![Page 1: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/1.jpg)
1
Title: Overexpression of poplar cellulase accelerates growth and disturbs the closing
movements of leaves in sengon
Running title: Overexpression of poplar cellulase
Corresponding author: Taka Hayashi
Kyoto University, RISH
Gokasho, Uji, Kyoto 611-0011, Japan
Tel & Fax: +81 774 38 3618
Email: [email protected]
Appropriate Journal Research Area: Cell Wall
Plant Physiology Preview. Published on April 16, 2008, as DOI:10.1104/pp.108.116970
Copyright 2008 by the American Society of Plant Biologists
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 2: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/2.jpg)
2
Overexpression of poplar cellulase accelerates growth and disturbs the
closing movements of leaves in sengon
Sri Hartati, Enny Sudarmonowati, Yong Woo Park, Tomomi Kaku, Rumi Kaida, Kei’ichi
Baba and Takahisa Hayashi*
Research Centre for Biotechnology, LIPI, Cibinong 16911, Indonesia (S.H., E.S.)
Kyoto University, RISH, Uji 611-0011, Japan (Y.W.P., T.K., R.K., K.B., T.H.)
*Corresponding author. Email: [email protected]
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 3: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/3.jpg)
3
This work was supported partly by the Program for the Promotion of Basic Research
Activities for Innovative Biosciences (PROBRAIN) and partly by JSPS KAKENHI (No.
19208016 and 19405030). This paper is also a part of the outcome of the JSPS Global COE
Program (E-04): In Search of Sustainable Humanosphere in Asia and Africa.
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 4: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/4.jpg)
4
ABSTRACT
In this study, poplar cellulase (PaPopCel1) was overexpressed in a tropical Leguminosae tree,
sengon (Paraserianthes falcataria), by the Agrobacterium method. PaPopCel1
overexpression increased the length and width of stems with larger leaves, which showed a
moderately higher density of green color than leaves of the wild type. The pairs of leaves on
the transgenic plants closed more slowly during sunset than those on the wild-type plants.
When main veins from each genotype were excised and placed on a paper towel, however, the
leaves of the transgenic plants closed more rapidly than those of the wild-type plant. Based on
carbohydrate analyses of cell walls, the leaves of the transgenic plants contained less
wall-bound xyloglucan than those of the wild-type plants. In situ xyloglucan
endotransglucosylase activity showed that the incorporation of whole xyloglucan, potentially
for wall tightening, occurred in the parenchyma cells (motor cells) of the petiolule pulvinus
attached to the main vein, although the transgenic plant incorporated less whole xyloglucan
than the wild-type. These observations support the hypothesis that the paracrystalline sites of
cellulose microfibrils are attacked by poplar cellulase, which loosens xyloglucan intercalation,
resulting in an irreversible wall modification. This process could be the reason why the
overexpression of poplar cellulase both promotes plant growth and disturbs the biological
clock of the plant by altering the closing movements of the leaves of the plant.
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 5: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/5.jpg)
5
INTRODUCTION
Overexpression of plant cellulase in plants does not lead to a lack of cellulose, but rather,
modifies the cell walls by trimming off disordered glucose chains from the microfibrils. This
action has been demonstrated in Arabidopsis thaliana overexpressing poplar cellulase (Park et
al., 2003). Transgenic Populus tremula overexpressing Arabidopsis cellulase (cel1) had
longer internodes and longer fiber cells (Shani et al., 2004). Overexpression does not increase
xyloglucan depolymerization (Harpster et al., 2002) because the reaction efficiency of plant
cellulase for xyloglucan is very low compared with that for amorphous 1,4-β-glucans (the
amorphous regions of cellulose microfibrils). This is confirmed by the fact that the enzyme has
high reactive efficiency for artificial substrates such as carboxymethylcellulose,
phospho-swollen cellulose, and (1→3),(1→4)-β-glucan (Nakamura and Hayashi, 1993).
Nevertheless, the trimming of microfibrils by cellulase might solubilize some xyloglucan that
would otherwise have been intercalated within the disordered paracrystalline domains of the
microfibrils (Hayashi, 1989). This kind of cell wall modification in Arabidopsis causes an
increase in the size of cells in the petioles and blades of rosette leaves and stems (Park et al.,
2003). Based on relative load-extension curves, a cross-linking component appeared to be
reduced in the walls of the transgenic plants compared to those of the wild-type plants. The
decreased cross-linking component is attributable to a decreased amount of tethering
xyloglucan, and could in turn accelerate growth by increasing plastic extensibility under
turgor pressure. Thus, the overexpression of cellulase could affect wall dynamics, particularly
the turgor-related movements of plant organs such as the opening and closing movements of
leaves and stomata, etc.
