Transcript
Page 1: P-glycoprotein drug transporters in the parasitic

Graduate Theses and Dissertations Iowa State University Capstones, Theses and Dissertations

2019

P-glycoprotein drug transporters in the parasitic nematodes P-glycoprotein drug transporters in the parasitic nematodes

Toxocara canis and Parascaris Toxocara canis and Parascaris

Jeba Rose Jennifer Jesudoss Chelladurai Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd

Part of the Parasitology Commons, and the Veterinary Medicine Commons

Recommended Citation Recommended Citation Jesudoss Chelladurai, Jeba Rose Jennifer, "P-glycoprotein drug transporters in the parasitic nematodes Toxocara canis and Parascaris" (2019). Graduate Theses and Dissertations. 17707. https://lib.dr.iastate.edu/etd/17707

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].

Page 2: P-glycoprotein drug transporters in the parasitic

P-glycoprotein drug transporters in the parasitic nematodes Toxocara canis and Parascaris

by

Jeba Rose Jennifer Jesudoss Chelladurai

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Veterinary Pathology (Veterinary Parasitology)

Program of Study Committee:

Matthew T. Brewer, Major Professor

Douglas E. Jones

Richard J. Martin

Jodi D. Smith

Tomislav Jelesijevic

The student author, whose presentation of the scholarship herein was approved by the program

of study committee, is solely responsible for the content of this dissertation. The Graduate

College will ensure this dissertation is globally accessible and will not permit alterations after a

degree is conferred.

Iowa State University

Ames, Iowa

2019

Copyright © Jeba Rose Jennifer Jesudoss Chelladurai, 2019. All rights reserved.

Page 3: P-glycoprotein drug transporters in the parasitic

ii

TABLE OF CONTENTS

Page

LIST OF FIGURES .........................................................................................................................v

LIST OF TABLES ........................................................................................................................ vii

NOMENCLATURE .................................................................................................................... viii

ACKNOWLEDGMENTS ............................................................................................................. ix

ABSTRACT .....................................................................................................................................x

CHAPTER 1. GENERAL INTRODUCTION ................................................................................1 1. Use of macrocyclic lactones against nematodes of veterinary importance ........................... 1

2. A brief note on Ascarids, genome status and P-glycoproteins .............................................. 3 3. Thesis organization ................................................................................................................ 4 4. References ............................................................................................................................. 5

CHAPTER 2. METHODS IN THE STUDY OF P-GLYCOPROTEINS IN NEMATODE

PARASITES OF VETERINARY IMPORTANCE.........................................................................9

Abstract ...................................................................................................................................... 9 1. ATP binding cassette (ABC) superfamily ............................................................................. 9

1.1. Classification of the ABC superfamily ......................................................................... 9

1.2. Roles of subfamilies of ABC transporters ................................................................... 10

2. ABCB1 transporter family ................................................................................................... 13

2.1. P-glycoproteins ............................................................................................................ 13 2.2. Structure of P-glycoprotein ......................................................................................... 13

2.3. Mechanism of drug efflux ........................................................................................... 14 2.4. Substrate binding and prediction ................................................................................. 15 2.5. Substrates and inhibitors of P-gps ............................................................................... 15

2.6. Role of ABCB1 efflux proteins in veterinary species ................................................. 17 2.7. Role of ABCB1 efflux proteins in nematodes............................................................. 18

3. Methods used in the study of nematode P-gps .................................................................... 19

3.1. Gene identification ...................................................................................................... 19 3.2. Gene expression, polymorphism and induction studies .............................................. 20 3.3. Nematode P-gps in heterologous systems ................................................................... 22 3.4. Whole organism pharmacology................................................................................... 24

3.5. Localization studies ..................................................................................................... 26 3.6. In vivo assays ............................................................................................................... 26

4. Conclusions ......................................................................................................................... 26 5. References ........................................................................................................................... 27 Figures and tables .................................................................................................................... 43

Page 4: P-glycoprotein drug transporters in the parasitic

iii

CHAPTER 3. EFFECTS OF IN VITRO AND IN VIVO EXPOSURE TO MACROCYCLIC

LACTONES ON THE EXPRESSION PATTERNS OF P-GLYCOPROTEINS IN

TOXOCARA CANIS LARVAE ......................................................................................................68 Abstract .................................................................................................................................... 68

1. Introduction ......................................................................................................................... 68 2. Methods ............................................................................................................................... 70

2.1 Ethics statement ............................................................................................................ 70 2.2 Parasites ........................................................................................................................ 71 2.3 In vitro motility assays ................................................................................................. 71

2.4 In vitro larval dye efflux assay ..................................................................................... 71 2.5 Genomic survey and Phylogenetic analysis ................................................................. 72 2.6 qPCR in adults Toxocara canis .................................................................................... 73 2.7 qPCR following in vitro drug exposure ....................................................................... 73

2.8 qPCR following in vivo drug exposure in mice ........................................................... 74 3. Results ................................................................................................................................. 75

3.1 In vitro motility assay ................................................................................................... 75 3.2 In vitro efflux of P-gp is inhibited ................................................................................ 75 3.3 Thirteen P-gp genes identified in T .canis genome ...................................................... 75

3.4 Ten P-gp genes are expressed in adults ........................................................................ 76 3.5 In vitro effects of IVM on P-gp expression in larvae ................................................... 76 3.6 In vivo effects of MLs on P-gp expression in somatic larvae ...................................... 77

4. Discussion ............................................................................................................................ 77 5. References ........................................................................................................................... 80

Figures and tables .................................................................................................................... 83 Supplementary data ................................................................................................................. 91

CHAPTER 4. IDENTIFICATION AND FUNCTIONAL CHARACTERIZATION OF

P-GLYCOPROTEIN 11.1 OF TOXOCARA CANIS ......................................................................92 Abstract .................................................................................................................................... 92

1. Introduction ......................................................................................................................... 92 2. Materials and methods ......................................................................................................... 94

2.1. Ethics statement ........................................................................................................... 94 2.2. Molecular and phylogenetic characterization .............................................................. 94 2.3. Bioinformatic analyses ................................................................................................ 95

2.4. Heterologous expression in MDCK cells .................................................................... 96 2.5. Tca-Pgp-11.1 mediated efflux assays ......................................................................... 98 2.6. Chromogenic in situ mRNA hybridization ................................................................. 99 2.7. Statistical analysis ....................................................................................................... 99

3. Results ................................................................................................................................. 99 3.1. Bioinformatic analysis of Tca-Pgp-11.1 ..................................................................... 99 3.2. Expression of Tca-Pgp-11.1 in CRISPR-edited MDCK cells ................................... 100 3.3. Functional transport activity by Tca-Pgp-11.1.......................................................... 101 3.4. Unique pharmacology of Tca-Pgp-11.1 .................................................................... 101

3.5. Tissue specific expression of Tca-Pgp-11................................................................. 102 4. Discussion .......................................................................................................................... 102 5. References ......................................................................................................................... 107

Page 5: P-glycoprotein drug transporters in the parasitic

iv

Figures and tables .................................................................................................................. 111 Supplementary data ............................................................................................................... 122

CHAPTER 5. DETECTION AND QUANTIFICATION OF PARASCARIS

P-GLYCOPROTEIN DRUG TRANSPORTER EXPRESSION WITH A NOVEL MRNA

HYBRIDIZATION TECHNIQUE ..............................................................................................128 Abstract .................................................................................................................................. 128 1. Introduction ....................................................................................................................... 129 2. Materials and methods ....................................................................................................... 131

2.1. Parasites ..................................................................................................................... 131

2.2. Probe targets .............................................................................................................. 132 2.3. Analysis ..................................................................................................................... 133

3. Results ............................................................................................................................... 133

3.1. Multiple nucleic acid hybridization is sensitive and specific for Parascaris P-gp ... 133 3.2. Qualitative analysis of Peq-pgp-11 and Peq-pgp-16 mRNA expressed in

Parascaris ........................................................................................................................ 134

3.3. Quantitative analysis of Peq-pgp-11 and Peq-pgp-16 mRNA expressed in

Parascaris ........................................................................................................................ 136 4. Discussion .......................................................................................................................... 137

5. References ......................................................................................................................... 140 Figures and tables .................................................................................................................. 160 Supplementary data ............................................................................................................... 166

CHAPTER 6. GENERAL CONCLUSIONS ...............................................................................167

Page 6: P-glycoprotein drug transporters in the parasitic

v

LIST OF FIGURES

Page

Figure 2-1. UPGMA phylogenetic tree of ABC superfamily proteins annotated in the

genomes of Toxocara canis and C. elegans. ............................................................ 43

Figure 2-2. Secondary structure of C. elegans Pgp-1 ................................................................... 44

Figure 2-3. Transmembrane view of the X-ray diffraction crystal structure of C. elegans

Pgp-1 ........................................................................................................................ 45

Figure 3-1. WormLab output obtained with Toxocara canis larvae ............................................. 83

Figure 3-2. Representative bright-field overlays and fluorescence images of T. canis larvae

stained with Hoechst 33342 ...................................................................................... 84

Figure 3-3. Area of H33342 staining of T. canis larvae exposed to P-gp inhibitors. ................... 85

Figure 3-4. Maximum Likelihood phylogenetic tree of conceptually translated P-gp genes. ...... 86

Figure 3-5. Mean + SE of expression levels of P-gp genes in adult T. canis worms. .................. 87

Figure 3-6. Mean + SE of induction of P-gp expression following exposure to ivermectin. ....... 88

Figure 3-7. Mean + SE of expression of P-gp genes in somatic T. canis larvae derived from

mice treated with (A) ivermectin or (B) moxidectin. ............................................... 89

Figure 4-1. Bioinformatic analysis of conceptually translated protein sequence of Tca-Pgp-

11.1. ........................................................................................................................ 111

Figure 4-2. Maximum likelihood phylogenetic tree of cloned and predicted T. canis Pgp

genes in comparison with those from other nematodes. ......................................... 113

Figure 4-3. Expression of Tca-Pgp-11.1 in transfected MDCK-ΔMDR cells............................ 114

Figure 4-4. Western blot and dot blot using anti-Tca-Pgp-11 polyclonal antibodies raised in

rabbits ..................................................................................................................... 114

Figure 4-5. Flow cytometry histograms of EffluxID dye transport activity in WT cells, Tca-

Pgp-11 transfected, and KO cells ........................................................................... 115

Figure 4-6.Flow cytometry histograms of Calcein-AM (A) and Rhodamine 123 (C) dye

transport activity in WT cells, Tca-Pgp-11 transfected, and KO cells with no

drugs. ...................................................................................................................... 116

Page 7: P-glycoprotein drug transporters in the parasitic

vi

Figure 4-7. Flow cytometry histograms of Calcein-AM dye transport activity in WT cells,

Tca-Pgp-11 transfected, and KO cells. ................................................................... 117

Figure 4-8. Normalized mean fluorescence obtained with Calcein-AM .................................... 118

Figure 4-9. Mean fluorescence intensity ratios in Tca-Ppg-11 transfected cells co-incubated

with Calcein-AM and inhibitors. ............................................................................ 119

Figure 4-10. Representative images of multiple nucleic acid in situ hybridization in adult

female and male Toxocara canis. ........................................................................... 120

Figure 5-1. Representative images of adult male Parascaris. .................................................... 160

Figure 5-2. Representative images of adult female Parascaris. ................................................. 161

Figure 5-3. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in adult male Parascaris. ....... 162

Figure 5-4. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in adult female Parascaris. .... 163

Figure 5-5. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in different body regions of

adult male Parascaris. ............................................................................................ 164

Figure 5-6. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in different body regions of

adult female Parascaris. ......................................................................................... 165

Page 8: P-glycoprotein drug transporters in the parasitic

vii

LIST OF TABLES

Page

Table 2-1. ABC transporter genes in humans and nematodes, derived from the KEGG

pathways (Kanehisa et al., 2017). ............................................................................. 46

Table 2-2. P-glycoprotein encoding genes in pathogenic nematodes of veterinary

importance ................................................................................................................ 49

Table 2-3. Summary of gene expression and polymorphism studies in parasitic nematodes

of veterinary importance. .......................................................................................... 51

Table 2-4. Drug interaction studies of nematode P-gps in heterologous systems. ....................... 58

Table 2-5. In vitro P-gp-drug interaction assays with whole organisms. ..................................... 60

Table 2-6. Localization studies in nematodes of veterinary importance. ..................................... 65

Table 2-7. In vivo studies of effect on P-gps when MLs are co-administrated with P-gp

inhibitors. .................................................................................................................. 66

Table 3-1. Nomenclature for P-gp protein sequences in Toxocara canis ..................................... 90

Table 4-1. Peptide sequences used as antigens for antibody production in rabbits. ................... 121

Page 9: P-glycoprotein drug transporters in the parasitic

viii

NOMENCLATURE

P-gp P-glycoprotein

ABCB1 ATP binding cassette family B1

MDR1 Multi drug resistance gene 1

MLs Macrocyclic Lactones

TMD Transmembrane Domain

NBD Nucleotide Binding Domain

ATP Adenosine tri-phosphate

GluClR Glutamate gated chloride channel receptor

Page 10: P-glycoprotein drug transporters in the parasitic

ix

ACKNOWLEDGMENTS

I would like to thank my committee chair, Dr. Matthew T. Brewer, and my committee

members, Douglas E. Jones, Jodi D. Smith, Richard J. Martin, and Tomislav Jelesijevic, for their

guidance and support throughout the course of this research. A special thanks to Dr. Brewer,

under whose tutelage as one author put it, “I have changed in taste, improved in theory, and

probably in craft” (J.R.R Tolkien, The Letters of J.R.R. Tolkien) . I would also like to thank

NCVP for funding my residency and PhD training.

I would like to thank my parents for their prayers, encouragement and patience during my

long graduate school journey in the United States. I would also like to acknowledge the

contributions of my church families and family groups, who made my stay in Ames a wonderful

experience. And to those special few who have become my closest friends, I thank my God every

time I remember you, and I hope we will be friends till we leave the shadowlands, sail past the

gray havens and meet in the glorious city!

In addition, I would also like to thank my friends, colleagues, the department faculty and

staff for making my time at Iowa State University memorable.

Page 11: P-glycoprotein drug transporters in the parasitic

x

ABSTRACT

P-glycoproteins (P-gp) are ATP-binding cassette transporters capable of effluxing a wide

range of structurally unrelated compounds from cells. Parasitic nematodes express P-gps that

have the potential to contribute toward anthelmintic resistance via transport of macrocyclic

lactone drugs. This thesis characterizes the expression and function of P-gps from ascarid

nematodes. In canines, somatic larvae in bitches are the source of transplacentally transmitted T.

canis to neonates. Somatic larvae are tolerant to the macrocyclic lactone (ML) class of

anthelmintics. We hypothesized that P-gps may play a role in larval tolerance to MLs. This

dissertation sought to identify P-gp expression in T. canis stages and to characterize the unique

pharmacology and localization of Pgp-11, which has been implicated in resistance in other

nematodes.

13 P-gps were identified in the T. canis genome, of which 10 were found to be expressed

in adults and infective larvae. P-gps expression could not be induced in infective larvae treated

with MLs in vitro, but Pgp-10 was upregulated in somatic larvae treated with moxidectin in vivo.

P-gp mediated efflux in infective larvae could be mitigated by some P-gp inhibitors. T. canis

Pgp-11 was heterologously expressed in a canine cell line expressing no endogenous P-gp and

could not be inhibited by verapamil, cyclosporine A and reserpine. Pgp-11 was expressed in

adult worm intestines but was absent in reproductive tissues.

P-gps have been implicated in ML resistance in the equine nematode Parascaris spp.

Pgp-11 and Pgp-16 have been previously described from Parascaris, but the exact localization of

their expression was unknown. This dissertation sought to semi-quantitatively determine the

localization of Pgp-11 and Pgp-16 mRNA in adult worm tissues using a novel chromogenic in

situ hybridization assay.

Page 12: P-glycoprotein drug transporters in the parasitic

1

CHAPTER 1. GENERAL INTRODUCTION

1. Use of macrocyclic lactones against nematodes of veterinary importance

Nematodes are common parasites of domestic animals and chemotherapeutic

interventions are the mainstay in veterinary medicine to mitigate their effects on animal health.

Resistance to anthelmintics is an emerging problem across all the drug classes licensed for

veterinary use in many domestic species (Gasbarre et al., 2009). It is difficult to quantify the loss

that is caused due to anthelmintic resistance given the variability of a number of factors, which

include (a) parasite population characteristics such as refugia, predominance of dose-limiting

species, (b) host factors such as age, nutrition, immune status, breed-dependent inherent

resistance, (c) production factors such as stocking density and degree of environmental

contamination. It has been suggested that an increase in anthelmintic resistance in nematodes is

due to the indiscriminate overuse of anthelmintics, route of administration, use of slow-release

formulations, failure to establish a refugia population of nematodes susceptible to anthelmintics

and failure to treat during the quarantine period (Sutherland and Leathwick, 2011). Resistance

often involves multigenic loci and mechanisms of resistance in nematodes to different drug

classes have been studied (Whittaker et al., 2017). Several studies use the non-parasitic nematode

Caenorhabditis elegans, which has proved to be a reasonable but not an absolute model to study

anthelmintic resistance (Geary and Thompson, 2001).

Macrocyclic lactones (MLs) constitute a class of endectocide drugs that are effective

against many nematodes and arthropods. MLs approved for veterinary use include ivermectin,

selamectin, doramectin, eprinomectin, moxidectin and milbemycin oxime. They act on glutamate

gated chloride channels (GluCl) in nematodes, insects, crustaceans, and molluscs. The

phenotypic effects of ML action in nematodes observed in vitro include worm death and

Page 13: P-glycoprotein drug transporters in the parasitic

2

impaired motility in adults, motility cessation and death in microfilaria and L3s, and potentiation

of the immune system (Tompkins et al., 2010; Vatta et al., 2014). The phenotypic effects

observed in vivo include alteration of embryonic morphology, degenerative changes to nematode

enterocytes, microfilarial death in utero, abnormalities in the morphology and motility of adult

worms, and adult worm death (Bazzocchi et al., 2008; McCall, 2005; McCall et al., 2008;

Tompkins et al., 2010).

Resistance to MLs have risen in many important nematodes including Dirofilaria immitis

of dogs (Bourguinat et al., 2011a), Haemonchus contortus of sheep (Xu et al., 1998), Parascaris

spp. of equines (Boersema et al., 2002), Cooperia spp. of cattle (Fiel et al., 2001), Onchocerca

volvulus in humans (Churcher et al., 2009) among others. Two main paradigms of resistance

mechanisms have been extensively evaluated to understand the reduction of susceptibility or

increased resistance to the MLs. These are (a) changes in the receptor target of the MLs – the

glutamate gated chloride channels, and (b) efflux proteins that decrease effective drug

concentration at the receptor site of action.

Glutamate gated chloride channels of nematodes are pentameric structures made of two

or three different subunits and has been reviewed in (Lynagh and Lynch, 2012; Wolstenholme

and Rogers, 2005). Sensitivity to ivermectin in nanomolar concentrations is conferred by a

glycine residue (Gly-281, also known as M3-Gly) in the membrane bound helix M3 of the alpha

subunit of GluClR (Hibbs and Gouaux, 2011; Lynagh and Lynch, 2010, 2012). Sensitivity to

moxidectin was not due to the same interactions (Prichard et al., 2012). Changes in GluClR that

were previously thought to confer ivermectin resistance on nematodes included: (a) an amino

acid change (L256F) in the GluCl alpha3 subunit (Njue et al., 2004), (b) an amino acid change in

the M3-Gly residue in the GluClR alpha3B subunit (Lynagh and Lynch, 2010), (c) changes in

Page 14: P-glycoprotein drug transporters in the parasitic

3

the frequency of alleles encoding the alpha subunits (Blackhall et al., 1998b) and (d) changes in

the expression levels of ligand gated chloride channel subunits glc-3, glc-5 (Williamson et al.,

2011). However, these changes were not able to definitively provide an explanation for

resistance in the field isolates.

The second most important mechanism of resistance to the macrocyclic lactones are the

permeability glycoproteins (P-gp), also known as ATP Binding Cassette Family B1 (ABCB1).

They belong to the large family of ATP Binding Cassette transporters and are capable of

effluxing xenobiotic compounds (Lespine et al., 2012; Prichard and Roulet, 2007). Changes in P-

glycoprotein that are thought to confer resistance to MLs include (a) SNPs in P-gp genes

(Bourguinat et al., 2011b; Sangster et al., 1999; Xu et al., 1998) and (b) increased expression of

P-gps in resistant field isolates (Dicker et al., 2011b; Janssen et al., 2013a; Tydén et al., 2014), in

vitro (Raza et al., 2016b) and in experimental in vivo studies (Lloberas et al., 2013).

2. A brief note on Ascarids, genome status and P-glycoproteins

Ascarids are a group of large parasitic nematodes that belong to the Superfamily

Ascaridoidea. Ascarids found in domestic hosts include Toxocara canis that infects canids,

Toxocara cati that infects felids, Toxascaris leonina that infects canids and felids, Toxocara

vitulorum that infects bovids, Parascaris univalens and Parascaris equorum that infect equids,

and Ascaris suum and Ascaris lumbricoides that infect pigs and humans. Adult ascarids are

generally susceptible to label doses of FDA approved macrocyclic lactones, benzimidazoles,

imidathiazoles, tetrahydropyrimidines and cyclic depsipeptides, given at the appropriate time to

the appropriate host species. Multiple reports of macrocyclic lactone resistance in adult

Parascaris spp. has been documented across the world (Boersema et al., 2002; Craig et al., 2007;

Slocombe et al., 2007). A single report of reduced susceptibility to albendazole in Ascaris spp. in

humans also exists (Krücken et al., 2017). While resistance in adult Toxocara canis has not been

Page 15: P-glycoprotein drug transporters in the parasitic

4

reported, somatic larvae which causes visceral larval migrans in humans and non-human hosts

show an apparent tolerance to label doses of approved macrocyclic lactones (Fok and Kassai,

1998). Arrested somatic larvae are an important feature of the lifecycle of T. canis, T. cati and T.

vitulorum, and are a reservoir of infection to progeny by transplacental or transmammary routes

in the definitive hosts. Mechanisms of tolerance to the MLs in T. canis somatic larvae may be

similar to mechanisms of resistance in other nematodes.

The genes encoding P-glycoproteins and their function in ML efflux have been studied in

Parascaris spp. (Janssen et al., 2013a). But very little is known about P-glycoproteins in

Toxocara canis and Ascaris spp. The availability of draft genomes of these organisms will

facilitate the study of P-gp genes. One draft genome each of Ascaris lumbricoides, Parascaris

equorum and P. univalens have been assembled (Consortium, 2019; Wang et al., 2017). Two

draft genomes each of Ascaris suum and Toxocara canis have also been made available

(Consortium, 2019; Jex et al., 2011; Wang et al., 2012b; Zhu et al., 2015). While draft genomes

that are available as fragments and/or scaffolds are valuable resources for research, they do not

provide a chromosome level resolution of the genome. Additionally, since ab initio gene

prediction models are often used for gene prediction and annotation, single genes are often

fragmented and genome quality may later be improved by empirical transcription data such as

ESTs, RNA-seq and ChIP-seq (Wang et al., 2017).

3. Thesis organization

This thesis investigates P-glycoproteins in the ascarid nematodes Toxocara canis and

Parascaris spp. Chapter 2 reviews the ATP binding cassette superfamily in general followed by

a detailed summary of the methods of study of P-glycoproteins in nematodes. Chapter 3

examines the P-gp repertoire of T. canis expressed in adults and larval stages. Chapter 4

describes the unique pharmacology of T. canis Pgp-11. Chapter 5 shows the localization of two

Page 16: P-glycoprotein drug transporters in the parasitic

5

P-gps in Parascaris adults. The final chapter summarizes the knowledge gap filled by this work

and identifies future work that must be pursued in this field.

4. References

Bazzocchi, C., Mortarino, M., Grandi, G., Kramer, L.H., Genchi, C., Bandi, C., Genchi, M.,

Sacchi, L., McCall, J.W., 2008. Combined ivermectin and doxycycline treatment has

microfilaricidal and adulticidal activity against Dirofilaria immitis in experimentally

infected dogs. Int J Parasitol 38, 1401-1410.

Blackhall, W.J., Pouliot, J.F., Prichard, R.K., Beech, R.N., 1998. Haemonchus contortus:

selection at a glutamate-gated chloride channel gene in ivermectin- and moxidectin-

selected strains. Exp Parasitol 90, 42-48.

Boersema, J.H., Eysker, M., Nas, J.W., 2002. Apparent resistance of Parascaris equorum to

macrocylic lactones. Vet Rec 150, 279-281.

Bourguinat, C., Keller, K., Bhan, A., Peregrine, A., Geary, T., Prichard, R., 2011a. Macrocyclic

lactone resistance in Dirofilaria immitis. Vet Parasitol 181, 388-392.

Bourguinat, C., Keller, K., Blagburn, B., Schenker, R., Geary, T.G., Prichard, R.K., 2011b.

Correlation between loss of efficacy of macrocyclic lactone heartworm anthelmintics and

P-glycoprotein genotype. Vet Parasitol 176, 374-381.

Churcher, T.S., Pion, S.D., Osei-Atweneboana, M.Y., Prichard, R.K., Awadzi, K., Boussinesq,

M., Collins, R.C., Whitworth, J.A., Basáñez, M.G., 2009. Identifying sub-optimal

responses to ivermectin in the treatment of River Blindness. Proc Natl Acad Sci U S A

106, 16716-16721.

Consortium, I.H.G., 2019. Comparative genomics of the major parasitic worms. Nat Genet 51,

163-174.

Craig, T.M., Diamond, P.L., Ferwerda, N.S., Thompson, J.A., 2007. Evidence of ivermectin

resistance by Parascaris equorum on a Texas horse farm. Journal of Equine Veterinary

Science 27, 67-71.

Dicker, A.J., Nisbet, A.J., Skuce, P.J., 2011. Gene expression changes in a P-glycoprotein (Tci-

pgp-9) putatively associated with ivermectin resistance in Teladorsagia circumcincta. Int

J Parasitol 41, 935-942.

Fiel, C.A., Saumell, C.A., Steffan, P.E., Rodriguez, E.M., 2001. Resistance of Cooperia to

ivermectin treatments in grazing cattle of the Humid Pampa, Argentina. Vet Parasitol 97,

211-217.

Fok, E., Kassai, T., 1998. Toxocara canis infection in the paratenic host: a study on the

chemosusceptibility of the somatic larvae in mice. Vet Parasitol 74, 243-259.

Gasbarre, L.C., Smith, L.L., Lichtenfels, J.R., Pilitt, P.A., 2009. The identification of cattle

nematode parasites resistant to multiple classes of anthelmintics in a commercial cattle

population in the US. Vet Parasitol 166, 281-285.

Page 17: P-glycoprotein drug transporters in the parasitic

6

Geary, T.G., Thompson, D.P., 2001. Caenorhabditis elegans: how good a model for veterinary

parasites? Vet Parasitol 101, 371-386.

Hibbs, R.E., Gouaux, E., 2011. Principles of activation and permeation in an anion-selective

Cys-loop receptor. Nature 474, 54-60.

Janssen, I.J., Krücken, J., Demeler, J., Basiaga, M., Kornaś, S., von Samson-Himmelstjerna, G.,

2013. Genetic variants and increased expression of Parascaris equorum P-glycoprotein-11

in populations with decreased ivermectin susceptibility. PLoS One 8, e61635.

Jex, A.R., Liu, S., Li, B., Young, N.D., Hall, R.S., Li, Y., Yang, L., Zeng, N., Xu, X., Xiong, Z.,

Chen, F., Wu, X., Zhang, G., Fang, X., Kang, Y., Anderson, G.A., Harris, T.W.,

Campbell, B.E., Vlaminck, J., Wang, T., Cantacessi, C., Schwarz, E.M., Ranganathan, S.,

Geldhof, P., Nejsum, P., Sternberg, P.W., Yang, H., Wang, J., Gasser, R.B., 2011.

Ascaris suum draft genome. Nature 479, 529-533.

Krücken, J., Fraundorfer, K., Mugisha, J.C., Ramünke, S., Sifft, K.C., Geus, D., Habarugira, F.,

Ndoli, J., Sendegeya, A., Mukampunga, C., Bayingana, C., Aebischer, T., Demeler, J.,

Gahutu, J.B., Mockenhaupt, F.P., von Samson-Himmelstjerna, G., 2017. Reduced

efficacy of albendazole against Ascaris lumbricoides in Rwandan schoolchildren. Int J

Parasitol Drugs Drug Resist 7, 262-271.

Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other

multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for

reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist

2, 58-75.

Lloberas, M., Alvarez, L., Entrocasso, C., Virkel, G., Ballent, M., Mate, L., Lanusse, C.,

Lifschitz, A., 2013. Comparative tissue pharmacokinetics and efficacy of moxidectin,

abamectin and ivermectin in lambs infected with resistant nematodes: Impact of drug

treatments on parasite P-glycoprotein expression. Int J Parasitol Drugs Drug Resist 3, 20-

27.

Lynagh, T., Lynch, J.W., 2010. A glycine residue essential for high ivermectin sensitivity in

Cys-loop ion channel receptors. Int J Parasitol 40, 1477-1481.

Lynagh, T., Lynch, J.W., 2012. Ivermectin binding sites in human and invertebrate Cys-loop

receptors. Trends Pharmacol Sci 33, 432-441.

McCall, J.W., 2005. The safety-net story about macrocyclic lactone heartworm preventives: a

review, an update, and recommendations. Vet Parasitol 133, 197-206.

McCall, J.W., Genchi, C., Kramer, L., Guerrero, J., Dzimianski, M.T., Supakorndej, P.,

Mansour, A.M., McCall, S.D., Supakorndej, N., Grandi, G., Carson, B., 2008.

Heartworm and Wolbachia: therapeutic implications. Vet Parasitol 158, 204-214.

Njue, A.I., Hayashi, J., Kinne, L., Feng, X.P., Prichard, R.K., 2004. Mutations in the

extracellular domains of glutamate-gated chloride channel alpha3 and beta subunits from

ivermectin-resistant Cooperia oncophora affect agonist sensitivity. J Neurochem 89,

1137-1147.

Page 18: P-glycoprotein drug transporters in the parasitic

7

Prichard, R., Ménez, C., Lespine, A., 2012. Moxidectin and the avermectins: Consanguinity but

not identity. Int J Parasitol Drugs Drug Resist 2, 134-153.

Prichard, R.K., Roulet, A., 2007. ABC transporters and beta-tubulin in macrocyclic lactone

resistance: prospects for marker development. Parasitology 134, 1123-1132.

Raza, A., Kopp, S.R., Bagnall, N.H., Jabbar, A., Kotze, A.C., 2016. Effects of in vitro exposure

to ivermectin and levamisole on the expression patterns of ABC transporters in

Haemonchus contortus larvae. Int J Parasitol Drugs Drug Resist 6, 103-115.

Sangster, N.C., Bannan, S.C., Weiss, A.S., Nulf, S.C., Klein, R.D., Geary, T.G., 1999.

Haemonchus contortus: sequence heterogeneity of internucleotide binding domains from

P-glycoproteins. Exp Parasitol 91, 250-257.

Slocombe, J.O., de Gannes, R.V., Lake, M.C., 2007. Macrocyclic lactone-resistant Parascaris

equorum on stud farms in Canada and effectiveness of fenbendazole and pyrantel

pamoate. Vet Parasitol 145, 371-376.

Sutherland, I.A., Leathwick, D.M., 2011. Anthelmintic resistance in nematode parasites of cattle:

a global issue? Trends Parasitol 27, 176-181.

Tompkins, J.B., Stitt, L.E., Ardelli, B.F., 2010. Brugia malayi: in vitro effects of ivermectin and

moxidectin on adults and microfilariae. Exp Parasitol 124, 394-402.

Tydén, E., Skarin, M., Höglund, J., 2014. Gene expression of ABC transporters in Cooperia

oncophora after field and laboratory selection with macrocyclic lactones. Mol Biochem

Parasitol 198, 66-70.

Vatta, A.F., Dzimianski, M., Storey, B.E., Camus, M.S., Moorhead, A.R., Kaplan, R.M.,

Wolstenholme, A.J., 2014. Ivermectin-dependent attachment of neutrophils and

peripheral blood mononuclear cells to Dirofilaria immitis microfilariae in vitro. Vet

Parasitol 206, 38-42.

Wang, J., Gao, S., Mostovoy, Y., Kang, Y., Zagoskin, M., Sun, Y., Zhang, B., White, L.K.,

Easton, A., Nutman, T.B., Kwok, P.Y., Hu, S., Nielsen, M.K., Davis, R.E., 2017.

Comparative genome analysis of programmed DNA elimination in nematodes. Genome

Res 27, 2001-2014.

Wang, J., Mitreva, M., Berriman, M., Thorne, A., Magrini, V., Koutsovoulos, G., Kumar, S.,

Blaxter, M.L., Davis, R.E., 2012. Silencing of germline-expressed genes by DNA

elimination in somatic cells. Dev Cell 23, 1072-1080.

Whittaker, J.H., Carlson, S.A., Jones, D.E., Brewer, M.T., 2017. Molecular mechanisms for

anthelmintic resistance in strongyle nematode parasites of veterinary importance. J Vet

Pharmacol Ther 40, 105-115.

Williamson, S.M., Storey, B., Howell, S., Harper, K.M., Kaplan, R.M., Wolstenholme, A.J.,

2011. Candidate anthelmintic resistance-associated gene expression and sequence

polymorphisms in a triple-resistant field isolate of Haemonchus contortus. Mol Biochem

Parasitol 180, 99-105.

Page 19: P-glycoprotein drug transporters in the parasitic

8

Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the mode of

action of the avermectin/milbemycin anthelmintics. Parasitology 131 Suppl, S85-95.

Xu, M., Molento, M., Blackhall, W., Ribeiro, P., Beech, R., Prichard, R., 1998. Ivermectin

resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol

Biochem Parasitol 91, 327-335.

Zhu, X.Q., Korhonen, P.K., Cai, H., Young, N.D., Nejsum, P., von Samson-Himmelstjerna, G.,

Boag, P.R., Tan, P., Li, Q., Min, J., Yang, Y., Wang, X., Fang, X., Hall, R.S., Hofmann,

A., Sternberg, P.W., Jex, A.R., Gasser, R.B., 2015. Genetic blueprint of the zoonotic

pathogen Toxocara canis. Nat Commun 6, 6145.

Page 20: P-glycoprotein drug transporters in the parasitic

9

CHAPTER 2. METHODS IN THE STUDY OF P-GLYCOPROTEINS IN NEMATODE

PARASITES OF VETERINARY IMPORTANCE

Jeba R. J. Jesudoss Chelladurai, Matthew T. Brewer

A review paper to be submitted

Abstract

Macrocyclic lactones (ML) are commonly used endectocides in veterinary medicine. But,

resistance to the MLs is an emerging threat to their use. P-glycoproteins and other multidrug

resistance transporters belonging to the ATP binding cassette (ABC) superfamily have been

associated with ML resistance in many nematodes. Little is known about the repertoire and

function of ABC superfamily members in nematodes. This review summarizes the available

knowledge of ABC subfamilies studied in nematodes, followed by an overview of the methods

used in the study and pharmacological characterization of the efflux proteins of the ABCB1

family in nematodes. The review also discusses the role of P-glycoproteins in nematodes and

animals of veterinary importance.

1. ATP binding cassette (ABC) superfamily

Members of the ATP binding cassette superfamily are membrane proteins, characterized

by an ATPase domain that hydrolyses ATP and an integral membrane domain that lies in the

membrane. They are involved in multiple cellular functions such as the import of nutrients in

prokaryotes, export of molecules in both eukaryotes and prokaryotes, in DNA repair, in

translation and gene regulation processes (Dassa and Bouige, 2001).

1.1. Classification of the ABC superfamily

Proteins in the ABC superfamily can be broadly classified into 3 classes based on

molecular structure: (a) Class 1 in which ATPase and membrane domains are fused and present

as one long polypeptide, (b) Class 2 in which there are no membrane domains but the ATPase

Page 21: P-glycoprotein drug transporters in the parasitic

10

domain is tandemly repeated and (c) Class 3 in which the ATPase and membrane domains may

or may not be on different polypeptides (Davidson et al., 2008). Eukaryotes including mammals

and nematode parasites possess several ABC proteins listed in Table 2-1. The functions of these

proteins have been studied in humans but are incompletely understood in nematodes. Their

presence in model non-pathogenic nematodes and a few pathogenic zoonotic nematodes have

been predicted by orthology of genes annotated with KEGG Orthology (KO) identifiers.

1.2. Roles of subfamilies of ABC transporters

Relatively little is known about ABC proteins other than ABCB1 transporters in parasitic

nematodes. But they have been reasonably researched in humans and C. elegans allowing for

broad inferences of putative functional roles of gene orthologues in parasitic nematodes. In the

following descriptions, a special emphasis has been laid on the ascarid nematode of dogs,

Toxocara canis, in order to provide context for the study of ABCB1 genes of the nematode

discussed in Chapters 3 and 4. A phylogenetic tree has been constructed to illustrate relationships

of ABC proteins of Toxocara canis and C. elegans (Figure 2-1).

ABCA proteins are large proteins generally involved in lipid transport and theorized to be

involved in drug sequestration in human carcinomas (Albrecht and Viturro, 2007). ABCA

orthologues exist in the model nematode Caenorhabditis elegans, C. briggsae and C. remanei

(Sheps et al., 2004). These include the genes Abt-1, Abt-2, , Abt-3, Abt-4, Abt-5 and Ced-7 (Zhao

et al., 2007). Ced-7 is known to engulf cell corpses during programmed cell death in

embryogenesis in C. elegans (Wu and Horvitz, 1998). Among pathogenic nematodes, Toxocara

canis encodes a ced-7, whose function has not been experimentally studied.

ABCB proteins in nematodes and animals have been extensively studied in the context of

anthelmintic resistance and drug detoxification. These include the full transporter genes known

as pgp or mdr and half transporter genes known as hafs (Zhao et al., 2007). Cel-Pgp-3 has been

Page 22: P-glycoprotein drug transporters in the parasitic

11

shown to protect C. elegans against naturally produced toxins such as colchicine and chloroquine

(Broeks et al., 1995). Phylogenetic analysis of vertebrate and nematode P-gp orthologues reveal

a significant divergence of nematode P-gps from mammalian and avian P-gps. In parasitic

nematodes, several homologs of C. elegans P-gps exist. However, a few novel P-gps with no

known C. elegans homologs have also been described. Nematode P-gps sequences share 35 –

64% identity with mammalian P-gps (Kerboeuf and Guégnard, 2011; Sangster et al., 1999).

Other ABCB genes in nematodes include ABCB6/hmt-1 which is involved in cadmium and

copper detoxification in C. elegans (Schwartz et al., 2010). There is a knowledge gap in the

identification and characterization of ABCB transporters in T. canis.

ABCC protein encoding genes in Caenorhabditis spp. includes at least 8 “MDR-related

protein” genes that are known as Mrp1 to Mrp8 (Zhao et al., 2007). Mrp-1 in C. elegans

regulates the diapause state known as dauer (Yabe et al., 2005) and may be involved in resistance

to heavy metals (Broeks et al., 1996). Cel-mrp-5 is involved in heme and vitamin B12 transport

during embryogenesis (Korolnek et al., 2014; Na et al., 2018). Cel-Mrp-7 inhibits toxicity

associated with methyl mercury (VanDuyn and Nass, 2014). The function of mrp genes in other

nematodes is yet unknown.

ABCD protein encoding genes in C. elegans include several “Peroxisomal Membrane

Protein” genes that are known as pmp-1 to pmp-5 (Zhao et al., 2007). Cel-pmp-1, Cel-pmp-2 and

Cel-pmp-4 are involved in transport of very long chain fatty acids to peroxisomes, and are

implicated in nematode development (Morita and Imanaka, 2012). Orthologs of pmp genes are

encoded in the pathogenic nematode, T. canis, but their functions have not been experimentally

studied.

Page 23: P-glycoprotein drug transporters in the parasitic

12

The single ABCE protein encoding gene in C. elegans is known as abce-1 (Yan et al.,

2012a; Zhao et al., 2007). Cel-abce-1 is involved in transcriptional and translational control, in

protein transport between the nucleus and cytoplasm, and appears to be involved in molting

(Zhao et al., 2004). SNPs in a ABCE1 gene were found to be IVM resistance associated (Luo et

al., 2017). In the pathogenic nematode T. canis, an ortholog of abce-1 is encoded in the genome,

but its function is unknown.

ABCF protein encoding genes in C. elegans include at least 4 members named abcf-1 to

abcf-4 (Zhao et al., 2007). Abcf-3 in C. elegans appears to be involved in apoptosis regulation

(Hirose and Horvitz, 2014). In the pathogenic nematode T. canis, orthologs of ABCF genes are

encoded in the genome, but their functions have not been empirically tested.

ABCG/BCRP protein is represented by the wht-6 gene in C. elegans, which is involved in

the mitochondrial uptake of the Vitamin B12 (cobalamin) (McDonald et al., 2017). Orthologs of

ABCG are encoded in the genome of T. canis but their functions have not been identified.

ABCH protein is encoded by a single gene in the C. elegans genome. There is no

ortholog in the T. canis genome.

A number of other ATP binding cassette domain containing proteins have been assigned

to the ABC superfamily that do not have significant similarity or identity with the classical ABC

transporters described above. These include the structural maintenance of chromosomes (SMC)

proteins that are involved in chromatin organization, DNA damage sensor proteins such as rfc-2,

double stranded break (DSB) repair proteins and DNA mismatch repair protein (MutS) involved

in mismatch repair (Dassa, 2011; Stergiou and Hengartner, 2004). These also include proteins

involved in (a) cytokinesis such as kinesin-like protein, spindle apparatus protein lin-5, (b)

molting such as mlt-10 related, (c) developmental cellular migration, (d) neurotransmitter release

Page 24: P-glycoprotein drug transporters in the parasitic

13

such as nsf-1 etc. (Ali and Siddiqui, 2000; Barclay et al., 2012; Meli et al., 2010; Srinivasan et

al., 2003; Stringham et al., 2002). There are orthologs of ABC ATPase genes in the Toxocara

canis genome.

