998. A Field Guide to Reptiles and Amphibians of Eastern and Central North America (3rd Edition). Houghton Miffl in Co., Boston, MA. 616 pp.

Crenshaw, J.W. 1965. Serum protein variation in an interspecies hybrid swarm of turtles of the genus Pseudemys. Evolution 19:1–15.

Dobie, J., and F. Bagley. 1990. Alabama Red-bellied Turtle (Pseudemys alabamensis)recovery plan. US Fish and Wildlife Service, Atlanta, GA.

Ennen, J.R., J.E. Lovich, B.R. Kreiser, W. Selman, and C.P. Qualls. 2010. Genetic and morphological variation between populations of the Pascagoula Map Turtle (Grapte-mys gibbonsi) in the Pearl and Pascagoula Rivers with description of a new species. Chelonian Conservation and Biology 9:98–113.

Ernst, C.H., and J.E. Lovich. 2009. Turtles of the United States and Canada, Second Edi-tion. John Hopkins University Press, Baltimore, MD. 827 pp.

Ernst, C.H., R.W. Barbour, and J.E. Lovich. 1994. Turtles of the United States and Canada. Smithsonian Institution Press, Washington, DC.

Galtier N., B. Nabholz, S. Glémin, and G.D.D. Hurst. 2009. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Molecular Ecology 18:4541–4550.

Hieb, E.E., T.G. Jackson, D.H. Nelson, and A.B. Morris. 2011. Characterization of eight polymorphic loci for the endangered Alabama Red-bellied Turtle (Pseudemys alaba-mensis; Emydidae). Conservation Genetics Resources 4:781–783.

Huelsenbeck, J.P., and F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:754–755.

International Union for the Conservation of Nature (IUCN). 2010. IUCN Red list of threatened species. Version 2010.4. Available online at http://www.iucnredlist.org. Accessed 19 May 2011.

Jackson, D.R. 1995. Systematics of the Pseudemys concinna-fl oridana complex (Testudines: Emydidae): An alternative interpretation. Chelonian Conservation and Biology 1:329–333.

Jackson, T.G. 2009. A phylogenetic appraisal of the endangered Alabama Red-bellied Turtle (Pseudemys alabamensis Baur). M.Sc. Thesis. University of South Alabama, Mobile, AL. 48 pp.

Kemp, B.M., and D.G. Smith. 2005. Use of bleach to eliminate contaminating DNA from the surface of bones and teeth. Forensic Science International 154:53–61.

Kozak, K.H., A. Larson, R.M. Bonett, and L.J. Harmon. 2005. Phylogenetic analysis of ecomorphological divergence, community structure, and diversifi cation rates in dusky salamanders (Plethodontidae: Desmognathus). Evolution 59:2000–2016.

Lamb, T.C., C. Lydeard, R. Walker, and J.W. Gibbons. 1994. Molecular systematics of map turtles (Graptemys): A comparison of mitochondrial restriction site versus se-quence data. Systematic Biology 43:543–559.

Leary, C.J., J.L. Dobie, T.M. Mann, and P.S. Floyd. 2003. Morphological variation in the endangered Alabama Red-bellied Cooter (Pseudemys alabamensis) and taxo-nomic status of a population in Mississippi. Chelonian Conservation and Biology 4:635–641.

Southeastern Naturalist Vol. 11, No. 2310

Lenk, P., U. Joger, U. Fritz, P. Heidrich, and M. Wink. 1998. Phylogeographic patterns in the mitochondrial cytochrome-b gene of the European Pond Turtle, Emys orbicularis(Linnaeus, 1758). In U. Fritz, U. Joger, R. Podloucky, and J. Servan (Eds.). Proceed-ings of the EMYS symposium Dresden 96. Mertensiella 10:159–175.

Lenk, P., and M. Wink. 1997. A RNA/RNA heteroduplex cleavage analysis to detect rare mutations in populations. Molecular Ecology 6:233–237.

Lydeard, C. 1996. Genetic analysis of Pseudemys sp., the undescribed Mississippi Red-belly Turtle. Report to US Fish and Wildlife Service Endangered Species Offi ce, Jackson, MS.

Posada, D., and T.R. Buckley. 2004. Model selection and model averaging in phyloge-netics: Advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53:793–808.

Posada, D., and K.A. Crandall. 1998. Modeltest: Testing the model of DNA substitution. Bioinformatics 14:817–818.

Ronquist, F., and J.P. Huelsenbeck. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574.

Seidel, M.E. 1994. Morphometric analysis and taxonomy of the cooter and red-bellied turtles in the North American genus Pseudemys (Emydidae). Chelonian Conservation and Biology 1:117–130.

Seidel, M.E. 1995. How many species of cooter turtles and where is the scientifi c evi-dence? A reply to Jackson. Chelonian Conservation and Biology 1:333–336.

Seidel, M.E., and C.H. Ernst. 1996. Pseudemys. Catalogue of American amphibians and reptiles 625:1–7.

Seidel, M.E., and W.M. Palmer. 1991. Morphological variation in turtles of the genus Pseudemys (Testidunes: Emydidae) from Central Atlantic drainages. Brimleyana 17:105–135.

Soltis, D.S., A.B. Morris, J.S. McLachlan, P.S. Manos, and P.S. Soltis. 2006. Com-parative phylogeography of unglaciated eastern North America. Molecular Ecology 15:4261–4293.

Spinks, P.Q., and H.B. Shaffer. 2009. Confl icting mitochondrial and nuclear phylogenies for the widely disjunct Emys (Testudines: Emydidae) species complex, and what they tell us about biogeography and hybridization. Systematic Biology 58:1–20.

Spinks, P.Q., R.C. Thomson, G.A. Lovely, and H.B. Shaffer. 2009. Assessing what is needed to resolve a molecular phylogeny: Simulations and empirical data from emy-did turtles. BMC Evolutionary Biology 9:56.

Starkey, D.E., H.B. Shaffer, R.L. Burke, M.R.J. Forstner, J.B. Iverson, F.J. Janzen, A.G.J. Rhodin, and G.R. Ultsch. 2003. Molecular systematics, phylogeography, and the effects of Pleistocene glaciation in the Painted Turtle (Chrysemys picta) complex. Evolution 57:119–128.

Stephens, P.R., and J.J. Wiens. 2003. Ecological diversifi cation and phylogeny of emydid turtles. Biological Journal of the Linnean Society 79:577–610.

Walker, D., W.S. Nelson, K.A. Buhlmann, and J.C. Avise. 1997. Mitochondrial DNA phylogeography and subspecies issues in the monotypic freshwater turtle Ster-notherus odoratus. Copeia 1:16–21.

Wiens, J.J., C.A. Kuczynski, and P.R. Stephens. 2010. Discordant mitochondrial and nuclear gene phylogenies in emydid turtles: Implications for speciation and conserva-tion. Biological Journal of the Linnean Society 99:445–461.


Top Related