Poplar cellulase cDNA with 35S promoter has been used in sengon because the
overexpression of poplar cellulase in Arabidopsis and poplar produced more visible effects in
their leaves (Ohmiya et al., 2003; Park et al., 2003). In these species, leaf length and width
were increased to the same extent as the length of the blade and petiole. The question is,
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 6: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/6.jpg)
6
therefore, whether Leguminosae plants that overexpress cellulase (in this case, sengon) show
any phenotype for leaf movements related to the walls of motor cells.
Sengon (Paraserianthes falcataria) belongs to the subfamily Mimosoideae of
Leguminosae, and is native to Haiti, Indonesia, and Papua New Guinea. The sengon variety
used for reforestation is the fastest-growing tree in industrial forests. It even thrives in
marginal land, where it grows symbiotically with nitrogen-fixing Rhizobium and
phosphorus-promoting mycorrhizal fungi. It is, therefore, a suitable species for industrial
timber estates in Southeast Asian countries (Binkley et al., 2003; Shively et al., 2004;
Kurinobu et al., 2007; Siregar et al., 2007). The sengon tree typically gains 7 m in height per
year and reaches a mean height of 25.5 m and a bole diameter of 17 cm after 6 years. After 15
years, it reaches 39 m in height and 63.5 cm in diameter. The tree is useful not only for timber
material but also for pulp and paper. Due to its soft timber and leaves that can be used as
animal feed (Merkel et al., 2000), the tree has a wider range of end-uses than Acacia species
(Otsamo, 1998). It is, therefore, expected to be one of the most useful tree species for
industrial forests. However, despite attempts with tree cuttings, tissue culture techniques with
multiple propagations, and stable gene transfer using Agrobacterium tumefaciens, attempts to
propagate the tree clonally have failed. In this paper, we demonstrate the production of
transgenic sengon for the first time.
Cellulose is an important component of plants and serves as the most abundant
bio-polymer on the earth, with about one hundred billion tons produced annually. In addition,
it is a significant biological sink for CO2. It has been suggested that cellulases may have
originally been involved in either the repair or arrangement of cellulose microfibrils during
their biosynthesis, rather than in cellulose degradation (Hayashi et al., 2005). It has also been
reported that membrane-bound cellulase (Korrigan) is required for cellulose biosynthesis
(Nicol et al., 1998), but nothing is known about its role in cellulose biosynthesis.
In the present study, we used the overexpression of poplar cellulase in the sengon tree in
order to increase its growth rate. We hope, thereby, to increase the plant’s production of raw
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 7: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/7.jpg)
7
material, not only for timber, pulp, and paper, but also for use as a biofuel (Ragaukas et al.,
2006). Ultimately, experiments like this that result in an increased deposition of cellulose in
the stem could produce the fastest-growing tree in the world.
RESULTS
Transformation
Two-week-old hypocotyls germinated from seeds were cut into 2- to 4-mm long stems, the
explants of which were used for transformation in the same manner as leaf disks for the
Agrobacterium-mediated transformation. The explants from the cut hypocotyls formed a
callus-like tissue, which was followed by green color and shoot formation on
Murashige-Skoog (MS) medium containing 4 µM benzylaminopurine. The transformants
were selected in MS medium containing kanamycin.
During several transfers of explants to fresh medium each month, shoots were induced by
the addition of benzylaminopurine (Figure 1A) under light (4,000 lux). Benzylaminopurine
alone was used as a plant hormone to induce shoots because auxin did not affect the formation
of callus tissue or shoots in the presence of benzyladenine (Bon et al., 1998).
During direct adventitious shoot formation, parts of the explants turned green and
produced green nodular structures to form adventitious buds at the apical ends. The
adventitious shoots (5 mm long) were transplanted into the medium in the absence of
benzylaminopurine. After the shoots elongated to 3 cm (Figure 1B), they were again
transplanted into fresh MS medium in the absence of any plant hormone for the induction of
roots (Figure 1C). No plant hormone was used for rooting because auxin and cytokinin
prevented the induction of roots (Bon et al., 1998).
Pinnate leaflets were formed during shoot elongation and root formation, although young
trees and shoot apical meristems in adult trees form pinnate leaves. About thirty shoots were
regenerated from 400 co-cultivated explants; 10 of these shoots produced roots. Ultimately,
seven independent seedlings were obtained. Shoots and roots were also induced from the
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 8: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/8.jpg)
8
young shoots of wild-type plants in the presence and absence of benzylaminopurine,
respectively (Figure 1D).