2. ABCB1 transporter family

2.1. P-glycoproteins

Members of the ABCB1 family are also known as permeability glycoprotein (P-gp) and

multiple drug resistance 1 (mdr1) protein, and the terms are used interchangeably. Orthologous

genes are named mdr1 in humans and mice, and pgp with a number designation in nematodes.

Rarely, abcb1 is also used to refer to the protein. The first known member of this family was

described as a 170kDa cell surface glycoprotein in Chinese hamster ovary cell line that was

resistant to colchicine (Juliano and Ling, 1976). Since then, multiple studies have shown that P-

glycoproteins have detoxification roles in mammals and are involved in multiple drug resistance

in several neoplasia.

2.2. Structure of P-glycoprotein

P-glycoproteins are translated into a single polypeptide from mRNA transcripts. The

crystal structure of P-glycoprotein has been elucidated for human mdr1 (Kim and Chen, 2018),

mouse mdr1a (Aller et al., 2009), and C. elegans pgp-1 (Jin et al., 2012) using crystallography

techniques, and were found to be structurally similar. P-gps have a pseudo two-fold symmetry

with two transmembrane (TM) domains and two nucleotide binding domains (NBD), made of

helices, bridges and beta strands. The two halves of the protein are connected by a flexible linker

allowing flexibility in the conformation of the protein during the transport cycle (Ward et al.,

2013). Each NBD is composed of Walker A, Walker B and C motifs, with the latter being the

distinguishing feature that differentiates ABCB1 transporters from other proteins that bind ATP

(Silva et al., 2015). The secondary structure of C. elegans Pgp-1 is illustrated in Figure 2-2 and

Page 25: P-glycoprotein drug transporters in the parasitic

14

the transmembrane view of the ribbon model of the crystal structure in the inward facing

conformation obtained by X ray diffraction at 3.4Å in Figure 2-3. Crystal structures of P-gps

from pathogenic nematodes of veterinary or human importance are not available yet.

2.3. Mechanism of drug efflux

P-gp molecules have a substrate binding pocket that involves most of the transmembrane

helices (Ward et al., 2013). In the inward facing conformation, the most likely active state, two

portals allow molecules access to the substrate binding pocket. These allow access from the

cytoplasm and inner leaflet of the cell membrane but preclude access from the extracellular space

or the outer leaflet. There are two leading models to explain efflux action – the pump or vacuum

cleaner model and the flippase model.

In the vacuum cleaner model, P-gp substrate molecules partition and aggregate near the

lipid headgroups of the inner layer of the cell membrane bilayer where they enter the substrate

binding pocket of P-gp and are effluxed into the extracellular space. In this model, some drugs

that enter the bilipid membrane may be effluxed out before gaining entry into the cytosol.

Evidence for this model is provided by transport studies with fluorescent molecules such as

Hoechst 33342 (Shapiro and Ling, 1997; Sharom, 2014).

In the flippase model, P-gp substrate molecules aggregate near phospholipid acyl cores of

the inner leaflet and by interaction with the drug binding pocket are translocated to the outer

leaflet of the membrane from where they passively diffuse into extracellular space. Evidence for

this model is provided by the efflux of phospholipid and glycosphingolipids (Eckford and

Sharom, 2005; Romsicki and Sharom, 2001; Sharom, 2014).

The two models are not mutually exclusive and experimental studies to accurately

ascertain the mechanism is constrained by available technologies (Sharom, 2014).

Conformational change from the inward facing confirmation to the outward facing conformation

Page 26: P-glycoprotein drug transporters in the parasitic

15

occurs when a substrate is bound to the substrate binding pocket. ATP binding causes

dimerization of the NBD. ATP hydrolysis causes disruption of the NBD dimers, causing a

reversal back to the inward facing conformation. ATP binding is seen only in the inward binding

state, but not in the outward state (Aller et al., 2009).

2.4. Substrate binding and prediction

There is a marked “substrate promiscuity” by which structurally diverse compounds can

be effluxed by P-gps. There is a large amount of flexibility in the transmembrane domains

manifested by helical kinking and/or unwinding of the helices allowing for the binding of diverse

substrates (Wen et al., 2013). Many of the compounds effluxed are hydrophobic and amphipathic

with variable molecular weights, chemical sidechains, linkages and topologies. In computer-

based molecular dynamics studies, distinct binding sites are not observed but rather a “binding

belt” of amino acids that interact with drugs (Jagodinsky and Akgun, 2015). Thus, the versatility

displayed by the amino acid residues in the drug binding pocket of the protein in addition to

diversity in the substrates are the biggest challenge to substrate binding prediction by in silico

methods. Despite the challenges, docking studies have shown the P-gps from pathogenic

nematodes such as Haemonchus contortus can be modelled using in silico algorithms on the

experimentally obtained crystal structure of C. elegans Pgp-1 (David et al., 2018). These can be

improved as higher resolution crystal structures of nematode P-gps are made available in the

future.

2.5. Substrates and inhibitors of P-gps

P-gps efflux a range of chemically diverse compounds, that may be hydrophobic or

amphipathic. Several fluorescent substrates of P-gps such as Rhodamine 123, Hoechst 33342,

Calcein-AM are known (Lebedeva et al., 2011) and are frequently used in research studies. P-gp

substrates approved as drugs for human and animal use have been reviewed and include

Page 27: P-glycoprotein drug transporters in the parasitic

16

antibacterials like erythromycin, antifungals like ketaconazole, cardiac drugs such as diltiazem,

opioids such as loperamide among others (Mealey and Fidel, 2015). Anthelmintics such as

macrocyclic lactones and monepantel are effluxed by P-gps and compete with rhodamine 123 for

efflux (Raza et al., 2016a). Eprinomectin, abamectin, doramectin, selamectin were capable of

causing an accumulation of Rhodamine 123 by competing for P-gp binding. Moxidectin, a

milbemycin, showed lower potency than the others (Lespine et al., 2007).

P-gp inhibitors are used frequently used to cause a reversal of resistant to susceptible

phenotype in human neoplasia (Nanayakkara et al., 2018). These act on the protein in one of

three different ways, viz. (a) blocking transport of another compound by direct interaction and

competitive or non-competetive antagonism at the active site; (b) inhibiting ATP hydrolysis, or

(c) altering drug interactions with the cellular membrane (Stouch and Gudmundsson, 2002).

There are three generations of P-gp inhibitors: (a) first generation inhibitors had low P-gp

specificity and were agonists of other receptors. These include verapamil, cyclosporine A,

caffeine, (b) second generation inhibitors had higher specificity and fewer side effects. These

include valspodar, dexverapamil and dexniguldipine, (c) third generation inhibitors have high

specificity and efficacy. These include zosuquidar, elacridar, tariquidar, and (d) fourth generation

inhibitors having the highest efficacy. These include peptidomimetics and dual activity ligands

like flavonoids, quercetin (Palmeira et al., 2012).

ATPase activity is also altered by the P-gp modulators, with the drugs being classified

into three classes: (a) Class I drugs like verapamil inhibit ATPase activity at high concentrations,

but enhance activity at low concentrations, (b) Class II drugs like valinomycin have no inhibitory

action but act in a dose dependent manner to enhance ATPase function, (c) Class III drugs like

Cyclosporine A inhibit basal and stimulated ATPase activity (Ambudkar et al., 1999).

Page 28: P-glycoprotein drug transporters in the parasitic

17

Several of these inhibitors have been used to inhibit P-glycoproteins in nematodes in

vitro and in vivo. However, nematode specific P-gp inhibitors have not been discovered and are

the holy grail of nematode research in order to overcome anthelmintic resistance.

2.6. Role of ABCB1 efflux proteins in veterinary species

In clinical veterinary medicine, there is evidence that P-gps in host animals interact with

multiple classes of drugs and alter pharmacokinetics and bioavailability in different tissues

(Virkel et al., 2019). They are briefly reviewed here.

In dogs, basal levels of tissue expression of the sole P-gp protein - mdr1 and MDR-

related proteins (mrp-1 and -2) have been studied (Conrad et al., 2001). P-gp in dogs is expressed

in enterocytes, endothelia of brain capillaries, canalicular cells of the liver, proximal tubular cells

of the kidneys, testes and placenta (Dowling, 2006). The most important clinical application of

studying the canine MDR1 gene has been the identification of breed related distribution and

elimination of oncotherapeutic drugs, macrocyclic lactones and several other drugs (Mealey,

2013). A 4-basepair deletion resulting in a mutated Can-mdr-1 gene conferring increased

ivermectin sensitivity in collies and herding breeds has been well characterized (Mealey et al.,

2001).

In adult cats, tissue distribution of P-gps at basal levels have been studied by

immunohistochemistry and found to similar to dogs (Van Der Heyden et al., 2009). Distribution

and function in neonatal or geriatric cats is unknown (Merola and Eubig, 2012). A premature

stop codon in the feline mdr-1 gene conferring a phenotype similar to the collie when exposed to

P-gp substrates has also been identified (Mealey and Burke, 2015).

In bovines, MDR1 is expressed in the rumen wall (Haslam and Simmons, 2014). It is also

expressed in mammary epithelial cells, and may be upregulated by mdr1 substrates (Yagdiran et

al., 2016).

Page 29: P-glycoprotein drug transporters in the parasitic

18

In swine, abcb1 gene function and pharmacology have been recently studied. Co-

administration of verapamil was found to increase the intestinal absorption of enrofloxacin (Guo

et al., 2016). There was also a decrease in abcb1 gene expression when fenbendazole or flunixin

meglumine were administered to certain breeds of commercial swine (Howard et al., 2015).

In horses, the P-gp gene is expressed in the intestines, liver and kidney. It is about 100

amino acids longer than P-gps of dogs, humans, rhesus macaques, sheep, mice and rats (Tydén

et al., 2009).

2.7. Role of ABCB1 efflux proteins in nematodes

P-glycoproteins in the nematodes C. elegans and Haemonchus contortus were first

discovered by Sangster et al. (Sangster, 1994). The role of nematode P-glycoproteins in (a) the

physiological maintenance of homeostasis and (b) their role in anthelmintic resistance have long

been debated (Sangster, 1994).

C. elegans has been used as a model to study P-gp pharmacology. C. elegans is a

rhabditid non-parasitic nematode and phylogenetically is a Clade IV nematode (Blaxter et al.,

1998). The suitability of C. elegans as a model for parasitic nematodes of distant clades such as

the Clade III ascarids (Ascaris, Parascaris, Toxocara) and spirurids (Dirofilaria, Brugia,

Onchocerca) and Clade I (Trichuris) has been questioned (Beech et al., 2011). However, this

might not be true for P-gps as an in silico analysis revealed a close relationship between various

P-gps genes from C. elegans, C. brenneri, C. briggsae, C. remanei and the parasitic nematodes

Ascaris spp., Brugia spp., Cooperia spp., Haemonchus spp., Loa spp., Onchocerca spp.,

Parascaris spp., Strongyloides spp., Trichuris spp. and Wuchereria sp.(Figueiredo et al., 2018).

A physiological role for P-gps in nematodes can be argued for, on the evidence of basal

levels of P-gp mRNA expression even in the absence of drugs (Figueiredo et al., 2018; Raza et

al., 2016a). Additionally, there is evidence that p-glycoproteins significantly contribute to

Page 30: P-glycoprotein drug transporters in the parasitic

19

molecular defenses against natural toxins in C. elegans (Lindblom and Dodd, 2006). However,

physiological roles of p-gps in parasitic nematodes have not been empirically demonstrated yet.

P-glycoproteins have been strongly associated with macrocyclic lactone resistance in

several parasitic nematodes (Janssen et al., 2015; Xu et al., 1998). In C. elegans, there are 14

functional P-gps and 1 pseudogene. Deletion/loss of function strains in which any one of the 14

functional P-gps had been altered showed a greater susceptibility to ivermectin, with pgp-11 and

pgp-14 being particularly important (Janssen et al., 2013b).

In the past, P-gps were also associated with benzimidazole resistance (Beugnet et al.,

1997; Lespine et al., 2012) but subsequent research has shown that benzimidazoles do not

significantly modulate P-gp activity (Kerboeuf and Guégnard, 2011; Kwa et al., 1998).

Several molecular techniques and model systems have been used to study nematode P-

glycoproteins. These are reviewed in detail below. These can be broadly classified into (a)

nematode P-gp gene identification studies by in silico mining of genomes, (b) gene expression,

polymorphism and induction studies (c) pharmacological studies in heterologous systems (d)

pharmacological studies in whole organisms (e) localization studies and (f) studies to alter

parasite p-gp pharmacology in vivo.

3. Methods used in the study of nematode P-gps

3.1. Gene identification

In general, nematodes possess more than one ABCB1/P-glycoprotein gene when

compared to mammals of veterinary interest which typically possess one gene with one or more

isoforms. The model nematode C. elegans has 14 functional genes and 1 pseudogene (Janssen et

al., 2013b). Isoforms are known to exist in some nematode P-gp genes, such as pgp-9 of

Haemonchus contortus which has three isoforms - Hco-pgp-9.1, Hco-pgp-9.2 and Hco-pgp-9.3

Page 31: P-glycoprotein drug transporters in the parasitic

20

(Issouf et al., 2014). P-gp genes that have been described in nematodes of veterinary and human

importance are listed in Table 2-2.

Several of these genes were described in the context of known clinical anthelmintic

resistance while others were identified by genomic analysis. Table 2-2 is not comprehensive list

as more genes are expected to be described as genome qualities of whole genomes improve and

as annotations are validated by cloning approaches, RNA-seq, gene silencing studies and

proteomics for each nematode genome separately (Palevich et al., 2018). Alternatively, accurate

chromosomal mapping and annotation of genes may result in a reduction in the number of total

genes. In a recent study, transcripts analyzed in the past as Hco-pgp-1 and Hco-pgp-11 were

revealed to be products of a single gene, as were the transcript of Hco-pgp-12 and Hco-pgp-14,

which matched Hco-pgp-13 (Maté et al., 2018).

Accurate gene naming is important for systematic comparison as inventories of genes that

do not follow gene naming conventions leads to confusion (Ardelli et al., 2010). However,

accurate identification of nematode genes are compounded by the fact that (a) only draft

genomes exist for several parasitic nematodes (Consortium, 2019) and (b) P-gp mRNAs have

multiple transcription start sites (Ince and Scotto, 1995) and different transcripts may map

differently to genomic sequences leading to inaccuracies in the annotation of draft genomes.

3.2. Gene expression, polymorphism and induction studies

P-glycoprotein genes have become increasingly associated with clinical resistance of

nematodes to macrocyclic lactones in companion and food animals. The extremely complex

nature of the transcriptional regulation mechanisms that govern P-gp mRNA expression have

been studied in eukaryotes (Ince and Scotto, 1995; Scotto and Egan, 1998; Shtil and Azare,

2005) but not in nematodes. P-gps are constitutively expressed in all life stages of Cooperia

oncophora (De Graef et al., 2013). It is not known if this is true of all parasitic nematodes.

Page 32: P-glycoprotein drug transporters in the parasitic

21

In the model nematode C. elegans, exposure to ever increasing doses of ivermectin

(IVM) was demonstrated to increase P-gp mRNA expression and induce resistance (James and

Davey, 2009). Selection for tolerance by exposure to non-toxic doses of MLs in C. elegans

caused an induced upregulation of certain P-gp mRNA (Pgp-1, Pgp-6, Pgp-10 and Pgp-14 in

IVM selected strains and Pgp-1, Pgp-6, Pgp-8 and Pgp-14 in MOX selected strains) (Ménez et

al., 2016). Similar research had previously led to the conclusion that certain individual P-gp

genes may not play a critical role in conferring IVM resistance (Yan et al., 2012b). P-gp

upregulation appears to occur in short time scales without sustained changes even over 2.5 hours

in individual genes in C. elegans in MOX-selected and IVM-resistant strains (Bygarski et al.,

2014). P-gp upregulation in parasitic nematodes may not necessarily be accurately reflected by

studies in C. elegans, since P-gp homologs of certain genes such as pgp-6 and pgp-8 have not

been found in parasitic nematodes so far (Table 2-2).

Several methods have been used to quantify expression changes and understand allelic

variations in different stages of the nematodes. These are summarized in Table 2-3. The most

frequently used assay is quantitative PCR (qPCR) to estimate mRNA transcription levels of

specific P-gps. Basal levels of P-gp transcription, upregulation or downregulation of

transcription when clinically susceptible or resistant nematode stages are exposed to drugs in

vivo or in vitro can be quickly and conveniently calculated using qPCR. Since substrate

specificity changes can occur even in the presence of silent mutations in mdr1 genes, SNP

analysis after sanger sequencing has also been used as a method to correlate genetic mutations

with clinical anthelmintic resistance (Kimchi-Sarfaty et al., 2007). RNA-seq analysis is a

promising new -omics platform tool that has been used to quantify transcription levels of P-gp

genes (Kenealy, 2019; Maté et al., 2018). The drawbacks that would have to be addressed in its

Page 33: P-glycoprotein drug transporters in the parasitic

22

use are: a possible transcript length bias in detecting differentially expressed genes (Oshlack and

Wakefield, 2009), over-detection of highly expressed transcripts (Young et al., 2010), and

biochemical selection bias in cDNA library preparation (Roberts et al., 2011). The emergence of

these assays in the 2000s based on improved molecular technologies have largely supplanted

older radioactive isotope-based assays used in the 1990s such as southern blotting (hybridization

of DNA with DNA probes) to detect restriction fragment length polymorphism and northern

blotting (hybridization of RNA with DNA or RNA probes) to detect RNA transcription.

There is considerable variation in the conclusions reached in these studies that can be

attributed to (a) differences in genetic make-up of isolates studied, (b) differences in mechanisms

of resistance and (c) differences in assay sensitivity. As assay technologies improve, future

studies are needed to understand how changes in gene expression correlate with clinically

detectable resistance/tolerance.

3.3. Nematode P-gps in heterologous systems

Heterologous expression systems are useful for expression of intact and mutant variants

of a protein in isolation. Mammalian P-gps have not been successfully expressed in prokaryotic

systems but have been expressed in yeast, baculovirus/insect cell systems and eukaryotic cell

lines (Bartley et al., 2009; Evans et al., 1995; Mealey et al., 2017; Tang et al., 2002). Nematode

P-gp genes have been expressed in cell lines, yeast or C. elegans to study efflux activity and

pharmacological interactions, with the most frequently used being the epithelial pig kidney cell

line LLC-PK1. An ideal cell line must allow protein translation from mRNA transcribed from a

transfected plasmid, followed by post-translational modifications and trafficking to the correct

protein compartment. In the study of P-gps, endogenous P-gp levels in the native cell lines must

be accounted for on a cell line to cell line basis. LLC-PK1 is a good model because it has very

low endogenous P-gp expression (Goh et al., 2002). This allows true estimation of transfected

Page 34: P-glycoprotein drug transporters in the parasitic

23

Pgp, when compared to other cell lines like Madin-Darby canine kidney (MDCK) in which the

higher endogenous activity leads to underestimation of activity of the transfected P-gp

(Kuteykin-Teplyakov et al., 2010).

Protein expression in heterologous models is often confirmed using Western blotting

using the anti-mammalian-Pgp antibody UIC2. However, the relevance of this is questionable as

(a) UIC2 binds to a conformational epitope in human P-gp (but not mouse Pgp) (Vahedi et al.,

2018), and (b) the absence of the same conformational epitope in nematode P-gps. Some

researchers have used antibodies raised against the specific nematode P-gp under study (Godoy

et al., 2015b). In these studies, glycosylation differences must be accounted for, as inter-species

glycosylation differences exist. Rat P-gp has an apparent molecular weight of 140 kDa due to

lower levels of glycosylation than human P-gp which has a higher apparent molecular weight of

170kDa due to higher glycosylation (Dong et al., 1998). The effect of these glycosylation

differences may result in differences in pharmacological responses in the heterologous system.

Pharmacology of transporters are determined by biochemical assays after heterologous

expression of the protein. Given the increasing association between anthelmintic resistance and

P-gp expression, there has been a growing interest in the pharmacological interaction of

anthelmintic molecules with nematode P-glycoproteins. The most frequently used assays in

nematode P-gp study are competitive efflux of a fluorescent substrate such as Rhodamine 123,

Hoechst 33342, Calcein-AM in the presence of a drug such as a macrocyclic lactone. Ivermectin,

eprinomectin, abamectin, doramectin, selamectin and moxidectin, interact with mammalian P-

gps by competitively inhibiting efflux of a fluorescent P-gp substrate (Lespine et al., 2007).

Other anthelmintics such as closantel, triclabendazole and rafoxanide also competitively inhibit

Rhodamine 123 efflux by mammalian P-gp (Dupuy et al., 2010). However, since nematode P-

Page 35: P-glycoprotein drug transporters in the parasitic

24

gps share only 35 - 64% identity with mammalian P-gps, efflux capabilities of the former cannot

be directly extrapolated from data of the latter. Additionally, different nematode P-gps may have

different affinities and responses to drugs, which can only be determined by empirical testing.

Other assays including measurements of ATPase activity have also occasionally been used. Drug

interaction studies in heterologous systems are summarized in Table 2-4.

3.4. Whole organism pharmacology

One or more free-living stages of nematodes are often used to assess the pharmacological

response of P-gps with the assumption that free-living stages are a surrogate for parasitic stages.

These assays involve the incubation of eggs or larvae with different drugs followed by flow

cytometry, development or motility assay (Demeler et al., 2012; Demeler et al., 2010; Kerboeuf

et al., 1996). In vitro tests possess the advantage that receptors and proteins are expressed in their

homologous state, and specific or class-wide ML resistance can be detected (Kotze et al., 2014).

They suffer from the disadvantage that free living stages are not generally accessible to drugs

and tissue specific responses may not be the same in different life stages unless empirically

proven. In some groups of nematodes such as the ascarids, no free-living larval stages exist.

Therefore, assays have to be optimized with biological relevance in mind. Relevant whole

organism studies of P-gps have been summarized in Table 2-5.

Larval development assay (LDA) is based on the inhibition of the biological development

and hatching of larvae from a single cell/morula that is present in a freshly laid egg in the

presence of drugs. Some drugs such as the benzimidazoles have known ovicidal properties while

the ovicidal effects of others such as the ivermectin depends on the route of administration in in

vivo studies (Tyrrell et al., 2002). Several lines of evidence led to the conclusion that LDA

suffers from having poor correlation between clinical phenotype and in vitro assay output, being

the best for benzimidazoles such as thiabendazole, which has known ovicidal property, and the

Page 36: P-glycoprotein drug transporters in the parasitic

25

worst for levamisole and ivermectin (Tandon and Kaplan, 2004). This was further demonstrated

in a comparison of two variants of the LDA in which the assays were able to detect

benzimidazole and levamisole resistance but not ivermectin resistance (Várady et al., 2009). But,

a more recent study has demonstrated its use in distinguishing susceptible and resistant isolates

of nematodes (Dolinská et al., 2013). Some researchers have used the LDA with known P-gp

inhibitors and MLs to test if P-gp inhibition leads to developmental arrest/death. The LDA has

only been used to study strongyle nematodes.

The Larval motility inhibition assay/test (LMIA/LMIT) is based on the behavioral

propensity of third larval stages of strongyles to actively migrate up grass blades to await

ingestion by a host. The in vitro assay setup involves a filter mesh through which larvae are

allowed to migrate in the presence or absence of drugs (Rothwell and Sangster, 1993). The assay

can be modified to detect paralysis after hatching in the presence of avermectins (Gill et al.,

1995).

The larval feeding inhibition assay is based on the inhibition of bacterivoral behavior of

first stage strongyle larvae in the presence of drugs (Alvarez-Sánchez et al., 2005). This assay

cannot be used in nematode groups such as ascarids, oxyurids and spirurids which do not have

free-living L1s.

Motility as measured by number of movements of the posterior end of the adult worm per

unit time, as measured by an operator has been used in studies of filarid nematodes (Tompkins et

al., 2010). Given the great variation in sizes of nematode life stages, motility measurements

cannot be easily compared between groups of nematodes. Further research is needed to optimize

motility measures for each drug class and each parasitic nematode.

Page 37: P-glycoprotein drug transporters in the parasitic

26

Phenotypic assays such as pharyngeal pumping and velocity have been used as outputs in

the model organism C. elegans to demonstrate the role of P-gps in cross resistance of IVM and

MOX (Bygarski et al., 2014). These have not been used in parasitic nematodes so far.

3.5. Localization studies

Tissue specific transporter activity is important for understanding

pharmacokinetic disposition of drugs. In nematodes, P-gp expression in different tissues is

relevant in understanding compartmentalization of anthelmintics. Antibodies raised against

mammalian P-gps are frequently used as reagents to understand nematode P-gp localization.

Nucleic acid-based assays including chromogenic in situ hybridization RNAscope have been

recently used. These are summarized in Table 2-6.

3.6. In vivo assays

ML resistance in parasitic nematodes is due to adult populations that survive

anthelmintic treatments. P-gp activity in these parasites can be inhibited by administering P-gp

inhibitors to host animals. Pharmacokinetic studies have shown that plasma concentrations of the

ivermectin and moxidectin increase when P-gp inhibitors such as loperamide, quercetine,

verapamil, closantel, ketaconazole, itraconazole, albendazole and triclabendazole are co-

administered (Alvarez et al., 2008; Alvinerie et al., 2008; Ballent et al., 2007; Cromie et al.,

2006; Dupuy et al., 2003; Lifschitz et al., 2009; Lifschitz et al., 2002; Molento et al., 2004).

Several in vivo studies that have examined the effect of co-administration of drugs on parasites

are summarized in Table 2-7.

4. Conclusions

Macrocyclic lactone resistance in nematodes of veterinary importance is an

emerging issue which has morphed into a massive economic burden on producers in recent

years. In companion animals, emerging loss of efficacy of MLs in controlling Dirofilaria immitis

Page 38: P-glycoprotein drug transporters in the parasitic

27

has resulted in poor life quality. Research efforts have identified a role for P-glycoproteins in ML

resistance and tolerance. However, several questions remain about the mechanism by which P-

gps confer resistance.

Given the variation in expression levels obtained by different research groups in different

nematodes, empirical studies are essential in parasites in which P-gps have not been studied so

far. Methods used in the study of nematode P-gps have to be developed and optimized for each

nematode with biologically relevant life stages prioritized over easily obtainable free-living

stages. Regulatory mechanisms that govern P-gp expression such as transcription factors (Ménez

et al., 2019) must be identified, along with interactions between glutamate-gated chloride

channels, other ion channels and P-gps. Candidate gene based approaches in the study of

macrocyclic lactone resistance are being slowly supplanted by whole genome scale approaches

when chromosomal scale genome assemblies are available (Doyle and Cotton, 2019), but these

have yet to be used in P-gp studies.

Pharmacological profiles of different nematode P-gps have to be individually

assessed to identify those with unique profiles that can be exploited to reverse drug resistance.

Further, there is a need for P-gp inhibitors that will specifically inhibit nematode P-gps.

Finally, selection protocols may dictate the development of resistance and more

than one mechanism may exist for resistance development (Gill et al., 1998). Clinically relevant

anthelmintic selection and use protocols, tailored for used in different vegetation and climate

belts of the world must be developed to lower the selection pressure on parasites.

5. References

Albrecht, C., Viturro, E., 2007. The ABCA subfamily--gene and protein structures, functions and

associated hereditary diseases. Pflugers Arch 453, 581-589.

Page 39: P-glycoprotein drug transporters in the parasitic

28

AlGusbi, S., Krücken, J., Ramünke, S., von Samson-Himmelstjerna, G., Demeler, J., 2014.

Analysis of putative inhibitors of anthelmintic resistance mechanisms in cattle

gastrointestinal nematodes. Int J Parasitol 44, 647-658.

Ali, M.Y., Siddiqui, S.S., 2000. cDNA cloning and expression of a C-terminus motor kinesin-

like protein KLP-17, involved in chromosomal movement in Caenorhabditis elegans.

Biochem Biophys Res Commun 267, 643-650.

Aller, S.G., Yu, J., Ward, A., Weng, Y., Chittaboina, S., Zhuo, R., Harrell, P.M., Trinh, Y.T.,

Zhang, Q., Urbatsch, I.L., Chang, G., 2009. Structure of P-glycoprotein reveals a

molecular basis for poly-specific drug binding. Science 323, 1718-1722.

Alvarez, L., Lifschitz, A., Entrocasso, C., Manazza, J., Mottier, L., Borda, B., Virkel, G.,

Lanusse, C., 2008. Evaluation of the interaction between ivermectin and albendazole

following their combined use in lambs. J Vet Pharmacol Ther 31, 230-239.

Alvarez, L., Suarez, G., Ceballos, L., Moreno, L., Canton, C., Lifschitz, A., Maté, L., Ballent,

M., Virkel, G., Lanusse, C., 2015. Integrated assessment of ivermectin pharmacokinetics,

efficacy against resistant Haemonchus contortus and P-glycoprotein expression in lambs

treated at three different dosage levels. Vet Parasitol 210, 53-63.

Alvarez-Sánchez, M.A., Pérez García, J., Bartley, D., Jackson, F., Rojo-Vázquez, F.A., 2005.

The larval feeding inhibition assay for the diagnosis of nematode anthelmintic resistance.

Exp Parasitol 110, 56-61.

Alvinerie, M., Dupuy, J., Kiki-Mvouaka, S., Sutra, J.F., Lespine, A., 2008. Ketoconazole

increases the plasma levels of ivermectin in sheep. Vet Parasitol 157, 117-122.

Ambudkar, S.V., Dey, S., Hrycyna, C.A., Ramachandra, M., Pastan, I., Gottesman, M.M., 1999.

Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu

Rev Pharmacol Toxicol 39, 361-398.

Ardelli, B.F., Stitt, L.E., Tompkins, J.B., 2010. Inventory and analysis of ATP-binding cassette

(ABC) systems in Brugia malayi. Parasitology 137, 1195-1212.

Areskog, M., Engström, A., Tallkvist, J., von Samson-Himmelstjerna, G., Höglund, J., 2013.

PGP expression in Cooperia oncophora before and after ivermectin selection. Parasitol

Res 112, 3005-3012.

Ballent, M., Lifschitz, A., Virkel, G., Sallovitz, J., Lanusse, C., 2007. Involvement of P-

glycoprotein on ivermectin kinetic behaviour in sheep: itraconazole-mediated changes on

gastrointestinal disposition. J Vet Pharmacol Ther 30, 242-248.

Barclay, J.W., Morgan, A., Burgoyne, R.D., 2012. Neurotransmitter release mechanisms studied

in Caenorhabditis elegans. Cell Calcium 52, 289-295.

Bartley, D.J., McAllister, H., Bartley, Y., Dupuy, J., Ménez, C., Alvinerie, M., Jackson, F.,

Lespine, A., 2009. P-glycoprotein interfering agents potentiate ivermectin susceptibility

in ivermectin sensitive and resistant isolates of Teladorsagia circumcincta and

Haemonchus contortus. Parasitology 136, 1081-1088.

Page 40: P-glycoprotein drug transporters in the parasitic

29

Bartley, D.J., Morrison, A.A., Dupuy, J., Bartley, Y., Sutra, J.F., Menez, C., Alvinerie, M.,

Jackson, F., Devin, L., Lespine, A., 2012. Influence of Pluronic 85 and ketoconazole on

disposition and efficacy of ivermectin in sheep infected with a multiple resistant

Haemonchus contortus isolate. Vet Parasitol 187, 464-472.

Bazzocchi, C., Mortarino, M., Grandi, G., Kramer, L.H., Genchi, C., Bandi, C., Genchi, M.,

Sacchi, L., McCall, J.W., 2008. Combined ivermectin and doxycycline treatment has

microfilaricidal and adulticidal activity against Dirofilaria immitis in experimentally

infected dogs. Int J Parasitol 38, 1401-1410.

Beech, R.N., Skuce, P., Bartley, D.J., Martin, R.J., Prichard, R.K., Gilleard, J.S., 2011.

Anthelmintic resistance: markers for resistance, or susceptibility? Parasitology 138, 160-

174.

Beugnet, F., Gauthey, M., Kerboeuf, D., 1997. Partial in vitro reversal of benzimidazole

resistance by the free-living stages of Haemonchus contortus with verapamil. Vet Rec

141, 575-576.

Blackhall, W.J., Liu, H.Y., Xu, M., Prichard, R.K., Beech, R.N., 1998a. Selection at a P-

glycoprotein gene in ivermectin- and moxidectin-selected strains of Haemonchus

contortus. Mol Biochem Parasitol 95, 193-201.

Blackhall, W.J., Pouliot, J.F., Prichard, R.K., Beech, R.N., 1998b. Haemonchus contortus:

selection at a glutamate-gated chloride channel gene in ivermectin- and moxidectin-

selected strains. Exp Parasitol 90, 42-48.

Blackhall, W.J., Prichard, R.K., Beech, R.N., 2008. P-glycoprotein selection in strains of

Haemonchus contortus resistant to benzimidazoles. Vet Parasitol 152, 101-107.

Blaxter, M.L., De Ley, P., Garey, J.R., Liu, L.X., Scheldeman, P., Vierstraete, A., Vanfleteren,

J.R., Mackey, L.Y., Dorris, M., Frisse, L.M., Vida, J.T., Thomas, W.K., 1998. A

molecular evolutionary framework for the phylum Nematoda. Nature 392, 71-75.

Boersema, J.H., Eysker, M., Nas, J.W., 2002. Apparent resistance of Parascaris equorum to

macrocylic lactones. Vet Rec 150, 279-281.

Bourguinat, C., Che, H., Mani, T., Keller, K., Prichard, R.K., 2016. ABC-B transporter genes in

Dirofilaria immitis. Int J Parasitol Drugs Drug Resist 6, 116-124.

Bourguinat, C., Keller, K., Bhan, A., Peregrine, A., Geary, T., Prichard, R., 2011a. Macrocyclic

lactone resistance in Dirofilaria immitis. Vet Parasitol 181, 388-392.

Bourguinat, C., Keller, K., Blagburn, B., Schenker, R., Geary, T.G., Prichard, R.K., 2011b.

Correlation between loss of efficacy of macrocyclic lactone heartworm anthelmintics and

P-glycoprotein genotype. Vet Parasitol 176, 374-381.

Broeks, A., Gerrard, B., Allikmets, R., Dean, M., Plasterk, R.H., 1996. Homologues of the

human multidrug resistance genes MRP and MDR contribute to heavy metal resistance in

the soil nematode Caenorhabditis elegans. EMBO J 15, 6132-6143.

Broeks, A., Janssen, H.W., Calafat, J., Plasterk, R.H., 1995. A P-glycoprotein protects

Caenorhabditis elegans against natural toxins. EMBO J 14, 1858-1866.

Page 41: P-glycoprotein drug transporters in the parasitic

30

Bygarski, E.E., Prichard, R.K., Ardelli, B.F., 2014. Resistance to the macrocyclic lactone

moxidectin is mediated in part by membrane transporter P-glycoproteins: Implications for

control of drug resistant parasitic nematodes. Int J Parasitol Drugs Drug Resist 4, 143-

151.

Bártíková, H., Vokřál, I., Kubíček, V., Szotáková, B., Prchal, L., Lamka, J., Várady, M.,

Skálová, L., 2012. Import and efflux of flubendazole in Haemonchus contortus strains

susceptible and resistant to anthelmintics. Vet Parasitol 187, 473-479.

Churcher, T.S., Pion, S.D., Osei-Atweneboana, M.Y., Prichard, R.K., Awadzi, K., Boussinesq,

M., Collins, R.C., Whitworth, J.A., Basáñez, M.G., 2009. Identifying sub-optimal

responses to ivermectin in the treatment of River Blindness. Proc Natl Acad Sci U S A

106, 16716-16721.

Conrad, S., Viertelhaus, A., Orzechowski, A., Hoogstraate, J., Gjellan, K., Schrenk, D.,

Kauffmann, H.M., 2001. Sequencing and tissue distribution of the canine MRP2 gene

compared with MRP1 and MDR1. Toxicology 156, 81-91.

Consortium, I.H.G., 2019. Comparative genomics of the major parasitic worms. Nat Genet 51,

163-174.

Craig, T.M., Diamond, P.L., Ferwerda, N.S., Thompson, J.A., 2007. Evidence of ivermectin

resistance by Parascaris equorum on a Texas horse farm. Journal of Equine Veterinary

Science 27, 67-71.

Cromie, L., Ferry, M., Couper, A., Fields, C., Taylor, S.M., 2006. Pharmacokinetics of a novel

closantel/ivermectin injection in cattle. J Vet Pharmacol Ther 29, 205-211.

Dassa, E., 2011. Natural history of ABC systems: not only transporters. Essays Biochem 50, 19-

42.

Dassa, E., Bouige, P., 2001. The ABC of ABCS: a phylogenetic and functional classification of

ABC systems in living organisms. Res Microbiol 152, 211-229.

David, M., Lebrun, C., Duguet, T., Talmont, F., Beech, R., Orlowski, S., André, F., Prichard,

R.K., Lespine, A., 2018. Structural model, functional modulation by ivermectin and

tissue localization of Haemonchus contortus P-glycoprotein-13. Int J Parasitol Drugs

Drug Resist 8, 145-157.

Davidson, A.L., Dassa, E., Orelle, C., Chen, J., 2008. Structure, function, and evolution of

bacterial ATP-binding cassette systems. Microbiol Mol Biol Rev 72, 317-364, table of

contents.

De Graef, J., Demeler, J., Skuce, P., Mitreva, M., Von Samson-Himmelstjerna, G., Vercruysse,

J., Claerebout, E., Geldhof, P., 2013. Gene expression analysis of ABC transporters in a

resistant Cooperia oncophora isolate following in vivo and in vitro exposure to

macrocyclic lactones. Parasitology 140, 499-508.

Demeler, J., Kleinschmidt, N., Küttler, U., Koopmann, R., von Samson-Himmelstjerna, G.,

2012. Evaluation of the Egg Hatch Assay and the Larval Migration Inhibition Assay to

detect anthelmintic resistance in cattle parasitic nematodes on farms. Parasitol Int 61,

614-618.

Page 42: P-glycoprotein drug transporters in the parasitic

31

Demeler, J., Krücken, J., AlGusbi, S., Ramünke, S., De Graef, J., Kerboeuf, D., Geldhof, P.,

Pomroy, W.E., von Samson-Himmelstjerna, G., 2013. Potential contribution of P-

glycoproteins to macrocyclic lactone resistance in the cattle parasitic nematode Cooperia

oncophora. Mol Biochem Parasitol 188, 10-19.

Demeler, J., Küttler, U., von Samson-Himmelstjerna, G., 2010. Adaptation and evaluation of

three different in vitro tests for the detection of resistance to anthelmintics in gastro

intestinal nematodes of cattle. Vet Parasitol 170, 61-70.

Dicker, A.J., Nath, M., Yaga, R., Nisbet, A.J., Lainson, F.A., Gilleard, J.S., Skuce, P.J., 2011a.

Teladorsagia circumcincta: the transcriptomic response of a multi-drug-resistant isolate to

ivermectin exposure in vitro. Exp Parasitol 127, 351-356.

Dicker, A.J., Nisbet, A.J., Skuce, P.J., 2011b. Gene expression changes in a P-glycoprotein (Tci-

pgp-9) putatively associated with ivermectin resistance in Teladorsagia circumcincta. Int

J Parasitol 41, 935-942.

Doligalska, M., Jóźwicka, K., Kiersnowska, M., Mroczek, A., Pączkowski, C., Janiszowska, W.,

2011. Triterpenoid saponins affect the function of P-glycoprotein and reduce the survival

of the free-living stages of Heligmosomoides bakeri. Vet Parasitol 179, 144-151.

Dolinská, M., Königová, A., Letková, V., Molnár, L., Várady, M., 2013. Detection of ivermectin

resistance by a larval development test--back to the past or a step forward? Vet Parasitol

198, 154-158.

Dong, M., Ladavière, L., Penin, F., Deléage, G., Baggetto, L.G., 1998. Secondary structure of P-

glycoprotein investigated by circular dichroism and amino acid sequence analysis.

Biochim Biophys Acta 1371, 317-334.

Dowling, P., 2006. Pharmacogenetics: it's not just about ivermectin in collies. Can Vet J 47,

1165-1168.

Doyle, S.R., Cotton, J.A., 2019. Genome-wide Approaches to Investigate Anthelmintic

Resistance. Trends Parasitol 35, 289-301.

Drogemuller, M., Schnieder, T., von Samson-Himmelstjerna, G., 2004. Evidence of p-

glycoprotein sequence diversity in cyathostomins. J Parasitol 90, 998-1003.

Dupuy, J., Alvinerie, M., Ménez, C., Lespine, A., 2010. Interaction of anthelmintic drugs with P-

glycoprotein in recombinant LLC-PK1-mdr1a cells. Chem Biol Interact 186, 280-286.

Dupuy, J., Larrieu, G., Sutra, J.F., Lespine, A., Alvinerie, M., 2003. Enhancement of moxidectin

bioavailability in lamb by a natural flavonoid: quercetin. Vet Parasitol 112, 337-347.

Eckford, P.D., Sharom, F.J., 2005. The reconstituted P-glycoprotein multidrug transporter is a

flippase for glucosylceramide and other simple glycosphingolipids. Biochem J 389, 517-

526.

Evans, G.L., Ni, B., Hrycyna, C.A., Chen, D., Ambudkar, S.V., Pastan, I., Germann, U.A.,

Gottesman, M.M., 1995. Heterologous expression systems for P-glycoprotein: E. coli,

yeast, and baculovirus. J Bioenerg Biomembr 27, 43-52.