It should be noted that it took about 5 to 6 months to get produce transgenic seedlings and
about 2 to 3 months to produce wild-type seedlings.
Cellulase expression
To study the effects of cellulase on cell wall structure and growth, we generated transgenic
sengon plants that expressed poplar cellulase (PaPopCel1) under the control of a constitutive
promoter. To assay the expression of the transgene, we performed RT-PCR Southern blot
analysis of mRNAs derived from small sections excised from the petiolule pulvinus (Figure
2A). PopCel1 mRNA was accumulated in trg1 to trg7, and weak signals were detected in trg4
to trg7. Also, we used an antibody against a 15-amino-acid sequence
(163CWERPEDMDTPRNVY167) for PaPopCel1 gene product (Ohmiya et al., 2003).
In each transgenic line (trg1 to trg7), the antibody recognized a single, 50-kDa band on a
Western blot, present in the petiolule pulvinus, running at a position corresponding to the
expected and actual size of the mature cellulase (Figure 2B). No signal was detected in the
wild-type plants.
In the pulvinus attached to the veins of the transgenic plants, cell wall fractions showed
cellulase activity that was approximately 1.05- to 5.25-fold higher than that of the wild-type
(Figure 2C). The activity of cellulase was also assessed by measuring soluble
cello-oligosaccharides which are presumably released by the enzyme (Figure 2D). These
oligosaccharides accumulated in the transgenic plants, as all the transgenic plants were found
to contain far more oligosaccharides than the wild-type plants contained. The amount of
oligosaccharides was closely related to cellulase activity levels in each of the seven nic lines.
Thus, the levels of expression and activity varied among the transgenic plants: they were
relatively high in trg1 to trg3 and relatively low in trg7, although a trace of
cello-oligosaccharides were detected even in trg7. This was probably because the poplar
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 9: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/9.jpg)
9
cellulase expressed was discretely localized in the cellulose microfibrils of the apoplastic
spaces.
Based on the carbohydrate analyses of cell walls, it appears that the petiolule pulvinus
and the main vein in the transgenic plants contained less wall-bound xyloglucan than those in
the wild-type plants (Table 1). Increased cellulase activity in the wall did not decrease the
levels of cellulose; rather, cellulose content per plant increased with plant growth, i.e.,
cellulose per mg dry weight was not changed. The methylated sugars due to the minor
components consisted of 4-linked xylose, 4-linked galactose, and 4-linked mannose at a
constant proportion in both the transgenic and the wild-type plants (data not shown). These
methylated sugars are probably derived from xylan, galactan, and mannan at a ratio of
4.7:3.2:1. Therefore, the transgenic plants differ from the wild-type plants only in the amount
of xyloglucan present in the cell walls.
Admittedly, there is no correlation between cellulase activity (Figure 2B) and the extent
of xyloglucan solubilization (Table 1). Nevertheless, the levels of soluble
cello-oligosaccharides, which could be related to in vivo cellulase activity, were closely
related to cellulase activity levels across the seven transgenic lines and were consistently
higher in the transgenic plants than in the wild type, which again corresponds to cellulase
activity.
Growth response of transgenic plants
We generated seven independent transgenic sengon lines, four of which (trg1 to trg4) grew
significantly better than the wild type, although the overall morphology of these transgenic
plants was similar to that of the wild type (Figure 3). Two other transgenic lines (trg5 and trg6)
grew slightly better than the wild type, and one (trg7) grew about as well as the wild type.
Based on the expression of the transgene, the four lines which showed a high growth rate
(approximately 20-cm stem length) were selected for further analysis.
The transgenic sengon plants (trg1 to trg4) grew faster than the wild-type plants, although
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 10: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/10.jpg)
10
the young seedlings (less than 30 cm in height) of both types sometimes grew at the same rate.
The stems of the transgenic plants elongated faster than those of the wild-type and had larger
diameters (Figure 3). The overall morphology of the transgenic plants was similar to that of
the wild type (Figure 4A). As with stem growth, the leaves of the transgenic plants were
greener and larger than those of the wild type (Figure 4B). In both types, the length and width
of the leaves increased to the same extent as the length of the main and minor veins, and this
increase in size was even distributed among all leaves of the plant. Parenchyma cells in leaves
of both types were identified in the central part of the petioles. Finally, both palisade and
epidermal cells were a little larger in the leaves of the transgenic plants than in the leaves of the
wild-type plants (data not shown).