Page 43: P-glycoprotein drug transporters in the parasitic

32

Fiel, C.A., Saumell, C.A., Steffan, P.E., Rodriguez, E.M., 2001. Resistance of Cooperia to

ivermectin treatments in grazing cattle of the Humid Pampa, Argentina. Vet Parasitol 97,

211-217.

Figueiredo, L.A., Rebouças, T.F., Ferreira, S.R., Rodrigues-Luiz, G.F., Miranda, R.C., Araujo,

R.N., Fujiwara, R.T., 2018. Dominance of P-glycoprotein 12 in phenotypic resistance

conversion against ivermectin in Caenorhabditis elegans. PLoS One 13, e0192995.

Fok, E., Kassai, T., 1998. Toxocara canis infection in the paratenic host: a study on the

chemosusceptibility of the somatic larvae in mice. Vet Parasitol 74, 243-259.

Garavelli, J.S., 2004. The RESID Database of Protein Modifications as a resource and annotation

tool. Proteomics 4, 1527-1533.

Gasbarre, L.C., Smith, L.L., Lichtenfels, J.R., Pilitt, P.A., 2009. The identification of cattle

nematode parasites resistant to multiple classes of anthelmintics in a commercial cattle

population in the US. Vet Parasitol 166, 281-285.

Geary, T.G., Thompson, D.P., 2001. Caenorhabditis elegans: how good a model for veterinary

parasites? Vet Parasitol 101, 371-386.

Gill, J.H., Kerr, C.A., Shoop, W.L., Lacey, E., 1998. Evidence of multiple mechanisms of

avermectin resistance in haemonchus contortus--comparison of selection protocols. Int J

Parasitol 28, 783-789.

Gill, J.H., Redwin, J.M., van Wyk, J.A., Lacey, E., 1995. Avermectin inhibition of larval

development in Haemonchus contortus--effects of ivermectin resistance. Int J Parasitol

25, 463-470.

Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2015a. Characterization of Haemonchus

contortus P-glycoprotein-16 and its interaction with the macrocyclic lactone

anthelmintics. Mol Biochem Parasitol 204, 11-15.

Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2016. Characterisation of P-glycoprotein-9.1 in

Haemonchus contortus. Parasit Vectors 9, 52.

Godoy, P., Lian, J., Beech, R.N., Prichard, R.K., 2015b. Haemonchus contortus P-glycoprotein-

2: in situ localisation and characterisation of macrocyclic lactone transport. Int J Parasitol

45, 85-93.

Goh, L.B., Spears, K.J., Yao, D., Ayrton, A., Morgan, P., Roland Wolf, C., Friedberg, T., 2002.

Endogenous drug transporters in in vitro and in vivo models for the prediction of drug

disposition in man. Biochem Pharmacol 64, 1569-1578.

Guo, T., Huang, J., Zhang, H., Dong, L., Guo, D., Guo, L., He, F., Bhutto, Z.A., Wang, L., 2016.

Abcb1 in Pigs: Molecular cloning, tissues distribution, functional analysis, and its effect

on pharmacokinetics of enrofloxacin. Sci Rep 6, 32244.

Haslam, I.S., Simmons, N.L., 2014. Expression of the ABC transport proteins MDR1 (ABCB1)

and BCRP (ABCG2) in bovine rumen. J Comp Physiol B 184, 673-681.

Page 44: P-glycoprotein drug transporters in the parasitic

33

Heckler, R.P., Almeida, G.D., Santos, L.B., Borges, D.G., Neves, J.P., Onizuka, M.K., Borges,

F.A., 2014. P-gp modulating drugs greatly potentiate the in vitro effect of ivermectin

against resistant larvae of Haemonchus placei. Vet Parasitol 205, 638-645.

Hibbs, R.E., Gouaux, E., 2011. Principles of activation and permeation in an anion-selective

Cys-loop receptor. Nature 474, 54-60.

Hirose, T., Horvitz, H.R., 2014. The translational regulators GCN-1 and ABCF-3 act together to

promote apoptosis in C. elegans. PLoS Genet 10, e1004512.

Howard, J.T., O'Nan, A.T., Maltecca, C., Baynes, R.E., Ashwell, M.S., 2015. Differential Gene

Expression across Breed and Sex in Commercial Pigs Administered Fenbendazole and

Flunixin Meglumine. PLoS One 10, e0137830.

Ince, T.A., Scotto, K.W., 1995. Differential utilization of multiple transcription start points

accompanies the overexpression of the P-glycoprotein-encoding gene in Chinese hamster

lung cells. Gene 156, 287-290.

Issouf, M., Guégnard, F., Koch, C., Le Vern, Y., Blanchard-Letort, A., Che, H., Beech, R.N.,

Kerboeuf, D., Neveu, C., 2014. Haemonchus contortus P-glycoproteins interact with host

eosinophil granules: a novel insight into the role of ABC transporters in host-parasite

interaction. PLoS One 9, e87802.

Jagodinsky, J.C., Akgun, U., 2015. Characterizing the binding interactions between P-

glycoprotein and eight known cardiovascular transport substrates. Pharmacol Res

Perspect 3, e00114.

James, C.E., Davey, M.W., 2009. Increased expression of ABC transport proteins is associated

with ivermectin resistance in the model nematode Caenorhabditis elegans. Int J Parasitol

39, 213-220.

Janssen, I.J., Krücken, J., Demeler, J., Basiaga, M., Kornaś, S., von Samson-Himmelstjerna, G.,

2013a. Genetic variants and increased expression of Parascaris equorum P-glycoprotein-

11 in populations with decreased ivermectin susceptibility. PLoS One 8, e61635.

Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2013b. Caenorhabditis

elegans: modest increase of susceptibility to ivermectin in individual P-glycoprotein loss-

of-function strains. Exp Parasitol 134, 171-177.

Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2015. Transgenically

expressed Parascaris P-glycoprotein-11 can modulate ivermectin susceptibility in

Caenorhabditis elegans. Int J Parasitol Drugs Drug Resist 5, 44-47.

Jesudoss Chelladurai, J., Brewer, M.T., 2019. Detection and quantification of Parascaris P-

glycoprotein drug transporter expression with a novel mRNA hybridization technique.

Vet Parasitol 267, 75-83.

Jex, A.R., Liu, S., Li, B., Young, N.D., Hall, R.S., Li, Y., Yang, L., Zeng, N., Xu, X., Xiong, Z.,

Chen, F., Wu, X., Zhang, G., Fang, X., Kang, Y., Anderson, G.A., Harris, T.W.,

Campbell, B.E., Vlaminck, J., Wang, T., Cantacessi, C., Schwarz, E.M., Ranganathan, S.,

Geldhof, P., Nejsum, P., Sternberg, P.W., Yang, H., Wang, J., Gasser, R.B., 2011.

Ascaris suum draft genome. Nature 479, 529-533.

Page 45: P-glycoprotein drug transporters in the parasitic

34

Jin, M.S., Oldham, M.L., Zhang, Q., Chen, J., 2012. Crystal structure of the multidrug

transporter P-glycoprotein from Caenorhabditis elegans. Nature 490, 566-569.

Juliano, R.L., Ling, V., 1976. A surface glycoprotein modulating drug permeability in Chinese

hamster ovary cell mutants. Biochim Biophys Acta 455, 152-162.

Kabsch, W., Sander, C., 1983. Dictionary of protein secondary structure: pattern recognition of

hydrogen-bonded and geometrical features. Biopolymers 22, 2577-2637.

Kanehisa, M., Furumichi, M., Tanabe, M., Sato, Y., Morishima, K., 2017. KEGG: new

perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res 45, D353-

D361.

Kaschny, M., Demeler, J., Janssen, I.J., Kuzmina, T.A., Besognet, B., Kanellos, T., Kerboeuf,

D., von Samson-Himmelstjerna, G., Krücken, J., 2015. Macrocyclic lactones differ in

interaction with recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus

elongatus and ketoconazole in a yeast growth assay. PLoS Pathog 11, e1004781.

Kellerová, P., Matoušková, P., Lamka, J., Vokřál, I., Szotáková, B., Zajíčková, M., Pasák, M.,

Skálová, L., 2019. Ivermectin-induced changes in the expression of cytochromes P450

and efflux transporters in Haemonchus contortus female and male adults. Vet Parasitol

273, 24-31.

Kenealy, J.S., 2019. Anthelmintic resistance in equine parasites: mechanisms and treatment

approaches. University of Kentucky, Lexington, KY.

Kerboeuf, D., Aycardi, J., Soubieux, D., 1996. Flow-cytometry analysis of sheep-nematode egg

populations. Parasitol Res 82, 358-363.

Kerboeuf, D., Chambrier, P., Le Vern, Y., Aycardi, J., 1999. Flow cytometry analysis of drug

transport mechanisms in Haemonchus contortus susceptible or resistant to anthelmintics.

Parasitol Res 85, 118-123.

Kerboeuf, D., Guégnard, F., 2011. Anthelmintics are substrates and activators of nematode P

glycoprotein. Antimicrob Agents Chemother 55, 2224-2232.

Kerboeuf, D., Guégnard, F., Vern, Y.L., 2003. Detection of P-glycoprotein-mediated multidrug

resistance against anthelmintics in Haemonchus contortus using anti-human mdr1

monoclonal antibodies. Parasitol Res 91, 79-85.

Kim, Y., Chen, J., 2018. Molecular structure of human P-glycoprotein in the ATP-bound,

outward-facing conformation. Science 359, 915-919.

Kimchi-Sarfaty, C., Oh, J.M., Kim, I.W., Sauna, Z.E., Calcagno, A.M., Ambudkar, S.V.,

Gottesman, M.M., 2007. A "silent" polymorphism in the MDR1 gene changes substrate

specificity. Science 315, 525-528.

Korolnek, T., Zhang, J., Beardsley, S., Scheffer, G.L., Hamza, I., 2014. Control of metazoan

heme homeostasis by a conserved multidrug resistance protein. Cell Metab 19, 1008-

1019.

Page 46: P-glycoprotein drug transporters in the parasitic

35

Kotze, A.C., Ruffell, A.P., Knox, M.R., Kelly, G.A., 2014. Relative potency of macrocyclic

lactones in in vitro assays with larvae of susceptible and drug-resistant Australian isolates

of Haemonchus contortus and H. placei. Vet Parasitol 203, 294-302.

Krücken, J., Fraundorfer, K., Mugisha, J.C., Ramünke, S., Sifft, K.C., Geus, D., Habarugira, F.,

Ndoli, J., Sendegeya, A., Mukampunga, C., Bayingana, C., Aebischer, T., Demeler, J.,

Gahutu, J.B., Mockenhaupt, F.P., von Samson-Himmelstjerna, G., 2017. Reduced

efficacy of albendazole against Ascaris lumbricoides in Rwandan schoolchildren. Int J

Parasitol Drugs Drug Resist 7, 262-271.

Kuteykin-Teplyakov, K., Luna-Tortós, C., Ambroziak, K., Löscher, W., 2010. Differences in the

expression of endogenous efflux transporters in MDR1-transfected versus wildtype cell

lines affect P-glycoprotein mediated drug transport. Br J Pharmacol 160, 1453-1463.

Kwa, M.S., Okoli, M.N., Schulz-Key, H., Okongkwo, P.O., Roos, M.H., 1998. Use of P-

glycoprotein gene probes to investigate anthelmintic resistance in Haemonchus contortus

and comparison with Onchocerca volvulus. Int J Parasitol 28, 1235-1240.

Laing, R., Martinelli, A., Tracey, A., Holroyd, N., Gilleard, J.S., Cotton, J.A., 2016.

Haemonchus contortus: Genome Structure, Organization and Comparative Genomics.

Adv Parasitol 93, 569-598.

Le Jambre, L.F., Lenane, I.J., Wardrop, A.J., 1999. A hybridisation technique to identify

anthelmintic resistance genes in Haemonchus. Int J Parasitol 29, 1979-1985.

Lebedeva, I.V., Pande, P., Patton, W.F., 2011. Sensitive and specific fluorescent probes for

functional analysis of the three major types of mammalian ABC transporters. PLoS One

6, e22429.

Lespine, A., Martin, S., Dupuy, J., Roulet, A., Pineau, T., Orlowski, S., Alvinerie, M., 2007.

Interaction of macrocyclic lactones with P-glycoprotein: structure-affinity relationship.

Eur J Pharm Sci 30, 84-94.

Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other

multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for

reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist

2, 58-75.

Lifschitz, A., Entrocasso, C., Alvarez, L., Lloberas, M., Ballent, M., Manazza, G., Virkel, G.,

Borda, B., Lanusse, C., 2010a. Interference with P-glycoprotein improves ivermectin

activity against adult resistant nematodes in sheep. Vet Parasitol 172, 291-298.

Lifschitz, A., Suarez, V.H., Sallovitz, J., Cristel, S.L., Imperiale, F., Ahoussou, S., Schiavi, C.,

Lanusse, C., 2010b. Cattle nematodes resistant to macrocyclic lactones: comparative

effects of P-glycoprotein modulation on the efficacy and disposition kinetics of

ivermectin and moxidectin. Exp Parasitol 125, 172-178.

Lifschitz, A., Virkel, G., Ballent, M., Sallovitz, J., Lanusse, C., 2009. Combined use of

ivermectin and triclabendazole in sheep: in vitro and in vivo characterisation of their

pharmacological interaction. Vet J 182, 261-268.

Page 47: P-glycoprotein drug transporters in the parasitic

36

Lifschitz, A., Virkel, G., Sallovitz, J., Imperiale, F., Pis, A., Lanusse, C., 2002. Loperamide-

induced enhancement of moxidectin availability in cattle. J Vet Pharmacol Ther 25, 111-

120.

Lindblom, T.H., Dodd, A.K., 2006. Xenobiotic detoxification in the nematode Caenorhabditis

elegans. J Exp Zool A Comp Exp Biol 305, 720-730.

Lloberas, M., Alvarez, L., Entrocasso, C., Virkel, G., Ballent, M., Mate, L., Lanusse, C.,

Lifschitz, A., 2013. Comparative tissue pharmacokinetics and efficacy of moxidectin,

abamectin and ivermectin in lambs infected with resistant nematodes: Impact of drug

treatments on parasite P-glycoprotein expression. Int J Parasitol Drugs Drug Resist 3, 20-

27.

Lucchetti, C., Genchi, M., Venco, L., Menozzi, A., Serventi, P., Bertini, S., Bazzocchi, C.,

Kramer, L.H., Vismarra, A., 2019. Differential ABC transporter gene expression in adult

Dirofilaria immitis males and females following in vitro treatment with ivermectin,

doxycycline or a combination of both. Parasit Vectors 12, 401.

Luo, X., Shi, X., Yuan, C., Ai, M., Ge, C., Hu, M., Feng, X., Yang, X., 2017. Genome-wide SNP

analysis using 2b-RAD sequencing identifies the candidate genes putatively associated

with resistance to ivermectin in Haemonchus contortus. Parasit Vectors 10, 31.

Lynagh, T., Lynch, J.W., 2010. A glycine residue essential for high ivermectin sensitivity in

Cys-loop ion channel receptors. Int J Parasitol 40, 1477-1481.

Lynagh, T., Lynch, J.W., 2012. Ivermectin binding sites in human and invertebrate Cys-loop

receptors. Trends Pharmacol Sci 33, 432-441.

Mani, T., Bourguinat, C., Keller, K., Ashraf, S., Blagburn, B., Prichard, R.K., 2016. Interaction

of macrocyclic lactones with a Dirofilaria immitis P-glycoprotein. Int J Parasitol 46, 631-

640.

Maté, L., Ballent, M., Cantón, C., Ceballos, L., Lifschitz, A., Lanusse, C., Alvarez, L., Liron,

J.P., 2018. Assessment of P-glycoprotein gene expression in adult stage of Haemonchus

contortus in vivo exposed to ivermectin. Vet Parasitol 264, 1-7.

McCall, J.W., 2005. The safety-net story about macrocyclic lactone heartworm preventives: a

review, an update, and recommendations. Vet Parasitol 133, 197-206.

McCall, J.W., Genchi, C., Kramer, L., Guerrero, J., Dzimianski, M.T., Supakorndej, P.,

Mansour, A.M., McCall, S.D., Supakorndej, N., Grandi, G., Carson, B., 2008.

Heartworm and Wolbachia: therapeutic implications. Vet Parasitol 158, 204-214.

McDonald, M.K., Fritz, J.A., Jia, D., Scheuchner, D., Snyder, F.F., Stanislaus, A., Curle, J., Li,

L., Stabler, S.P., Allen, R.H., Mains, P.E., Gravel, R.A., 2017. Identification of ABC

transporters acting in vitamin B. Mol Genet Metab 122, 160-171.

Mealey, K.L., 2013. Adverse drug reactions in veterinary patients associated with drug

transporters. Vet Clin North Am Small Anim Pract 43, 1067-1078.

Mealey, K.L., Bentjen, S.A., Gay, J.M., Cantor, G.H., 2001. Ivermectin sensitivity in collies is

associated with a deletion mutation of the mdr1 gene. Pharmacogenetics 11, 727-733.

Page 48: P-glycoprotein drug transporters in the parasitic

37

Mealey, K.L., Burke, N.S., 2015. Identification of a nonsense mutation in feline ABCB1. J Vet

Pharmacol Ther 38, 429-433.

Mealey, K.L., Dassanayake, S., Burke, N.S., 2017. Establishment of a cell line for assessing

drugs as canine P-glycoprotein substrates: proof of principle. J Vet Pharmacol Ther 40,

545-551.

Mealey, K.L., Fidel, J., 2015. P-glycoprotein mediated drug interactions in animals and humans

with cancer. J Vet Intern Med 29, 1-6.

Meli, V.S., Osuna, B., Ruvkun, G., Frand, A.R., 2010. MLT-10 defines a family of DUF644 and

proline-rich repeat proteins involved in the molting cycle of Caenorhabditis elegans. Mol

Biol Cell 21, 1648-1661.

Merola, V.M., Eubig, P.A., 2012. Toxicology of avermectins and milbemycins (macrocylic

lactones) and the role of P-glycoprotein in dogs and cats. Vet Clin North Am Small Anim

Pract 42, 313-333, vii.

Molento, M.B., Lifschitz, A., Sallovitz, J., Lanusse, C., Prichard, R., 2004. Influence of

verapamil on the pharmacokinetics of the antiparasitic drugs ivermectin and moxidectin

in sheep. Parasitol Res 92, 121-127.

Montecchi-Palazzi, L., Beavis, R., Binz, P.A., Chalkley, R.J., Cottrell, J., Creasy, D., Shofstahl,

J., Seymour, S.L., Garavelli, J.S., 2008. The PSI-MOD community standard for

representation of protein modification data. Nat Biotechnol 26, 864-866.

Morita, M., Imanaka, T., 2012. Peroxisomal ABC transporters: structure, function and role in

disease. Biochim Biophys Acta 1822, 1387-1396.

Ménez, C., Alberich, M., Courtot, E., Guegnard, F., Blanchard, A., Aguilaniu, H., Lespine, A.,

2019. The transcription factor NHR-8: A new target to increase ivermectin efficacy in

nematodes. PLoS Pathog 15, e1007598.

Ménez, C., Alberich, M., Kansoh, D., Blanchard, A., Lespine, A., 2016. Acquired Tolerance to

Ivermectin and Moxidectin after Drug Selection Pressure in the Nematode

Caenorhabditis elegans. Antimicrob Agents Chemother 60, 4809-4819.

Na, H., Ponomarova, O., Giese, G.E., Walhout, A.J.M., 2018. C. elegans MRP-5 Exports

Vitamin B12 from Mother to Offspring to Support Embryonic Development. Cell Rep

22, 3126-3133.

Nanayakkara, A.K., Follit, C.A., Chen, G., Williams, N.S., Vogel, P.D., Wise, J.G., 2018.

Targeted inhibitors of P-glycoprotein increase chemotherapeutic-induced mortality of

multidrug resistant tumor cells. Sci Rep 8, 967.

Njue, A.I., Hayashi, J., Kinne, L., Feng, X.P., Prichard, R.K., 2004. Mutations in the

extracellular domains of glutamate-gated chloride channel alpha3 and beta subunits from

ivermectin-resistant Cooperia oncophora affect agonist sensitivity. J Neurochem 89,

1137-1147.

Oshlack, A., Wakefield, M.J., 2009. Transcript length bias in RNA-seq data confounds systems

biology. Biol Direct 4, 14.

Page 49: P-glycoprotein drug transporters in the parasitic

38

Palevich, N., Britton, C., Kamenetzky, L., Mitreva, M., de Moraes Mourão, M., Bennuru, S.,

Quack, T., Scholte, L.L.S., Tyagi, R., Slatko, B.E., (IMHAN), I.M.H.A.N., include, I.c.a.,

2018. Tackling Hypotheticals in Helminth Genomes. Trends Parasitol 34, 179-183.

Palmeira, A., Sousa, E., Vasconcelos, M.H., Pinto, M.M., 2012. Three decades of P-gp

inhibitors: skimming through several generations and scaffolds. Curr Med Chem 19,

1946-2025.

Peachey, L.E., Pinchbeck, G.L., Matthews, J.B., Burden, F.A., Lespine, A., von Samson-

Himmelstjerna, G., Krücken, J., Hodgkinson, J.E., 2017. P-glycoproteins play a role in

ivermectin resistance in cyathostomins. Int J Parasitol Drugs Drug Resist 7, 388-398.

Prichard, R., Ménez, C., Lespine, A., 2012. Moxidectin and the avermectins: Consanguinity but

not identity. Int J Parasitol Drugs Drug Resist 2, 134-153.

Prichard, R.K., Roulet, A., 2007. ABC transporters and beta-tubulin in macrocyclic lactone

resistance: prospects for marker development. Parasitology 134, 1123-1132.

Raza, A., Bagnall, N.H., Jabbar, A., Kopp, S.R., Kotze, A.C., 2016a. Increased expression of

ATP binding cassette transporter genes following exposure of Haemonchus contortus

larvae to a high concentration of monepantel in vitro. Parasit Vectors 9, 522.

Raza, A., Kopp, S.R., Bagnall, N.H., Jabbar, A., Kotze, A.C., 2016b. Effects of in vitro exposure

to ivermectin and levamisole on the expression patterns of ABC transporters in

Haemonchus contortus larvae. Int J Parasitol Drugs Drug Resist 6, 103-115.

Raza, A., Kopp, S.R., Jabbar, A., Kotze, A.C., 2015. Effects of third generation P-glycoprotein

inhibitors on the sensitivity of drug-resistant and -susceptible isolates of Haemonchus

contortus to anthelmintics in vitro. Vet Parasitol 211, 80-88.

Raza, A., Kopp, S.R., Kotze, A.C., 2016c. Synergism between ivermectin and the tyrosine

kinase/P-glycoprotein inhibitor crizotinib against Haemonchus contortus larvae in vitro.

Vet Parasitol 227, 64-68.

Riou, M., Guégnard, F., Sizaret, P.Y., Le Vern, Y., Kerboeuf, D., 2010. Drug resistance is

affected by colocalization of P-glycoproteins in raft-like structures unexpected in

eggshells of the nematode Haemonchus contortus. Biochem Cell Biol 88, 459-467.

Riou, M., Koch, C., Delaleu, B., Berthon, P., Kerboeuf, D., 2005. Immunolocalisation of an

ABC transporter, P-glycoprotein, in the eggshells and cuticles of free-living and parasitic

stages of Haemonchus contortus. Parasitol Res 96, 142-148.

Roberts, A., Trapnell, C., Donaghey, J., Rinn, J.L., Pachter, L., 2011. Improving RNA-Seq

expression estimates by correcting for fragment bias. Genome Biol 12, R22.

Romsicki, Y., Sharom, F.J., 2001. Phospholipid flippase activity of the reconstituted P-

glycoprotein multidrug transporter. Biochemistry 40, 6937-6947.

Rothwell, J.T., Sangster, N.C., 1993. An in vitro assay utilising parasitic larval Haemonchus

contortus to detect resistance to closantel and other anthelmintics. Int J Parasitol 23, 573-

578.

Page 50: P-glycoprotein drug transporters in the parasitic

39

Sangster, N.C., 1994. P-glycoproteins in nematodes. Parasitol Today 10, 319-322.

Sangster, N.C., Bannan, S.C., Weiss, A.S., Nulf, S.C., Klein, R.D., Geary, T.G., 1999.

Haemonchus contortus: sequence heterogeneity of internucleotide binding domains from

P-glycoproteins. Exp Parasitol 91, 250-257.

Sarai, R.S., Kopp, S.R., Coleman, G.T., Kotze, A.C., 2013. Acetylcholine receptor subunit and

P-glycoprotein transcription patterns in levamisole-susceptible and -resistant

Haemonchus contortus. Int J Parasitol Drugs Drug Resist 3, 51-58.

Schwartz, M.S., Benci, J.L., Selote, D.S., Sharma, A.K., Chen, A.G., Dang, H., Fares, H.,

Vatamaniuk, O.K., 2010. Detoxification of multiple heavy metals by a half-molecule

ABC transporter, HMT-1, and coelomocytes of Caenorhabditis elegans. PLoS One 5,

e9564.

Scotto, K.W., Egan, D.A., 1998. Transcriptional regulation of MDR genes. Cytotechnology 27,

257-269.

Shapiro, A.B., Ling, V., 1997. Extraction of Hoechst 33342 from the cytoplasmic leaflet of the

plasma membrane by P-glycoprotein. Eur J Biochem 250, 122-129.

Sharom, F.J., 2014. Complex Interplay between the P-Glycoprotein Multidrug Efflux Pump and

the Membrane: Its Role in Modulating Protein Function. Front Oncol 4, 41.

Sheps, J.A., Ralph, S., Zhao, Z., Baillie, D.L., Ling, V., 2004. The ABC transporter gene family

of Caenorhabditis elegans has implications for the evolutionary dynamics of multidrug

resistance in eukaryotes. Genome Biol 5, R15.

Shtil, A.A., Azare, J., 2005. Redundancy of biological regulation as the basis of emergence of

multidrug resistance. Int Rev Cytol 246, 1-29.

Silva, R., Vilas-Boas, V., Carmo, H., Dinis-Oliveira, R.J., Carvalho, F., de Lourdes Bastos, M.,

Remião, F., 2015. Modulation of P-glycoprotein efflux pump: induction and activation as

a therapeutic strategy. Pharmacol Ther 149, 1-123.

Slocombe, J.O., de Gannes, R.V., Lake, M.C., 2007. Macrocyclic lactone-resistant Parascaris

equorum on stud farms in Canada and effectiveness of fenbendazole and pyrantel

pamoate. Vet Parasitol 145, 371-376.

Smith, J.M., Prichard, R.K., 2002. Localization of p-glycoprotein mRNA in the tissues of

Haemonchus contortus adult worms and its relative abundance in drug-selected and

susceptible strains. J Parasitol 88, 612-620.

Srinivasan, D.G., Fisk, R.M., Xu, H., van den Heuvel, S., 2003. A complex of LIN-5 and GPR

proteins regulates G protein signaling and spindle function in C elegans. Genes Dev 17,

1225-1239.

Stergiou, L., Hengartner, M.O., 2004. Death and more: DNA damage response pathways in the

nematode C. elegans. Cell Death Differ 11, 21-28.

Page 51: P-glycoprotein drug transporters in the parasitic

40

Stitt, L.E., Tompkins, J.B., Dooley, L.A., Ardelli, B.F., 2011. ABC transporters influence

sensitivity of Brugia malayi to moxidectin and have potential roles in drug resistance.

Exp Parasitol 129, 137-144.

Stouch, T.R., Gudmundsson, O., 2002. Progress in understanding the structure-activity

relationships of P-glycoprotein. Adv Drug Deliv Rev 54, 315-328.

Stringham, E., Pujol, N., Vandekerckhove, J., Bogaert, T., 2002. unc-53 controls longitudinal

migration in C. elegans. Development 129, 3367-3379.

Sutherland, I.A., Leathwick, D.M., 2011. Anthelmintic resistance in nematode parasites of cattle:

a global issue? Trends Parasitol 27, 176-181.

Tandon, R., Kaplan, R.M., 2004. Evaluation of a larval development assay (DrenchRite) for the

detection of anthelmintic resistance in cyathostomin nematodes of horses. Vet Parasitol

121, 125-142.

Tang, F., Horie, K., Borchardt, R.T., 2002. Are MDCK cells transfected with the human MDR1

gene a good model of the human intestinal mucosa? Pharm Res 19, 765-772.

Tompkins, J.B., Stitt, L.E., Ardelli, B.F., 2010. Brugia malayi: in vitro effects of ivermectin and

moxidectin on adults and microfilariae. Exp Parasitol 124, 394-402.

Tompkins, J.B., Stitt, L.E., Morrissette, A.M., Ardelli, B.F., 2011. The role of Brugia malayi

ATP-binding cassette (ABC) transporters in potentiating drug sensitivity. Parasitol Res

109, 1311-1322.

Turnbull, F., Jonsson, N.N., Kenyon, F., Skuce, P.J., Bisset, S.A., 2018. P-glycoprotein-9 and

macrocyclic lactone resistance status in selected strains of the ovine gastrointestinal

nematode, Teladorsagia circumcincta. Int J Parasitol Drugs Drug Resist 8, 70-80.

Tydén, E., Skarin, M., Höglund, J., 2014. Gene expression of ABC transporters in Cooperia

oncophora after field and laboratory selection with macrocyclic lactones. Mol Biochem

Parasitol 198, 66-70.

Tydén, E., Tallkvist, J., Tjälve, H., Larsson, P., 2009. P-glycoprotein in intestines, liver, kidney

and lymphocytes in horse. J Vet Pharmacol Ther 32, 167-176.

Tyrrell, K.L., Dobson, R.J., Stein, P.A., Walkden-Brown, S.W., 2002. The effects of ivermectin

and moxidectin on egg viability and larval development of ivermectin-resistant

Haemonchus contortus. Vet Parasitol 107, 85-93.

Vahedi, S., Lusvarghi, S., Pluchino, K., Shafrir, Y., Durell, S.R., Gottesman, M.M., Ambudkar,

S.V., 2018. Mapping discontinuous epitopes for MRK-16, UIC2 and 4E3 antibodies to

extracellular loops 1 and 4 of human P-glycoprotein. Sci Rep 8, 12716.

Van Der Heyden, S., Chiers, K., Ducatelle, R., 2009. Tissue distribution of p-glycoprotein in

cats. Anat Histol Embryol 38, 455-460.

VanDuyn, N., Nass, R., 2014. The putative multidrug resistance protein MRP-7 inhibits

methylmercury-associated animal toxicity and dopaminergic neurodegeneration in

Caenorhabditis elegans. J Neurochem 128, 962-974.

Page 52: P-glycoprotein drug transporters in the parasitic

41

Vatta, A.F., Dzimianski, M., Storey, B.E., Camus, M.S., Moorhead, A.R., Kaplan, R.M.,

Wolstenholme, A.J., 2014. Ivermectin-dependent attachment of neutrophils and

peripheral blood mononuclear cells to Dirofilaria immitis microfilariae in vitro. Vet

Parasitol 206, 38-42.

Virkel, G., Ballent, M., Lanusse, C., Lifschitz, A., 2019. Role of ABC Transporters in Veterinary

Medicine: Pharmaco- Toxicological Implications. Curr Med Chem 26, 1251-1269.

Várady, M., Corba, J., Letková, V., Kovác, G., 2009. Comparison of two versions of larval

development test to detect anthelmintic resistance in Haemonchus contortus. Vet

Parasitol 160, 267-271.

Wang, J., Gao, S., Mostovoy, Y., Kang, Y., Zagoskin, M., Sun, Y., Zhang, B., White, L.K.,

Easton, A., Nutman, T.B., Kwok, P.Y., Hu, S., Nielsen, M.K., Davis, R.E., 2017.

Comparative genome analysis of programmed DNA elimination in nematodes. Genome

Res 27, 2001-2014.

Wang, J., Mitreva, M., Berriman, M., Thorne, A., Magrini, V., Koutsovoulos, G., Kumar, S.,

Blaxter, M.L., Davis, R.E., 2012. Silencing of germline-expressed genes by DNA

elimination in somatic cells. Dev Cell 23, 1072-1080.

Ward, A.B., Szewczyk, P., Grimard, V., Lee, C.W., Martinez, L., Doshi, R., Caya, A., Villaluz,

M., Pardon, E., Cregger, C., Swartz, D.J., Falson, P.G., Urbatsch, I.L., Govaerts, C.,

Steyaert, J., Chang, G., 2013. Structures of P-glycoprotein reveal its conformational

flexibility and an epitope on the nucleotide-binding domain. Proc Natl Acad Sci U S A

110, 13386-13391.

Wen, P.C., Verhalen, B., Wilkens, S., Mchaourab, H.S., Tajkhorshid, E., 2013. On the origin of

large flexibility of P-glycoprotein in the inward-facing state. J Biol Chem 288, 19211-

19220.

Whittaker, J.H., Carlson, S.A., Jones, D.E., Brewer, M.T., 2017. Molecular mechanisms for

anthelmintic resistance in strongyle nematode parasites of veterinary importance. J Vet

Pharmacol Ther 40, 105-115.

Williamson, S.M., Storey, B., Howell, S., Harper, K.M., Kaplan, R.M., Wolstenholme, A.J.,

2011. Candidate anthelmintic resistance-associated gene expression and sequence

polymorphisms in a triple-resistant field isolate of Haemonchus contortus. Mol Biochem

Parasitol 180, 99-105.

Williamson, S.M., Wolstenholme, A.J., 2012. P-glycoproteins of Haemonchus contortus:

development of real-time PCR assays for gene expression studies. J Helminthol 86, 202-

208.

Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the mode of

action of the avermectin/milbemycin anthelmintics. Parasitology 131 Suppl, S85-95.

Wu, Y.C., Horvitz, H.R., 1998. The C. elegans cell corpse engulfment gene ced-7 encodes a

protein similar to ABC transporters. Cell 93, 951-960.

Page 53: P-glycoprotein drug transporters in the parasitic

42

Xu, M., Molento, M., Blackhall, W., Ribeiro, P., Beech, R., Prichard, R., 1998. Ivermectin

resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol

Biochem Parasitol 91, 327-335.

Yabe, T., Suzuki, N., Furukawa, T., Ishihara, T., Katsura, I., 2005. Multidrug resistance-

associated protein MRP-1 regulates dauer diapause by its export activity in

Caenorhabditis elegans. Development 132, 3197-3207.

Yagdiran, Y., Oskarsson, A., Knight, C.H., Tallkvist, J., 2016. ABC- and SLC-Transporters in

Murine and Bovine Mammary Epithelium--Effects of Prochloraz. PLoS One 11,

e0151904.

Yan, C., Bi, Y., Yin, D., Zhao, Z., 2012a. A method for rapid and simultaneous mapping of

genetic loci and introgression sizes in nematode species. PLoS One 7, e43770.

Yan, R., Urdaneta-Marquez, L., Keller, K., James, C.E., Davey, M.W., Prichard, R.K., 2012b.

The role of several ABC transporter genes in ivermectin resistance in Caenorhabditis

elegans. Vet Parasitol 190, 519-529.

Young, M.D., Wakefield, M.J., Smyth, G.K., Oshlack, A., 2010. Gene ontology analysis for

RNA-seq: accounting for selection bias. Genome Biol 11, R14.

Zhao, Z., Fang, L.L., Johnsen, R., Baillie, D.L., 2004. ATP-binding cassette protein E is

involved in gene transcription and translation in Caenorhabditis elegans. Biochem

Biophys Res Commun 323, 104-111.

Zhao, Z., Thomas, J.H., Chen, N., Sheps, J.A., Baillie, D.L., 2007. Comparative genomics and

adaptive selection of the ATP-binding-cassette gene family in caenorhabditis species.

Genetics 175, 1407-1418.

Zhu, X.Q., Korhonen, P.K., Cai, H., Young, N.D., Nejsum, P., von Samson-Himmelstjerna, G.,

Boag, P.R., Tan, P., Li, Q., Min, J., Yang, Y., Wang, X., Fang, X., Hall, R.S., Hofmann,

A., Sternberg, P.W., Jex, A.R., Gasser, R.B., 2015. Genetic blueprint of the zoonotic

pathogen Toxocara canis. Nat Commun 6, 6145.

Page 54: P-glycoprotein drug transporters in the parasitic

43

Figures and tables

Figure 2-1. UPGMA phylogenetic tree of ABC superfamily proteins annotated in the genomes of Toxocara canis and C. elegans.

Page 55: P-glycoprotein drug transporters in the parasitic

44

Figure 2-2. Secondary structure of C. elegans Pgp-1 after (Jin et al., 2012), created using RCSB

PDB (PDB: 4F4C) with DSSP, RESID and PSI-MOD tools (Garavelli, 2004; Kabsch and

Sander, 1983; Montecchi-Palazzi et al., 2008). The secondary structure has an estimated 54%

helical and 9% beta sheet structure.

Page 56: P-glycoprotein drug transporters in the parasitic

45

Figure 2-3. Transmembrane view of the X-ray diffraction crystal structure of C. elegans Pgp-1at

3.4Å in the inward facing confirmation created using NGL viewer PDB ID: 4F4C after (Jin et

al., 2012).

Page 57: P-glycoprotein drug transporters in the parasitic

46

Table 2-1. ABC transporter genes in humans and nematodes, derived from the KEGG pathways (Kanehisa et al., 2017).

Family Sub family HGNC name Function in humans Present in nematodes

Class 1 systems

DPL Drug, peptides and lipid

P-gp ABCB1 Efflux pump xenobiotic compounds with

broad substrate specificity, multiple drug

resistance

C. elegans, C. briggsae, B. malayi, L. loa, N.

americanus

TAP ABCB2 Transport of degraded cytosolic peptides

TAP ABCB3 Peptide transport

MDR/TAP ABCB4 Function unknown. Phosphatidylcholine

substrate

ABCB5 Transport of small ions, sugars, peptides C. elegans, C. briggsae

HMI/HMT ABCB6 Heavy metal importer / transporter;

porphyrin transport

C. elegans, T. spiralis, N. americanus

MDR/TAP ABCB7 Fe/S cluster transporter C. elegans, C. briggsae, B. malayi, L. loa, T.

spiralis, N. americanus

MDR/TAP ABCB8 Organic and inorganic molecule transport

from mitochondria

C. elegans, C. briggsae, N. americanus

MDR/TAP ABCB9 Peptide transport from cytosol to

lysosome

C. elegans, C. briggsae, B. malayi, L. loa, T.

spiralis, N. americanus

ABCB10 Mitochondrial protein; function unknown B. malayi, L. loa, N. americanus

ABCB11P Pseudogene in humans

OAD MRP ABCC1 Conjugate drug exporters, organic anion

and bile salt transporter

C. elegans, C. briggsae, L. loa, T. spiralis, N.

americanus

ABCC2 Drug resistance in mammalian cells

ABCC3 Organic anion transport in biliary and

intestinal excretion

ABCC4 Organic anion transport; ciliogenesis N. americanus

ABCC5 Multiple drug resistance; nucleotide

export

C. elegans, C. briggsae, B. malayi, L. loa, T.

spiralis, N. americanus

ABCC6 Cellular detoxification; extracellular

matrix deposition

Page 58: P-glycoprotein drug transporters in the parasitic

47

Table 2-1 continued

Family Sub family HGNC name Function in humans Present in nematodes

CFTR ABCC7 Chloride anion transport

SUR ABCC8 Potassium channel regulation

ABCC9 Potassium channels in cardiac and skeletal

muscle

ABCC10 Cellular detoxification, lipophilic anion

extrusion

T. spiralis, N. americanus

ABCC11 Transport of lipophilic anions, glucose, bile

salts, organic acids

ABCC12 Transmembrane transport

ABCC13 Pseudogene in humans

FAE ABCD very long chain Fatty Acid Export

ABCD1 Fatty acid transport in peroxisomes L. loa

ABCD2 Fatty acid transport in peroxisomes C. elegans, C. briggsae, N. americanus

ABCD3 Fatty acid transport in peroxisomes C. elegans, C. briggsae, N. americanus

ABCD4 Fatty acid transport in peroxisomes C. elegans, C. briggsae, B. malayi, L. loa, T.

spiralis, N. americanus

EPD WHITE ABCG or

BCRP

Eye pigment precursors and drugs C. elegans

Class 2 systems

RLI ABCE1 RNase L inhibitor in mammals

ART REG ABCF Translation regulation

Class 3 systems

DRA ABCA;

previously

ABC1

ABCA Exclusive to multicellular eukaryotes;

Lipid trafficking

ABCA1 Cholesterol efflux regulatory

protein/cholesterol metabolism

C. elegans, C. briggsae, B. malayi, L. loa, N.

americanus

Page 59: P-glycoprotein drug transporters in the parasitic

48

Table 2-1 continued

Family Sub family HGNC name Function in humans Present in nematodes

DRA ABCA ABCA2 Macrophage lipid metabolism and neural

development

ABCA3 Resistance to xenobiotics and engulfment

during programmed cell death

C. elegans, C. briggsae, L. loa, N.

americanus, T. spiralis

ABCA4 Retina photoreceptor specific ABC

transporter that transports N-retinylidene-

PE

T. spiralis

ABCA5 Possibly lysosomal trafficking; Substrate

and function unknown

ABCA6 Macrophage lipid homeostasis

ABCA7 Immune cell lipid homeostasis

ABCA8 Formation and maintenance of myelin;

possibly drug transport

ABCA9 Monocyte differentiation

ABCA10 Lipid transport

ABCA11P Pseudogene in humans

ABCA12 Lipid transport in skin

ABCA13 Lipid transport

ABCA17P Pseudogene in humans

ABCA14 to

ABCA17

Present in rodents only

*HGNC= Human Gene Nomenclature Committee

Page 60: P-glycoprotein drug transporters in the parasitic

49

Table 2-2. P-glycoprotein encoding genes in pathogenic nematodes of veterinary importance

Species Protein encoded Gene Reference

Clade V nematodes

Haemonchus contortus Pgp-2 /Pgp-A Hco-Pgp-2 (Xu et al., 1998)

Pgp-1 Hco-Pgp-1 (Le Jambre et al., 1999)

Pgp 3 Hco-Pgp-3 (Issouf et al., 2014; Raza et al., 2016b;

Williamson and Wolstenholme, 2012)

Pgp-4 Hco-Pgp-4 (Williamson and Wolstenholme, 2012)

Pgp-9.1 Hco-Pgp-9.1 (Issouf et al., 2014; Raza et al., 2016b;

Williamson and Wolstenholme, 2012)

Pgp-9.2 Hco-Pgp-9.2 (Issouf et al., 2014; Raza et al., 2016b)

Pgp-9.3 Hco-Pgp-9.3 (Issouf et al., 2014; Raza et al., 2016b)

Pgp-10 Hco-Pgp-10 (Issouf et al., 2014; Raza et al., 2016b;

Williamson and Wolstenholme, 2012)

Pgp-11 Hco-Pgp-11 (Issouf et al., 2014; Raza et al., 2016b;

Williamson and Wolstenholme, 2012)

Pgp-12 Hco-Pgp-12 (Raza et al., 2016b)

Pgp-13 Hco-Pgp-13 (David et al., 2018)

Pgp-14 Hco-Pgp-14 (Issouf et al., 2014; Raza et al., 2016b;

Williamson and Wolstenholme, 2012)

Pgp-16 Hco-Pgp-16 (Issouf et al., 2014; Raza et al., 2016b)

Pgp-17 Hco-Pgp-17 (Laing et al., 2016; Maté et al., 2018)

Oesophagostomum

dentatum

2 P-gps (Laing et al., 2016)

Necator americanus Pgp10 tandem duplication (Laing et al., 2016)

Novel Pgp not present in H. contortus

or C. elegans

(Laing et al., 2016)

Teladorsagia

circumcincta

Pgp-2 Tci-Pgp-2 (Dicker et al., 2011b)

Pgp-3 or 4 Tci-Pgp-3 (Dicker et al., 2011b)

Pgp-9 Tci-Pgp-9 (Dicker et al., 2011b; Turnbull et al., 2018)

Putative Pgp10 Tci-Pgp-10 (Dicker et al., 2011b)

Page 61: P-glycoprotein drug transporters in the parasitic

50

Table 2-2 continued

Species Protein encoded Gene Reference

Cooperia oncophora Pgp-1 Con-Pgp-1 (De Graef et al., 2013)

Pgp-2 Con-Pgp-2 (Demeler et al., 2013)

Pgp-3 Con-Pgp-3 (Demeler et al., 2013)

Pgp-9 Con-Pgp-9 (Areskog et al., 2013; Tydén et al., 2014)

Pgp-11 Con-Pgp-11 (De Graef et al., 2013; Tydén et al., 2014)

Pgp-12 Con-Pgp-12 (Demeler et al., 2013; Tydén et al., 2014)

Pgp-16 Con-Pgp-16 (Demeler et al., 2013; Tydén et al., 2014)

Cylicocyclus elongatus Pgp-9 Ceg-Pgp-9 (Kaschny et al., 2015; Peachey et al., 2017)

Other cyathostome spp. (Drogemuller et al., 2004)

Clade III nematodes

Parascaris spp. Pgp-11 Peq-Pgp-11 (Janssen et al., 2013a; Janssen et al., 2015;

Jesudoss Chelladurai and Brewer, 2019)

Pgp-16 Peq-Pgp-16 (Janssen et al., 2013a; Jesudoss Chelladurai

and Brewer, 2019)

Dirofilaria immitis Pgp-3 Dim-Pgp-3 (Bourguinat et al., 2016)

Pgp-10 Dim-Pgp-10 (Bourguinat et al., 2016)

Pgp-11 Dim-Pgp-11 (Bourguinat et al., 2016; Mani et al., 2016)

Page 62: P-glycoprotein drug transporters in the parasitic

51

Table 2-3. Summary of gene expression and polymorphism studies in parasitic nematodes of veterinary importance.

Nematode Assay and experimental set-up Significant result Reference

Haemonchus

contortus

Restriction fragment length polymorphism of

Hco-Pgp-2 in adult male worms from IVM or

MOX selected and unselected strains

Polymorphism in P-gp genes as a result of

allelic differences in genes may be associated

with IVM and MOX resistance.

(Blackhall et

al., 1998a)

(a) Northern blotting of RNA from eggs from

IVM selected and unselected strains. (b)

Southern blotting of DNA on adults of both

strains

Increased expression of P-gp mRNA in IVM-

selected strain. Qualitative differences in DNA

restriction patterns between IVM selected strain

and unselected strain.

(Xu et al.,

1998)

(a) Cloning and sequencing of internucleotide

binding domains. (b) Northern blotting of RNA

from eggs, immature adult and adult males from

IVM susceptible strain. (c) Southern blotting of

DNA from adult worms of IVM resistant strain

Heterogeneity in IBDs of Hco-Pgps found. P-gp

mRNA is developmentally regulated and

differentially expressed in life stages. There is

evidence for P-gp involvement in IVM

resistance.

(Sangster et al.,

1999)

PCR followed by RFLP of Hco-Pgp-2 in

cambendazole selected and unselected strains

Difference in allelic frequency between

cambendazole selected and unselected strains

(Blackhall et

al., 2008)

PCR followed by RFLP of Hco-Pgp-9 in IVM

selected and unselected worms

Allelic frequency increase in ML selected

worms compared to unselected

(Le Jambre et

al., 1999)

Southern blotting to analyze restriction

fragment length polymorphism between

susceptible and resistant strains

First study to show that P-gps did not show any

selection in BZ or LEV resistance

(Kwa et al.,

1998)

Page 63: P-glycoprotein drug transporters in the parasitic

52

Table 2-3 continued

Nematode Assay and experimental set-up Significant result Reference

Haemonchus

contortus

qPCR to analyze P-gp transcription patterns in an

isolate resistant to benzimidazole, levamisole and

avermectins

Hco-Pgp-2 and -9 levels were significantly

upregulated; Hco-Pgp-1 level was

downregulated in the resistant strain

compared to susceptible lab isolate. No

changes in expression levels of Hco-pgp-3, -

4, -10, -11, -12 or -14 were noted.

(Williamson et

al., 2011)

qPCR to analyze P-gp transcription patterns in

isolate experimentally selected for IVM

resistance over 3 generations

In L3 of the selected strain, no significant

changes in expression level were found in

Hco-Pgp-1, -2, -3, -4, -9, -10, -11, -12 and -

14.

(Williamson

and

Wolstenholme,

2012)

qPCR to analyze P-gp transcription pattern of

Hco-Pgp-2 in resistant isolate treated in vivo with

MLs

Only ivermectin, not abamectin or moxidectin

caused upregulation of P-gp expression in

adults

(Lloberas et al.,

2013)

qPCR to analyze P-gp transcription patterns in

levamisole resistant strains

No consistent changes in P-gp gene

expression seen

(Sarai et al.,

2013)

qPCR to analyze P-gp transcription patterns in H.

contortus larvae exposed to eosinophil granules

Hco-Pgp-3 and -16 were upregulated when

larvae were exposed to eosinophil granules

(Issouf et al.,

2014)

qPCR to analyze P-gp transcription patterns in

IVM resistant adult worms from lambs 14 days

post treatment

IVM dosed at 10x recommended dose did not

modify P-gp homolog expression

(Alvarez et al.,

2015)

Page 64: P-glycoprotein drug transporters in the parasitic

53

Table 2-3 continued

Nematode Assay and experimental set-up Significant result Reference

Haemonchus

contortus

qPCR to analyze P-gp transcription patterns in

susceptible worms exposed to monepantel

Transcription of Hco-pgp-11, -12 and -14 genes

were upregulated, with a sustained increase in

Hco-pgp-11 after drug removal

(Raza et al.,

2016a)

qPCR to analyze P-gp transcription patterns in

L3s hatched from eggs derived from sheep feces

of an isolate resistant to benzimidazoles,

closantel, levamisole and ivermectin

L3s from resistant isolate expressed

significantly higher levels of Hco-Pgp-1, -2, -3,

-9.1, -9.2, -9.3, -10, -11, -12, -14 and -16

compared to susceptible isolate

(Raza et al.,

2016b)

qPCR to analyze P-gp transcription patterns in

L3s exposed in vitro to drugs for 3 – 6 hrs.

No changes in the susceptible isolate following

exposure to IVM for 3 hrs. or 6 hrs. Hco-pgp-2,

-9.1, -11, -1, -10 upregulated in resistant isolate

after IVM or LEV exposure for 3 hrs. but not 6

hrs. LEV exposure also upregulated Hco-pgp11

at 6hrs.

(Raza et al.,

2016b)

RNA-seq and qPCR to analyze P-gp gene

transcription in adult males and females after in

vivo exposure to 10x the therapeutic dose

Hco-pgp-3 and -9 were downregulated and

Hco-Pgp-2 was upregulated over 24 hrs after in

vivo IVM exposure. Hco-pgp-1 and -11 levels

did not change over time

(Maté et al.,

2018)

Page 65: P-glycoprotein drug transporters in the parasitic

54

Table 2-3 continued

Nematode Assay and experimental set-up Significant result Reference

Haemonchus

contortus

(a) qPCR to analyze basal P-gp transcription

patterns in adult male and female worms. (b)

qPCR to analyze transcription response to low

doses of IVM in vitro in adult males and

females.

Hco-Pgp-2 was the highest basal transcription

level in females while Hco-Pgp-3 and -9.1 had

the highest basal transcription levels in males.

Significant upregulation of Hco-pgp-9.2 in

IVM exposed males and of Hco-pgp-10 and -11

in IVM exposed females

(Kellerová et

al., 2019)

Cooperia

oncophora

SNP analysis of Con-Pgp-2 and Con-Pgp-3 in

various field isolates

32 SNPs found among 6 isolates that caused

increase/ decrease/ complete change in amino

acid variability in Con-Pgp-2, while Con-Pgp-3

had low to no variability and was highly

conserved

(Demeler et al.,

2013)

Reverse transcription-qPCR to analyze

transcription response to selection with IVM in

vivo 10 days post treatment in IVM selected and

unselected populations.

Amplified fragment length polymorphism

(AFLP) to detect gene diversity variations

between pre and post treatment populations.

Con-Pgp-9 expression was higher in female

worms than male worms. No differences in

expression pattern between IVM selected and

unselected groups were observed.

No differences in gene diversity between pre

and post treatment populations were observed.

(Areskog et al.,

2013)

Page 66: P-glycoprotein drug transporters in the parasitic

55

Table 2-3 continued

Nematode Assay and experimental set-up Significant result Reference

qPCR to analyze basal P-gp expression after in

vivo and in vitro ML exposure of IVM resistant

and susceptible isolates

Basal levels of P-gp expression in eggs, L3 and

adult was not significantly different between

resistant and susceptible worms. Significant

upregulation of Con-pgp-11 was found in IVM-

resistant adults exposed to IVM. Con-pgp-2 and

-11 were upregulated IVM-resistant adults

exposed to MOX. Con-pgp-12 and Con-pgp-16

were upregulated in IVM-exposed susceptible

and IVM-resistant L3s.

(De Graef et

al., 2013)

qPCR to analyze transcription in adult worms

of a field selected isolate exposed to MLs in

vivo

Con-pgp-9, -11, -12 and -16 basal expression

levels were higher in male and female worms in

field-selected isolate compared to susceptible

isolate. Con-Pgp-16 was upregulated after

treatment with ivermectin in field and lab

selected isolates. No changes were induced by

doramectin.

(Tydén et al.,

2014)

Teladorsagia

circumcincta

qPCR to analyze transcription of Tci-pgp-9 in

susceptible and triple resistant (FBZ, LEV,

IVM) field isolate

Triple resistant field isolate had higher levels of

Tci-pgp-9 than the susceptible isolate at all life

stages (eggs, L1, exsheathed L3, L4, adults)

(Dicker et al.,

2011b)

Page 67: P-glycoprotein drug transporters in the parasitic

56

Table 2-3 continued

Nematode Assay and experimental set-up Significant result Reference

Teladorsagia

circumcincta

SNP analysis of partial Tci-pgp-9 in

susceptible and triple resistant (FBZ,

LEV, IVM) field isolate

Partial sequence analysis of the second internuclotide

binding domain of Tci-pgp-9 revealed several non-coding

SNPs between the susceptible and triple resistant isolates

(Dicker et al.,

2011b)

Transcriptomic (EST) analysis

following in vitro exposure of

resistant adult worms to IVM

P-gp genes were poorly represented in the exposed and

unexposed EST datasets

(Dicker et al.,

2011a)

Sequence and SNP analysis of

complete Tci-pgp-9 in IVM, LEV and

BZ isolate

9 non-synonymous SNPs were found in the multidrug

resistant isolate. High intra-worm allelic variability in IBD

region was found. Selection for specific gene variants

observed in resistant strain.

(Turnbull et

al., 2018)

Mixed spp. of

Cyathostomins

qPCR to quantify transcription of

Pgp-9 in mixed population L3s after

exposure to IVM in vitro

Higher levels of Pgp-9 transcription was found in IVM

resistant isolate after IVM exposure compared to the IVM

sensitive isolate

(Peachey et al.,

2017)

Parascaris

spp.

qPCR to quantify expression of Peq-

pgp-11 and -16 in eggs, pre-adults

and adults of resistant and susceptible

populations.

SNP analysis of Peq-Pgp-11 in

resistant and susceptible populations

No significant differences P-gp expression were found in

embryonated eggs derived from ML resistant and

susceptible populations. Peq-pgp-11 was overexpressed in

preadults resistant to MLs. IVM incubation of adults did

not affect Peq-pgp-11 and -16 expression. Three SNPs

were identified in Peq-Pgp-11 and were associated with

ML resistance.

(Janssen et al.,

2013a)

Page 68: P-glycoprotein drug transporters in the parasitic

57

Table 2-3 continued

Nematode Assay and experimental set-up Significant result Reference

Dirofilaria

immitis

SNP analysis of Dim-Pgp-11 Partial sequence analysis of Dim-Pgp-11 revealed 2 SNPs

(one in the coding region in the IBD and one in non-coding

region) between putative IVM resistant and susceptible

isolates. Diplotype analysis revealed significant high

presence of GG-GG in resistant isolates

(Bourguinat et

al., 2011b)

qPCR to quantify expression of Dim-

Pgp-10, Dim-Pgp-11 in male and

female adults treated in vitro with

IVM, doxycycline or both

In IVM treated females, both genes were downregulated,

but were upregulated when treated with DOX alone.

Combination therapy caused upregulation of Dim-Pgp-10.

In IVM treated males, both genes were upregulated in

IVM treated and combination therapy but not when treated

with DOX alone.

(Lucchetti et

al., 2019)

Page 69: P-glycoprotein drug transporters in the parasitic

58

Table 2-4. Drug interaction studies of nematode P-gps in heterologous systems.

Model P-gp studied Assay used to study Inhibitors used Significant results Reference

Pig epithelial

kidney cell line -

LLC-PK1

Hco-Pgp-2 Rhodamine 123 and

Calcein-AM accumulation

in a ligand competition

assay

IVM, ABA,

MOX,

Valspodar

IVM and abamectin but not MOX

had inhibitory effect on R123

efflux similar to VSP. All three

MLs had an inhibitory effect on

Calcein-AM efflux

(Godoy et

al., 2015b)

Hco-Pgp-9.1 Rhodamine 123

accumulation in a ligand

competition assay

IVM, ABA,

MOX, VSP

IVM and abamectin but not MOX

had inhibitory effect on R123

efflux, similar to VSP

(Godoy et

al., 2016)

Hco-Pgp-16 Rhodamine 123

accumulation in a ligand

competition assay

IVM, ABA,

MOX, VSP

IVM and abamectin and high

concentrations of moxidectin had

inhibitory effect on R123 efflux,

similar to VSP

(Godoy et

al., 2015a)

Dim-Pgp-11 Rhodamine 123 and

Hoechst 33342

accumulation in a ligand

competition

IVM, SEL,

MOX, MBO,

VSP

IVM and selamectin but not MOX

had inhibitory effect on R123 and

H33342 efflux

(Mani et al.,

2016)

Pichia pastoris Hco-Pgp-13 Vanadate sensitive

ATPase activity

IVM,

Actinomycin D

Inhibition by IVM and stimulation

of ATPase activity by ACD in a

concentration depended biphasic

manner

(David et

al., 2018)

Page 70: P-glycoprotein drug transporters in the parasitic

59

Table 2-4 continued

Model P-gp studied Assay used to study Inhibitors used Significant results Reference

Saccharomyces

cerevisiae lacking

seven endogenous

transporters

Pgp-9 from

Cylicocyclus

elongatus

Direct Growth assay Actinomycin D,

Daunorubicin,

Valinomycin,

Ketaconazole,

Thiabendazole

Ceg-Pgp-9 decreased yeast

susceptibility to Ket. EC50

was higher for actinomycin,

daunorubicin and

valinomycin. No differences

were found for TBZ

(Kaschny et

al., 2015)

Pgp-9 from

Cylicocyclus

elongatus

Indirect growth assay;

competitive killing assay

in the presence of

Ketoconazole

IVM, EPM, MOX,

SEL, DORA

Fungicidal effect of Ket was

significantly increased when

EPM, IVM and MOX, but not

SEL or DORA are added

Ceg-Pgp-9

Antibody binding in the

presence of drugs

IVM, MOX, SEL,

Daunorubicin

IVM, MOX, daunorubicin

increased binding of UIC2 to

yeast cells. Selamectin had no

effect.

C. elegans

deficient in Pgp11

Pgp-11

Parascaris

spp.

Thrashing assay IVM EC50 for IVM in transfected

strain of C. elegans was higher

than control strain

(Janssen et

al., 2015)

Page 71: P-glycoprotein drug transporters in the parasitic

60

Table 2-5. In vitro P-gp-drug interaction assays with whole organisms.

Organism Stage used Assay Results/comments Reference

Haemonchus

contortus

Eggs Rhodamine 123 accumulation in a

ligand competition assay using flow

cytometry

Higher levels of accumulation of R123

when verapamil was added to IVM

resistant strain eggs

(Kerboeuf et

al., 1999)

Eggs Rhodamine 123 accumulation in a

ligand competition assay

MLs except ivermectin stimulated P-gps (Kerboeuf and

Guégnard,

2011)

Eggs Rhodamine 123 accumulation after

exposure to eosinophil granules

Eosinophil granules caused a dose

dependent increase in R123 accumulation

(Issouf et al.,

2014)

Eggs and

L3s

Larval migration inhibition assay

with IVM and P-gp inhbitors.

Larval development assay

LMA: Third generation P-gp inhibitors

increased larval sensitivity to ivermectin.

Synergism seen between tariquidar and

IVM in the resistant strain in the LMA.

Synergism was also seen between

zosuquidar and IVM, and between

verapamil and IVM in larval development

assays.

(Raza et al.,

2015)

L3s Rhodamine 123 efflux

spectrophotometrically measured in

supernatant following ligand

competition assay

In vitro exposure to high doses of

monepantel caused increased efflux of

Rhodamine 123

(Raza et al.,

2016a)

Page 72: P-glycoprotein drug transporters in the parasitic

61

Table 2-5 continued

Organism Stage used Assay Results/comments Reference

Haemonchus

contortus

L3s Larval migration inhibition assay with

IVM or LEV dilutions after pre-

exposure to monepantel

Dose response curves obtained. In vitro

pre-exposure to high doses of monepantel

increased larval migration at high

concentrations of IVM but not LEV

(Raza et al.,

2016a)

L3s Rhodamine 123 efflux

spectrophotometrically measured in

supernatant following ligand

competition assay. Larval migration

inhibition assay in the presence of

different concentrations of drugs with

in vitro pre-exposure to IVM or LEV

In vitro exposure to IVM and LEV

increased efflux of Rhodamine 123.

Dose response curves obtained. In vitro

pre-exposure to high concentrations of

IVM increased larval motility through a

filter mesh system.

(Raza et al.,

2016b)

Eggs and

L3s

Larval development assay with IVM

and P-gp inhibitor. Larval migration

inhibition assay in the presence of

different concentrations of IVM and

P-gp inhibitor

Dose response curves obtained. In LDA,

crizotinib decreased IVM IC50 in both

susceptible and resistant strains. In LMIA,

crizotinib caused a 2.6 fold decrease in

IVM IC50 in the resistant but not

susceptible strain.

(Raza et al.,

2016c)

Eggs Larval development assay with ML

resistant strain against IVM, MOX,

EPR

Dose response curves obtained with MOX

having 29 fold and 280 fold lower EC50

than IVM and EPR

(Ménez et al.,

2016)

Page 73: P-glycoprotein drug transporters in the parasitic

62

Table 2-5 continued

Organism Stage used Assay Results/comments Reference

Adults HPLC analysis of flubendazole in

worms incubated verapamil

Flubendazole accumulation was not

affected by Ver in any strains

(Bártíková et

al., 2012)

Haemonchus

placei

L3s Larval migration inhibition assay in

the presence of different

concentrations of IVM with fixed

concentrations of P-gp modulators

Increased IVM efficacy with a reduction in

EC50 was seen with cyclosporine A,

dexamethasone, verapamil, vinblastine,

ceftriaxone, quercetin, trifluperazine

(Heckler et

al., 2014)

T. circumcinta

and H. contortus

L1s Larval feeding inhibition by IVM in

the presence and absence of P-gp

interfering agents with FITC-E. coli

Resistant worms required more IVM than

sensitive worms to arrest feeding behavior.

P-gp inhibitors decreased larval feeding.

(Bartley et

al., 2009)

C. oncophora Eggs (Eggs

and larvae

counted in

output)

Larval development assay with IVM

VPL

Dose response curves obtained. Resistance

worms had higher EC50 than susceptible

worms in the absence of VPL. In the

presence of VPL, resistance worms had

lower EC50s than susceptible strain.

(Demeler et

al., 2013)

Sheathed

L3s

Larval migration inhibition assay

(LMIA) with IVM VPL

Dose response curves obtained. IVM

resistant isolates had higher EC50 in the

presence of IVM only. VPL addition

lowered the EC50 below that of the

susceptible isolate.

(Demeler et

al., 2013)

Page 74: P-glycoprotein drug transporters in the parasitic

63

Table 2-5 continued

Organism Stage used Assay Results/comments Reference

C. oncophora and

Ostertagia

ostertagi

Eggs

L3s

Larval development assay

Larval migration inhibition

Dose response curves obtained. Verapamil

and piperonyl butoxide caused a decrease

in EC50 of ivermectin

In LMIA, verapamil increases

susceptibility of ivermectin

(AlGusbi et

al., 2014)

Mixed population

of Cyathostomins

Eggs and

L3s

Larval development assay

Larval migration inhibition test

Dose response curves obtained. P-gp

inhibitors - Ketaconzole and Pluronic 85

caused a higher reduction in EC50 in

susceptible population than in the resistant

population in LDA.

Ketaconazole and ivermectin-aglycone

caused a decrease in EC50 in the resistant

population only in LMIT

(Peachey et

al., 2017)

Heligmosomoides

bakeri

Eggs and

L3

Rhodamine 123 accumulation

measured as % of R123 positive eggs

following a ligand competition assay

Verapamil co-incubated with

phytochemicals had an additive lethal

effect on eggs and larvae

(Doligalska

et al., 2011)

Page 75: P-glycoprotein drug transporters in the parasitic

64

Table 2-5 continued

Organism Stage used Assay Results/comments Reference

Brugia

malayi

Male and

female

adults

Microfilaria

Motility measured as no. of

movements per minute in adults with

IVM verapamil, cyclosporine A,

vinblastine, daunorubicin

Motility was significantly inhibited in

males and females when P-gp inhibitors

were co-administered with ivermectin.

Motility of microfilariae were lower when

co-incubated with IVM + verapamil,

quinidine, vincristine, vinblastine,

colchicine, actinomycin d, daunorubicin,

doxorubicin, etoposide, rhodamine and

forskolin over a period of 7 days

(Tompkins et al.,

2011)

Male and

female

adults

Microfilaria

Motility measured as no. of

movements per minute in adults with

MOX Verapamil or daunorubicin

Mf treated with Mox P-gp

inhibitors

Motility was significantly inhibited in

females only but not males when inhibitors

were co-incubated .

Motility of microfilariae were lower when

co-incubated with MOX + verapamil,

vinblastine, colchicine, etoposide,

forskolin.

(Stitt et al., 2011)

Page 76: P-glycoprotein drug transporters in the parasitic

65

Table 2-6. Localization studies in nematodes of veterinary importance.

Parasite Life stage Assay and reagent Results/comments Reference

Haemonchus

contortus

In situ hybridization using a labelled

cDNA probe

P-gps were mainly expressed in the intestine

and lateral cords. no differences between

ML-selected and susceptible strains

(Smith and

Prichard,

2002)

Eggs Flow cytometry with mammalian P-gp

antibodies UIC2 and C219

P-gps detected on eggshells (Kerboeuf et

al., 2003)

Eggs, L1s.

L2s, L3s,

adults

Indirect immunofluorescence with

mammalian P-gp antibody UIC2

P-gps expressed in external layers of the

eggshell, sheath of L3 larvae, cuticles of

larval stages, intestinal cells of male worms,

intestinal cells of L1 and L2 larvae

(Riou et al.,

2005)

Eggs Flow cytometry with mammalian P-gp

antibody UIC2

P-gps colocalized with raft-like cholesterol-

enriched microdomains on the egg shells

(Riou et al.,

2010)

Cooperia

oncophora

Eggs Flow cytometry with mammalian P-gp

antibody UIC2

Higher binding seen with resistant eggs than

with susceptible eggs

(Demeler et

al., 2013)

Parascaris

spp.

Adults Dissection of worm and qPCR for P-

gp expression

Peq-pgp-11 expression was highest in the

intestines in both males and females. Peq-

pgp-16 expression was highest in the body

wall of males.

(Janssen et al.,

2013a)

Page 77: P-glycoprotein drug transporters in the parasitic

66

Table 2-7. In vivo studies of effect on P-gps when MLs are co-administrated with P-gp inhibitors.

Parasite Host animal

used

P-gp inhibitor used Results Reference

Haemonchus contortus

Jird Verapamil with IVM or

MOX

Efficacy of IVM determined by worm count at

necropsy increased from 80% (without Ver) to

93% (with Ver) and MOX from 70% (without

Ver) to 96% (with Ver)

(Xu et al.,

1998)

Sheep Loperamide with IVM FECRT improved from 78.6% with IVM alone to

96% with IVM+LPM. Worm counts improved

from 0% efficacy with IVM alone to 72.5% with

IVM+LPM

(Lifschitz et

al., 2010a)

Sheep IVM + Ketaconazole

IVM + Pluronic 85

Worm burden in sheep given IVM with P-gp

inhibitor decreased by 16% and 51%

(Bartley et

al., 2012)

Trichostrongylus axei Sheep Loperamide with IVM Worm counts improved from 98.6% efficacy with

IVM alone to 99.6% with IVM+LPM

(Lifschitz et

al., 2010a)

Trichostrongylus

colubriformis

Sheep Loperamide with IVM Worm counts improved from 77.9% efficacy with

IVM alone to 96.3% with IVM+LPM

(Lifschitz et

al., 2010a)

Page 78: P-glycoprotein drug transporters in the parasitic

67

Table 2-7 continued

Parasite Host animal

used

P-gp inhibitor used Results Reference

Nematodirus spp. Sheep Loperamide with IVM Worm counts improved from 85.5% efficacy with

IVM alone to 93% with IVM+LPM

(Lifschitz et

al., 2010a)

Mixed infection with

resistant Ostertagia,

Trichostrongylus,

Cooperia,

Haemonchus

Cattle Loperamide with IVM

or MOX

FECRT improved from 23.5% with IVM alone to

50% with IVM+LPM. FECRT improved from

69% with MOX alone to 87.1% with MOX+LPM.

(Lifschitz et

al., 2010b)

Page 79: P-glycoprotein drug transporters in the parasitic

68

CHAPTER 3. EFFECTS OF IN VITRO AND IN VIVO EXPOSURE TO

MACROCYCLIC LACTONES ON THE EXPRESSION PATTERNS OF P-

GLYCOPROTEINS IN TOXOCARA CANIS LARVAE

Jeba R J Jesudoss Chelladurai, Alan Robertson, Matt T Brewer

Modified from a manuscript to be submitted

Abstract

Toxocara canis has a complex lifecycle that includes somatic larval stages in the

tissues of adult dogs, paratenic hosts and humans. These larvae are tolerant to therapeutic doses

of macrocyclic lactones. We investigated hatched T. canis L3s and observed that ivermectin did

not halt motility of larvae. However, a combination of ivermectin and the P-glycoprotein

inhibitor verapamil decreased the area and wavelength during swimming motility of larvae.

Whole organism assays revealed total P-glycoprotein efflux activity could be mitigated by drugs

known to inhibit these proteins in mammals, but in an unusual rank order of potency. Analysis of

the T. canis draft genome resulted in the identification of 13 annotated P-gp genes which enabled

naming of genes and isoforms. Quantitative PCR was used to measure P-glycoprotein mRNA

expression in adult worms, hatched larvae, and somatic larvae derived from experimentally

infected mice. 10 of the predicted genes were expressed in adults and hatched larvae, and 6 were

expressed in visceral larvae. There were no differences in expression patterns between adults and

hatched larvae. Tca-Pgp-10 was significantly upregulated in somatic larvae from mice treated

with moxidectin. Further studies are needed to understand the role of the different ATP binding

cassette transporters leading to macrocyclic lactone tolerance in T. canis.

1. Introduction

Toxocara canis is a cosmopolitan zoonotic nematode of dogs. T. canis larvae are

transplacentally transferred from bitches to neonatal puppies and after a complex hepato-

pulmonary-tracheal migration develop to adult worms in the small intestines. In older puppies

Page 80: P-glycoprotein drug transporters in the parasitic

69

and adult dogs, larvae that hatch following the ingestion of infective eggs migrate to the skeletal

muscles, kidneys, liver and heart and persist for years as somatic larvae (Schnieder et al., 2011).

Somatic larvae in the tissues of bitches are reactivated during pregnancy and are a reservoir of

infection for up to three litters following a single infection (Soulsby, 1983). Prenatal

transmission of reactivated larvae has been stopped in infections using a few experimental drug

regimens (Burke and Roberson, 1983; Krämer et al., 2006; Payne and Ridley, 1999). However,

somatic non-reactivated larvae are not killed by macrocyclic lactones in dogs. Somatic larvae in

paratenic hosts such as mice are not amenable to death by ivermectin (Carrillo and Barriga,

1987; Fok and Kassai, 1998). Larval migration to somatic musculature or brain allowed

survivability and protection against drugs (Abo-Shehada and Herbert, 1984). These studies point

to an unknown mechanism of tolerance to the macrocyclic lactones exhibited by somatic T. canis

larvae to the macrocyclic lactones.

Ivermectin (IVM) is multimodal in its mechanism and in the effects that it produces on

nematodes. Ivermectin acts on glutamate-gated chloride channels, causing hyperpolarization of

muscles resulting in pharyngeal muscle paralysis, ES pore-associated muscle paralysis, and

inhibition of larval motility (Geary et al., 1993; Gill et al., 1991; Moreno et al., 2010). It

potentiates the adherence of mononuclear cells and activated neutrophils to nematode cuticle

(Vatta et al., 2014). IVM and other macrocyclic lactones are also substrates of P-glycoproteins

and multidrug resistance proteins (MRPs) that efflux xenobiotics from cells (Lespine et al., 2006;

Lespine et al., 2007).

P-glycoproteins are encoded by genes from the ATP-binding cassette (ABC) class B1

family. Typically, one or two isoforms of the ABCB1 gene are expressed in vertebrates. In

contrast, nematodes commonly express multiple ABCB1 genes. Gene identification, assessment

Page 81: P-glycoprotein drug transporters in the parasitic

70

of expression and function have been carried out for a few nematode P-gps (Godoy et al.,

2015b). The role of P-glycoproteins in anthelmintic resistance in ruminant gastrointestinal

nematodes and filarid nematodes have been widely studied (Bourguinat et al., 2016; Lespine et

al., 2012). Several in vitro studies have demonstrated that P-gp substrates and blockers can

compete for efflux at the binding site and potentiate the others’ effects (Kaschny et al., 2015;

Raza et al., 2016c). Initial preliminary observations of Toxocara canis larval motility in the

presence of P-gp substrate – ivermectin, and P-gp competitive inhibitor – verapamil led to the

investigation of P-gps. However, the identity, expression and function of genes encoding P-

glycoproteins in T. canis are unknown.

Based on our observations on larval motility in the face of ML treatment, we

hypothesized that P-glycoproteins may play a role in larval tolerance to MLs, since somatic

larvae of T. canis are present at sites where macrocyclic lactones are bioavailable. Additionally,

we hypothesized that known inhibitors may affect function of P-gp in T. canis. To those ends,

the aim of this study was to identify P-gp genes in T. canis by bioinformatically mining the draft

genome and to evaluate constitutive P-gp gene expression in adults and larvae. We also sought to

detect differences in P-gp expression in larvae exposed to macrocyclic lactones in vitro and in

vivo.

2. Methods

2.1 Ethics statement

All experiments were conducted in accordance with the recommendations of the NIH

Guide for the care and use of laboratory animals. The studies were approved by the Iowa State

University Institutional Animal Care and Use Committee.

Page 82: P-glycoprotein drug transporters in the parasitic

71

2.2 Parasites

Toxocara canis were obtained from dogs that expelled adult worms after treatment with

anthelmintics. Worms were washed in tap water and eggs were isolated from the uteri of female

adult worms by careful dissection. Eggs were washed and incubated in 1x phosphate buffered

saline (PBS) at room temperature for at least 2 weeks to allow development of larvae to the third

larval (L3) stage. L3 larvae were isolated by a chemical hatching protocol (Ponce-Macotela et

al., 2011).

2.3 In vitro motility assays

Stock solutions of 10mM ivermectin and verapamil were prepared in 100%

DMSO and diluted in 1x PBS to obtain working dilutions of drugs with 0.1% final DMSO

concentration. Hatched T. canis L3 larvae were individually transferred to 24 well plates in

RPMI1640. The drugs were added to the wells and the final volume adjusted to 400L using

RPMI. Videos of larval motility were recorded using the WormLab software (MBF Bioscience,

Williston, VT) using the default settings. All larvae were tracked for 2 minutes and videos

analysed using the default settings. Motility parameters including wavelength, amplitude, linear

speed and peristaltic speed, linear and peristaltic track length and mean area occupied by the

larvae were obtained as outputs. One-way ANOVA with Tukey’s multiple comparison test was

used to compare each motility parameter of the larvae using GraphPad Prism version 8 (San

Diego, CA).

2.4 In vitro larval dye efflux assay

The larval efflux assay was modified from Raza et al. (2016b). Hatched larvae were

washed in 1x Dulbecco’s PBS and exposed to 10 M ivermectin or P-gp inhibitors (cyclosporine

A, loperamide, reserpine, verapamil or tariquidar) for 1 hr at 37°C with horizontal shaking at 200

Page 83: P-glycoprotein drug transporters in the parasitic

72

rpm. The larvae were washed in 1x D-PBS and then incubated in the fluorescent P-gp substrate

15M Hoechst 33342, a fluorescent P-gp substrate for 10 min at 37°C. Images obtained by

fluorescence microscopy were analyzed using the fluorescence area module in Halo (Indica

Labs, Advanced Cell Diagnostics, Hayward, CA). Percentage of Hoechst staining in larvae was

calculated using the formula: (fluorescently stained area/ total area of larva) x 100. Percentage of

fluorescence was compared to larvae that were not exposed to drugs. One way ANOVA with

Tukey’s multiple comparison test was used to analyze percentage of staining in GraphPad Prism

version 8 (San Diego, CA).

2.5 Genomic survey and Phylogenetic analysis

The 317Mb draft genome of Toxocara canis (Zhu et al., 2015) on NCBI (Toxocara canis

isolate PN_DK_2014, whole genome shotgun sequencing project, GenBank Accession

JPKZ00000000) was surveyed and annotated P-gp genes obtained. These were annotated as

either pgp-1 or pgp-3. Nucleotide sequences of P-gp genes of Toxocara canis retrieved from

GenBank were used to design custom primers to amplify partial sequences from cDNA. Protein

sequences translated from nucleotide sequences of P-gp genes described in other nematodes such

as Haemonchus contortus, Cooperia oncophora, Teladorsagia circumcinta, Cylicocyclus spp.,

Parascaris spp., Dirofilaria immitis, and C. elegans were obtained from GenBank and aligned

with the MAFFT algorithm (Katoh and Standley, 2013). Substitution model was selected using

the SMS tool with Bayesian Information Criteria (Lefort et al., 2017). The model with lowest BIC

value was LG+F+I+G with 4 parameter gamma distribution (Le and Gascuel, 2008). Maximum

likelihood phylogenetic analyses performed using PhyML3.0 (Guindon et al., 2010). The tree

was visualized using Mega X (Kumar et al., 2018).

Page 84: P-glycoprotein drug transporters in the parasitic

73

2.6 qPCR in adults Toxocara canis

Expression levels of P-gp genes was determined using qPCR in adult male and female

worms separately and results pooled. qPCR primers were designed to amplify the genes (Table

3-S1) and specificity was confirmed using BLAST in silico. RNA extracted from pools of adult

male and female worms was extracted with Trizol reagent (Ambion by Life Technologies,

Carlsbad, CA) followed by purification using the Direct-zol RNA Miniprep kit (Zymo Research)

according to the manufacturer's instructions. cDNA was synthesized from 50 ng of total RNA in

a 20L volume using the iScript cDNA synthesis kit (Bio-rad), using random oligonucleotides.

qPCR reactions were individually optimized using diluted cDNA synthesized from adult

Toxocara canis worms. Specificity was determined using melt curve analysis and sequencing.

18S was used as a reference gene (Durant et al., 2012). qPCR was carried out in a volume of 20

L with 2 L of diluted cDNA, 1x of SSoAdvanced Universal SYBR Green Master Mix (Bio-

rad) and 0.2 - 0.5 M of diluted primers. PCR efficiency was determined for each primer pair

using LinRegPCR (Ramakers et al., 2003) and change in gene expression was calculated using

the efficiency corrected Ct method based on single samples (Pfaffl, 2004). One way ANOVA

with Tukey’s multiple comparison test was used to analyze fold changes in expression using

GraphPad Prism version 8 (San Diego, CA).

2.7 qPCR following in vitro drug exposure

Groups of 500 hatched L3 larvae were washed in 1x Dulbecco’s PBS and exposed to 10

M Ivermectin (MP Biomedicals, Solon, OH) or no drugs (control) in RPMI 1640 (Gibco, Grand

Island, NY) at 37°C with horizontal shaking at 200 rpm for 24 hours. Drug exposure assays were

carried out separately with three different isolates of Toxocara canis eggs. Immediately after

drug exposure, larvae were washed in RPMI1640. Sterile 0.1mm, 0.5mm and 2mm Zymo

Page 85: P-glycoprotein drug transporters in the parasitic

74

bashing beads (Zymo research, Irvine, CA) were used to homogenize larvae in Trizol reagent

and total RNA was extracted following manufacturer’s protocol. RNA concentration and purity

were measured using a Nanodrop spectrophotometer and stored at -80°C. cDNA was synthesized

from 50 ng of total RNA in a 20L volume using the iScript cDNA synthesis kit (Bio-rad), using

random oligonucleotides and stored at -20C till use. To determine differences between drug

exposed and unexposed larvae, qPCR was carried out in a volume of 20 L with 2 L of

undiluted cDNA, 1x of SSoAdvanced Universal SYBR Green Master Mix and 0.2 - 0.5 M of

diluted primers. PCR efficiency was determined for each primer pair using LinRegPCR

(Ramakers et al., 2003). Fold changes in gene expression were calculated using the efficiency

corrected Ct method based on single samples (Pfaffl, 2004). One way ANOVA with Tukey’s

multiple comparison test was used to analyze fold changes in expression using GraphPad Prism

version 8 (San Diego, CA).

2.8 qPCR following in vivo drug exposure in mice

Male and female C3H/HEJ mice were obtained from Jackson Labs and housed in

ventilated rack cage system with standard enrichment. After acclimatization, mice were gavaged

with 5000 larvated Toxocara canis eggs. Mice were injected subcutaneously with ivermectin

(200 g/kg), moxidectin (500 g/kg), or sham (saline) on day 7 PI and euthanized on day 10 PI.

Liver, lungs, brain were collected from each mouse and frozen at -80°C for RNA extraction.

qPCR following cDNA synthesis was performed using the methods outlined above for T. canis

adult and larvae. One way ANOVA with Tukey’s multiple comparison test was used to analyze

fold changes in expression using GraphPad Prism version 8 (San Diego, CA).

Page 86: P-glycoprotein drug transporters in the parasitic

75

3. Results

3.1 In vitro motility assay

T. canis larvae exhibit sinusoidal thrashing motility in liquid media without

progressive or forward movement. The WormLab software tracked swimming larvae using

anterior, middle and posterior markers. Larvae treated with a combination of ivermectin and

verapamil had a lower mean area than larvae in any other treatment group (p<0.05, Figure 3-1).

Larvae treated with the combination also had lower wavelength than verapamil alone(p<0.05).

Speed of larvae was reduced following treatment with the combination, although this change was

not statistically different (P=0.0942).

3.2 In vitro efflux of P-gp is inhibited

Total P-gp activity and inhibition was measured by a Hoechst 33342 efflux assay.