Figure 5 shows the times at which the transgenic and wild-type plants started
leaf-opening before sunrise and completed leaf-closure during sunset. There was no difference
between transgenic and wild-type plants in the starting time of leaf opening (Figure 5A); the
leaves in both types of plants started opening around midnight and completed opening by 5:25
am. In contrast, the leaf pairs closed more slowly in the transgenic plants than in the wild-type
plants. This difference was visible in the upper, middle, and lower parts of the petioles (Figure
5B). In the transgenic plants, older leaves located at the middle and bottom part of the stems
started closing 30 min later than corresponding leaves in the wild-type plants. Likewise, in the
transgenic plants, leaves at the bottom part of the stem completed closing more than one hour
later than corresponding wild-type leaves. However, both the transgenic and wild-type plants
closed their leaves within a few minutes when they were placed in darkness at noon (data not
shown). In spite of this change to their normal conditions, they also started opening their
leaves at almost the same time (midnight) and finished opening completely by 5:25 am (Figure
5A).
Interestingly, the transgene had the opposite effect on excised main veins. When the main
vein with leaves was excised and placed on a paper towel, the pairs of leaves from the
transgenic plants closed faster than those of the wild type (Figure 6). The younger leaves in the
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 11: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/11.jpg)
11
upper part of each plant started closing immediately; leaves in the middle part completed
closing more than one hour later; and leaves in the lower part completed closing two hours
later. The older leaves in the middle and lower parts of the transgenic plants completed closing
more than 30 minutes earlier than those of the wild type. Thus, when the main vein was
excised, closing was faster in the leaves of the transgenic plants than in those of the wild-type
plants, whereas in vivo, closing was slower in the transgenic leaves.
Xyloglucan endotransglucosylase activity was detected in situ on the transverse sections
of the petiolule pulvinus attached to the main vein using either fluorescent whole xyloglucan
(50 kDa) or fluorescent xyloglucan heptasaccharide (XXXG) (Takeda et al., 2002). Whole
xyloglucan was incorporated into the parenchyma cells (motor cells) of the pulvinus in both
genotypes, although the transgenic plants incorporated less xyloglucan than the wild type
(Figure 7). The incorporation of whole xyloglucan into the vascular bundle of the main vein
was also greater in the wild type than in the transgenic plants, although it was incorporated
into the connection between the petiolule pulvinus and main vein at the same rate in both
genotypes.
In contrast, the incorporation of XXXG, either into the parenchyma cells of the pulvinus
or into the vascular bundle of the main vein, was not observed in either genotype. These results
show that the walls of the parenchyma cells (motor cells) can incorporate whole xyloglucan
but not XXXG. The level of incorporation was higher in the wild-type plants than in the
transgenic plants, probably because the walls of the transgenic plants contain less endogenous
xyloglucan molecules to act as donors. Another possible explanation is that the increased
cellulase in the transgenic plants cleaves the glucan chains to which xyloglucan binds, so that
the glucan chains are washed out, making it more difficult for xyloglucan molecules to attach
firmly to the wall.
DISCUSSION
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 12: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/12.jpg)
12
We have succeeded in producing transgenic sengon plants for the first time. Seven
independent shoots regenerated from 400 co-cultivated explants were demonstrated to be
transgenic; this represents a transformation frequency of 1.75%. So far, we have not
succeeded in either multiple propagation of the transgenic shoots or clonal propagation by
cutting their stems. Nevertheless, shoots and roots were induced in MS medium both in the
presence and absence of 4 µM benzylaminopurine. The shoots always formed from the
callus-like tissues of explants from the cut hypocotyls, although the shoots and roots directly
formed from the explants of hypocotyls in the case of Acacia sinuate (Vengadesan, et al.,
2006). Now sengon can be genetically modified to exhibit desirable traits, such as easy
degradation of cellulose microfibrils, as well as pathogen and insect resistance, qualities
which are hard to achieve by traditional breeding. It would also be expected to increase the
transformation frequency, particularly the induction of roots from shoots. The increased
frequency of root induction should accelerate the biotechnological application of sengon as a
biomass resource. It should be noted that wild-type sengon is already one of the fastest
growing tree species in the world; the transgenic sengon developed in this study grows even
faster and may ultimately be the fastest growing tree in the world.
Transgenic sengon overexpressing poplar cellulase (PaPopCel1) increased the size of
leaves by increasing cell volume, as other authors have demonstrated in Arabidopsis leaves
(Park et al., 2003). This phenomenon has been attributed to an increase in the specific activity
of cellulase, similar to the increase observed in transgenic Arabidopsis and poplar (Park et al,
2003; Shani et al., 2004). Nevertheless, no bulk degradation of cellulose was confirmed,
because the amount of cellulose per dry weight was nearly the same in the transgenic and the
wild-type plants. Therefore, we believe that cellulase promotes increased growth in transgenic
sengon by trimming off disordered glucose chains from cellulose microfibrils, where some
xyloglucan would otherwise be solubilized. Residual xyloglucan can adhere tightly to
cellulose microfibrils, perhaps as a monolayer coating the surface, but the transgenic plants
contained less xyloglucan bound to cellulose microfibrils. This agrees with a previous finding
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 13: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/13.jpg)
13
that a decrease in xyloglucan tethers accelerates cell elongation (Takeda et al., 2002).
We have found that leaf movements are somehow disturbed by the transgene expression.
The transgenic plants opened their leaf pairs at the same time as the wild-type plants
(midnight), but started closing their leaves 30 minutes later and completed closing them more
than one hour later (Figure 5). Nevertheless, transgenic sengon still retains a type of circadian
rhythm in the opening and closing movements of leaves, although sterilized sengon (in vitro
culture) did not show closing movements at night, even if the plant was placed in darkness.
The opening and closing movements of leaves occur in the leaf bases (petiolule pulvinus) and
are caused by the expansion and contraction of the motor cells. Motor cells occupy most of the
space in the pulvinus, surrounding the central ring of the vascular bundle. The expansion and
contraction of these cells is believed to result from changes in their turgor, which is regulated
in turn by the flow of K+ ions across the cells’ thin walls.
In the case of transgenic sengon that overexpresses poplar cellulase, an increase in wall
plasticity may cause changes in normal leaf movements, because the movements correspond
to the balance between turgor pressure and wall pressure. Therefore, the turgor pressure in
transgenic sengon motor cells might increase during the day and decrease at night, while the
wall pressure remains constant. In the case of pea hypocotyls, the wall pressure in growing
cells is decreased during elongation, while the turgor pressure remains constant. Since the
walls of the motor cells in the pulvinus incorporated whole xyloglucan but not XXXG, wall
tightening rather than loosening could be required for preventing the expansion of the cells at a
cut surface (Takeda et al., 2002).
In this case, the xyloglucan endotransglucosylase activity could occur between
high-molecular-size xyloglucans in the cell walls, where the enzyme has both enzyme-donor
enzyme-acceptor complexes. Ueda and Nakamura (2007) suggested that leaf movements are
controlled by the balance of the concentrations of chemical substances involving an aglycon or
a glucoside, which induce opening and closing, respectively. Nakanishi et al. (2005) showed
that in excised leaves of O. corymbosa, the opening movement was sensitive to blue light but
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 14: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/14.jpg)
14
not to red light. It should be noted that cellulase tends to affect the down-regulation of leaf
movements, whereas chemical substances and light tend to affect the up-regulation of leaf
movements.
Darwin (1880) postulated that the nyctinastic movements of plants occurred in order to
hide the upper surface of the leaves at night, because the upper leaf epidermis was believed to
be a sense organ for adaptive responses. Bunning and Moser (1969), on the contrary,
suggested that adaptive leaf movements occurred to protect the plant’s photoperiodic rhythm
against radiation from moonlight rather than against radiation from the leaf surfaces into the
sky. This cannot be considered a satisfactory explanation in the case of sengon, however,
because pairs of sengon leaves start to open at night. It should be noted that light does not
induce the opening movements during normal growth.
It is possible that the transgenic sengon plants have slightly higher photosynthetic
capability than the wild-type plants, since the leaf pairs of the transgenic plants close more
slowly than those of the wild-type plants. The sun always sets in Indonesia by 18:40, while the
transgenic plants keep their leaf pairs open for about an hour after the normal sunset time. We
are performing detailed analyses of the plant’s leaf movements to determine their
photosynthetic efficiency.
MATERIALS AND METHODS
Transgenic constructs
The PaPopCel1 cDNA fragment was excised from pBluescript SK by digestion with BamHI
and KpnI (Nakamura et al., 1995). The GUS-coding sequence of pBE2113 was removed from
the fragment by digestion with BamHI and SacI, and the cDNA fragment was inserted into the
pBE vector between the cauliflower mosaic virus 35S promoter and the Agrobacterium
tumefaciens NOS transcription terminator. The chimeric construct was introduced into the
disarmed A. tumefaciens strain LBA4404.