Fluorescent H33342 is a substrate of P-gps which efflux it from the plasma membrane. It does

not fluoresce when not associated with membranes (Shapiro et al., 1997), allowing fluorescence

microscopy of larvae without fluorescent background signal on a slide. Larvae were co-

incubated with and without P-gp inhibitors, photographed, and positive H33342 staining was

quantitated using computer software (Figure 3-2). Untreated larvae had constitutive P-gp efflux

activity, indicated by absence of H33342 staining. In contrast, larvae treated with P-gp inhibitors

had low P-gp activity leading to retention of H33342. Interestingly, reserpine, verapamil, and

tariquidar caused a significant decrease in P-gp activity (p<0.05, Figure 3-3). On the other hand,

P-gp inhibition by ivermectin, cyclosporine A, and loperamide were modest and not statistically

different (Figure 3-3).

3.3 Thirteen P-gp genes identified in T .canis genome

The draft genome of Toxocara canis on NCBI GenBank nucleotide database was initially

used for primer design. Thirteen P-gp protein sequences with length > 450 amino acids annotated

Page 87: P-glycoprotein drug transporters in the parasitic

76

in the T. canis genome were identified in the analysis. Conceptually translated amino acid

sequences from P-gp genes annotated in the T. canis genome, annotated in genomes of other

nematodes obtained from GenBank, and cloned sequences obtained in this study were used in the

Maximum Likelihood phylogenetic analyses (Figure 3-4). Names for the 13 P-gp genes are given

in Table 3-1. Based on the phylogenetic analysis, several of these were determined to be

isoforms. Isoforms have been observed in other nematode P-gps including Haemonchus

contortus Pgp-9 (Godoy et al., 2016). In our analysis, three annotated isoforms of Pgp-11, two

isoforms each of Pgp-9, Pgp-13 and Pgp-16 were found. One P-gp (KHN86334) has an

ambiguous position with low statistical support in the tree and was named (Tca-Pgp-16.3/3.2).

PCR investigation resulted in six partial and one full length Pgp cloned from mRNA. Thus, these

seven annotated P-gp genes are not pseudogenes.

3.4 Ten P-gp genes are expressed in adults

Constitutive expression levels of P-gp genes were determined using qPCR in

adult T. canis nematodes and infective larvae hatched from eggs. Ct values from 10 P-gp genes

and isoforms were compared between adults and larvae (Figure 3-5). Variability in expression

levels were seen between biological replicates with no significant differences between the genes.

Specific primer sets could not be designed/optimized for Tca-Pgp-3, Tca-Pgp-11.3 and Tca-Pgp-

13.2 because of very high sequence cross-identity and the presence of multiple peaks in melt

curve analyses of products, reinforcing our finding that isoforms of the genes exist as predicted

in the phylogenetic analysis.

3.5 In vitro effects of IVM on P-gp expression in larvae

Expression profile of 10 P-gp genes and isoforms in T. canis larvae was determined

before and after treatment with 10 M ivermectin for 24 hrs (Figure 3-6). Variability in

expression levels were seen between biological replicates with no differences between the genes.

Page 88: P-glycoprotein drug transporters in the parasitic

77

3.6 In vivo effects of MLs on P-gp expression in somatic larvae

Expression profile of P-gp genes was determined in somatic T. canis larvae derived from

infected mice. P-gp expression was detected in larvae from mice treated with ivermectin or

moxidectin (Figure 3-7). There were no differences among genes in the ivermectin-treated group.

Tca-Pgp-10 was significantly upregulated in larvae from moxidectin-treated mice. Tca-Pgp-10

was also significantly upregulated compared to Tca-Pgp-16.1. Several P-gp genes and isoforms

could not be amplified from somatic larvae due to poor RNA quality, RNA degradation and

overabundance of host RNA.

4. Discussion

Bitches harboring somatic T. canis larvae are reservoirs for infection of puppies

which occurs primarily by a transplacental route. Arrested somatic larvae evade drug-mediated

killing until they are reactivated, and the reason for this drug-resistant phenotype has not been

elucidated. Our hypothesis is that nematode P-glycoproteins contribute to evasion of drug-

mediated killing of somatic larvae. In this study we described the repertoire of P-gp genes,

phenotypic effects of P-gp inhibition, and induction of P-gp mRNA expression. In addition,

experiments with hatched larvae revealed larval expulsion of the P-gp substrate H33342 and this

activity could be blocked by some but not all P-gp inhibitors tested.

Motility has been used to determine the activity of anthelmintics against different

stages of nematodes (Blanchard et al., 2018; Kotze et al., 2004; Storey et al., 2014).

Interestingly, we observed that ivermectin treatment did not alter motility of T. canis larvae

(Figure 3-1). Combination of ivermectin and the P-gp inhibitor verapamil resulted only in

modest changes in measures of motility. Our results are largely in agreement with previous

studies of nematodes in which exposure to physiological levels of macrocyclic lactones fails to

Page 89: P-glycoprotein drug transporters in the parasitic

78

inhibit larval motility, thus supporting the hypothesis that ivermectin exerts an effect beyond

paralysis (Vatta et al., 2014).

An important finding of this study was that T. canis larvae constitutively expel

H33342, indicating the presence of functional P-gps. The P-gp inhibitors tariquidar, verapamil,

and reserpine caused significant inhibition of H33342 efflux. Interestingly, numerous other

known inhibitors failed to inhibit P-gp activity in T. canis larvae. Although our assays represent

the net effect of inhibition on total larval P-gp activity, we demonstrated that T. canis P-gp

cannot be inhibited by all P-gp inhibitors unlike mammalian P-gps. This supports further

investigation of these putative drug targets.

Analysis of the T. canis draft genome led to an estimate of 530 genes that were likely to

be transporters (out of the 18,596 protein coding genes), of which 10.8% were predicted to be

ABC transporters by computer algorithms (Zhu et al., 2015). Of all the genes annotated as P-gp

genes in the genome of T. canis, our phylogenetic analysis suggests that only 13 genes likely

exist, of which several are isoforms. >1000 base pair fragments of seven of these genes could be

cloned from mRNA, suggesting that they are functional genes. Gene naming conventions based

on C. elegans genes as suggested by Beech et al. (2010) were used except where cases of

ambiguity existed such as Tca-Pgp-16.3/3.2. Uncertainties in the assigning of genes can be

resolved as genome assemblies of organisms improve and as paralogs are studied in closely

related nematodes.

We demonstrated that at least 10 of the 13 named genes/isoforms are expressed in T.

canis adults and larvae. While comparisons of adults and hatched infective larvae did not yield

significant differences, constitutive expression of P-gps are likely to have functional significance

in both stages. In larvae exposed to ivermectin in vitro for 24 hours, significant changes in P-gp

Page 90: P-glycoprotein drug transporters in the parasitic

79

gene expression did not occur. These results have to be cautiously interpreted as biological

compensation may occur by which a single P-gp gene may be upregulated to compensate for the

downregulation of another as has been shown in H. contortus (Maté et al., 2018). Additionally,

larval gene regulatory changes may occur earlier than 24 hours. Further research is essential to

map fine scale temporal gene expression changes that result from drug exposure, with an assay

that provides greater molecular resolution such as RNA-seq.

Finally, P-gp gene expression was determined in T. canis somatic larvae derived

from liver granulomas of experimentally infected mice. Mice are natural paratenic hosts for T.

canis and are a tractable model for study of somatic larval migrans of humans. Ivermectin at

various doses and routes is unable to eliminate larvae in mice (Fok and Kassai, 1998). Several

genes in larvae from ivermectin and moxidectin treated animals had differential expression, with

only one gene – Tca-Pgp-10 having a significant increase. Gene expression in larvae derived

from other organs in the paratenic host is essential to determine if larvae in relatively immuno-

privileged sites exhibit the similar gene changes.

This study revealed significant findings regarding P-gps of the zoonotic nematode

Toxocara canis. First, we curated and named putative P-gp genes present in the genome which

was supported by phylogenetic analysis and molecular cloning. We then demonstrated

phenotypic evidence that T. canis larvae exhibit physiologic responses to P-gp inhibition with a

unique pharmacological profile. In addition, we detected the expression of numerous P-gp genes

in adult worms, larvae hatched in vitro, and somatic larvae recovered from mice. While a few P-

gps were induced by macrocyclic lactone treatment, many were constitutively expressed in both

larvae and adults. In conclusion, T. canis expresses a large repertoire of P-gps, some of which

Page 91: P-glycoprotein drug transporters in the parasitic

80

appear unresponsive to mammalian P-gp inhibitors. Taken together, our findings support further

study of this protein family in the search for new nematode-specific drug targets.

5. References

Abo-Shehada, M.N., Herbert, I.V., 1984. Anthelmintic effect of levamisole, ivermectin,

albendazole and fenbendazole on larval Toxocara canis infection in mice. Res Vet Sci 36,

87-91.

Beech, R.N., Wolstenholme, A.J., Neveu, C., Dent, J.A., 2010. Nematode parasite genes: what's

in a name? Trends Parasitol 26, 334-340.

Blanchard, A., Guégnard, F., Charvet, C.L., Crisford, A., Courtot, E., Sauvé, C., Harmache, A.,

Duguet, T., O'Connor, V., Castagnone-Sereno, P., Reaves, B., Wolstenholme, A.J.,

Beech, R.N., Holden-Dye, L., Neveu, C., 2018. Deciphering the molecular determinants

of cholinergic anthelmintic sensitivity in nematodes: When novel functional validation

approaches highlight major differences between the model Caenorhabditis elegans and

parasitic species. PLoS Pathog 14, e1006996.

Bourguinat, C., Che, H., Mani, T., Keller, K., Prichard, R.K., 2016. ABC-B transporter genes in

Dirofilaria immitis. Int J Parasitol Drugs Drug Resist 6, 116-124.

Burke, T.M., Roberson, E.L., 1983. Fenbendazole treatment of pregnant bitches to reduce

prenatal and lactogenic infections of Toxocara canis and Ancylostoma caninum in pups. J

Am Vet Med Assoc 183, 987-990.

Carrillo, M., Barriga, O.O., 1987. Anthelmintic effect of levamisole hydrochloride or ivermectin

on tissue toxocariasis of mice. Am J Vet Res 48, 281-283.

Durant, J.F., Irenge, L.M., Fogt-Wyrwas, R., Dumont, C., Doucet, J.P., Mignon, B., Losson, B.,

Gala, J.L., 2012. Duplex quantitative real-time PCR assay for the detection and

discrimination of the eggs of Toxocara canis and Toxocara cati (Nematoda,

Ascaridoidea) in soil and fecal samples. Parasit Vectors 5, 288.

Fok, E., Kassai, T., 1998. Toxocara canis infection in the paratenic host: a study on the

chemosusceptibility of the somatic larvae in mice. Vet Parasitol 74, 243-259.

Geary, T.G., Sims, S.M., Thomas, E.M., Vanover, L., Davis, J.P., Winterrowd, C.A., Klein,

R.D., Ho, N.F., Thompson, D.P., 1993. Haemonchus contortus: ivermectin-induced

paralysis of the pharynx. Exp Parasitol 77, 88-96.

Gill, J.H., Redwin, J.M., van Wyk, J.A., Lacey, E., 1991. Detection of resistance to ivermectin in

Haemonchus contortus. Int J Parasitol 21, 771-776.

Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2016. Characterisation of P-glycoprotein-9.1 in

Haemonchus contortus. Parasit Vectors 9, 52.

Godoy, P., Lian, J., Beech, R.N., Prichard, R.K., 2015. Haemonchus contortus P-glycoprotein-2:

in situ localisation and characterisation of macrocyclic lactone transport. Int J Parasitol

45, 85-93.

Page 92: P-glycoprotein drug transporters in the parasitic

81

Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New

algorithms and methods to estimate maximum-likelihood phylogenies: assessing the

performance of PhyML 3.0. Syst Biol 59, 307-321.

Kaschny, M., Demeler, J., Janssen, I.J., Kuzmina, T.A., Besognet, B., Kanellos, T., Kerboeuf,

D., von Samson-Himmelstjerna, G., Krücken, J., 2015. Macrocyclic lactones differ in

interaction with recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus

elongatus and ketoconazole in a yeast growth assay. PLoS Pathog 11, e1004781.

Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7:

improvements in performance and usability. Mol Biol Evol 30, 772-780.

Kotze, A.C., Clifford, S., O'Grady, J., Behnke, J.M., McCarthy, J.S., 2004. An in vitro larval

motility assay to determine anthelmintic sensitivity for human hookworm and

Strongyloides species. Am J Trop Med Hyg 71, 608-616.

Krämer, F., Hammerstein, R., Stoye, M., Epe, C., 2006. Investigations into the prevention of

prenatal and lactogenic Toxocara canis infections in puppies by application of moxidectin

to the pregnant dog. J Vet Med B Infect Dis Vet Public Health 53, 218-223.

Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: Molecular Evolutionary

Genetics Analysis across Computing Platforms. Mol Biol Evol 35, 1547-1549.

Le, S.Q., Gascuel, O., 2008. An improved general amino acid replacement matrix. Mol Biol Evol

25, 1307-1320.

Lefort, V., Longueville, J.E., Gascuel, O., 2017. SMS: Smart Model Selection in PhyML. Mol

Biol Evol 34, 2422-2424.

Lespine, A., Dupuy, J., Orlowski, S., Nagy, T., Glavinas, H., Krajcsi, P., Alvinerie, M., 2006.

Interaction of ivermectin with multidrug resistance proteins (MRP1, 2 and 3). Chem Biol

Interact 159, 169-179.

Lespine, A., Martin, S., Dupuy, J., Roulet, A., Pineau, T., Orlowski, S., Alvinerie, M., 2007.

Interaction of macrocyclic lactones with P-glycoprotein: structure-affinity relationship.

Eur J Pharm Sci 30, 84-94.

Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other

multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for

reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist

2, 58-75.

Maté, L., Ballent, M., Cantón, C., Ceballos, L., Lifschitz, A., Lanusse, C., Alvarez, L., Liron,

J.P., 2018. Assessment of P-glycoprotein gene expression in adult stage of Haemonchus

contortus in vivo exposed to ivermectin. Vet Parasitol 264, 1-7.

Moreno, Y., Nabhan, J.F., Solomon, J., Mackenzie, C.D., Geary, T.G., 2010. Ivermectin disrupts

the function of the excretory-secretory apparatus in microfilariae of Brugia malayi. Proc

Natl Acad Sci U S A 107, 20120-20125.

Payne, P.A., Ridley, R.K., 1999. Strategic use of ivermectin during pregnancy to control

toxocara canis in greyhound puppies. Vet Parasitol 85, 305-312.

Page 93: P-glycoprotein drug transporters in the parasitic

82

Pfaffl, M.W., 2004. A–Z of Quantitative PCR, 1 Edition. International University Line, La Jolla,

CA.

Ponce-Macotela, M., Rodríguez-Caballero, A., Peralta-Abarca, G.E., Martínez-Gordillo, M.N.,

2011. A simplified method for hatching and isolating Toxocara canis larvae to facilitate

excretory-secretory antigen collection in vitro. Vet Parasitol 175, 382-385.

Ramakers, C., Ruijter, J.M., Deprez, R.H., Moorman, A.F., 2003. Assumption-free analysis of

quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62-66.

Raza, A., Kopp, S.R., Bagnall, N.H., Jabbar, A., Kotze, A.C., 2016a. Effects of in vitro exposure

to ivermectin and levamisole on the expression patterns of ABC transporters in

Haemonchus contortus larvae. Int J Parasitol Drugs Drug Resist 6, 103-115.

Raza, A., Kopp, S.R., Kotze, A.C., 2016b. Synergism between ivermectin and the tyrosine

kinase/P-glycoprotein inhibitor crizotinib against Haemonchus contortus larvae in vitro.

Vet Parasitol 227, 64-68.

Schnieder, T., Laabs, E.M., Welz, C., 2011. Larval development of Toxocara canis in dogs. Vet

Parasitol 175, 193-206.

Shapiro, A.B., Corder, A.B., Ling, V., 1997. P-glycoprotein-mediated Hoechst 33342 transport

out of the lipid bilayer. Eur J Biochem 250, 115-121.

Soulsby, E.J., 1983. Toxocariasis. Br Vet J 139, 471-475.

Storey, B., Marcellino, C., Miller, M., Maclean, M., Mostafa, E., Howell, S., Sakanari, J.,

Wolstenholme, A., Kaplan, R., 2014. Utilization of computer processed high definition

video imaging for measuring motility of microscopic nematode stages on a quantitative

scale: "The Worminator". Int J Parasitol Drugs Drug Resist 4, 233-243.

Vatta, A.F., Dzimianski, M., Storey, B.E., Camus, M.S., Moorhead, A.R., Kaplan, R.M.,

Wolstenholme, A.J., 2014. Ivermectin-dependent attachment of neutrophils and

peripheral blood mononuclear cells to Dirofilaria immitis microfilariae in vitro. Vet

Parasitol 206, 38-42.

Zhu, X.Q., Korhonen, P.K., Cai, H., Young, N.D., Nejsum, P., von Samson-Himmelstjerna, G.,

Boag, P.R., Tan, P., Li, Q., Min, J., Yang, Y., Wang, X., Fang, X., Hall, R.S., Hofmann,

A., Sternberg, P.W., Jex, A.R., Gasser, R.B., 2015. Genetic blueprint of the zoonotic

pathogen Toxocara canis. Nat Commun 6, 6145.

Page 94: P-glycoprotein drug transporters in the parasitic

83

Figures and tables

Figure 3-1. WormLab output obtained with Toxocara canis larvae exposed to DMSO control, 10 M ivermectin, 10 M verapamil or

combination of 10 M ivermectin with 10 M verapamil. Various motility parameters are shown : (A) track length in m (forward +

reverse), (B) peristaltic track length in m (forward – reverse), (C) speed in m/s (track length/time), (D) peristaltic speed in m/sec

(peristaltic track length/time), (E) mean area occupied by the larvae, (F) Wavelength in m, (G) mean amplitude in m and (H)

maximum amplitude in m. Statistically significant differences are marked by * (One-way ANOVA, p<0.05)

Page 95: P-glycoprotein drug transporters in the parasitic

84

Figure 3-2. Representative bright-field overlays and fluorescence images of T. canis larvae stained with Hoechst 33342 in the absence

of drugs (A,B) and presence of inhibitors - ivermectin (C,D), cyclosporine A (E, F), loperamide (G, H), reserpine (I, J), verapamil (K,

L) and tariquidar (M,N) (400x). The brightfield image was used to annotate the outline of the larvae which was overlaid on the

fluorescent image. The area stained was quantitated using image analysis software (Figure 3-3).

Page 96: P-glycoprotein drug transporters in the parasitic

85

Figure 3-3. Area of H33342 staining of T. canis larvae exposed to P-gp inhibitors. Experiments

were performed in triplicate with larvae hatched from different batches of eggs (n ≥ 5 larvae per

replicate). Mean ± SE are shown, asterisks denote statistical differences (p<0.05).

Page 97: P-glycoprotein drug transporters in the parasitic

86

Figure 3-4. Maximum Likelihood phylogenetic tree of conceptually translated P-gp genes. Pgp

genes predicted in the genome (o) and cloned () are highlighted along with assigned names for

T. canis P-gp genes provided in red.

Page 98: P-glycoprotein drug transporters in the parasitic

87

Figure 3-5. Mean + SE of expression levels of P-gp genes in adult T. canis worms. Three pools

of adult worms with two technical replicates each were compared to three biological replicate

populations of hatched larvae from different pools of eggs with two technical each. Fold change

was calculated using the efficiency corrected Ct method using T. canis 18S as the reference

gene.

Tca-

Pgp-2

Tca-

Pgp-9

.1

Tca-

Pgp-9

.2

Tca-

Pgp-1

0

Tca-

Pgp-1

1.1

Tca-

Pgp-1

1.2

Tca-

Pgp-1

3.1

Tca-

Pgp-1

6.1

Tca-

Pgp-1

6.2

Tca-

Pgp-1

6.3/

3.2

-5

0

5

10

15

20

25F

old

ch

an

ge o

ver

hatc

hed

larv

ae

Page 99: P-glycoprotein drug transporters in the parasitic

88

Figure 3-6. Mean + SE of induction of P-gp expression following exposure to ivermectin. Three

biological replicate populations of hatched larvae from different pools of eggs with two technical

replicates were used to obtain Ct values. Each biological replicate had ivermectin treated and

untreated groups of larvae derived from the same population of eggs. Fold change was obtained

using the efficiency corrected Ct method using T. canis 18S as the reference gene.

Tca-

Pgp-2

Tca-

Pgp-9

.1

Tca-

Pgp-9

.2

Tca-

Pgp-1

0

Tca-

Pgp-1

1.1

Tca-

Pgp-1

1.2

Tca-

Pgp-1

3.1

Tca-

Pgp-1

6.1

Tca-

Pgp-1

6.2

Tca-

Pgp-1

6.3/

3.2

0

1

2

3

4

Fo

ld c

han

ge o

ver

un

treate

d larv

ae

Page 100: P-glycoprotein drug transporters in the parasitic

89

Figure 3-7. Mean + SE of expression of P-gp genes in somatic T. canis larvae derived from mice

treated with (A) ivermectin or (B) moxidectin. Six biological replicate populations of somatic

larvae with two technical replicates each were used to obtain Ct values. Fold change was

calculated using the efficiency corrected Ct method using T. canis 18S as the reference gene.

Page 101: P-glycoprotein drug transporters in the parasitic

90

Table 3-1. Nomenclature for P-gp protein sequences in Toxocara canis

GenBank accession number

(Protein database)

Length of annotated protein Assigned gene names

KHN80157 1285aa Tca-Pgp-2

KHN86334 1700aa Tca-Pgp-16.3/3.2

KHN78383 1352aa Tca-Pgp-3

KHN77280 741aa Tca-Pgp-9.1

KHN76604 462aa Tca-Pgp-9.2

KHN84692 1368aa Tca-Pgp-10

KHN73709 1337aa Tca-Pgp-11.1

KHN87227 1337aa Tca-Pgp-11.2

KHN89031 1268aa Tca-Pgp-11.3

KHN87070 1355aa Tca-Pgp-13.1/14.1

KHN87068 1330 aa Tca-Pgp-13.2/14.2

KHN80315 1368aa Tca-Pgp-16.1

KHN80341 2130aa Tca-Pgp-16.2

Page 102: P-glycoprotein drug transporters in the parasitic

91

Supplementary data

The following is the supplementary data to this article:

Table 3-S 1. qPCR primers used in this study

Gene name Primer sequence

Tca-Pgp- 2 5’ ATGCGATCTAGACAAGTTGAGG 5’ TCAGGCCACTGCAACAAGTG

Tca-Pgp-9.1 5’ AGGGCGGTATGAGAGATGGT 5’ CGAGCGCATAAGAGCCAAAC

5’ GACGACACGCAGCATATAATTC 5’ GATTGGTGTTGTATCGCAAGAG

Tca-Pgp-9.2 5’ GCTATAACAAGGACGCGAAGG 5’ TGAATTTTTGTGCGGTCTTTCC

Tca-Pgp-10 5’ TGGTCATGGCTTCTGTGGTC 5’ AGACGACCTGGAGTGTTCCT

Tca-Pgp-11.1 5’ TGCAACGGTCAGGAAACGAT 5’ AATATCGCCCGGCTCTTTGA

Tca-Pgp-11.2 5’ TGCAAGAGGCGCTCAAAAAG 5’ AAGCGACGACAAGCGATGAG

Tca-Pgp-13.1 5’ GAGGACGTATCATCGAACAAGG 5’ GAGTTGAAACTGTTGGGCTTTC

Tca-Pgp-16.1 5’ GGATATGACCGAGGAAGAAATGG 5’ GCACGTGCGATAGCGATAC

Tca-Pgp-16.2 5’ GCTCGTGTTGAAATGTGGGAG 5’ GTTCTTGACCGTTGTAAGCGA

Tca-Pgp-16.3/3.2 5’ TGCAGATCCAGGTGAAACGA 5’ TCCCGAGACGGCATCATAGT

Tca-18S 5’ CTACCACATCCAAGGAAGGCA 5’ TTATTTTTCGTCACTACCTCCTCATG

Page 103: P-glycoprotein drug transporters in the parasitic

92

CHAPTER 4. IDENTIFICATION AND FUNCTIONAL CHARACTERIZATION OF P-

GLYCOPROTEIN 11.1 OF TOXOCARA CANIS

Jeba Jesudoss Chelladurai, Tomislav Jelesijevic, Matthew T. Brewer

Modified from a manuscript to be submitted

Abstract

The interaction of macrocyclic lactones with P-glycoproteins has been studied in

nematodes with reduced susceptibility to the drug class. Toxocara canis somatic larvae exhibit a

remarkable tolerance to systemically bioavailable macrocyclic lactones and resist death, except

when they are hormonally reactivated during the third trimester of pregnancy in dogs. We

hypothesized that the tolerance to MLs could be due to P-glycoprotein mediated efflux of drugs

from their sites of action. In the present study, a full length Toxocara canis P-gp was studied by

cloning, and by phylogenetic analysis was named Tca-Pgp-11.1. The cloned P-gp was expressed

and its pharmacological substrate profile was studied by fluorescent substrate efflux in

transfected cells using flow cytometry in the presence and absence of known P-gp substrates and

inhibitors. Tissue distribution of two isoforms of Tca-Pgp-11 mRNA in adult male and female

worms was studied using chromogenic in situ hybridization and expression was found to be the

highest in the intestine and absent in the reproductive tissues. We have previously shown that

somatic larvae express isoforms of Tca-Pgp-11. Taken together, these results indicate that Tca-

Pgp-11.1 transports macrocyclic lactones, which could contribute to somatic larval tolerance to

MLs.

1. Introduction

Toxocara canis is a cosmopolitan ascarid nematode of dogs. Dogs acquire infection by

one of four routes - ingestion of eggs with infective L3 larvae, ingestion of paratenic hosts

harboring infective L3, transplacentally transferred larvae or lactogenically derived larvae from

Page 104: P-glycoprotein drug transporters in the parasitic

93

infected dams. Upon ingestion of infective eggs, the larvae are released in the stomach and

undergo extensive migration in the body. In dogs that are > 8 weeks of age, the larvae are

retained in skeletal muscles, kidneys, liver, heart, lungs and diaphragm as arrested somatic larvae

(Schnieder et al., 2011). Transplacentally and lactogenically transmitted T. canis larvae are

important in neonates and worms grow to adulthood in the small intestines.

The efficacy of the macrocyclic lactones in the treatment of infections with adult T. canis

is well-established and there have been no reports of resistance. However, somatic larvae are not

completely eliminated by macrocyclic lactones. We hypothesized that P-glycoproteins may be

involved in the transport of MLs out of target cells in somatic larvae, as ML resistance in several

nematodes has been associated with P-gp mediated efflux of drugs from target sites.

P-glycoproteins are a family of transporters located on the cell membrane that have a

characteristic ATP-binding cassette and are involved in the ATP-mediated efflux of a wide range

of xenobiotics. Nematode P-gps have several paralogs that have been studied in the context of

anthelmintic resistance (Figueiredo et al., 2018). Specifically, Pgp-11 appears to be important in

parasitic nematodes of veterinary importance and its role has been studied in Parascaris

(Janssen et al., 2013a; Janssen et al., 2015), Dirofilaria immitis (Mani et al., 2016), Haemonchus

contortus (Issouf et al., 2014), Cooperia oncophora (De Graef et al., 2013) and others.

The pharmacological interactions of drugs and Toxocara canis P-glycoproteins have not

been characterized. The draft genome of T. canis has been surveyed to identify ABC transporters

and the expression levels of P-gps have been studied in adults, hatched third stage larvae and

somatic larvae recovered from mice (Chapter 3 of this thesis). In this study, we cloned and

bioinformatically analyzed a P-gp gene from Toxocara canis. We characterized the unique

Page 105: P-glycoprotein drug transporters in the parasitic

94

pharmacology of Tca-Pgp-11.1 in stably transfected MDCK II cMDR1-KO cells and localized

gene expression in adult worm tissue by chromogenic in situ hybridization.

2. Materials and methods

2.1. Ethics statement

All experiments were conducted in accordance with the recommendations of the NIH

Guide for the care and use of laboratory animals. The studies were approved by the Iowa State

University Institutional Animal Care and Use Committee.

2.2. Molecular and phylogenetic characterization

Adult Toxocara canis worms were obtained from feces of puppies recently treated with

anthelmintics. To extract RNA for cloning, adult worms were homogenized with Trizol reagent

(Life Technologies) followed by purification using the Direct-zol RNA Miniprep kit (Zymo)

according to the manufacturer's instructions. RNA was eluted into 50µL of nuclease free water,

quantified using a Nanodrop1000 spectrophotometer, and stored at -80C. RNA quality was

assessed using the 260/280 ratio and by electrophoresis in a denaturing bleach agarose gel

(Aranda et al., 2012). cDNA was synthesized using 0.5g of total RNA, 200U of SuperScript IV

Reverse Transcriptase enzyme (Invitrogen) and 2.5M Oligo d(T)20 primers, using the

manufacturer’s recommended protocol.

To clone a full length Toxocara canis P-gp gene, the predicted nucleotide sequence was

derived from the T. canis draft genome assembly Scaffold1303 on NCBI GenBank - Accession

number JPKZ01003065.1, and specific primer pairs were designed using the Primer3 software

(version 2.2.3) on the PrimerQuest Tool platform (Integrated DNA technologies, Coralville, IA).

Primers were synthesized at the Iowa State University DNA Facility. Tca-Pgp-11.1 was cloned

as two separate fragments initially using the conserved nematode spliced leader primer SL3 and

Page 106: P-glycoprotein drug transporters in the parasitic

95

custom designed primers (Table 4-S 1). Gibson assembly was used to fuse and clone the full-

length sequence into the pCR-XL-TOPO vector (Life Technologies) for sequencing. PCR

reactions consisted of 1x OneTaq HotStart DNA polymerase master mix (New England

BioLabs), 1M of each primer and 2L of cDNA. A touch down PCR cycle of initial

denaturation at 94C for 2 min, followed by 20 cycles of cyclic denaturation at 94C 15 sec,

annealing at 65C for 15 sec with a drop of 1C per cycle, cyclic extension at 68C for 6 min,

and again followed by 20 cycles of cyclic denaturation at 94C 15 sec, annealing at 45C for 15

sec, cyclic extension at 68C for 6 min and final extension at 68C for 10 min was used. PCR

products were visualized on an agarose gel, purified using Wizard SV Gel and PCR Clean-Up

system (Promega), cloned into pCR-XL-TOPO, and transformed into OneShot TOP10

Chemically competent E. coli (Life Technologies). Transformants were analysed by PCR and

sequenced using a primer walking strategy on an Applied Biosystems 3730xl DNA analyzer at

the Iowa State University DNA Facility. The amplicon was double digested using HindIII and

BamHI (Thermo Scientific) after reamplification using primers with restriction sites and His tag,

gel purified and directionally sub-cloned into pcDNA3.1+ Mammalian Expression Vector

(Invitrogen). Transformants were analysed by restriction digestion and sequencing by primer

walking.

2.3. Bioinformatic analyses

Sequences were assembled using GeneStudio Professional Edition version 2.2.0.0, and

conceptually translated to the corresponding peptide sequence using EMBOSS Transeq (Rice et

al., 2000). The BLAST suite was used to align and confirm sequence identities of nucleotide and

translated peptide sequences by comparison to draft Toxocara canis genomes WGS: JPKZ01,

LYYD01 and UYWY01 (NCBI Genome database assemblies GCA_000803305.1,

Page 107: P-glycoprotein drug transporters in the parasitic

96

GCA_001680135.1 and GCA_900622545.1 respectively) (Johnson et al., 2008). The 1283

amino acid long conceptually translated protein sequence was analyzed with ScanProsite (de

Castro et al., 2006) and InterPro for residue annotation (Mitchell et al., 2019). Protein secondary

structure was predicted using Porter 5.0 (Torrisi et al., 2019) with secondary structure (SS3, SS8)

output as defined by DSSP (Kabsch and Sander, 1983) with prediction confidence intervals (0 to

9). Protein tertiary structure was predicted using ModWeb using the combined sequence-profile

and PSI-BLAST fold assignment methods (Pieper et al., 2014). Multiple sequence alignments of

nucleotide and translated protein sequences were visualized with Multalin version 5.4.1 (Corpet,

1988).

Translated protein sequence of other nematode P-gp sequences were obtained from NCBI

GenBank protein database, aligned using MAFFT (Katoh and Standley, 2013). Substitution

model was selected using the SMS tool with Bayesian Information Criteria (Lefort et al., 2017).

The model with lowest BIC value was LG+F+I+G with 4 parameter gamma distribution (Le and

Gascuel, 2008) and maximum likelihood phylogenetic analyses performed using PhyML3.0

(Guindon et al., 2010). The tree was visualized using Mega X (Kumar et al., 2018).

2.4. Heterologous expression in MDCK cells

Tca-Pgp-11.1 was heterologously expressed in MDCK cells lacking expression of

endogenous P-gp due to CRISPR/Cas9-mediated deletion of MDR1 (Karlgren et al., 2017). Cells

were maintained in Eagle’s minimum essential medium with 10% heat inactivated fetal bovine

serum (Atlanta biologicals) at 37C with 5% CO2. Chemical transfection was carried out using

Lipofectamine 2000 reagent, according to the manufacturer’s protocol. 5µg of the plasmid

pcDNA3.1+ containing the Tca-Pgp-11.1 gene was transfected into the cells at 90% confluency

Page 108: P-glycoprotein drug transporters in the parasitic

97

in 24 well plates. Transfected cells were selected using 400 µg/mL of Geneticin/ G418 sulfate,

and after 2 weeks of selection, stably transfected colonies were transferred to cell culture flasks.

The expression profile of Tca-Pgp11 was quantitated using RT-qPCR. Cells were

removed from cell culture flasks using 0.25% Trypsin-EDTA and used for RNA extraction using

Trizol reagent. cDNA was synthesized using iScript Select cDNA synthesis kit (Bio-rad). The

synthesized cDNA was used as template for qPCR using the primers listed in Table 4-S 1. Tca-

Pgp-11.1 and CanMDR1 expression levels were measured in all cell lines. CanGAPDH was used

as the reference gene. qPCR was carried out in a QuantStudio 3 Real-time PCR system (Applied

Biosystems) using the Sso Advanced Universal SYBR Green Supermix (Bio-rad). qPCR

efficiencies for each reaction were calculated by linear regression analysis of amplification

curves using LinregPCR (Ramakers et al., 2003). Relative fold differences between cells were

calculated using the efficiency corrected Ct method based on individual samples (Pfaffl, 2004).

Cells were harvested at 100% confluency and lysed using sterile beads (0.1mm, 0.5mm

and 2mm Zymo bashing beads). Total protein concentrations were determined using the

Coomassie Plus (Bradford) Assay. 30 g of total protein per well was resolved in a

discontinuous denaturing SDS-polyacrylamide gel with 4% stacking and 8% resolving gel.

Proteins were transferred to a PVDF membrane, blocked with Superblock blocking buffer in

PBS (Thermo Scientific) and incubated with primary antibody (1:250 dilution). Antibodies were

raised in rabbits targeting three 14 amino acid peptides (Table 4-1) predicted to be encoded by

the cloned Tca-Pgp11.1 (GenScript). Binding was detected by a 50:50 mixture of 1:5000 anti-

rabbit IgG and IgM (Jackson Labs) and Super signal picoluminescence (Thermo Fisher). The

same samples were blotted on a nitrocellulose membrane for a dot blot assay. Primary and

Page 109: P-glycoprotein drug transporters in the parasitic

98

secondary antibodies were used at the same dilutions as the western blotting experiment with

NBT/BCIP substrate (Thermo Fisher)

2.5. Tca-Pgp-11.1 mediated efflux assays

Tca-Pgp-11.1-mediated efflux of known P-gp substrates was measured using flow

cytometry. WT MDCK cells expressing canine endogenous MDR1 (Pgp) were used as positive

control and are hereafter referred to as WT cells. Non-transfected MDCK KO cells were used as

negative control and are hereafter referred to as KO cells. Fluorescent substrates included

Rhodamine 123 (R123), EffluxIDGreen (Enzo Life Sciences) and Calcein-AM (Invitrogen).

EffluxID Green was tested with specific inhibitors for MDR1/P-gp (Verapamil), MRP1/2 (MK-

571) and BCRP (Novobiocin) respectively. Calcein-AM was used to test the efflux of known

mammalian P-gp inhibitors - Verapamil (Acros Organics), Cyclosporine A, Tariquidar,

Reserpine (SelleckChem), Ivermectin (MP Biomedicals), Milbemycin oxime (US Pharmacopia).

Cells were grown to 90- 100% confluency, trypsinized, triturated to create a single cell

suspension, and washed with 1x D-PBS. Cells were incubated at 37C with dilutions of drugs in

1x D-PBS for 30 min, followed by with Calcein-AM (1M) at 37C for 15 min, washed twice

with D-PBS, and incubated at 37C for 60 mins prior to flow cytometry. Fluorescence was

determined by in a BD Accuri C6 flow cytometer with laser excitation of 488nm and emission

filter 530/30 (FITC channel), acquiring a minimum of 30,000 events per sample.

Pharmacological profile was recorded and normalized median fluorescence intensity (nMFI) was

calculated as a ratio of MFI of cells exposed to inhibitor drugs + dye and MFI of cells exposed to

no drugs or dye as described in (Chan et al., 2013). Additionally, ratio of mean fluorescence

intensities of transfected cells treated with drugs and transfected cells that were not treated with

inhibitors as described in (Mealey et al., 2017).

Page 110: P-glycoprotein drug transporters in the parasitic

99

2.6. Chromogenic in situ mRNA hybridization

Multiple nucleic acid hybridization was carried out to determine tissue specific

expression of isoforms of Tca-Pgp-11. Adult male and female worms were formalin fixed for 22

hours and embedded in paraffin for chromogenic hybridization studies.

Probes targeting the nucleotides 421 - 1364 of Tca-Pgp-11.1 were obtained from

Advanced Cell Diagnostics. The probes were also able to bind to putative Tca-Pgp-11.2 mRNA

which has high identity (>90%) with Tca-Pgp-11.1. Positive control probes targeting nucleotides

4 - 1004 of JPKZ01000754.1:68516-75076 of the T. canis β-tubulin component encoded by the

ttb4 gene and negative control probes targeting the nucleotides 414 - 862 of the dapB gene of

Bacillus subtilis (GenBank Accession number EF191515) were obtained. Probes were stored at

4C until use. RNAscope 2.5 HD Assay-Red reagents (Advanced Cell Diagnostics) were used

with Fast Red substrate. Chromogenic in situ mRNA hybridization was carried out on 5m thick

sections according to the protocol optimized for ascarid nematodes (Jesudoss Chelladurai and

Brewer, 2019). Positive mRNA signal after amplification was observed as red-pink dots in

nematode tissue.

2.7. Statistical analysis

Two-way ANOVA with Tukey’s multiple comparison tests was performed for the

analysis of flow cytometry data. All statistical analyses were performed using GraphPad Prism

version 8 .

3. Results

3.1. Bioinformatic analysis of Tca-Pgp-11.1

The full length cloned Tca-Pgp-11.1 gene is 3,849 base pairs in length, and the

conceptually translated protein is 1283 amino acids in length. In BLAST analyses, the cloned

sequence showed 98.88%, 91.88% and 53.84% identity with T.canis draft genome-predicted P-

Page 111: P-glycoprotein drug transporters in the parasitic

100

gp sequences KHN73709, KHN87227 and KHN89031. The cloned sequence demonstrated 72%

identity to Pgp11 from Parascaris equorum (72%), Brugia malayi (55%) and Dirofilaria immitis

(55%), consistent with similar comparisons in other nematodes (David et al., 2018).

Structural bioinformatic analyses of translated protein sequence showed tandem

arrangement of ABC transporter type-1 fused domain and ATP-binding domain in tandem in

each half of the protein which is typical of P-glycoproteins (Figure 4-1). The ATP transporter

family signature motif (LSGGQ) as well as the conserved Walker A, Walker B, Q loop/lid, D

loop and H loop/switch motifs were also present. Predicted secondary structures with the SS3 (3

state secondary structure) and SS8 (8 state secondary structure) are also depicted. Multiple

sequence alignments of predicted nucleotide and protein sequences from the T.canis draft

genome (GenBank Accession number JPKZ01003065 and KHN73709) and Parascaris Peq-

Pgp-11 (GenBank Accession numbers JX308320 and AGL08022) and are shown in Figures 4-S1

and S2.

Maximum Likelihood phylogenetic analysis of P-gp sequences revealed that Pgp-11

sequences from C. elegans and other parasitic nematodes formed a distinct clade (Figure 4-2).

Three predicted T. canis Pgps were observed in the Pgp11 clade – KHN73709, KHN87227 and

KHN89031. It is likely that the three are isoforms of Pgp11.

3.2. Expression of Tca-Pgp-11.1 in CRISPR-edited MDCK cells

The cloned sequence of Tca-Pgp-11.1 was ligated into the pcDNA3.1+ vector and stably

transfected into MDCK cells CRISPR-edited to remove endogenous canine MDR1 expression.

Expression of Tca-Pgp-11.1 mRNA was found to be on average 4000 times higher in transfected

cells than in the KO control cells (Figure 4-3). Translation of the protein was demonstrated by

immunoblotting (Figure 4-4). Western blotting revealed several bands, suggesting variations in

glycosylation of translated protein, including one of the expected (140kDa) size.

Page 112: P-glycoprotein drug transporters in the parasitic

101

3.3. Functional transport activity by Tca-Pgp-11.1

Functional activity of Tca-Pgp-11.1 was characterized by flow cytometry using the P-gp

substrates EffluxID Green (Figure 4-5), Calcein-AM, and R123 (Figure 4-6).EffluxID Green is a

non-specific dye that can be effluxed by mammalian MDR1, MRP and BCRP (Lebedeva et al.,

2011). Functional assays revealed efflux activity by Tc-Pgp-11.1-transfected cells that was

similar to WT, but significantly higher than KO cells (Figure 4-5). Similarly, R123 efflux was

apparent in both wild type and Tc-Pgp-11.1-transfected cells as compare to KO (Figure 4-6).