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 15: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/15.jpg)
15
Plant transformation
Agrobacterium carrying plasmid-harboring poplar cellulase cDNA (PaPopCel1) and
selectable marker NPTII genes were cultured in YES medium (0.1% yeast extract, 0.5%
polypeptone, 0.5% sucrose, 0.0246% MgSO4) containing 50 µg ml-1 kanamycin. The bacterial
suspension was pelleted and resuspended with sterilized water. Seeds were germinated for two
weeks to produce hypocotyls elongating 1 to 2 cm in length.
Pieces of sengon stems (2 to 4 mm in length) excised from their hypocotyls were dipped
in diluted Agrobacterium solution (OD600 = 0.1) for 5 to 10 min and put on sterile filter paper,
then co-cultivated for 1 day on half-strength hormone-free Murashige-Skoog (MS) medium.
Next, the pieces of stems were placed on MS agar medium containing 600 µg ml-1 kanamycin
for 2 weeks, after which they were washed with a water solution containing 400 µg ml-1
Claforan. The stems were cultured several times by transplantation on MS agar media
containing 600 µg ml-1 kanamycin and 4 µM benzylaminopurine for 2 to 4 months, under 14 h
day (4,000 lux)/10 h night cycles, after which they were placed on a medium containing 300
µg ml-1 kanamycin for 2 weeks. Shoots 5 mm in length were excised from the medium and
cultured again on a medium containing 300 µg ml-1 kanamycin in the absence of plant
hormone. Roots were then formed in the medium for 2 to 4 weeks, and the plantlets were
further cultured for growth in the medium for 2 months. Plantlets approximately 10 to 15 cm
long were planted in soil.
RNA isolation and reverse transcription-PCR analysis
Total RNA was isolated from the main vein with petiolule pulvinus (Ohmiya et al., 2000). The
first-strand cDNA was synthesized using 5 µg of total RNA at 42 oC for 1 h using oligo(dT) (n
= 20) and SuperScript II reverse transcriptase (Gibco BRL, Rockville, MD, USA). PCR was
performed with final volumes of 20 µl containing 0.5 unit of cDNA polymerase mix (Clontech,
Palo Alto, CA, USA), 0.2 mM dNTPs, 3.5 mM Mg(OAc)2 and 0.4 µM gene-specific primers.
The forward primer was CACCACGCAATGTGTACAAAGTAACCATC (nucleotide
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 16: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/16.jpg)
16
position 512-540) and the reverse primer was
GGGTGTATATTGGGCCTGGAAACTAGAAGTT (nucleotide position 993-1,023) with
the first-strand cDNA. The PCR reaction was initially denatured at 94 oC for 5 min and in the
subsequent cycles at 94 oC for 30 sec. Annealing and elongation cycles were both performed
for 3 min at 68 oC. PCR products were size-separated by electrophoresis in a 0.9 % agarose gel
and blotted onto nylon membranes (Hybond-N+ from Amersham-Pharmacia Biotech, Uppsala,
Sweden).
Membranes were hybridized in 5 x SSC, with 1.0 % blocking reagent, 0.1%
lauroylsarcosine and 0.02 % SDS at 42 oC to digoxigenin-dUTP-labeled probes. Probes were
labeled using a DIG-DNA labeling kit (Roche Diagnostics, Tokyo, Japan), which were
synthesized from PopCel1 cDNA by gene-specific primers.
Following hybridization, the membranes were washed in 2 x SSC for 5 min at room
temperature and then two times in 0.1 x SSC with 0.1 % SDS at 68 oC, for 15 min each time.
The washed membranes were developed using a DIG-DNA Detection kit (Roche Diagnostic)
for chemiluminescent detection.
Western blot analysis
After the leaves were removed, the main vein with petiolule pulvinus in the middle part of the
petiole was homogenized in 20 mM sodium phosphate buffer (pH 6.2) in a mortar and the wall
residue was washed three times. The wall-bound proteins were extracted from the wall residue
with a buffer containing 1 M NaCl. The proteins were then subjected to electrophoresis with
10% SDS-PAGE, electrotransferred to Hybond-C Extra (Amersham), and probed with an
antibody against the PopCel sequence, followed by a second antibody using a Toyobo-ABC
high-HRP Immunostaining Kit (Toyobo, Osaka, Japan). Seven lines of transgenic plants were
assayed.
Cellulase activity assay
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 17: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/17.jpg)
17
Each enzyme preparation was obtained from the wall residue of the main vein with petiolule
pulvinus in the middle part of the petiole with a buffer containing 1 M NaCl, and its activity
was assayed viscometrically at 35 oC for 2 h, using 0.1 ml of the enzyme preparation plus 0.9
ml of 10 mM sodium phosphate buffer (pH 6.2) containing 0.65% (W/V)
carboxymethylcellulose in Cannon semimicroviscometers (Cannon Instrument Co., State
College, PA, USA). One unit of activity is defined as the amount of enzyme required to cause
0.1% loss in viscosity in 2 h under such conditions (Ohmiya et al., 1995). Protein was
determined using the Coomassie Plus Protein Assay Reagent (Pierce, Rockford, IL, USA),
according to the method described by Bradford (1976).