Interestingly, Calcein AM efflux was evident in Tca-Pgp-11.1-transfected cells, but not WT or

KO cells (Figure 4-6). Additionally, MK-571 (50 µM) caused marked losses in cell viability

(9.4% - 16% viable) in WT or KO cells compared to nematode P-gp (35% viable) (Data not

shown).

3.4. Unique pharmacology of Tca-Pgp-11.1

Tca-Pgp-11.1 activity was assessed with Calcein-AM in the presence of six drugs – two

macrocyclic lactones and four known mammalian P-gp inhibitors. Mean fluorescence intensities

ratios calculated at various concentrations of the six drugs are presented in Figure 4-9 and Table

4-S 2. A mean fluorescence intensity ratio of <1 represents low levels of efflux and conversely, a

ratio >1 represents higher Calcein-AM retention. An overlay of histograms of different

concentrations of the six drugs in Tca-Pgp-11.1 transfected are presented in Figure 4-S3.

P-gp activity of WT cells expressing mammalian MDR1 was sensitive to verapamil,

cyclosporine A, reserpine, and tariquidar in a dose-dependent manner. Interestingly, Tca-Pgp-

11.1 was insensitive to these inhibitors, exhibiting efflux activity that was similar to KO cells in

the presence of these drugs (p<0.05, Figure 4-8).

P-gp activity was increased in Tca-Pgp-11.1 and WT compared to KO cells, while Tca-

Pgp-11.1 and WT efflux activity were equivalent for all doses of ivermectin and milbemycin

Page 113: P-glycoprotein drug transporters in the parasitic

102

oxime studied (p<0.05, Figure 4-8). High dose ivermectin (100 µM) and milbemycin oxime

(≥ 50 µM) caused 50% reduction in viability compared to cells exposed to lower

concentrations of drugs in all three cell lines (Data not shown).

3.5. Tissue specific expression of Tca-Pgp-11

In situ multiple nucleic acid RNA hybridization was used to visualize mRNA transcripts

in tissues of adult male and female worms (Figure 4-10). No signal was detected in any

nematode tissue for the negative control (Bacillus subtilis DapB) (Figure 4-S4). Positive control

for the assay was a β-tubulin component encoded by the ttb4 gene in T. canis, which was

visualized throughout the parasite (Figure 4-S5). Ascarid anatomy for interpreting in situ

hybridization has been outlined in a previous study (Jesudoss Chelladurai and Brewer, 2019).

Red-pink dots indicative of Tca-Pgp-11 mRNA were observed in the hypodermis, but not in the

cuticle of both male and female worms. Increased positive signal was also observed in the single

layer of columnar cells of the intestine in both sexes. A large number of vacuoles were also

observed in the intestine in both sexes. Red-pink dots indicative of Tca-Pgp-11 mRNA was

observed in low numbers in the lateral cords and nerve cords. No hybridization signal was

visualized in either the male or female reproductive tracts at any transverse section measured.

4. Discussion

Toxocara canis somatic larvae in dog tissue are not susceptible to macrocyclic lactone

anthelmintics. Macrocyclic lactone efflux has been associated with P-glycoproteins in other

parasitic nematodes but much is unknown about the role that P-gp orthologs play in mediating a

drug-resistant phenotype (Kaschny et al., 2015). The present study described Toxocara canis

Pgp-11.1, which is an ortholog of Pgp-11 in the related Clade III nematodes Parascaris spp.,

Dirofilaria immitis and Brugia malayi (Bourguinat et al., 2011a; Janssen et al., 2013a; Stitt et al.,

2011) and in the unrelated Clade V nematodes Haemonchus contortus, Cooperia oncophora and

Page 114: P-glycoprotein drug transporters in the parasitic

103

Caenorhabditis elegans (De Graef et al., 2013; Kellerová et al., 2019; Ménez et al., 2016). In

these nematodes, resistance has been associated with SNPs in the DNA sequence and/or mRNA

expression changes in Pgp-11. In order to study the role of Pgp-11 in Toxocara canis, we cloned

and heterologously expressed Tca-Pgp-11.1 and assessed the interaction of MLs and known P-gp

inhibitors by flow cytometry. We present bioinformatic and phylogenetic analyses of the cloned

gene, the localization of mRNA expression, and evidence that Tca-Pgp-11.1 has a unique

pharmacological inhibition profile.

The cloned sequence was confirmed to be an ortholog of Pgp-11 by phylogenetic analysis

and was designated Tca-Pgp-11.1 in accordance with gene naming conventions (Beech et al.,

2010). Multiple sequence alignments revealed that the cloned sequence had very close identity to

Pgp-11 of the ascarid nematode Parascaris and slightly lower identity to Pgp-11 of C. elegans.

Phylogenetic analysis revealed that the cloned gene was found in the same clade in the ML tree

as Parascaris Pgp-11 and C. elegans Pgp-11. Orthologs from the spirurid nematode Dirofilaria

immitis, Onchocerca volvulus, Brugia malayi and Acanthocheilonema vitae formed a district

sub-clade that did not contain any ascarid Pgp-11 sequences. Two other protein sequences

encoded in the T. canis draft genome were found in the Pgp-11 clade. It is currently unknown if

these are paralogs or isoforms of Pgp-11. As genome assembly qualities improve, questions

about gene ontology can be resolved by the use of advanced new techniques such as RNA-seq.

Bioinformatic assessment of the Tca-Pgp-11.1 gene revealed that the mRNA transcript in

adult T. canis possessed a trans-spliced nematode leader SL3, which was not found at the 5’ end

of P-gp genes in all three draft genomes. While the spliced leader sequence has been used to

facilitate cloning of full length P-glycoprotein genes (Bourguinat et al., 2016; David et al., 2018),

Page 115: P-glycoprotein drug transporters in the parasitic

104

its role in gene regulation remains elusive 23 years after the question was first posed (Blaxter and

Liu, 1996).

Tca-Pgp-11.1 is a classical P-gp with two each of transporter and ATP-binding domains.

The tertiary structure deduced from the crystal structure of C. elegans Pgp-1 (Jin et al., 2012)

revealed that Tca-Pgp-11.1 has two transmembrane domains with 6 transmembrane helices

where drugs may bind. This modelled structure can be used to screen compounds by in silico

methods prior to testing in in vitro models (David et al., 2018) in order to expedite screening of

large libraries of compounds that might be transported by Tca-Pgp-11.1.

Tca-Pgp-11.1 was expressed without codon optimization changes, in order to accurately

assess the function of the nematode gene. In this study, KO cells, altered by CRISPR-Cas9

technology, were used for nematode P-gp expression. This cell line has been a tractable model in

our hands to study nematode P-gps as it expresses no endogenous MDR1 (P-gp) similar to LLC-

PK1 pig kidney cells (which has low endogenous MDR1 levels), with the added advantage of

having increased growth rates. Transfected cells both transcribed and translated Tca-Pgp-11.1

which was detectable by qPCR as well as polyclonal antibodies targeting exposed regions of the

protein. Thus, we developed a novel method for studying nematode P-glycoproteins in the

absence of interference by mammalian MDR1. This system will be highly valuable for studying

the pharmacology of nematode P-gp.

In the functional efflux assays, three fluorescent dyes were tested to determine the best

candidate for use in the MDCK KO model since individual dyes have different transport rates in

various cell lines under different experimental conditions (Lebedeva et al., 2011). The

observation that Tca-Pgp-11.1 mediated efflux of all three substrates reinforced the suitability of

the model. Calcein-AM was chosen for further drug assessments because of light stability and

Page 116: P-glycoprotein drug transporters in the parasitic

105

ease of handling. Calcein-AM is a non-fluorescent Pgp substrate that is hydrolyzed

intracellularly to fluorescent Calcein molecules, which cannot be effluxed (Liminga et al., 1994).

Efflux data suggests that Tca-Pgp-11.1 is capable of transporting both avermectin and

milbemycin class drug candidates. Additionally, Tca-Pgp-11.1 mRNA is expressed in hatched

and somatic larvae (Chapter 3 of this thesis). Taken together, these points provide evidence that

Tca-Pgp-11.1 plays some role in the perceived tolerance of somatic larvae to macrocyclic

lactones. Further research to explore the regulation of Pgp-11 is essential to aid in understanding

how modulating/down-regulating the action/expression of P-gps can help overcome tolerance in

clinical situations.

Mammalian P-gp inhibition has been extensively studied because of the role that P-gps

play in the MDR phenotype exhibited by many mammalian tumors (Briz et al., 2019; Zandvliet

and Teske, 2015). Verapamil (also a calcium channel blocker) and Cyclosporine A (also an

immunosuppressive agent) are first generation inhibitors that are themselves substrates of P-gps,

and compete with other substrates for P-gp mediated efflux (Palmeira et al., 2012). Reserpine (an

antihypertensive alkaloid) inhibits mammalian P-gp activity but also affects the catecholamine

pathways (Abdelfatah and Efferth, 2015). Tariquidar is a third generation P-gp inhibitor that was

specifically designed to allosterically inhibit mammalian P-gps but is not itself a substrate

(Weidner et al., 2016).

Interestingly, our studies revealed that Tca-Pgp-11.1 was insensitive to verapamil,

cyclosporine A, reserpine, and tariquidar (Figure 4-8, Figure 4-S3). This is in disagreement with

some studies using first generation inhibitors both in vitro and in vivo with the intention of

nematode P-gp inhibition (AlGusbi et al., 2014; Stitt et al., 2011; Xu et al., 1998). We

hypothesize that whole organism assays are measurements of net P-gp activity that is a result of

Page 117: P-glycoprotein drug transporters in the parasitic

106

simultaneous expression of numerous P-gps. It is also possible that past studies have made

observations resulting from these drugs interacting with other cellular targets. Additional

research with other P-gp orthologs, paralogs from T. canis including allelic variations among

individuals, as suggested by (Kaschny et al., 2015) is necessary to understand the fine scale

molecular mechanism of action of these inhibitors.

Localization studies have been conducted in ascarid nematodes to study P-gps using the

multiple nucleotide chromogenic in situ hybridization assay (Jesudoss Chelladurai and Brewer,

2019). The sites of mRNA expression of more than one isoform of Tca-Pgp-11 was determined

in this study as probes used were unable to distinguish between Tca-Pgp-11.1 and Tca-Pgp-11.2

due to their high level of identity. Differential expression of Pgp-11 mRNA was observed with

high levels in the intestines and low levels in the body wall, nerve and lateral cords of adult T.

canis were similar to patterns of Peq-Pgp-11 expression observed in adult Parascaris (Jesudoss

Chelladurai and Brewer, 2019). However, there was no Tca-Pgp-11 mRNA expression in the

reproductive tissues in either sex of T. canis, while Peq-Pgp-11 was expressed in the

reproductive tissues of both sexes. Further research is necessary to understand the localization

patterns of P-gps paralogs in adult tissue and to determine the significance of differential P-gp

gene expression in nematode reproductive tissues.

In this study, we identified an ATP-binding cassette transporter from the nematode

parasite T. canis. Phylogenetic and bioinformatic analysis allowed us to designate this gene Tca-

Pgp-11.1, which is an ortholog of Pgp-11 in related ascarids. Nucleic acid hybridization studies

demonstrated expression of Tca-Pgp-11 in adult parasites. Heterologous expression assays

revealed that Tca-Pgp-11.1 has P-gp activity, measurable by efflux of fluorescent P-gp

substrates. Significantly, we used a gene-edited cell line enabling the study of Tca-Pgp-11.1 in

Page 118: P-glycoprotein drug transporters in the parasitic

107

isolation from mammalian P-gp which has the potential to confound such heterologous studies.

Flow cytometric analysis of cells expressing the nematode protein revealed a novel

pharmacological profile, being insensitive to many agents known to cause P-gp inhibition.

Further studies are needed to investigate the repertoire of P-glycoprotein activity in nematodes

and to identify parasite-specific inhibitors that could be used to potentiate anthelmintic activity.

5. References

Abdelfatah, S.A., Efferth, T., 2015. Cytotoxicity of the indole alkaloid reserpine from

Rauwolfia serpentina against drug-resistant tumor cells. Phytomedicine 22, 308-318.

AlGusbi, S., Krücken, J., Ramünke, S., von Samson-Himmelstjerna, G., Demeler, J.,

2014. Analysis of putative inhibitors of anthelmintic resistance mechanisms in cattle

gastrointestinal nematodes. Int J Parasitol 44, 647-658.

Aranda, P.S., LaJoie, D.M., Jorcyk, C.L., 2012. Bleach gel: a simple agarose gel for

analyzing RNA quality. Electrophoresis 33, 366-369.

Beech, R.N., Wolstenholme, A.J., Neveu, C., Dent, J.A., 2010. Nematode parasite genes:

what's in a name? Trends Parasitol 26, 334-340.

Blaxter, M., Liu, L., 1996. Nematode spliced leaders--ubiquity, evolution and utility. Int J

Parasitol 26, 1025-1033.

Bourguinat, C., Che, H., Mani, T., Keller, K., Prichard, R.K., 2016. ABC-B transporter

genes in Dirofilaria immitis. Int J Parasitol Drugs Drug Resist 6, 116-124.

Bourguinat, C., Keller, K., Bhan, A., Peregrine, A., Geary, T., Prichard, R., 2011.

Macrocyclic lactone resistance in Dirofilaria immitis. Vet Parasitol 181, 388-392.

Briz, O., Perez-Silva, L., Al-Abdulla, R., Abete, L., Reviejo, M., Romero, M.R., Marin,

J.J.G., 2019. What "The Cancer Genome Atlas" database tells us about the role of ATP-binding

cassette (ABC) proteins in chemoresistance to anticancer drugs. Expert Opin Drug Metab

Toxicol 15, 577-593.

Calabrese, E.J., 2008. P-glycoprotein efflux transporter activity often displays biphasic

dose-response relationships. Crit Rev Toxicol 38, 473-487.

Chan, L.Y., Yim, E.K., Choo, A.B., 2013. Normalized median fluorescence: an

alternative flow cytometry analysis method for tracking human embryonic stem cell states during

differentiation. Tissue Eng Part C Methods 19, 156-165.

Corpet, F., 1988. Multiple sequence alignment with hierarchical clustering. Nucleic

Acids Res 16, 10881-10890.

David, M., Lebrun, C., Duguet, T., Talmont, F., Beech, R., Orlowski, S., André, F.,

Prichard, R.K., Lespine, A., 2018. Structural model, functional modulation by ivermectin and

Page 119: P-glycoprotein drug transporters in the parasitic

108

tissue localization of Haemonchus contortus P-glycoprotein-13. Int J Parasitol Drugs Drug Resist

8, 145-157.

de Castro, E., Sigrist, C.J., Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S.,

Gasteiger, E., Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITE signature

matches and ProRule-associated functional and structural residues in proteins. Nucleic Acids Res

34, W362-365.

De Graef, J., Demeler, J., Skuce, P., Mitreva, M., Von Samson-Himmelstjerna, G.,

Vercruysse, J., Claerebout, E., Geldhof, P., 2013. Gene expression analysis of ABC transporters

in a resistant Cooperia oncophora isolate following in vivo and in vitro exposure to macrocyclic

lactones. Parasitology 140, 499-508.

Figueiredo, L.A., Rebouças, T.F., Ferreira, S.R., Rodrigues-Luiz, G.F., Miranda, R.C.,

Araujo, R.N., Fujiwara, R.T., 2018. Dominance of P-glycoprotein 12 in phenotypic resistance

conversion against ivermectin in Caenorhabditis elegans. PLoS One 13, e0192995.

Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010.

New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the

performance of PhyML 3.0. Syst Biol 59, 307-321.

Issouf, M., Guégnard, F., Koch, C., Le Vern, Y., Blanchard-Letort, A., Che, H., Beech,

R.N., Kerboeuf, D., Neveu, C., 2014. Haemonchus contortus P-glycoproteins interact with host

eosinophil granules: a novel insight into the role of ABC transporters in host-parasite interaction.

PLoS One 9, e87802.

Janssen, I.J., Krücken, J., Demeler, J., Basiaga, M., Kornaś, S., von Samson-

Himmelstjerna, G., 2013. Genetic variants and increased expression of Parascaris equorum P-

glycoprotein-11 in populations with decreased ivermectin susceptibility. PLoS One 8, e61635.

Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2015.

Transgenically expressed Parascaris P-glycoprotein-11 can modulate ivermectin susceptibility in

Caenorhabditis elegans. Int J Parasitol Drugs Drug Resist 5, 44-47.

Jesudoss Chelladurai, J., Brewer, M.T., 2019. Detection and quantification of Parascaris

P-glycoprotein drug transporter expression with a novel mRNA hybridization technique. Vet

Parasitol 267, 75-83.

Jin, M.S., Oldham, M.L., Zhang, Q., Chen, J., 2012. Crystal structure of the multidrug

transporter P-glycoprotein from Caenorhabditis elegans. Nature 490, 566-569.

Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., Madden, T.L.,

2008. NCBI BLAST: a better web interface. Nucleic Acids Res 36, W5-9.

Kabsch, W., Sander, C., 1983. Dictionary of protein secondary structure: pattern

recognition of hydrogen-bonded and geometrical features. Biopolymers 22, 2577-2637.

Karlgren, M., Simoff, I., Backlund, M., Wegler, C., Keiser, M., Handin, N., Müller, J.,

Lundquist, P., Jareborg, A.C., Oswald, S., Artursson, P., 2017. A CRISPR-Cas9 Generated

MDCK Cell Line Expressing Human MDR1 Without Endogenous Canine MDR1 (cABCB1):

An Improved Tool for Drug Efflux Studies. J Pharm Sci 106, 2909-2913.

Page 120: P-glycoprotein drug transporters in the parasitic

109

Kaschny, M., Demeler, J., Janssen, I.J., Kuzmina, T.A., Besognet, B., Kanellos, T.,

Kerboeuf, D., von Samson-Himmelstjerna, G., Krücken, J., 2015. Macrocyclic lactones differ in

interaction with recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus elongatus

and ketoconazole in a yeast growth assay. PLoS Pathog 11, e1004781.

Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version

7: improvements in performance and usability. Mol Biol Evol 30, 772-780.

Kellerová, P., Matoušková, P., Lamka, J., Vokřál, I., Szotáková, B., Zajíčková, M.,

Pasák, M., Skálová, L., 2019. Ivermectin-induced changes in the expression of cytochromes

P450 and efflux transporters in Haemonchus contortus female and male adults. Vet Parasitol

273, 24-31.

Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: Molecular

Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol 35, 1547-1549.

Le, S.Q., Gascuel, O., 2008. An improved general amino acid replacement matrix. Mol

Biol Evol 25, 1307-1320.

Lebedeva, I.V., Pande, P., Patton, W.F., 2011. Sensitive and specific fluorescent probes

for functional analysis of the three major types of mammalian ABC transporters. PLoS One 6,

e22429.

Lefort, V., Longueville, J.E., Gascuel, O., 2017. SMS: Smart Model Selection in PhyML.

Mol Biol Evol 34, 2422-2424.

Liminga, G., Nygren, P., Larsson, R., 1994. Microfluorometric evaluation of calcein

acetoxymethyl ester as a probe for P-glycoprotein-mediated resistance: effects of cyclosporin A

and its nonimmunosuppressive analogue SDZ PSC 833. Exp Cell Res 212, 291-296.

Mani, T., Bourguinat, C., Keller, K., Ashraf, S., Blagburn, B., Prichard, R.K., 2016.

Interaction of macrocyclic lactones with a Dirofilaria immitis P-glycoprotein. Int J Parasitol 46,

631-640.

Mealey, K.L., Dassanayake, S., Burke, N.S., 2017. Establishment of a cell line for

assessing drugs as canine P-glycoprotein substrates: proof of principle. J Vet Pharmacol Ther 40,

545-551.

Mitchell, A.L., Attwood, T.K., Babbitt, P.C., Blum, M., Bork, P., Bridge, A., Brown,

S.D., Chang, H.Y., El-Gebali, S., Fraser, M.I., Gough, J., Haft, D.R., Huang, H., Letunic, I.,

Lopez, R., Luciani, A., Madeira, F., Marchler-Bauer, A., Mi, H., Natale, D.A., Necci, M., Nuka,

G., Orengo, C., Pandurangan, A.P., Paysan-Lafosse, T., Pesseat, S., Potter, S.C., Qureshi, M.A.,

Rawlings, N.D., Redaschi, N., Richardson, L.J., Rivoire, C., Salazar, G.A., Sangrador-Vegas, A.,

Sigrist, C.J.A., Sillitoe, I., Sutton, G.G., Thanki, N., Thomas, P.D., Tosatto, S.C.E., Yong, S.Y.,

Finn, R.D., 2019. InterPro in 2019: improving coverage, classification and access to protein

sequence annotations. Nucleic Acids Res 47, D351-D360.

Ménez, C., Alberich, M., Kansoh, D., Blanchard, A., Lespine, A., 2016. Acquired

Tolerance to Ivermectin and Moxidectin after Drug Selection Pressure in the Nematode

Caenorhabditis elegans. Antimicrob Agents Chemother 60, 4809-4819.

Page 121: P-glycoprotein drug transporters in the parasitic

110

Palmeira, A., Sousa, E., Vasconcelos, M.H., Pinto, M.M., 2012. Three decades of P-gp

inhibitors: skimming through several generations and scaffolds. Curr Med Chem 19, 1946-2025.

Pfaffl, M.W., 2004. A–Z of Quantitative PCR, 1 Edition. International University Line,

La Jolla, CA.

Pieper, U., Webb, B.M., Dong, G.Q., Schneidman-Duhovny, D., Fan, H., Kim, S.J.,

Khuri, N., Spill, Y.G., Weinkam, P., Hammel, M., Tainer, J.A., Nilges, M., Sali, A., 2014.

ModBase, a database of annotated comparative protein structure models and associated

resources. Nucleic Acids Res 42, D336-346.

Ramakers, C., Ruijter, J.M., Deprez, R.H., Moorman, A.F., 2003. Assumption-free

analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62-

66.

Rice, P., Longden, I., Bleasby, A., 2000. EMBOSS: the European Molecular Biology

Open Software Suite. Trends Genet 16, 276-277.

Schnieder, T., Laabs, E.M., Welz, C., 2011. Larval development of Toxocara canis in

dogs. Vet Parasitol 175, 193-206.

Stitt, L.E., Tompkins, J.B., Dooley, L.A., Ardelli, B.F., 2011. ABC transporters influence

sensitivity of Brugia malayi to moxidectin and have potential roles in drug resistance. Exp

Parasitol 129, 137-144.

Torrisi, M., Kaleel, M., Pollastri, G., 2019. Deeper Profiles and Cascaded Recurrent and

Convolutional Neural Networks for state-of-the-art Protein Secondary Structure Prediction. Sci

Rep 9, 12374.

Weidner, L.D., Fung, K.L., Kannan, P., Moen, J.K., Kumar, J.S., Mulder, J., Innis, R.B.,

Gottesman, M.M., Hall, M.D., 2016. Tariquidar Is an Inhibitor and Not a Substrate of Human

and Mouse P-glycoprotein. Drug Metab Dispos 44, 275-282.

Xu, M., Molento, M., Blackhall, W., Ribeiro, P., Beech, R., Prichard, R., 1998.

Ivermectin resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol

Biochem Parasitol 91, 327-335.

Zandvliet, M., Teske, E., 2015. Mechanisms of Drug Resistance in Veterinary Oncology-

A Review with an Emphasis on Canine Lymphoma. Vet Sci 2, 150-184.

Page 122: P-glycoprotein drug transporters in the parasitic

111

Figures and tables

Figure 4-1. Bioinformatic analysis of conceptually translated protein sequence of Tca-Pgp-11.1. (A) ScanProsite predicted domain

arrangements in conceptually translated protein sequence of Tca-Pgp-11.1. (B) ModWeb predicted tertiary structure modelled after C.

elegans Pgp-1 crystal structure (PDB: 4f4c). (C) Porter 5.0 predicted secondary structure of conceptually translated protein sequence

Page 123: P-glycoprotein drug transporters in the parasitic

112

of Tca-Pgp-11.1 with domain architecture annotations from ScanProsite and residue level annotation from InterPro. Line 1 denotes

conceptually translated Tca-Pgp-11.1 protein sequence (SEQ). Line 2 denotes SS3, the 3-class secondary structure prediction where H

= helix (alpha helix, 3-10 helix, pi-helix) classes, E = strand (extended strand, beta-bridge classes) and C = the rest (turn, bend etc.).

Line 3 denotes 3 class Secondary structure prediction confidence: a number between 0 and 9, with 9 signifying maximal confidence.

Line 4 denotes SS8, the 8-class secondary structure prediction where H = alpha helix, G = 3-10 helix, I = pi-helix, E = extended

strand, B = beta-bridge, T = turn, S = bend and C = the rest. Line 5 denotes 8 class Secondary structure prediction confidence: a

number between 0 and 9, with 9 signifying maximal confidence. Helices are colored red and coils are colored blue.

Page 124: P-glycoprotein drug transporters in the parasitic

113

Figure 4-2. Maximum likelihood phylogenetic tree of cloned and predicted T. canis Pgp genes in

comparison with those from other nematodes. Mouse, human and dog Pgp (MDR1) protein

sequences were used as outgroup. The cloned Tca-Pgp-11 is highlighted with a black bullet ().

Page 125: P-glycoprotein drug transporters in the parasitic

114

Figure 4-3. Expression of Tca-Pgp-11.1 in transfected MDCK-ΔMDR cells. Relative fold

change was calculated with the efficiency corrected Ct method based on single samples using

transfected cells as samples, KO cells as calibrators, and canine GAPDH as the reference gene.

Figure 4-4. Western blot and dot blot using anti-Tca-Pgp-11 polyclonal antibodies raised in

rabbits against (A) whole cell lysate of Tca-Pgp-11.1 transfected cells, (B) whole cell lysate of

Page 126: P-glycoprotein drug transporters in the parasitic

115

KO cells and (C) protein marker (PageRuler Plus, ThermoScientific). Each lane was loaded with

30 µg of total protein. Expected 140 KDa band is indicated by a green arrow.

Figure 4-5. Flow cytometry histograms of EffluxID dye transport activity in WT cells, Tca-Pgp-

11 transfected, and KO cells with (A) EffluxID Green with no drugs (B) EffluxID Green + 20µM

Verapamil, (C) EffluxID Green + 50µM MK-571, (D) EffluxID Green + 100µM Novobiocin. A

Page 127: P-glycoprotein drug transporters in the parasitic

116

minimum of 10,000 gated cells are represented in each histogram, except where indicated in

the text. Normalized mean fluorescence obtained with Calcein-AM (B) and Rhodamine 123 (D)

as fluorophores. Significant differences in a two-way ANOVA are depicted (*) (p<0.05).

Figure 4-6.Flow cytometry histograms of Calcein-AM (A) and Rhodamine 123 (C) dye transport

activity in WT cells, Tca-Pgp-11 transfected, and KO cells with no drugs.A minimum of 10,000

gated cells are represented in each histogram, except where indicated in the text. Normalized

mean fluorescence obtained with Calcein-AM (B) and Rhodamine 123 (D) as fluorophores.

Page 128: P-glycoprotein drug transporters in the parasitic

117

Figure 4-7. Flow cytometry histograms of Calcein-AM dye transport activity in WT cells, Tca-

Pgp-11 transfected, and KO cells.Flow plots of the three cell lines with dilutions of ivermectin

(A-G), milbemycin oxime (I-O), verapamil, (P-V), cyclosporine A (W-AC), reserpine (AD-AJ)

and tariquidar (AK-AQ). A minimum of 10,000 gated cells are represented in each histogram,

except where indicated in the text.

Page 129: P-glycoprotein drug transporters in the parasitic

118

Figure 4-8. Normalized mean fluorescence obtained with Calcein-AM in the presence of

ivermectin, milbemycin oxime, verapamil, cyclosporine A, reserpine and tariquidar.

Page 130: P-glycoprotein drug transporters in the parasitic

119

Figure 4-9. Mean fluorescence intensity ratios in Tca-Ppg-11 transfected cells co-incubated with

Calcein-AM and inhibitors.

0.00

0.01

0.10

1.00

5.00

10.0

0

50.0

0

100.

00

0

1

2

3

4

Drug, mM

Mean

flu

ore

scen

ce in

ten

sti

y

rati

o

Ivermectin

Milbemycin oxime

Verapamil

Cyclosporine A

Reserpine

Tariquidar

Page 131: P-glycoprotein drug transporters in the parasitic

120

Figure 4-10. Representative images of multiple nucleic acid in situ hybridization in adult female

and male Toxocara canis. Positive signal resulting from hybridization of Tca-Pgp-11 probes

Page 132: P-glycoprotein drug transporters in the parasitic

121

appeared as red punctate dots in all tissues except the reproductive tract. Black boxes indicate

the location of high magnification insets. Black arrows point to red dots in locations where

signal was low.

Table 4-1. Peptide sequences used as antigens for antibody production in rabbits.

Antigen Length Antigenicity/Surface/ Hydrophilicity

VDAASSKQMKGNAEC 14 aa 1.51/0.86/0.48

CGQKQRIAIARTIAR 14 aa 1.20/0.57/0.29

IKSEGSIQFSDVHFC 14 aa 0.99/0.64/-0.00

Page 133: P-glycoprotein drug transporters in the parasitic

122

Supplementary data

The following is supplementary data to this article:

Figure 4-S 1. Multiple sequence alignments of nucleotide sequences of cloned Tca-Pgp-11.1,

Parascaris gene Peq-Pgp-11 (GenBank Accession number JX308320) and predicted P-gp from

draft genome of T. canis (GenBank Accession number JPKZ01003065).

Page 134: P-glycoprotein drug transporters in the parasitic

123

Figure 4-S 2. Multiple sequence alignments of conceptually translated protein sequences of

cloned Tca-Pgp-11.1, Parascaris Peq-Pgp-11 (GenBank Accession number AGL08022) and

predicted P-gp from draft genome of T. canis (GenBank Accession number KHN73709).

Page 135: P-glycoprotein drug transporters in the parasitic

124

Figure 4-S 3. Flow cytometric analysis of transport activity of ABC transporters exposed to (A)

Ivermectin, (B) Milbemycin oxime, (C) Verapamil, (D) Cyclosporine A, (E) Reserpine and (F)

Tariquidar.

Page 136: P-glycoprotein drug transporters in the parasitic

125

Figure 4-S 4. Representative images of adult female and male Toxocara canis. No positive signal

resulting from hybridization of B. subtilis DapB probes appeared in any nematode tissue studied

in either sex.

Page 137: P-glycoprotein drug transporters in the parasitic

126

Figure 4-S 5. Representative images of adult female and male Toxocara canis. Positive signal

resulting from hybridization of Toxocara canis tubulin gene ttb4 probes appeared as red punctate

dots in all tissues studied in both sexes.

Page 138: P-glycoprotein drug transporters in the parasitic

127

Table 4-S 1. Primers used to clone Tca-Pgp-11.1 and in qPCR

Primer name Sequence Reference

SL3 5'- GGT TTA ATT ACC CAA GTT TGA G -3' (Gems et al., 1995)

Pgp11R 5’- GTA TGA GTT CGG CGT AT -3’ Custom designed

Pgp11 forward-

HindIII

5’- ACT GAA AAC CCC TTT TGG GGA AGC

TTG CCG CCA CCA TGG ATG ACA ATC GCA

AGG ACT C -3’

Custom designed

Pgp11 reverse-

BamH1

5’- ACT GAA AAC CCC TTT TGG GGG GAT

CCT TAA TGG TGA TGG TGA TGG TGG CTG

CGC AGA TCC TGT TTG CGT ATG AGT TCG

GCG TAT -3’

Custom designed

qTcPgp11-2F TGCAACGGTCAGGAAACGAT Custom designed

qTcPg11-2R AATATCGCCCGGCTCTTTGA Custom designed

Table 4-S 2. Ratio of Mean fluorescence Intensities in Tca-Pgp-11.1 transfected cells with

Calcein-AM with the experimental drugs at various concentrations

Ivermectin Milbemycin

oxime

Verapamil Cyclosporine

A

Reserpine Tariquidar

100 µM 0.65248 0.56614 1.10767 1.21652 0.64602 1.63992

50 µM 0.99269 0.84915 1.20057 1.20963 0.96822 2.23853

10 µM 1.21566 1.00715 1.06833 1.18814 1.06587 3.58703

5 µM 0.96961 0.85356

1 µM 1.31677 1.22984 0.99923 0.95178 1.05937 1.92403

0.1 µM 0.49697 0.89788 0.98064 0.92345 0.99778 1.00113

0.01 µM 1.06221 0.97367 0.95830 1.34620

0 µM 1 1 1 1 1 1

Page 139: P-glycoprotein drug transporters in the parasitic

128

CHAPTER 5. DETECTION AND QUANTIFICATION OF PARASCARIS P-

GLYCOPROTEIN DRUG TRANSPORTER EXPRESSION WITH A NOVEL MRNA

HYBRIDIZATION TECHNIQUE

Jeba R J Jesudoss Chelladurai, Matt T Brewer

Modified from a manuscript published in Veterinary Parasitology

https://doi.org/10.1016/j.vetpar.2019.02.002

Abstract

Macrocyclic lactone-resistant Parascaris have been reported throughout the world. In

part, the drug resistant phenotype is hypothesized to be associated with ATP-binding cassette

transporters known as P-glycoproteins. In many systems, P-glycoproteins efflux drugs out of

cells thereby precluding drug binding to target receptors. Parascaris may evade macrocyclic

lactone-mediated death by effluxing drugs away from target receptors in the nervous system.

Alternatively, P-glycoprotein expression in the gut or body wall could prevent penetration of

drugs into the body of the parasite altogether. In the present study, we evaluate expression of

Peq-pgp-11 and Peq-pgp-16 using a novel multiple nucleic acid hybridization method. This

method allowed for visualization of individual mRNA transcripts within fixed tissue sections of

Parascaris adults. Our investigation revealed expression of Peq-pgp-11 and Peq-pgp-16 in the

intestine, body wall, nerves, lateral cords, and reproductive tissues of male and female parasites.

These results suggest that P-gp could efflux drugs locally at the level of parasite neuronal tissue

as well as at sites of entry for drugs such as the hypodermis and intestine. The multiple nucleic

acid hybridization method could be useful for providing tissue context for gene expression in a

variety of nematode parasites.

Page 140: P-glycoprotein drug transporters in the parasitic

129

1. Introduction

Parascaris spp. is a cosmopolitan ascarid nematode that inhabits the small intestine of

equids. These large nematodes reach up to 30 cm in length and are known to cause malnutrition

and intestinal impaction when present in large numbers. Unfortunately, this parasite has

developed resistance to macrocyclic lactone (ML) anthelmintics including ivermectin and

moxidectin (Boersema et al., 2002). The first report of drug resistance in the United States was

published in 2007 (Craig et al., 2007). Resistance is now considered to be relatively widespread

in Europe and North America (Peregrine et al., 2014). Drug resistance has also been reported in

Parascaris in South America (Molento et al., 2008), Oceania (Beasley et al., 2015; Bishop et al.,

2014) and Asia (Shah et al., 2016). These findings have prompted the implementation of

measures designed to delay the development of resistance in susceptible populations (Nielsen,

2016).

The ML group of anthelmintics includes the avermectins and milbemycins. These agents

selectively act on glutamate-gated chloride channels of invertebrates causing a slow and

permanent state of hyperpolarization due to excessive chloride ion influx leading to paralysis

(Wolstenholme, 2012). The effects are concentration-dependent, but species-specific differences

in potency due to biochemical and pharmacological differences have been demonstrated (Geary

and Moreno, 2012). Resistance to the ML anthelmintics has often been attributed to mutations

and decreased expression of glutamate-gated chloride channels (Whittaker et al., 2017).

However, an understanding of other mechanisms of resistance is beginning to emerge, and

includes metabolism by cytochrome P450 (Riga et al., 2014), and efflux due to overexpression

by ABCB1 transporter family (James and Davey, 2009; Xu et al., 1998).

For several parasites of veterinary importance, there is a growing body of evidence that

resistance to ML is, at least in part, mediated by ABC transporters (P-glycoproteins) (Whittaker

Page 141: P-glycoprotein drug transporters in the parasitic

130

et al., 2017). P-glycoproteins (Pgps) are members of the ATP-binding cassette transporter family

that are well known to modulate drug resistance in bacteria and neoplastic tissues (Davidson and

Chen, 2004; Licht et al., 1994). In helminths, P-gps are thought to contribute to drug resistance

by effluxing anthelmintics away from their molecular target. P-gps associated with ML

resistance have been characterized in several nematode parasites including the trichostrongyle

Haemonchus contortus (Godoy et al., 2015a, 2016; Godoy et al., 2015b; Xu et al., 1998),

cyathostomins (Drogemuller et al., 2004; Kaschny et al., 2015), and the filarid Dirofilaria

immitis (Bourguinat et al., 2016; Mani et al., 2016).

Recent evidence suggests that increased levels of P-gp expression are highly correlated

with reduced susceptibility of Parascaris to MLs (Janssen et al., 2013a). Two P-gp genes, Peq-

pgp-11 and Peq-pgp-16, have been identified. Of these two P-gp genes, it appears that Peq-pgp-

11 is more strongly associated with resistance (Janssen et al., 2013a).Decreased susceptibility to

MLs has been demonstrated with transgenically expressed Peq-pgp-11 in C. elegans (Janssen et

al., 2015). It is thought that the ML resistant phenotype occurs when expression of Peq-pgp-11 is

high, however, the factors regulating this expression are not well characterized (Nielsen et al.,

2014).

Pgp-11 orthologs that alter susceptibility to MLs have been shown to occur in other

parasitic nematodes including D. immitis (Mani et al., 2016), Cooperia oncophora (De Graef et

al., 2013), H. contortus (Raza et al., 2016b) and non-parasitic Caenorhabditis elegans (Bygarski

et al., 2014). Pgp-16 orthologs occur in H. contortus (Godoy et al., 2015a) and in C. oncophora

(Demeler et al., 2013; Tydén et al., 2014) with expression levels increased after ML exposure in

the latter. In contrast Pgp-16 orthologs were not found in C. elegans (Issouf et al., 2014).

Page 142: P-glycoprotein drug transporters in the parasitic

131

In Parascaris, tissue-specific expression of P-gp has been investigated by dissecting

worm tissues and amplifying expressed genes by PCR (Janssen et al., 2013a). However, this

preparation method precludes making clean preparations of tortuous linear organs such as the

testes (Janssen et al., 2013a), and makes studying localization in nerve cords, and lateral cords

impossible due to their small size. To overcome these obstacles, expression of P-gps can be

studied in situ in sections of worm tissue that allow the preservation of anatomy and tissue

architecture.

We examined P-gp expression using an in situ multiple nucleic acid RNA hybridization

method that allowed visualization of individual mRNA transcripts through a novel signal

amplification technique (Wang et al., 2012a). This method utilizes a double Z probe design

based on a target mRNA with the base of the Z having a complementary binding sequence. The

18- to 25- nucleotide base and the 14- nucleotide tail of the Z are connected by a spacer. Binding

of two adjacent Z probes allows the formation of a 28 nucleotide binding site made of two tails

of the Z probes. A preamplifier binds to the site, and is turn bound by an amplifier, which is

bound by an alkaline phosphatase labeled signal amplifying probe. A chromogenic substrate is

added that allows visualization. The chromogenic signal, indicating an individual mRNA

transcript, can be viewed as a punctate dot by light microscopy. The aim of this present study

was to determine the tissue distribution of Peq-pgp-11 and Peq-pgp-16 as determined by

multiple nucleic acid RNA hybridization.

2. Materials and methods

2.1. Parasites

Adult male and female Parascaris were obtained opportunistically from foals necropsied

at the College of Veterinary Medicine, Iowa State University. All procedures were conducted in

accordance with applicable institutional animal care and use committee protocols and guidelines.

Page 143: P-glycoprotein drug transporters in the parasitic

132

Adult worms were fixed in 10% neutral buffered formalin (NBF) (Fisher Scientific, NJ)

for 22 h. Ten percent NBF was injected into the worms to fix internal organs, and the whole

worms were placed in 10% NBF. Four segments from each of three body regions (anterior,

middle, posterior) were excised from a male and female worm and embedded in paraffin blocks.

Five μm tissue sections were prepared on microscope slides by standard histological procedures

in the Department of Veterinary Pathology at Iowa State University.

2.2. Probe targets

Probes for chromogenic multiple nucleic acid in situ mRNA hybridization were obtained

from Advanced Cell Diagnostics (Hayward, CA). Multiple nucleic acid probes targeting the

nucleotides 687–2489 of Peq-pgp-11 (GenBank Accession number JX308230.1) and nucleotides

2592–3541 of Peq-pgp-16 (GenBank Accession number JX308231.1) were used. A positive

control probe targeted the nucleotides 5–1305 of Peq-beta-tubulin (GenBank Accession number

JN034256.1), a component of the eukaryotic cytoskeleton. This probe could also weakly bind

isotype 2 of P. equorum β-tubulin (GenBank Accession number KC713798.1). A negative

control probe was designed to target the nucleotides 414–862 of the dapB sequence of Bacillus

subtilis (GenBank Accession number EF191515), encoding the bacterial enzyme

dihydrodipicolinate reductase. Proprietary programs were used to assure target probe specificity.

Probes were stored at 4 °C and used according to the manufacturer's protocol.

Chromogenic in situ mRNA hybridization was performed using RNAscope 2.5 HD

Assay - Red reagents (Advanced Cell Diagnostics, Hayward, CA) on 5 μm thick sections of the

adult worms and mounted according to the manufacturer's protocol. Fast Red was used as

substrate for alkaline phosphatase in the chromogenic reaction.

Page 144: P-glycoprotein drug transporters in the parasitic

133

2.3. Analysis

Photomicrographs were obtained on Olympus BX40 and BX60 microscopes with an

Olympus DP70 camera using CellSens software (Olympus, Waltham, MA). The intestine, body

wall, lateral cords with excretory canals, dorsal, and ventral nerve cords were examined. The

ovaries, uteri, and testes were examined when present. Signal was measured from n = 5 images

from each of 3 tissue sections obtained from each body region (anterior, middle, posterior).

Hybridization signal was resolved as punctate, stained spots located within parasite tissues.

Areas of positive signal were measured using the ISH 2.2/RNAscope module of HALO image

analysis software (Indica Labs, Advanced Cell Diagnostics, Hayward, CA). Ratio of probe

hybridization area to total tissue area was calculated and used for data analysis. Differences in

expression levels were compared among tissues as well as within individual tissues across

anterior, middle and posterior of the worms by one-way ANOVA with Tukey-Kramer HSD

(Honestly Significant Difference) post-hoc test on SAS JMP Pro 12.

3. Results

3.1. Multiple nucleic acid hybridization is sensitive and specific for Parascaris P-gp

To characterize the tissue-specific expression of Peq-pgp-11 and Peq-pgp-16, adult worm

tissues were analyzed with a multiple nucleic acid hybridization technique. Multiple nucleic acid

hybridization allows for specific signal amplification, with low background, resulting in

individual mRNA transcripts appearing as distinct spots in tissue sections. Probes binding

Bacillus subtilis DapB was used as the negative control for the assay. No positive signal

indicative of DapB mRNA was found in any of the organs examined (Figure 5-S1). Parascaris

β-tubulin was used as the positive control for the assay. Positive signal indicative of β-tubulin

mRNA was found to be highly expressed in all the organs examined (Figure 5-S1).

Page 145: P-glycoprotein drug transporters in the parasitic

134

3.2. Qualitative analysis of Peq-pgp-11 and Peq-pgp-16 mRNA expressed in Parascaris

Positive signal indicative of Peq-pgp-11 mRNA and Peq-pgp-16 mRNA visualized as

red-pink dots were found in a variety of parasite tissues. Histologic features and location of

mRNA hybridization are presented in Figure 5-1 (male) and Figure 5-2 (female) and described

below.

3.2.1. Body wall

The ascarid body wall is typically composed of three distinct layers - a cuticle,

hypodermis and a single layer of coelomyarian muscle cells (Watson, 1965). Red-pink dots

indicative of Peq-pgp-11 and Peq-pgp-16 mRNA were visualized in the hypodermis and in the

muscle cells, but not in the cuticle in sections of male and female worms.

3.2.2. Intestine

Intestines of ascarids consist of a single layer of epithelial cells with an apical microvilli/

bacillary layer and a layer of dense cytoplasm on the luminal side called a plasma cap. The basal

part has a basal lamella and an outer mesenteric membrane. Brown granular inclusions were

present in sections of the intestines, typical of the ascarid gut (Kessel et al., 1961). These features

are of note so as not to confuse them with nucleic acid hybridization signal. Peq-pgp-11 and

Peq-pgp-16 mRNA was visualized in moderate numbers throughout the cell including around the

nuclear envelope, but was absent at the microvilli, plasma cap, basal lamella and mesenteric

membrane in both male and female worms.

3.2.3. Lateral cords

Ascarids have a H-shaped excretory system that is embedded in the lateral lines and

extend from the nerve ring to about the middle of the body as a continuous canal with a lumen,

after which the canal appears to degenerate. The lateral line tissue also contributes to this

drainage through the many intercellular spaces that it contains (Dankwarth, 1971). Peq-pgp-11

Page 146: P-glycoprotein drug transporters in the parasitic

135

mRNA and Peq-pgp-16 mRNA were noted in the central excretory canal and in the tissue of the

lateral lines in both male and female worms in very low numbers.

3.2.4. Nerve cords

The dorsal and ventral nerve cords, which are the major components of the ascarid

nervous system, originate at the nerve ring and run along the length of the body (del Castillo et

al., 1989). Peq-pgp-11 mRNA and Peq-pgp-16 mRNA were visualized in the dorsal and ventral

nerve cords in very low numbers in male and female worms.

3.2.5. Male reproductive tissue

The male ascarid reproductive tissue consists of a single convoluted, tubular testis,

seminal vesicle and a terminal vas deferens (Foor, 1976). Peq-pgp-11 mRNA and Peq-pgp-16

mRNA were seen in all parts of the male reproductive tissue in low numbers.

3.2.6. Female reproductive tissue

The female reproductive tissue consists of convoluted tubular ovaries lined by a single

layer of simple cuboidal epithelium, that eventually become two tubular uteri proceeding

anteriorly, and which terminate in a single uterus with simple cuboidal to columnar epithelium

with the presence of some free intercellular space, depending on their location in the body

(Lýsek and Ondrus, 1992). Peq-pgp-11 mRNA and Peq-pgp-16 mRNA were visualized in low

numbers in the ovaries and uterus.

Our results demonstrate that Peq-pgp-11 and Peq-pgp-16 mRNA expression could be

qualitatively visualized using multiple nucleic acid hybridization in situ in the enterocytes of the

intestines, hypodermis and coelomyarian muscles of the body wall, epithelia of the ovaries and

uteri in the female, cells of the reproductive tract in the male, excretory canal, lateral line, and

nerve cords. These findings are generally in agreement with P-gp expression data assessed by

qPCR (Janssen et al., 2013a).

Page 147: P-glycoprotein drug transporters in the parasitic

136

3.3. Quantitative analysis of Peq-pgp-11 and Peq-pgp-16 mRNA expressed in Parascaris

In order to make comparisons of signal among tissues, positive signal was quantified as

dots per μm2 for each probe. Expression levels of Peq-pgp-11 mRNA and Peq-pgp-16 mRNA

relative to beta tubulin mRNA (positive control probe) were analyzed (Figure 5-3, Figure 5-4).

Expression levels were also analyzed in each organ in sections from the anterior, middle and

posterior of the worms (Figure 5-5 and Figure 5-6 ).

In male parasites, overall expression of Peq-pgp-11 was significantly higher in the

intestine and reproductive tissue (which were not significantly different from each other) than in

the body wall, nerve cords and lateral cords (Figure 5-3A). In contrast, expression of Peq-pgp-16

mRNA was not significantly different among the tissues studied (Figure 5-3B). However,

significant differences in the relative expression levels of Peq-pgp-11 and Peq-pgp-16 mRNA

were observed in body wall, intestine, nerve cord and reproductive tissue when comparing the

anterior, middle and posterior regions of the parasite. (Figure 5-5).

In female parasites, overall expression of Peq-pgp-11 was significantly higher in the

intestine when compared with the body wall, ovaries, uterus, lateral and nerve cords (Figure 5-

4A). Similarly, expression of Peq-pgp-16 was significantly higher in the intestine when

compared to all other tissues studied (Figure 5-4B). Significant differences of relative expression

of Peq-pgp-11 and Peq-pgp-16 were observed in the body wall, intestine, nerve cords and uterus

when comparing the anterior, middle and posterior regions of the parasite (Figure 5-6).

Thus, Peq-pgp-11 and Peq-pgp-16 mRNA expression could be quantitatively analyzed

using multiple nucleic acid hybridization in the tissues of male and female worms, and this was

in agreement with the previously published report for Peq-pgp-11 (Janssen et al., 2013).

Comparisons between expression levels in the same organs in different sections of the worms

were also possible with this technique.

Page 148: P-glycoprotein drug transporters in the parasitic

137

4. Discussion

P-glycoproteins have been associated with macrocyclic lactone resistance in nematode

parasites, including Parascaris. This is the first study to examine in situ P-glycoprotein mRNA

localization in an ascarid or equine nematode parasite. More broadly, our results suggest the

multiple nucleic acid hybridization technique can be used as a quantitative measure of mRNA

transcripts in parasitic nematodes.

Previously, localization studies have been conducted using antibody-based detection of

P-gp protein in tissues of Clade V nematodes. In transgenic C. elegans, Cel-Pgp-3 and Cel-Pgp-

1 proteins localized to the apical membranes of the excretory and intestinal cells and the anterior

pharynx (Broeks et al., 1995). In Haemonchus contortus, antibodies developed by immunization

with synthesized peptides detected Hco-Pgp-2 in the pharynx, lateral nerve cords, deirids and

mid-intestine (Godoy et al., 2015b). A monoclonal antibody targeting human P-gp bound to the

cuticle, eggs, and intestinal cells of H. contortus (Riou et al., 2005). Fewer studies have assessed

the localization of P-gp mRNA transcripts in situ. In H. contortus, in situ hybridization revealed

that mRNA of Pgp-A (Hco-Pgp-2) was present in the worm gut, anterior to the pharyngeal

intestinal junction, lateral cords, vas deferens and spicules, with no significant differences being

observed in males or females (Smith and Prichard, 2002).

In the present study, multiple nucleic acid hybridization revealed significant levels of

Peq-pgp-11 transcripts in the intestines of both sexes and in the reproductive tissue of the male

and significant levels of Peq-pgp-16 mRNA transcripts in the intestines of male and female

Parascaris. This technique has a significant advantage over worm dissection and qPCR, as

tubular organs such as the testes that take significant skill to isolate without contamination. In

addition, small organs such as nerve cords can be studied in the context of the surrounding

tissues.

Page 149: P-glycoprotein drug transporters in the parasitic

138

P-glycoproteins are thought to efflux MLs out of cells and prevent drug binding to

nematode glutamate-gated chloride channels. It is unclear if Pgp-mediated drug efflux acts at a

local level, near nematode nervous tissues expressing ion channels. Another possibility is that P-

gp eliminates anthelmintics at the level of the nematode body wall or intestine, which may

initially encounter the drug. Alternatively, P-gp efflux could trap anthelmintics in specific tissue

compartments thereby sequestering them away from target receptors. In order to develop a model

for understanding Pgp-mediated ML resistance, it is important to determine the location and

expression patterns of Pgps.

Detection of P-gp transcripts in some cell types suggests that P-gps could prevent entry of

ML into the body of the nematode. P-gp mRNA was visualized in the hypodermis and in the

coelomyarian musculature. Since transcuticular diffusion of anthelmintics has been demonstrated

in ascarids (Alvarez et al., 2001; Martin et al., 1992), anthelmintic efflux could be relevant at the

level of the body wall. High levels of P-gp were also observed within intestinal cells. In

mammals, the intestinal epithelium is the first line of defense and effluxes many foreign

substances. There is a possibility that ingested anthelmintics are effluxed at the level of the

intestine, thereby preventing their entry into the body of the nematode.

P-gp transcripts were also visualized, albeit in lower numbers, in the lateral cords through

which the excretory canal passes (Martin et al., 1992; Sanglas et al., 2009). It has been postulated

that since nematodes lack a liver or kidneys, drug and xenobiotic clearance occurs through the

excretory canal by P-glycoproteins on the surface of cell membranes (Broeks et al., 1995). In

Ascaris, vacuolated cells of the lateral cords absorb ML from the peri-enteric fluid (Martin et al.,

1992). Thus, the presence of P-gps in the lateral cords may enable drug efflux into the excretory

Page 150: P-glycoprotein drug transporters in the parasitic

139

canal causing a reduction in effective concentration of the drug at other active sites in the

parasite.

In mammals, nervous system P-gps exclude xenobiotics at the level of the blood brain

barrier (de Boer et al., 2003). In the present study, P-gp mRNA was visualized in low numbers in

the dorsal and ventral nerve cords. One binding site for MLs is in the outer monolayer of the

plasma membrane of muscle cells and nerve-cords (Martin et al., 1992), therefore, efflux of

anthelmintics could also be relevant at the level of the nerves bearing ligand-gated ion channels.

Thus, although the mammalian body components are different structurally, the function of Pgp-

mediated neuroprotection could be similar.

P-gp mRNA was visualized in the reproductive tissues of both the male and female

worms. Increased uterine expression of Peq-pgp-11 and Peq-pgp-16 has also been detected by

PCR for Parascaris (Janssen et al., 2013a). Uterine muscles are sites of action of for MLs and

the presence of P-gps in the uterus and uterine muscles has been proposed (Godoy et al., 2015a;

Prichard, 2001). However, the potential function of P-gps in the male reproductive organs such

as the testis, vas deferens, and seminal vesicles are largely unknown.

Overall, the multiple nucleic acid hybridization method is useful for detecting specific

transcripts within tissues of nematodes. The present study suggests that Peq-pgp-11 and Peq-

pgp-16 mRNAs are expressed in many tissues of Parascaris. Our results indicate that P-gps

could protect nematodes from anthelmintics locally, at the level of the neuron, but also at sites of

entry such as the hypodermis and intestine. The parasites studied in this report were not known

to be drug-resistant, so it appears these P-gps are expressed constitutively in a variety of tissues.

Therefore, ML-induced hyperexpression or post-translational changes in P-gps require additional

investigation. The multiple nucleic acid hybridization approach can be used in combination with

Page 151: P-glycoprotein drug transporters in the parasitic

140

protein-detection techniques to enable future studies comparing drug-resistant and -susceptible

nematodes.

Acknowledgement

This research was supported by start-up funds from the Iowa State University College of

Veterinary Medicine provided to MTB.

5. References

Abdelfatah, S.A., Efferth, T., 2015. Cytotoxicity of the indole alkaloid reserpine from Rauwolfia

serpentina against drug-resistant tumor cells. Phytomedicine 22, 308-318.

Abo-Shehada, M.N., Herbert, I.V., 1984. Anthelmintic effect of levamisole, ivermectin,

albendazole and fenbendazole on larval Toxocara canis infection in mice. Res Vet Sci 36,

87-91.

Albrecht, C., Viturro, E., 2007. The ABCA subfamily--gene and protein structures, functions and

associated hereditary diseases. Pflugers Arch 453, 581-589.

AlGusbi, S., Krücken, J., Ramünke, S., von Samson-Himmelstjerna, G., Demeler, J., 2014.

Analysis of putative inhibitors of anthelmintic resistance mechanisms in cattle

gastrointestinal nematodes. Int J Parasitol 44, 647-658.

Ali, M.Y., Siddiqui, S.S., 2000. cDNA cloning and expression of a C-terminus motor kinesin-

like protein KLP-17, involved in chromosomal movement in Caenorhabditis elegans.

Biochem Biophys Res Commun 267, 643-650.

Aller, S.G., Yu, J., Ward, A., Weng, Y., Chittaboina, S., Zhuo, R., Harrell, P.M., Trinh, Y.T.,

Zhang, Q., Urbatsch, I.L., Chang, G., 2009. Structure of P-glycoprotein reveals a

molecular basis for poly-specific drug binding. Science 323, 1718-1722.

Alvarez, L., Lifschitz, A., Entrocasso, C., Manazza, J., Mottier, L., Borda, B., Virkel, G.,

Lanusse, C., 2008. Evaluation of the interaction between ivermectin and albendazole

following their combined use in lambs. J Vet Pharmacol Ther 31, 230-239.

Alvarez, L., Suarez, G., Ceballos, L., Moreno, L., Canton, C., Lifschitz, A., Maté, L., Ballent,

M., Virkel, G., Lanusse, C., 2015. Integrated assessment of ivermectin pharmacokinetics,

efficacy against resistant Haemonchus contortus and P-glycoprotein expression in lambs

treated at three different dosage levels. Vet Parasitol 210, 53-63.

Alvarez, L.I., Mottier, M.L., Sánchez, S.F., Lanusse, C.E., 2001. Ex vivo diffusion of

albendazole and its sulfoxide metabolite into ascaris suum and Fasciola hepatica.

Parasitol Res 87, 929-934.

Page 152: P-glycoprotein drug transporters in the parasitic

141

Alvarez-Sánchez, M.A., Pérez García, J., Bartley, D., Jackson, F., Rojo-Vázquez, F.A., 2005.

The larval feeding inhibition assay for the diagnosis of nematode anthelmintic resistance.

Exp Parasitol 110, 56-61.

Alvinerie, M., Dupuy, J., Kiki-Mvouaka, S., Sutra, J.F., Lespine, A., 2008. Ketoconazole

increases the plasma levels of ivermectin in sheep. Vet Parasitol 157, 117-122.

Ambudkar, S.V., Dey, S., Hrycyna, C.A., Ramachandra, M., Pastan, I., Gottesman, M.M., 1999.

Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu

Rev Pharmacol Toxicol 39, 361-398.

Aranda, P.S., LaJoie, D.M., Jorcyk, C.L., 2012. Bleach gel: a simple agarose gel for analyzing

RNA quality. Electrophoresis 33, 366-369.

Ardelli, B.F., Stitt, L.E., Tompkins, J.B., 2010. Inventory and analysis of ATP-binding cassette

(ABC) systems in Brugia malayi. Parasitology 137, 1195-1212.

Areskog, M., Engström, A., Tallkvist, J., von Samson-Himmelstjerna, G., Höglund, J., 2013.

PGP expression in Cooperia oncophora before and after ivermectin selection. Parasitol

Res 112, 3005-3012.

Ballent, M., Lifschitz, A., Virkel, G., Sallovitz, J., Lanusse, C., 2007. Involvement of P-

glycoprotein on ivermectin kinetic behaviour in sheep: itraconazole-mediated changes on

gastrointestinal disposition. J Vet Pharmacol Ther 30, 242-248.

Barclay, J.W., Morgan, A., Burgoyne, R.D., 2012. Neurotransmitter release mechanisms studied

in Caenorhabditis elegans. Cell Calcium 52, 289-295.

Bartley, D.J., McAllister, H., Bartley, Y., Dupuy, J., Ménez, C., Alvinerie, M., Jackson, F.,

Lespine, A., 2009. P-glycoprotein interfering agents potentiate ivermectin susceptibility

in ivermectin sensitive and resistant isolates of Teladorsagia circumcincta and

Haemonchus contortus. Parasitology 136, 1081-1088.

Bartley, D.J., Morrison, A.A., Dupuy, J., Bartley, Y., Sutra, J.F., Menez, C., Alvinerie, M.,

Jackson, F., Devin, L., Lespine, A., 2012. Influence of Pluronic 85 and ketoconazole on

disposition and efficacy of ivermectin in sheep infected with a multiple resistant

Haemonchus contortus isolate. Vet Parasitol 187, 464-472.

Bazzocchi, C., Mortarino, M., Grandi, G., Kramer, L.H., Genchi, C., Bandi, C., Genchi, M.,

Sacchi, L., McCall, J.W., 2008. Combined ivermectin and doxycycline treatment has

microfilaricidal and adulticidal activity against Dirofilaria immitis in experimentally

infected dogs. Int J Parasitol 38, 1401-1410.

Beasley, A., Coleman, G., Kotze, A.C., 2015. Suspected ivermectin resistance in a south-east

Queensland Parascaris equorum population. Aust Vet J 93, 305-307.

Beech, R.N., Skuce, P., Bartley, D.J., Martin, R.J., Prichard, R.K., Gilleard, J.S., 2011.

Anthelmintic resistance: markers for resistance, or susceptibility? Parasitology 138, 160-

174.

Beech, R.N., Wolstenholme, A.J., Neveu, C., Dent, J.A., 2010. Nematode parasite genes: what's

in a name? Trends Parasitol 26, 334-340.

Page 153: P-glycoprotein drug transporters in the parasitic

142

Beugnet, F., Gauthey, M., Kerboeuf, D., 1997. Partial in vitro reversal of benzimidazole

resistance by the free-living stages of Haemonchus contortus with verapamil. Vet Rec

141, 575-576.

Bishop, R.M., Scott, I., Gee, E.K., Rogers, C.W., Pomroy, W.E., Mayhew, I.G., 2014. Sub-

optimal efficacy of ivermectin against Parascaris equorum in foals on three

Thoroughbred stud farms in the Manawatu region of New Zealand. N Z Vet J 62, 91-95.

Blackhall, W.J., Liu, H.Y., Xu, M., Prichard, R.K., Beech, R.N., 1998a. Selection at a P-

glycoprotein gene in ivermectin- and moxidectin-selected strains of Haemonchus

contortus. Mol Biochem Parasitol 95, 193-201.

Blackhall, W.J., Pouliot, J.F., Prichard, R.K., Beech, R.N., 1998b. Haemonchus contortus:

selection at a glutamate-gated chloride channel gene in ivermectin- and moxidectin-

selected strains. Exp Parasitol 90, 42-48.

Blackhall, W.J., Prichard, R.K., Beech, R.N., 2008. P-glycoprotein selection in strains of

Haemonchus contortus resistant to benzimidazoles. Vet Parasitol 152, 101-107.

Blanchard, A., Guégnard, F., Charvet, C.L., Crisford, A., Courtot, E., Sauvé, C., Harmache, A.,

Duguet, T., O'Connor, V., Castagnone-Sereno, P., Reaves, B., Wolstenholme, A.J.,

Beech, R.N., Holden-Dye, L., Neveu, C., 2018. Deciphering the molecular determinants

of cholinergic anthelmintic sensitivity in nematodes: When novel functional validation

approaches highlight major differences between the model Caenorhabditis elegans and

parasitic species. PLoS Pathog 14, e1006996.

Blaxter, M., Liu, L., 1996. Nematode spliced leaders--ubiquity, evolution and utility. Int J

Parasitol 26, 1025-1033.

Blaxter, M.L., De Ley, P., Garey, J.R., Liu, L.X., Scheldeman, P., Vierstraete, A., Vanfleteren,

J.R., Mackey, L.Y., Dorris, M., Frisse, L.M., Vida, J.T., Thomas, W.K., 1998. A

molecular evolutionary framework for the phylum Nematoda. Nature 392, 71-75.

Boersema, J.H., Eysker, M., Nas, J.W., 2002. Apparent resistance of Parascaris equorum to

macrocylic lactones. Vet Rec 150, 279-281.

Bourguinat, C., Che, H., Mani, T., Keller, K., Prichard, R.K., 2016. ABC-B transporter genes in

Dirofilaria immitis. Int J Parasitol Drugs Drug Resist 6, 116-124.

Bourguinat, C., Keller, K., Bhan, A., Peregrine, A., Geary, T., Prichard, R., 2011a. Macrocyclic

lactone resistance in Dirofilaria immitis. Vet Parasitol 181, 388-392.

Bourguinat, C., Keller, K., Blagburn, B., Schenker, R., Geary, T.G., Prichard, R.K., 2011b.

Correlation between loss of efficacy of macrocyclic lactone heartworm anthelmintics and

P-glycoprotein genotype. Vet Parasitol 176, 374-381.

Briz, O., Perez-Silva, L., Al-Abdulla, R., Abete, L., Reviejo, M., Romero, M.R., Marin, J.J.G.,

2019. What "The Cancer Genome Atlas" database tells us about the role of ATP-binding

cassette (ABC) proteins in chemoresistance to anticancer drugs. Expert Opin Drug Metab

Toxicol 15, 577-593.

Page 154: P-glycoprotein drug transporters in the parasitic

143

Broeks, A., Gerrard, B., Allikmets, R., Dean, M., Plasterk, R.H., 1996. Homologues of the

human multidrug resistance genes MRP and MDR contribute to heavy metal resistance in

the soil nematode Caenorhabditis elegans. EMBO J 15, 6132-6143.

Broeks, A., Janssen, H.W., Calafat, J., Plasterk, R.H., 1995. A P-glycoprotein protects

Caenorhabditis elegans against natural toxins. EMBO J 14, 1858-1866.

Burke, T.M., Roberson, E.L., 1983. Fenbendazole treatment of pregnant bitches to reduce

prenatal and lactogenic infections of Toxocara canis and Ancylostoma caninum in pups. J

Am Vet Med Assoc 183, 987-990.

Bygarski, E.E., Prichard, R.K., Ardelli, B.F., 2014. Resistance to the macrocyclic lactone

moxidectin is mediated in part by membrane transporter P-glycoproteins: Implications for

control of drug resistant parasitic nematodes. Int J Parasitol Drugs Drug Resist 4, 143-

151.

Bártíková, H., Vokřál, I., Kubíček, V., Szotáková, B., Prchal, L., Lamka, J., Várady, M.,

Skálová, L., 2012. Import and efflux of flubendazole in Haemonchus contortus strains

susceptible and resistant to anthelmintics. Vet Parasitol 187, 473-479.

Carrillo, M., Barriga, O.O., 1987. Anthelmintic effect of levamisole hydrochloride or ivermectin

on tissue toxocariasis of mice. Am J Vet Res 48, 281-283.

Chan, L.Y., Yim, E.K., Choo, A.B., 2013. Normalized median fluorescence: an alternative flow

cytometry analysis method for tracking human embryonic stem cell states during

differentiation. Tissue Eng Part C Methods 19, 156-165.

Churcher, T.S., Pion, S.D., Osei-Atweneboana, M.Y., Prichard, R.K., Awadzi, K., Boussinesq,

M., Collins, R.C., Whitworth, J.A., Basáñez, M.G., 2009. Identifying sub-optimal

responses to ivermectin in the treatment of River Blindness. Proc Natl Acad Sci U S A

106, 16716-16721.

Conrad, S., Viertelhaus, A., Orzechowski, A., Hoogstraate, J., Gjellan, K., Schrenk, D.,

Kauffmann, H.M., 2001. Sequencing and tissue distribution of the canine MRP2 gene

compared with MRP1 and MDR1. Toxicology 156, 81-91.

Consortium, I.H.G., 2019. Comparative genomics of the major parasitic worms. Nat Genet 51,

163-174.

Corpet, F., 1988. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res

16, 10881-10890.

Craig, T.M., Diamond, P.L., Ferwerda, N.S., Thompson, J.A., 2007. Evidence of ivermectin

resistance by Parascaris equorum on a Texas horse farm. Journal of Equine Veterinary

Science 27, 67-71.

Cromie, L., Ferry, M., Couper, A., Fields, C., Taylor, S.M., 2006. Pharmacokinetics of a novel

closantel/ivermectin injection in cattle. J Vet Pharmacol Ther 29, 205-211.

Dankwarth, L., 1971. [Ultrastructure and function of the excretory organ of Ascaris lumbricoides

L. (Nematoda)]. Z Zellforsch Mikrosk Anat 113, 581-608.

Page 155: P-glycoprotein drug transporters in the parasitic

144

Dassa, E., 2011. Natural history of ABC systems: not only transporters. Essays Biochem 50, 19-

42.

Dassa, E., Bouige, P., 2001. The ABC of ABCS: a phylogenetic and functional classification of

ABC systems in living organisms. Res Microbiol 152, 211-229.

David, M., Lebrun, C., Duguet, T., Talmont, F., Beech, R., Orlowski, S., André, F., Prichard,

R.K., Lespine, A., 2018. Structural model, functional modulation by ivermectin and

tissue localization of Haemonchus contortus P-glycoprotein-13. Int J Parasitol Drugs

Drug Resist 8, 145-157.

Davidson, A.L., Chen, J., 2004. ATP-binding cassette transporters in bacteria. Annu Rev

Biochem 73, 241-268.

Davidson, A.L., Dassa, E., Orelle, C., Chen, J., 2008. Structure, function, and evolution of

bacterial ATP-binding cassette systems. Microbiol Mol Biol Rev 72, 317-364, table of

contents.

de Boer, A.G., van der Sandt, I.C., Gaillard, P.J., 2003. The role of drug transporters at the

blood-brain barrier. Annu Rev Pharmacol Toxicol 43, 629-656.

de Castro, E., Sigrist, C.J., Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S., Gasteiger, E.,

Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITE signature matches and

ProRule-associated functional and structural residues in proteins. Nucleic Acids Res 34,

W362-365.

De Graef, J., Demeler, J., Skuce, P., Mitreva, M., Von Samson-Himmelstjerna, G., Vercruysse,

J., Claerebout, E., Geldhof, P., 2013. Gene expression analysis of ABC transporters in a

resistant Cooperia oncophora isolate following in vivo and in vitro exposure to

macrocyclic lactones. Parasitology 140, 499-508.

del Castillo, J., Rivera, A., Solórzano, S., Serrato, J., 1989. Some aspects of the neuromuscular

system of Ascaris. Quarterly Journal of Experimental Physiology 74, 1071-1087.

Demeler, J., Kleinschmidt, N., Küttler, U., Koopmann, R., von Samson-Himmelstjerna, G.,

2012. Evaluation of the Egg Hatch Assay and the Larval Migration Inhibition Assay to

detect anthelmintic resistance in cattle parasitic nematodes on farms. Parasitol Int 61,

614-618.

Demeler, J., Krücken, J., AlGusbi, S., Ramünke, S., De Graef, J., Kerboeuf, D., Geldhof, P.,

Pomroy, W.E., von Samson-Himmelstjerna, G., 2013. Potential contribution of P-

glycoproteins to macrocyclic lactone resistance in the cattle parasitic nematode Cooperia

oncophora. Mol Biochem Parasitol 188, 10-19.

Demeler, J., Küttler, U., von Samson-Himmelstjerna, G., 2010. Adaptation and evaluation of

three different in vitro tests for the detection of resistance to anthelmintics in gastro

intestinal nematodes of cattle. Vet Parasitol 170, 61-70.

Dicker, A.J., Nath, M., Yaga, R., Nisbet, A.J., Lainson, F.A., Gilleard, J.S., Skuce, P.J., 2011a.

Teladorsagia circumcincta: the transcriptomic response of a multi-drug-resistant isolate to

ivermectin exposure in vitro. Exp Parasitol 127, 351-356.

Page 156: P-glycoprotein drug transporters in the parasitic

145

Dicker, A.J., Nisbet, A.J., Skuce, P.J., 2011b. Gene expression changes in a P-glycoprotein (Tci-

pgp-9) putatively associated with ivermectin resistance in Teladorsagia circumcincta. Int

J Parasitol 41, 935-942.

Doligalska, M., Jóźwicka, K., Kiersnowska, M., Mroczek, A., Pączkowski, C., Janiszowska, W.,

2011. Triterpenoid saponins affect the function of P-glycoprotein and reduce the survival

of the free-living stages of Heligmosomoides bakeri. Vet Parasitol 179, 144-151.

Dolinská, M., Königová, A., Letková, V., Molnár, L., Várady, M., 2013. Detection of ivermectin

resistance by a larval development test--back to the past or a step forward? Vet Parasitol

198, 154-158.

Dong, M., Ladavière, L., Penin, F., Deléage, G., Baggetto, L.G., 1998. Secondary structure of P-

glycoprotein investigated by circular dichroism and amino acid sequence analysis.

Biochim Biophys Acta 1371, 317-334.

Dowling, P., 2006. Pharmacogenetics: it's not just about ivermectin in collies. Can Vet J 47,

1165-1168.

Doyle, S.R., Cotton, J.A., 2019. Genome-wide Approaches to Investigate Anthelmintic

Resistance. Trends Parasitol 35, 289-301.

Drogemuller, M., Schnieder, T., von Samson-Himmelstjerna, G., 2004. Evidence of p-

glycoprotein sequence diversity in cyathostomins. J Parasitol 90, 998-1003.

Dupuy, J., Alvinerie, M., Ménez, C., Lespine, A., 2010. Interaction of anthelmintic drugs with P-

glycoprotein in recombinant LLC-PK1-mdr1a cells. Chem Biol Interact 186, 280-286.

Dupuy, J., Larrieu, G., Sutra, J.F., Lespine, A., Alvinerie, M., 2003. Enhancement of moxidectin

bioavailability in lamb by a natural flavonoid: quercetin. Vet Parasitol 112, 337-347.

Durant, J.F., Irenge, L.M., Fogt-Wyrwas, R., Dumont, C., Doucet, J.P., Mignon, B., Losson, B.,

Gala, J.L., 2012. Duplex quantitative real-time PCR assay for the detection and

discrimination of the eggs of Toxocara canis and Toxocara cati (Nematoda,

Ascaridoidea) in soil and fecal samples. Parasit Vectors 5, 288.

Eckford, P.D., Sharom, F.J., 2005. The reconstituted P-glycoprotein multidrug transporter is a

flippase for glucosylceramide and other simple glycosphingolipids. Biochem J 389, 517-

526.

Evans, G.L., Ni, B., Hrycyna, C.A., Chen, D., Ambudkar, S.V., Pastan, I., Germann, U.A.,

Gottesman, M.M., 1995. Heterologous expression systems for P-glycoprotein: E. coli,

yeast, and baculovirus. J Bioenerg Biomembr 27, 43-52.

Fiel, C.A., Saumell, C.A., Steffan, P.E., Rodriguez, E.M., 2001. Resistance of Cooperia to

ivermectin treatments in grazing cattle of the Humid Pampa, Argentina. Vet Parasitol 97,

211-217.

Figueiredo, L.A., Rebouças, T.F., Ferreira, S.R., Rodrigues-Luiz, G.F., Miranda, R.C., Araujo,

R.N., Fujiwara, R.T., 2018. Dominance of P-glycoprotein 12 in phenotypic resistance

conversion against ivermectin in Caenorhabditis elegans. PLoS One 13, e0192995.

Page 157: P-glycoprotein drug transporters in the parasitic

146

Fok, E., Kassai, T., 1998. Toxocara canis infection in the paratenic host: a study on the

chemosusceptibility of the somatic larvae in mice. Vet Parasitol 74, 243-259.

Foor, W.E., 1976. Structure and function of the glandular vas deferens in Ascaris suum

(Nematoda). J Parasitol 62, 849-864.

Garavelli, J.S., 2004. The RESID Database of Protein Modifications as a resource and annotation

tool. Proteomics 4, 1527-1533.

Gasbarre, L.C., Smith, L.L., Lichtenfels, J.R., Pilitt, P.A., 2009. The identification of cattle

nematode parasites resistant to multiple classes of anthelmintics in a commercial cattle

population in the US. Vet Parasitol 166, 281-285.

Geary, T.G., Moreno, Y., 2012. Macrocyclic lactone anthelmintics: spectrum of activity and

mechanism of action. Curr Pharm Biotechnol 13, 866-872.

Geary, T.G., Sims, S.M., Thomas, E.M., Vanover, L., Davis, J.P., Winterrowd, C.A., Klein,

R.D., Ho, N.F., Thompson, D.P., 1993. Haemonchus contortus: ivermectin-induced

paralysis of the pharynx. Exp Parasitol 77, 88-96.

Geary, T.G., Thompson, D.P., 2001. Caenorhabditis elegans: how good a model for veterinary

parasites? Vet Parasitol 101, 371-386.

Gems, D., Ferguson, C.J., Robertson, B.D., Nieves, R., Page, A.P., Blaxter, M.L., Maizels, R.M.,

1995. An abundant, trans-spliced mRNA from Toxocara canis infective larvae encodes a

26-kDa protein with homology to phosphatidylethanolamine-binding proteins. J Biol

Chem 270, 18517-18522.

Gill, J.H., Kerr, C.A., Shoop, W.L., Lacey, E., 1998. Evidence of multiple mechanisms of

avermectin resistance in haemonchus contortus--comparison of selection protocols. Int J

Parasitol 28, 783-789.

Gill, J.H., Redwin, J.M., van Wyk, J.A., Lacey, E., 1991. Detection of resistance to ivermectin in

Haemonchus contortus. Int J Parasitol 21, 771-776.

Gill, J.H., Redwin, J.M., van Wyk, J.A., Lacey, E., 1995. Avermectin inhibition of larval

development in Haemonchus contortus--effects of ivermectin resistance. Int J Parasitol

25, 463-470.

Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2015a. Characterization of Haemonchus

contortus P-glycoprotein-16 and its interaction with the macrocyclic lactone

anthelmintics. Mol Biochem Parasitol 204, 11-15.

Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2016. Characterisation of P-glycoprotein-9.1 in

Haemonchus contortus. Parasit Vectors 9, 52.

Godoy, P., Lian, J., Beech, R.N., Prichard, R.K., 2015b. Haemonchus contortus P-glycoprotein-

2: in situ localisation and characterisation of macrocyclic lactone transport. Int J Parasitol

45, 85-93.

Page 158: P-glycoprotein drug transporters in the parasitic

147

Goh, L.B., Spears, K.J., Yao, D., Ayrton, A., Morgan, P., Roland Wolf, C., Friedberg, T., 2002.

Endogenous drug transporters in in vitro and in vivo models for the prediction of drug

disposition in man. Biochem Pharmacol 64, 1569-1578.

Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New

algorithms and methods to estimate maximum-likelihood phylogenies: assessing the

performance of PhyML 3.0. Syst Biol 59, 307-321.

Guo, T., Huang, J., Zhang, H., Dong, L., Guo, D., Guo, L., He, F., Bhutto, Z.A., Wang, L., 2016.

Abcb1 in Pigs: Molecular cloning, tissues distribution, functional analysis, and its effect

on pharmacokinetics of enrofloxacin. Sci Rep 6, 32244.

Haslam, I.S., Simmons, N.L., 2014. Expression of the ABC transport proteins MDR1 (ABCB1)

and BCRP (ABCG2) in bovine rumen. J Comp Physiol B 184, 673-681.

Heckler, R.P., Almeida, G.D., Santos, L.B., Borges, D.G., Neves, J.P., Onizuka, M.K., Borges,

F.A., 2014. P-gp modulating drugs greatly potentiate the in vitro effect of ivermectin

against resistant larvae of Haemonchus placei. Vet Parasitol 205, 638-645.

Hibbs, R.E., Gouaux, E., 2011. Principles of activation and permeation in an anion-selective

Cys-loop receptor. Nature 474, 54-60.

Hirose, T., Horvitz, H.R., 2014. The translational regulators GCN-1 and ABCF-3 act together to

promote apoptosis in C. elegans. PLoS Genet 10, e1004512.

Howard, J.T., O'Nan, A.T., Maltecca, C., Baynes, R.E., Ashwell, M.S., 2015. Differential Gene

Expression across Breed and Sex in Commercial Pigs Administered Fenbendazole and

Flunixin Meglumine. PLoS One 10, e0137830.

Ince, T.A., Scotto, K.W., 1995. Differential utilization of multiple transcription start points

accompanies the overexpression of the P-glycoprotein-encoding gene in Chinese hamster

lung cells. Gene 156, 287-290.

Issouf, M., Guégnard, F., Koch, C., Le Vern, Y., Blanchard-Letort, A., Che, H., Beech, R.N.,

Kerboeuf, D., Neveu, C., 2014. Haemonchus contortus P-glycoproteins interact with host

eosinophil granules: a novel insight into the role of ABC transporters in host-parasite

interaction. PLoS One 9, e87802.

Jagodinsky, J.C., Akgun, U., 2015. Characterizing the binding interactions between P-

glycoprotein and eight known cardiovascular transport substrates. Pharmacol Res

Perspect 3, e00114.

James, C.E., Davey, M.W., 2009. Increased expression of ABC transport proteins is associated

with ivermectin resistance in the model nematode Caenorhabditis elegans. Int J Parasitol

39, 213-220.

Janssen, I.J., Krücken, J., Demeler, J., Basiaga, M., Kornaś, S., von Samson-Himmelstjerna, G.,

2013a. Genetic variants and increased expression of Parascaris equorum P-glycoprotein-

11 in populations with decreased ivermectin susceptibility. PLoS One 8, e61635.

Page 159: P-glycoprotein drug transporters in the parasitic

148

Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2013b. Caenorhabditis

elegans: modest increase of susceptibility to ivermectin in individual P-glycoprotein loss-

of-function strains. Exp Parasitol 134, 171-177.

Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2015. Transgenically

expressed Parascaris P-glycoprotein-11 can modulate ivermectin susceptibility in

Caenorhabditis elegans. Int J Parasitol Drugs Drug Resist 5, 44-47.

Jesudoss Chelladurai, J., Brewer, M.T., 2019. Detection and quantification of Parascaris P-

glycoprotein drug transporter expression with a novel mRNA hybridization technique.

Vet Parasitol 267, 75-83.

Jex, A.R., Liu, S., Li, B., Young, N.D., Hall, R.S., Li, Y., Yang, L., Zeng, N., Xu, X., Xiong, Z.,

Chen, F., Wu, X., Zhang, G., Fang, X., Kang, Y., Anderson, G.A., Harris, T.W.,

Campbell, B.E., Vlaminck, J., Wang, T., Cantacessi, C., Schwarz, E.M., Ranganathan, S.,

Geldhof, P., Nejsum, P., Sternberg, P.W., Yang, H., Wang, J., Gasser, R.B., 2011.

Ascaris suum draft genome. Nature 479, 529-533.

Jin, M.S., Oldham, M.L., Zhang, Q., Chen, J., 2012. Crystal structure of the multidrug

transporter P-glycoprotein from Caenorhabditis elegans. Nature 490, 566-569.

Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., Madden, T.L., 2008.

NCBI BLAST: a better web interface. Nucleic Acids Res 36, W5-9.

Juliano, R.L., Ling, V., 1976. A surface glycoprotein modulating drug permeability in Chinese

hamster ovary cell mutants. Biochim Biophys Acta 455, 152-162.

Kabsch, W., Sander, C., 1983. Dictionary of protein secondary structure: pattern recognition of

hydrogen-bonded and geometrical features. Biopolymers 22, 2577-2637.

Karlgren, M., Simoff, I., Backlund, M., Wegler, C., Keiser, M., Handin, N., Müller, J.,

Lundquist, P., Jareborg, A.C., Oswald, S., Artursson, P., 2017. A CRISPR-Cas9

Generated MDCK Cell Line Expressing Human MDR1 Without Endogenous Canine

MDR1 (cABCB1): An Improved Tool for Drug Efflux Studies. J Pharm Sci 106, 2909-

2913.

Kaschny, M., Demeler, J., Janssen, I.J., Kuzmina, T.A., Besognet, B., Kanellos, T., Kerboeuf,

D., von Samson-Himmelstjerna, G., Krücken, J., 2015. Macrocyclic lactones differ in

interaction with recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus

elongatus and ketoconazole in a yeast growth assay. PLoS Pathog 11, e1004781.

Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7:

improvements in performance and usability. Mol Biol Evol 30, 772-780.

Kellerová, P., Matoušková, P., Lamka, J., Vokřál, I., Szotáková, B., Zajíčková, M., Pasák, M.,

Skálová, L., 2019. Ivermectin-induced changes in the expression of cytochromes P450

and efflux transporters in Haemonchus contortus female and male adults. Vet Parasitol

273, 24-31.