Determination of cello-oligosaccharides
After the leaves were removed, the main vein with petiolule pulvinus in the middle part of the
petiole was homogenized in 20 mM sodium phosphate buffer (pH 6.2) in a mortar. The soluble
extract was boiled for 5 min and left at room temperature for 24 h to equilibrate the anomer
configuration between α- and β-types. After centrifugation, the amount of
cello-oligosaccharides was determined by cellobiose dehydrogenase purified from conidia
spores of Phanerochaete chrysosporium (Tominaga et al., 1999). The reaction mixture
contained 90 mU (10 µl) of cellobiose dehydrogenase, 50 µM Cyt c (10 µl), and sample
solution (70 µl) in 100 mM sodium acetate buffer, with a pH of 4.2. After incubation for 5 min
at room temperature, the absorbance at 550 nm was determined. A linear standard curve was
obtained with a standard cellobiose solution, and an absorbance of 0.5 % corresponded to
approximately 270 ng per 100 µl of reaction mixture for cellobiose.
Fractionation and measurement of wall components
The main vein and petiolule pulvinus in the middle part of the petiole were separated after the
leaves had been removed. Each sample was ground in liquid nitrogen and freeze-dried before
its dry weight was determined. The sample was successively extracted 6 times with 10 mM
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 18: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/18.jpg)
18
sodium phosphate buffer (pH 7.0) and 3 times with 24% KOH containing 0.1% NaBH4 at less
than 45 oC for 3 h in an ultrasonic bath. The insoluble wall residue (the cellulose fraction) was
washed with water and solubilized with ice-cold 72% sulfuric acid. Total sugar in each
fraction was determined by the phenol/sulphuric acid method (Dubois, 1956). The xyloglucan
level was determined by the iodine/sodium sulfate method (Kooiman, 1961).
Growth measurement
The growth response of the transgenic plants was monitored after they were transplanted in
soil and habituated for 3 weeks under non-sterile conditions. Each stem (around 15 cm) was
marked at a height of 5 cm, which was used as a reference point for measuring the height,
diameter, and number of internodes every third day. The length of the stem was determined
from the top to the reference point. Dry weight was determined after freeze-drying the
samples.
The timing of the leaf movement was determined by observing the movements every day
for 20 days during both the rainy (January) and dry (May) seasons. The closing movements of
the leaves with the base of their main vein excised occurred between 10:00 am and 11:00 am
during both the rainy (January) and dry (May) seasons. The veins with leaves attached were
placed on paper towels immediately after excision.
Four transgenic lines, trg1, trg2, trg3 and trg4, were used to observe the opening and
closing movements of leaves. These plants had 9 or 10 petioles each, all of which were more
than 10 cm long. The lower part of the petiole was defined as the 2nd petiole from the bottom;
the middle part as 5th or 6th petiole from the bottom; and the upper part as the 9th or 10th (or
newest) petiole. All the pairs of leaves attached to the main vein in the petiole were observed
to determine the opening and closing movements.
Fluorescent xyloglucans
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 19: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/19.jpg)
19
Fluorescent xyloglucan (Takeda et al., 2002) was prepared by dissolving 10 mg of CNBr and
20 mg of pea xyloglucan (50 kDa) in 1 ml of water and adjusting the pH to 11.0 by adding
NaOH. The activated polysaccharide was incubated with 4 mg fluoresceinamine overnight at
room temperature. The fluorescein-labeled xyloglucan was purified by gel filtration on a
Sephadex G-50 column (Amersham-Pharmacia Biotech, Uppsala, Sweden). Calculations
showed that 1 µmol of fluorescein incorporated into 110 µmol of sugar residues,
corresponding to a substitution rate of 3.7 mol fluorescein per mole of xyloglucan. To prepare
fluorescent XXXG (Fry, 1997), 40 mg of XXXG was aminated with 2 ml of 0.4 M sodium
cyanotrihydroborate in 2.0 M ammonium chloride at 100 °C for 120 min. The aminated
oligosaccharide was purified by gel filtration on Bio-Gel P-2 and incubated with 50 mg
fluorescein isothiocyanate (FITC) in sodium carbonate bicarbonate buffer (pH 9.0) for 2 h at
room temperature. The oligosaccharide-FITC conjugate was purified by gel filtration on
Bio-Gel P-2.