Kenealy, J.S., 2019. Anthelmintic resistance in equine parasites: mechanisms and treatment

approaches. University of Kentucky, Lexington, KY.

Page 160: P-glycoprotein drug transporters in the parasitic

149

Kerboeuf, D., Aycardi, J., Soubieux, D., 1996. Flow-cytometry analysis of sheep-nematode egg

populations. Parasitol Res 82, 358-363.

Kerboeuf, D., Chambrier, P., Le Vern, Y., Aycardi, J., 1999. Flow cytometry analysis of drug

transport mechanisms in Haemonchus contortus susceptible or resistant to anthelmintics.

Parasitol Res 85, 118-123.

Kerboeuf, D., Guégnard, F., 2011. Anthelmintics are substrates and activators of nematode P

glycoprotein. Antimicrob Agents Chemother 55, 2224-2232.

Kerboeuf, D., Guégnard, F., Vern, Y.L., 2003. Detection of P-glycoprotein-mediated multidrug

resistance against anthelmintics in Haemonchus contortus using anti-human mdr1

monoclonal antibodies. Parasitol Res 91, 79-85.

Kessel, R.G., Prestage, J.J., Sekhon, S.S., Smalley, R.L., Beams, H.W.C.F.p.d.J., 1961.

Cytological Studies on the Intestinal Epithelial Cells of Ascaris lumbricoides suum.

Transactions of the American Microscopical Society 80, 103-118.

Kim, Y., Chen, J., 2018. Molecular structure of human P-glycoprotein in the ATP-bound,

outward-facing conformation. Science 359, 915-919.

Kimchi-Sarfaty, C., Oh, J.M., Kim, I.W., Sauna, Z.E., Calcagno, A.M., Ambudkar, S.V.,

Gottesman, M.M., 2007. A "silent" polymorphism in the MDR1 gene changes substrate

specificity. Science 315, 525-528.

Korolnek, T., Zhang, J., Beardsley, S., Scheffer, G.L., Hamza, I., 2014. Control of metazoan

heme homeostasis by a conserved multidrug resistance protein. Cell Metab 19, 1008-

1019.

Kotze, A.C., Clifford, S., O'Grady, J., Behnke, J.M., McCarthy, J.S., 2004. An in vitro larval

motility assay to determine anthelmintic sensitivity for human hookworm and

Strongyloides species. Am J Trop Med Hyg 71, 608-616.

Kotze, A.C., Ruffell, A.P., Knox, M.R., Kelly, G.A., 2014. Relative potency of macrocyclic

lactones in in vitro assays with larvae of susceptible and drug-resistant Australian isolates

of Haemonchus contortus and H. placei. Vet Parasitol 203, 294-302.

Krämer, F., Hammerstein, R., Stoye, M., Epe, C., 2006. Investigations into the prevention of

prenatal and lactogenic Toxocara canis infections in puppies by application of moxidectin

to the pregnant dog. J Vet Med B Infect Dis Vet Public Health 53, 218-223.

Krücken, J., Fraundorfer, K., Mugisha, J.C., Ramünke, S., Sifft, K.C., Geus, D., Habarugira, F.,

Ndoli, J., Sendegeya, A., Mukampunga, C., Bayingana, C., Aebischer, T., Demeler, J.,

Gahutu, J.B., Mockenhaupt, F.P., von Samson-Himmelstjerna, G., 2017. Reduced

efficacy of albendazole against Ascaris lumbricoides in Rwandan schoolchildren. Int J

Parasitol Drugs Drug Resist 7, 262-271.

Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: Molecular Evolutionary

Genetics Analysis across Computing Platforms. Mol Biol Evol 35, 1547-1549.

Page 161: P-glycoprotein drug transporters in the parasitic

150

Kuteykin-Teplyakov, K., Luna-Tortós, C., Ambroziak, K., Löscher, W., 2010. Differences in the

expression of endogenous efflux transporters in MDR1-transfected versus wildtype cell

lines affect P-glycoprotein mediated drug transport. Br J Pharmacol 160, 1453-1463.

Kwa, M.S., Okoli, M.N., Schulz-Key, H., Okongkwo, P.O., Roos, M.H., 1998. Use of P-

glycoprotein gene probes to investigate anthelmintic resistance in Haemonchus contortus

and comparison with Onchocerca volvulus. Int J Parasitol 28, 1235-1240.

Laing, R., Martinelli, A., Tracey, A., Holroyd, N., Gilleard, J.S., Cotton, J.A., 2016.

Haemonchus contortus: Genome Structure, Organization and Comparative Genomics.

Adv Parasitol 93, 569-598.

Le Jambre, L.F., Lenane, I.J., Wardrop, A.J., 1999. A hybridisation technique to identify

anthelmintic resistance genes in Haemonchus. Int J Parasitol 29, 1979-1985.

Le, S.Q., Gascuel, O., 2008. An improved general amino acid replacement matrix. Mol Biol Evol

25, 1307-1320.

Lebedeva, I.V., Pande, P., Patton, W.F., 2011. Sensitive and specific fluorescent probes for

functional analysis of the three major types of mammalian ABC transporters. PLoS One

6, e22429.

Lefort, V., Longueville, J.E., Gascuel, O., 2017. SMS: Smart Model Selection in PhyML. Mol

Biol Evol 34, 2422-2424.

Lespine, A., Dupuy, J., Orlowski, S., Nagy, T., Glavinas, H., Krajcsi, P., Alvinerie, M., 2006.

Interaction of ivermectin with multidrug resistance proteins (MRP1, 2 and 3). Chem Biol

Interact 159, 169-179.

Lespine, A., Martin, S., Dupuy, J., Roulet, A., Pineau, T., Orlowski, S., Alvinerie, M., 2007.

Interaction of macrocyclic lactones with P-glycoprotein: structure-affinity relationship.

Eur J Pharm Sci 30, 84-94.

Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other

multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for

reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist

2, 58-75.

Licht, T., Pastan, I., Gottesman, M., Herrmann, F., 1994. P-glycoprotein-mediated multidrug

resistance in normal and neoplastic hematopoietic cells. Ann Hematol 69, 159-171.

Lifschitz, A., Entrocasso, C., Alvarez, L., Lloberas, M., Ballent, M., Manazza, G., Virkel, G.,

Borda, B., Lanusse, C., 2010a. Interference with P-glycoprotein improves ivermectin

activity against adult resistant nematodes in sheep. Vet Parasitol 172, 291-298.

Lifschitz, A., Suarez, V.H., Sallovitz, J., Cristel, S.L., Imperiale, F., Ahoussou, S., Schiavi, C.,

Lanusse, C., 2010b. Cattle nematodes resistant to macrocyclic lactones: comparative

effects of P-glycoprotein modulation on the efficacy and disposition kinetics of

ivermectin and moxidectin. Exp Parasitol 125, 172-178.

Page 162: P-glycoprotein drug transporters in the parasitic

151

Lifschitz, A., Virkel, G., Ballent, M., Sallovitz, J., Lanusse, C., 2009. Combined use of

ivermectin and triclabendazole in sheep: in vitro and in vivo characterisation of their

pharmacological interaction. Vet J 182, 261-268.

Lifschitz, A., Virkel, G., Sallovitz, J., Imperiale, F., Pis, A., Lanusse, C., 2002. Loperamide-

induced enhancement of moxidectin availability in cattle. J Vet Pharmacol Ther 25, 111-

120.

Liminga, G., Nygren, P., Larsson, R., 1994. Microfluorometric evaluation of calcein

acetoxymethyl ester as a probe for P-glycoprotein-mediated resistance: effects of

cyclosporin A and its nonimmunosuppressive analogue SDZ PSC 833. Exp Cell Res 212,

291-296.

Lindblom, T.H., Dodd, A.K., 2006. Xenobiotic detoxification in the nematode Caenorhabditis

elegans. J Exp Zool A Comp Exp Biol 305, 720-730.

Lloberas, M., Alvarez, L., Entrocasso, C., Virkel, G., Ballent, M., Mate, L., Lanusse, C.,

Lifschitz, A., 2013. Comparative tissue pharmacokinetics and efficacy of moxidectin,

abamectin and ivermectin in lambs infected with resistant nematodes: Impact of drug

treatments on parasite P-glycoprotein expression. Int J Parasitol Drugs Drug Resist 3, 20-

27.

Lucchetti, C., Genchi, M., Venco, L., Menozzi, A., Serventi, P., Bertini, S., Bazzocchi, C.,

Kramer, L.H., Vismarra, A., 2019. Differential ABC transporter gene expression in adult

Dirofilaria immitis males and females following in vitro treatment with ivermectin,

doxycycline or a combination of both. Parasit Vectors 12, 401.

Luo, X., Shi, X., Yuan, C., Ai, M., Ge, C., Hu, M., Feng, X., Yang, X., 2017. Genome-wide SNP

analysis using 2b-RAD sequencing identifies the candidate genes putatively associated

with resistance to ivermectin in Haemonchus contortus. Parasit Vectors 10, 31.

Lynagh, T., Lynch, J.W., 2010. A glycine residue essential for high ivermectin sensitivity in

Cys-loop ion channel receptors. Int J Parasitol 40, 1477-1481.

Lynagh, T., Lynch, J.W., 2012. Ivermectin binding sites in human and invertebrate Cys-loop

receptors. Trends Pharmacol Sci 33, 432-441.

Lýsek, H., Ondrus, J., 1992. Morphology of the uterus of Ascaris lumbricoides in the region

where fertilization and formation of egg-shell occur. Folia Parasitol (Praha) 39, 41-50.

Mani, T., Bourguinat, C., Keller, K., Ashraf, S., Blagburn, B., Prichard, R.K., 2016. Interaction

of macrocyclic lactones with a Dirofilaria immitis P-glycoprotein. Int J Parasitol 46, 631-

640.

Martin, R.J., Kusel, J.R., Robertson, S.J., Minta, A., Haugland, R.P., 1992. Distribution of a

fluorescent ivermectin probe, bodipy ivermectin, in tissues of the nematode parasite

Ascaris suum. Parasitol Res 78, 341-348.

Maté, L., Ballent, M., Cantón, C., Ceballos, L., Lifschitz, A., Lanusse, C., Alvarez, L., Liron,

J.P., 2018. Assessment of P-glycoprotein gene expression in adult stage of Haemonchus

contortus in vivo exposed to ivermectin. Vet Parasitol 264, 1-7.

Page 163: P-glycoprotein drug transporters in the parasitic

152

McCall, J.W., 2005. The safety-net story about macrocyclic lactone heartworm preventives: a

review, an update, and recommendations. Vet Parasitol 133, 197-206.

McCall, J.W., Genchi, C., Kramer, L., Guerrero, J., Dzimianski, M.T., Supakorndej, P.,

Mansour, A.M., McCall, S.D., Supakorndej, N., Grandi, G., Carson, B., 2008.

Heartworm and Wolbachia: therapeutic implications. Vet Parasitol 158, 204-214.

McDonald, M.K., Fritz, J.A., Jia, D., Scheuchner, D., Snyder, F.F., Stanislaus, A., Curle, J., Li,

L., Stabler, S.P., Allen, R.H., Mains, P.E., Gravel, R.A., 2017. Identification of ABC

transporters acting in vitamin B. Mol Genet Metab 122, 160-171.

Mealey, K.L., 2013. Adverse drug reactions in veterinary patients associated with drug

transporters. Vet Clin North Am Small Anim Pract 43, 1067-1078.

Mealey, K.L., Bentjen, S.A., Gay, J.M., Cantor, G.H., 2001. Ivermectin sensitivity in collies is

associated with a deletion mutation of the mdr1 gene. Pharmacogenetics 11, 727-733.

Mealey, K.L., Burke, N.S., 2015. Identification of a nonsense mutation in feline ABCB1. J Vet

Pharmacol Ther 38, 429-433.

Mealey, K.L., Dassanayake, S., Burke, N.S., 2017. Establishment of a cell line for assessing

drugs as canine P-glycoprotein substrates: proof of principle. J Vet Pharmacol Ther 40,

545-551.

Mealey, K.L., Fidel, J., 2015. P-glycoprotein mediated drug interactions in animals and humans

with cancer. J Vet Intern Med 29, 1-6.

Meli, V.S., Osuna, B., Ruvkun, G., Frand, A.R., 2010. MLT-10 defines a family of DUF644 and

proline-rich repeat proteins involved in the molting cycle of Caenorhabditis elegans. Mol

Biol Cell 21, 1648-1661.

Merola, V.M., Eubig, P.A., 2012. Toxicology of avermectins and milbemycins (macrocylic

lactones) and the role of P-glycoprotein in dogs and cats. Vet Clin North Am Small Anim

Pract 42, 313-333, vii.

Mitchell, A.L., Attwood, T.K., Babbitt, P.C., Blum, M., Bork, P., Bridge, A., Brown, S.D.,

Chang, H.Y., El-Gebali, S., Fraser, M.I., Gough, J., Haft, D.R., Huang, H., Letunic, I.,

Lopez, R., Luciani, A., Madeira, F., Marchler-Bauer, A., Mi, H., Natale, D.A., Necci, M.,

Nuka, G., Orengo, C., Pandurangan, A.P., Paysan-Lafosse, T., Pesseat, S., Potter, S.C.,

Qureshi, M.A., Rawlings, N.D., Redaschi, N., Richardson, L.J., Rivoire, C., Salazar,

G.A., Sangrador-Vegas, A., Sigrist, C.J.A., Sillitoe, I., Sutton, G.G., Thanki, N., Thomas,

P.D., Tosatto, S.C.E., Yong, S.Y., Finn, R.D., 2019. InterPro in 2019: improving

coverage, classification and access to protein sequence annotations. Nucleic Acids Res

47, D351-D360.

Molento, M.B., Antunes, J., Bentes, R.N., Coles, G.C., 2008. Anthelmintic resistant nematodes

in Brazilian horses. Vet Rec 162, 384-385.

Molento, M.B., Lifschitz, A., Sallovitz, J., Lanusse, C., Prichard, R., 2004. Influence of

verapamil on the pharmacokinetics of the antiparasitic drugs ivermectin and moxidectin

in sheep. Parasitol Res 92, 121-127.

Page 164: P-glycoprotein drug transporters in the parasitic

153

Montecchi-Palazzi, L., Beavis, R., Binz, P.A., Chalkley, R.J., Cottrell, J., Creasy, D., Shofstahl,

J., Seymour, S.L., Garavelli, J.S., 2008. The PSI-MOD community standard for

representation of protein modification data. Nat Biotechnol 26, 864-866.

Moreno, Y., Nabhan, J.F., Solomon, J., Mackenzie, C.D., Geary, T.G., 2010. Ivermectin disrupts

the function of the excretory-secretory apparatus in microfilariae of Brugia malayi. Proc

Natl Acad Sci U S A 107, 20120-20125.

Morita, M., Imanaka, T., 2012. Peroxisomal ABC transporters: structure, function and role in

disease. Biochim Biophys Acta 1822, 1387-1396.

Ménez, C., Alberich, M., Courtot, E., Guegnard, F., Blanchard, A., Aguilaniu, H., Lespine, A.,

2019. The transcription factor NHR-8: A new target to increase ivermectin efficacy in

nematodes. PLoS Pathog 15, e1007598.

Ménez, C., Alberich, M., Kansoh, D., Blanchard, A., Lespine, A., 2016. Acquired Tolerance to

Ivermectin and Moxidectin after Drug Selection Pressure in the Nematode

Caenorhabditis elegans. Antimicrob Agents Chemother 60, 4809-4819.

Na, H., Ponomarova, O., Giese, G.E., Walhout, A.J.M., 2018. C. elegans MRP-5 Exports

Vitamin B12 from Mother to Offspring to Support Embryonic Development. Cell Rep

22, 3126-3133.

Nanayakkara, A.K., Follit, C.A., Chen, G., Williams, N.S., Vogel, P.D., Wise, J.G., 2018.

Targeted inhibitors of P-glycoprotein increase chemotherapeutic-induced mortality of

multidrug resistant tumor cells. Sci Rep 8, 967.

Nielsen, M.K., 2016. Evidence-based considerations for control of Parascaris spp. infections in

horses. Equine Veterinary Education 28, 224-231.

Nielsen, M.K., Reinemeyer, C.R., Donecker, J.M., Leathwick, D.M., Marchiondo, A.A., Kaplan,

R.M., 2014. Anthelmintic resistance in equine parasites—Current evidence and

knowledge gaps. Veterinary Parasitology 204, 55-63.

Njue, A.I., Hayashi, J., Kinne, L., Feng, X.P., Prichard, R.K., 2004. Mutations in the

extracellular domains of glutamate-gated chloride channel alpha3 and beta subunits from

ivermectin-resistant Cooperia oncophora affect agonist sensitivity. J Neurochem 89,

1137-1147.

Oshlack, A., Wakefield, M.J., 2009. Transcript length bias in RNA-seq data confounds systems

biology. Biol Direct 4, 14.

Palevich, N., Britton, C., Kamenetzky, L., Mitreva, M., de Moraes Mourão, M., Bennuru, S.,

Quack, T., Scholte, L.L.S., Tyagi, R., Slatko, B.E., (IMHAN), I.M.H.A.N., include, I.c.a.,

2018. Tackling Hypotheticals in Helminth Genomes. Trends Parasitol 34, 179-183.

Palmeira, A., Sousa, E., Vasconcelos, M.H., Pinto, M.M., 2012. Three decades of P-gp

inhibitors: skimming through several generations and scaffolds. Curr Med Chem 19,

1946-2025.

Payne, P.A., Ridley, R.K., 1999. Strategic use of ivermectin during pregnancy to control

toxocara canis in greyhound puppies. Vet Parasitol 85, 305-312.

Page 165: P-glycoprotein drug transporters in the parasitic

154

Peachey, L.E., Pinchbeck, G.L., Matthews, J.B., Burden, F.A., Lespine, A., von Samson-

Himmelstjerna, G., Krücken, J., Hodgkinson, J.E., 2017. P-glycoproteins play a role in

ivermectin resistance in cyathostomins. Int J Parasitol Drugs Drug Resist 7, 388-398.

Peregrine, A.S., Molento, M.B., Kaplan, R.M., Nielsen, M.K., 2014. Anthelmintic resistance in

important parasites of horses: does it really matter? Vet Parasitol 201, 1-8.

Pfaffl, M.W., 2004. A–Z of Quantitative PCR, 1 Edition. International University Line, La Jolla,

CA.

Pieper, U., Webb, B.M., Dong, G.Q., Schneidman-Duhovny, D., Fan, H., Kim, S.J., Khuri, N.,

Spill, Y.G., Weinkam, P., Hammel, M., Tainer, J.A., Nilges, M., Sali, A., 2014.

ModBase, a database of annotated comparative protein structure models and associated

resources. Nucleic Acids Res 42, D336-346.

Ponce-Macotela, M., Rodríguez-Caballero, A., Peralta-Abarca, G.E., Martínez-Gordillo, M.N.,

2011. A simplified method for hatching and isolating Toxocara canis larvae to facilitate

excretory-secretory antigen collection in vitro. Vet Parasitol 175, 382-385.

Prichard, R., 2001. Genetic variability following selection of Haemonchus contortus with

anthelmintics. Trends Parasitol 17, 445-453.

Prichard, R., Ménez, C., Lespine, A., 2012. Moxidectin and the avermectins: Consanguinity but

not identity. Int J Parasitol Drugs Drug Resist 2, 134-153.

Prichard, R.K., Roulet, A., 2007. ABC transporters and beta-tubulin in macrocyclic lactone

resistance: prospects for marker development. Parasitology 134, 1123-1132.

Ramakers, C., Ruijter, J.M., Deprez, R.H., Moorman, A.F., 2003. Assumption-free analysis of

quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62-66.

Raza, A., Bagnall, N.H., Jabbar, A., Kopp, S.R., Kotze, A.C., 2016a. Increased expression of

ATP binding cassette transporter genes following exposure of Haemonchus contortus

larvae to a high concentration of monepantel in vitro. Parasit Vectors 9, 522.

Raza, A., Kopp, S.R., Bagnall, N.H., Jabbar, A., Kotze, A.C., 2016b. Effects of in vitro exposure

to ivermectin and levamisole on the expression patterns of ABC transporters in

Haemonchus contortus larvae. Int J Parasitol Drugs Drug Resist 6, 103-115.

Raza, A., Kopp, S.R., Jabbar, A., Kotze, A.C., 2015. Effects of third generation P-glycoprotein

inhibitors on the sensitivity of drug-resistant and -susceptible isolates of Haemonchus

contortus to anthelmintics in vitro. Vet Parasitol 211, 80-88.

Raza, A., Kopp, S.R., Kotze, A.C., 2016c. Synergism between ivermectin and the tyrosine

kinase/P-glycoprotein inhibitor crizotinib against Haemonchus contortus larvae in vitro.

Vet Parasitol 227, 64-68.

Rice, P., Longden, I., Bleasby, A., 2000. EMBOSS: the European Molecular Biology Open

Software Suite. Trends Genet 16, 276-277.

Riga, M., Tsakireli, D., Ilias, A., Morou, E., Myridakis, A., Stephanou, E.G., Nauen, R.,

Dermauw, W., Van Leeuwen, T., Paine, M., Vontas, J., 2014. Abamectin is metabolized

Page 166: P-glycoprotein drug transporters in the parasitic

155

by CYP392A16, a cytochrome P450 associated with high levels of acaricide resistance in

Tetranychus urticae. Insect Biochem Mol Biol 46, 43-53.

Riou, M., Guégnard, F., Sizaret, P.Y., Le Vern, Y., Kerboeuf, D., 2010. Drug resistance is

affected by colocalization of P-glycoproteins in raft-like structures unexpected in

eggshells of the nematode Haemonchus contortus. Biochem Cell Biol 88, 459-467.

Riou, M., Koch, C., Delaleu, B., Berthon, P., Kerboeuf, D., 2005. Immunolocalisation of an

ABC transporter, P-glycoprotein, in the eggshells and cuticles of free-living and parasitic

stages of Haemonchus contortus. Parasitol Res 96, 142-148.

Roberts, A., Trapnell, C., Donaghey, J., Rinn, J.L., Pachter, L., 2011. Improving RNA-Seq

expression estimates by correcting for fragment bias. Genome Biol 12, R22.

Romsicki, Y., Sharom, F.J., 2001. Phospholipid flippase activity of the reconstituted P-

glycoprotein multidrug transporter. Biochemistry 40, 6937-6947.

Rothwell, J.T., Sangster, N.C., 1993. An in vitro assay utilising parasitic larval Haemonchus

contortus to detect resistance to closantel and other anthelmintics. Int J Parasitol 23, 573-

578.

Sanglas, L., Aviles, F.X., Huber, R., Gomis-Rüth, F.X., Arolas, J.L., 2009. Mammalian

metallopeptidase inhibition at the defense barrier of Ascaris parasite. Proc Natl Acad Sci

U S A 106, 1743-1747.

Sangster, N.C., 1994. P-glycoproteins in nematodes. Parasitol Today 10, 319-322.

Sangster, N.C., Bannan, S.C., Weiss, A.S., Nulf, S.C., Klein, R.D., Geary, T.G., 1999.

Haemonchus contortus: sequence heterogeneity of internucleotide binding domains from

P-glycoproteins. Exp Parasitol 91, 250-257.

Sarai, R.S., Kopp, S.R., Coleman, G.T., Kotze, A.C., 2013. Acetylcholine receptor subunit and

P-glycoprotein transcription patterns in levamisole-susceptible and -resistant

Haemonchus contortus. Int J Parasitol Drugs Drug Resist 3, 51-58.

Schnieder, T., Laabs, E.M., Welz, C., 2011. Larval development of Toxocara canis in dogs. Vet

Parasitol 175, 193-206.

Schwartz, M.S., Benci, J.L., Selote, D.S., Sharma, A.K., Chen, A.G., Dang, H., Fares, H.,

Vatamaniuk, O.K., 2010. Detoxification of multiple heavy metals by a half-molecule

ABC transporter, HMT-1, and coelomocytes of Caenorhabditis elegans. PLoS One 5,

e9564.

Scotto, K.W., Egan, D.A., 1998. Transcriptional regulation of MDR genes. Cytotechnology 27,

257-269.

Shah, S.Z.A., Khan, S., Compston, P., Upjohn, M., Jobling, R., 2016. Gastrointestinal parasite

infestation and the efficacy of Fenbendazole and Ivermectin in working equids in selected

areas of Pakistan. Journal of Equine Veterinary Science 39, Supplement, S103.

Shapiro, A.B., Corder, A.B., Ling, V., 1997. P-glycoprotein-mediated Hoechst 33342 transport

out of the lipid bilayer. Eur J Biochem 250, 115-121.

Page 167: P-glycoprotein drug transporters in the parasitic

156

Shapiro, A.B., Ling, V., 1997. Extraction of Hoechst 33342 from the cytoplasmic leaflet of the

plasma membrane by P-glycoprotein. Eur J Biochem 250, 122-129.

Sharom, F.J., 2014. Complex Interplay between the P-Glycoprotein Multidrug Efflux Pump and

the Membrane: Its Role in Modulating Protein Function. Front Oncol 4, 41.

Sheps, J.A., Ralph, S., Zhao, Z., Baillie, D.L., Ling, V., 2004. The ABC transporter gene family

of Caenorhabditis elegans has implications for the evolutionary dynamics of multidrug

resistance in eukaryotes. Genome Biol 5, R15.

Shtil, A.A., Azare, J., 2005. Redundancy of biological regulation as the basis of emergence of

multidrug resistance. Int Rev Cytol 246, 1-29.

Silva, R., Vilas-Boas, V., Carmo, H., Dinis-Oliveira, R.J., Carvalho, F., de Lourdes Bastos, M.,

Remião, F., 2015. Modulation of P-glycoprotein efflux pump: induction and activation as

a therapeutic strategy. Pharmacol Ther 149, 1-123.

Slocombe, J.O., de Gannes, R.V., Lake, M.C., 2007. Macrocyclic lactone-resistant Parascaris

equorum on stud farms in Canada and effectiveness of fenbendazole and pyrantel

pamoate. Vet Parasitol 145, 371-376.

Smith, J.M., Prichard, R.K., 2002. Localization of p-glycoprotein mRNA in the tissues of

Haemonchus contortus adult worms and its relative abundance in drug-selected and

susceptible strains. J Parasitol 88, 612-620.

Soulsby, E.J., 1983. Toxocariasis. Br Vet J 139, 471-475.

Srinivasan, D.G., Fisk, R.M., Xu, H., van den Heuvel, S., 2003. A complex of LIN-5 and GPR

proteins regulates G protein signaling and spindle function in C elegans. Genes Dev 17,

1225-1239.

Stergiou, L., Hengartner, M.O., 2004. Death and more: DNA damage response pathways in the

nematode C. elegans. Cell Death Differ 11, 21-28.

Stitt, L.E., Tompkins, J.B., Dooley, L.A., Ardelli, B.F., 2011. ABC transporters influence

sensitivity of Brugia malayi to moxidectin and have potential roles in drug resistance.

Exp Parasitol 129, 137-144.

Storey, B., Marcellino, C., Miller, M., Maclean, M., Mostafa, E., Howell, S., Sakanari, J.,

Wolstenholme, A., Kaplan, R., 2014. Utilization of computer processed high definition

video imaging for measuring motility of microscopic nematode stages on a quantitative

scale: "The Worminator". Int J Parasitol Drugs Drug Resist 4, 233-243.

Stouch, T.R., Gudmundsson, O., 2002. Progress in understanding the structure-activity

relationships of P-glycoprotein. Adv Drug Deliv Rev 54, 315-328.

Stringham, E., Pujol, N., Vandekerckhove, J., Bogaert, T., 2002. unc-53 controls longitudinal

migration in C. elegans. Development 129, 3367-3379.

Sutherland, I.A., Leathwick, D.M., 2011. Anthelmintic resistance in nematode parasites of cattle:

a global issue? Trends Parasitol 27, 176-181.

Page 168: P-glycoprotein drug transporters in the parasitic

157

Tandon, R., Kaplan, R.M., 2004. Evaluation of a larval development assay (DrenchRite) for the

detection of anthelmintic resistance in cyathostomin nematodes of horses. Vet Parasitol

121, 125-142.

Tang, F., Horie, K., Borchardt, R.T., 2002. Are MDCK cells transfected with the human MDR1

gene a good model of the human intestinal mucosa? Pharm Res 19, 765-772.

Tompkins, J.B., Stitt, L.E., Ardelli, B.F., 2010. Brugia malayi: in vitro effects of ivermectin and

moxidectin on adults and microfilariae. Exp Parasitol 124, 394-402.

Tompkins, J.B., Stitt, L.E., Morrissette, A.M., Ardelli, B.F., 2011. The role of Brugia malayi

ATP-binding cassette (ABC) transporters in potentiating drug sensitivity. Parasitol Res

109, 1311-1322.

Torrisi, M., Kaleel, M., Pollastri, G., 2019. Deeper Profiles and Cascaded Recurrent and

Convolutional Neural Networks for state-of-the-art Protein Secondary Structure

Prediction. Sci Rep 9, 12374.

Turnbull, F., Jonsson, N.N., Kenyon, F., Skuce, P.J., Bisset, S.A., 2018. P-glycoprotein-9 and

macrocyclic lactone resistance status in selected strains of the ovine gastrointestinal

nematode, Teladorsagia circumcincta. Int J Parasitol Drugs Drug Resist 8, 70-80.

Tydén, E., Skarin, M., Höglund, J., 2014. Gene expression of ABC transporters in Cooperia

oncophora after field and laboratory selection with macrocyclic lactones. Mol Biochem

Parasitol 198, 66-70.

Tydén, E., Tallkvist, J., Tjälve, H., Larsson, P., 2009. P-glycoprotein in intestines, liver, kidney

and lymphocytes in horse. J Vet Pharmacol Ther 32, 167-176.

Tyrrell, K.L., Dobson, R.J., Stein, P.A., Walkden-Brown, S.W., 2002. The effects of ivermectin

and moxidectin on egg viability and larval development of ivermectin-resistant

Haemonchus contortus. Vet Parasitol 107, 85-93.

Vahedi, S., Lusvarghi, S., Pluchino, K., Shafrir, Y., Durell, S.R., Gottesman, M.M., Ambudkar,

S.V., 2018. Mapping discontinuous epitopes for MRK-16, UIC2 and 4E3 antibodies to

extracellular loops 1 and 4 of human P-glycoprotein. Sci Rep 8, 12716.

Van Der Heyden, S., Chiers, K., Ducatelle, R., 2009. Tissue distribution of p-glycoprotein in

cats. Anat Histol Embryol 38, 455-460.

VanDuyn, N., Nass, R., 2014. The putative multidrug resistance protein MRP-7 inhibits

methylmercury-associated animal toxicity and dopaminergic neurodegeneration in

Caenorhabditis elegans. J Neurochem 128, 962-974.

Vatta, A.F., Dzimianski, M., Storey, B.E., Camus, M.S., Moorhead, A.R., Kaplan, R.M.,

Wolstenholme, A.J., 2014. Ivermectin-dependent attachment of neutrophils and

peripheral blood mononuclear cells to Dirofilaria immitis microfilariae in vitro. Vet

Parasitol 206, 38-42.

Virkel, G., Ballent, M., Lanusse, C., Lifschitz, A., 2019. Role of ABC Transporters in Veterinary

Medicine: Pharmaco- Toxicological Implications. Curr Med Chem 26, 1251-1269.

Page 169: P-glycoprotein drug transporters in the parasitic

158

Várady, M., Corba, J., Letková, V., Kovác, G., 2009. Comparison of two versions of larval

development test to detect anthelmintic resistance in Haemonchus contortus. Vet

Parasitol 160, 267-271.

Wang, F., Flanagan, J., Su, N., Wang, L.C., Bui, S., Nielson, A., Wu, X., Vo, H.T., Ma, X.J.,

Luo, Y., 2012a. RNAscope: a novel in situ RNA analysis platform for formalin-fixed,

paraffin-embedded tissues. J Mol Diagn 14, 22-29.

Wang, J., Gao, S., Mostovoy, Y., Kang, Y., Zagoskin, M., Sun, Y., Zhang, B., White, L.K.,

Easton, A., Nutman, T.B., Kwok, P.Y., Hu, S., Nielsen, M.K., Davis, R.E., 2017.

Comparative genome analysis of programmed DNA elimination in nematodes. Genome

Res 27, 2001-2014.

Wang, J., Mitreva, M., Berriman, M., Thorne, A., Magrini, V., Koutsovoulos, G., Kumar, S.,

Blaxter, M.L., Davis, R.E., 2012b. Silencing of germline-expressed genes by DNA

elimination in somatic cells. Dev Cell 23, 1072-1080.

Ward, A.B., Szewczyk, P., Grimard, V., Lee, C.W., Martinez, L., Doshi, R., Caya, A., Villaluz,

M., Pardon, E., Cregger, C., Swartz, D.J., Falson, P.G., Urbatsch, I.L., Govaerts, C.,

Steyaert, J., Chang, G., 2013. Structures of P-glycoprotein reveal its conformational

flexibility and an epitope on the nucleotide-binding domain. Proc Natl Acad Sci U S A

110, 13386-13391.

Watson, B.D., 1965. The fine structure of the body-wall and the growth of the cuticle in the adult

nematode Ascaris lumbricoides. Journal of Cell Science 3, 83-91.

Weidner, L.D., Fung, K.L., Kannan, P., Moen, J.K., Kumar, J.S., Mulder, J., Innis, R.B.,

Gottesman, M.M., Hall, M.D., 2016. Tariquidar Is an Inhibitor and Not a Substrate of

Human and Mouse P-glycoprotein. Drug Metab Dispos 44, 275-282.

Wen, P.C., Verhalen, B., Wilkens, S., Mchaourab, H.S., Tajkhorshid, E., 2013. On the origin of

large flexibility of P-glycoprotein in the inward-facing state. J Biol Chem 288, 19211-

19220.

Whittaker, J.H., Carlson, S.A., Jones, D.E., Brewer, M.T., 2017. Molecular mechanisms for

anthelmintic resistance in strongyle nematode parasites of veterinary importance. J Vet

Pharmacol Ther 40, 105-115.

Williamson, S.M., Storey, B., Howell, S., Harper, K.M., Kaplan, R.M., Wolstenholme, A.J.,

2011. Candidate anthelmintic resistance-associated gene expression and sequence

polymorphisms in a triple-resistant field isolate of Haemonchus contortus. Mol Biochem

Parasitol 180, 99-105.

Williamson, S.M., Wolstenholme, A.J., 2012. P-glycoproteins of Haemonchus contortus:

development of real-time PCR assays for gene expression studies. J Helminthol 86, 202-

208.

Wolstenholme, A.J., 2012. Glutamate-gated chloride channels. J Biol Chem 287, 40232-40238.

Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the mode of

action of the avermectin/milbemycin anthelmintics. Parasitology 131 Suppl, S85-95.

Page 170: P-glycoprotein drug transporters in the parasitic

159

Wu, Y.C., Horvitz, H.R., 1998. The C. elegans cell corpse engulfment gene ced-7 encodes a

protein similar to ABC transporters. Cell 93, 951-960.

Xu, M., Molento, M., Blackhall, W., Ribeiro, P., Beech, R., Prichard, R., 1998. Ivermectin

resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol

Biochem Parasitol 91, 327-335.

Yabe, T., Suzuki, N., Furukawa, T., Ishihara, T., Katsura, I., 2005. Multidrug resistance-

associated protein MRP-1 regulates dauer diapause by its export activity in

Caenorhabditis elegans. Development 132, 3197-3207.

Yagdiran, Y., Oskarsson, A., Knight, C.H., Tallkvist, J., 2016. ABC- and SLC-Transporters in

Murine and Bovine Mammary Epithelium--Effects of Prochloraz. PLoS One 11,

e0151904.

Yan, C., Bi, Y., Yin, D., Zhao, Z., 2012a. A method for rapid and simultaneous mapping of

genetic loci and introgression sizes in nematode species. PLoS One 7, e43770.

Yan, R., Urdaneta-Marquez, L., Keller, K., James, C.E., Davey, M.W., Prichard, R.K., 2012b.

The role of several ABC transporter genes in ivermectin resistance in Caenorhabditis

elegans. Vet Parasitol 190, 519-529.

Young, M.D., Wakefield, M.J., Smyth, G.K., Oshlack, A., 2010. Gene ontology analysis for

RNA-seq: accounting for selection bias. Genome Biol 11, R14.

Zandvliet, M., Teske, E., 2015. Mechanisms of Drug Resistance in Veterinary Oncology- A

Review with an Emphasis on Canine Lymphoma. Vet Sci 2, 150-184.

Zhao, Z., Fang, L.L., Johnsen, R., Baillie, D.L., 2004. ATP-binding cassette protein E is

involved in gene transcription and translation in Caenorhabditis elegans. Biochem

Biophys Res Commun 323, 104-111.

Zhao, Z., Thomas, J.H., Chen, N., Sheps, J.A., Baillie, D.L., 2007. Comparative genomics and

adaptive selection of the ATP-binding-cassette gene family in caenorhabditis species.

Genetics 175, 1407-1418.

Zhu, X.Q., Korhonen, P.K., Cai, H., Young, N.D., Nejsum, P., von Samson-Himmelstjerna, G.,

Boag, P.R., Tan, P., Li, Q., Min, J., Yang, Y., Wang, X., Fang, X., Hall, R.S., Hofmann,

A., Sternberg, P.W., Jex, A.R., Gasser, R.B., 2015. Genetic blueprint of the zoonotic

pathogen Toxocara canis. Nat Commun 6, 6145.

Page 171: P-glycoprotein drug transporters in the parasitic

160

Figures and tables

Figure 5-1. Representative images of adult male Parascaris. Positive signal resulting from probe

hybridization appeared as red punctate dots. Black boxes indicate the location of high

magnification insets. A description of staining in specific tissues is given in Section 3.2.

Page 172: P-glycoprotein drug transporters in the parasitic

161

Figure 5-2. Representative images of adult female Parascaris. Positive signal resulting from

probe hybridization appeared as red punctate dots. Black boxes indicate the location of high

magnification insets. A description of staining in specific tissues is given in Section 3.2.

Page 173: P-glycoprotein drug transporters in the parasitic

162

Figure 5-3. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in adult male Parascaris. Values

represent percent area of the tissue with positive staining relative to beta-tubulin ± S.E.M.

Columns with different symbols are significantly different (p < 0.05).

Page 174: P-glycoprotein drug transporters in the parasitic

163

Figure 5-4. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in adult female Parascaris.

Values represent percent area of the tissue with positive staining relative to beta-tubulin ± S.E.M.

Columns with different symbols are significantly different (p < 0.05).

Page 175: P-glycoprotein drug transporters in the parasitic

164

Figure 5-5. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in different body regions of adult

male Parascaris. Values represent percent area of the tissue with positive staining relative to

beta-tubulin ± S.E.M. Columns with different symbols are significantly different from other

regions of a specific tissue (p < 0.05).

Page 176: P-glycoprotein drug transporters in the parasitic

165

Figure 5-6. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in different body regions of adult

female Parascaris. Values represent percent area of the tissue with positive staining relative to

beta-tubulin ± S.E.M. Columns with different symbols are significantly different from other

regions of a specific tissue (p < 0.05).

Page 177: P-glycoprotein drug transporters in the parasitic

166

Supplementary data

The following is supplementary data to this article:

Figure 5-S 1. Representative images of adult Parascaris. Positive signal resulting from positive

and negative control probe hybridization appeared as red punctate dots.

Page 178: P-glycoprotein drug transporters in the parasitic

167

CHAPTER 6. GENERAL CONCLUSIONS

In order to understand the function of P-glycoproteins in ascarid worms, a series of

studies were conducted in Toxocara canis and Parascaris. The principle findings of these

experiments were:

P-gp genes are expressed in T. canis

Phylogenetic analysis and molecular cloning revealed 13 P-gp encoding genes present in

T. canis, with several isoforms predicted. 10 of these were constitutively expressed in adults and

infective larvae, while 6 were expressed in somatic larvae. Tca-Pgp-10 expression was

upregulated in somatic larvae derived from mice treated with moxidectin. Larval inhibition

assays provided phenotypic evidence of functional P-gp activity with a unique pharmacological

profile. Further work is required to study the function of these genes and discover nematode

specific P-gp inhibitors.

Tca-Pgp-11 has unique pharmacology and localization

A full length was cloned and designated Tca-Pgp-11. Tca-Pgp-11 was stably

expressed in a cell line lacking endogenous P-gp expression, and the pharmacological profile

was studied using flow cytometry. These experiments revealed that macrocyclic lactones are

transported by Tca-Pgp-11 and that this transporter has a inhibition profile that differs from

mammalian P-gps. Notably, Tca-Pgp-11 was insensitive to the P-gp inhibitors verapamil,

cyclosporine A, reserpine and tariquidar. Tca-Pgp-11 expression was restricted to intestines,

body wall, nerve and lateral cords and was completely absent from the reproductive tissue in

adult worms.

Peq-pgp-11 and Peq-pgp-16 are expressed by several cell types in adult parasites

Macrocyclic lactone resistance is a clinical problem in Parascaris and has been

Page 179: P-glycoprotein drug transporters in the parasitic

168

associated with Peq-pgp-11. This research demonstrated that P-gp mRNA localization could be

quantitatively measured using a multiple nucleic acid hybridization technique in formalin-fixed

paraffin embedded nematode tissue sections. Peq-pgp-11 and Peq-pgp-16 transcripts were

detected in several tissues in male and female worms indicating that P-gps could protect the

worm from MLs locally in the intestines, neurons, reproductive tissue and hypodermis. Further

work is necessary to understand if tissue localization of P-gp mRNA changes with ML-induced

hyperexpression in resistant isolates of Parascaris. mRNA in situ hybridization in combination

with immunohistochemistry would provide a snap-shot of mRNA and protein expression to

understand drug resistance mechanisms better.


Top Related