In situ xyloglucan endotransglucosylase activity
The transverse sections (200 µm) of the main vein including petiolule pulvinus with
fluorescent derivatives were incubated for 15 min in 300 µl of 2 mM MES/KOH buffer (pH
6.2) containing 0.2 mM fluorescent whole xyloglucan or 9 mM fluorescent XXXG while
being shaken in darkness at 23 °C. The sections that were incubated with whole xyloglucan
were washed three times in 0.01 M NaOH for 30 min. Those incubated with XXXG were
washed with 5% formic acid in 90% ethanol for 5 min followed by 5% formic acid for 5 min
(Takeda et al., 2002). The sections were washed twice with water and examined using a Zeiss
Axioscope microscope equipped with epifluorescence illumination (Oberkochen, Germany).
ACKNOWLEDGEMENTS
We thank Takahide Tsuchiya and Nobuyuki Kanzawa (Department of Chemistry, Sophia
University) for valuable discussions during the final preparation of the paper.
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 20: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/20.jpg)
20
LITERATURE CITED
Binkley D, Senock R, Bird S, Cole TG (2003) Twenty years of stand development in pure
and mixed stands of Eucalyptus saligna and nitrogen-fixing Facaltaria moluccana. Forest
Ecol Manage 182: 93-102
Bon MC, Bonal D, Goh DK, Monteuuis O (1998) Influence of different macronutrient
solutions and growth regulators on micropropagation of juvenile Acacia mangium and
Paraserianthes falcataria explants. Plant Cell Tissue Organ Culture 53: 171-177
Bradford MN (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Ana Biochem 72:
248-254
Bunning E, Moser I (1969) Interference of moonlight with the photoperiodic measurement of
time by plants, and their adaptive reaction. Proc Natl Acad Sci USA 62: 1018-1022
Darwin C (1880) The Power of movement in Plants, John Murray, London
Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F (1956) Colorimetric method for
determination of sugars and related substances. Anal Chem 28: 350-356
Fry SC (1997) Novel ‘dot-blot’ assays for glycosyltransferases and glycosylhydrolases:
optimization for xyloglucan endotransglycosylase (XET) activity. Plant J 11: 1141-1150
Harpster MH, Dawson DM, Nevins DJ, Dunsmuir P, Brummell DA (2002) Constitutive
overexpression of ripening-related pepper endo-1,4-beta glucanase in transgenic tomato
fruit does not increase xyloglucan depolymerization of fruit softening. Plant Mol Biol 50:
357-69
Hayashi T (1989) Xyloglucans in the primary cell wall. Ann Rev Plant Physiol Plant Mol Biol
40: 139-168
Hayashi T, Yoshida K, Park YW, Konishi T, Baba K (2005) Cellulose metabolism in
plants. Inter Rev Cytol 247: 1-34
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 21: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/21.jpg)
21
Kooiman P (1961) The constitution of Tamarindus-amyloid in plant seeds. Recl Trav Chim
Pays-Bas 80: 849-865
Kurinobu S, Prehatin D, Mohanmad N, Matsune K, Chigira O (2007) A provisional
growth model with a size-density relationship for a plantation of Paraserianthes falcataria
derived from measurements taken over 2 years in Pare, Indonesia. J Forest Res 12: 230-236
Merkel RC, Pond KR, Burns JC, Fisher DS (2000) Rate and extent of dry matter
digestibility in sacco of both oven- and freeze-dried Paraserianthes falcataria, Calliandra
calothyrsus, and Gliricidia sepium. Trop Agriculture 77: 1-5
Nakamura S, Hayashi T (1993) Purification and properties of extracellular
endo-1,4-β-glucanase from suspension-cultured poplar cells. Plant Cell Physiol 34:
1009-1013
Nakamura S, Mori H, Sakai F, Hayashi T (1995) Cloning and sequencing of cDNA for
poplar endo-1,4-β-glucanase. Plant Cell Physiol 36: 1229-1235
Nakanishi F, Nakazawa M, Katayama N (2005) Opening and closing of Oxalis leaves in
response to light stimuli. J Biol Education 39: 87-91
Nicol F, His I, Jauneau A, Vernhettes S, Canut H, Hofte H. (1998) A plasma
membrane-bound putative endo-1,4-β-glucanase is required for normal wall assembly and
cell elongation in Arabidopsis. EMBO J 17: 5563-5576
Ohmiya Y, Nakamura S, Sakai F, Hayashi T (1995) Purification and properties of
wall-bound endo-1,4-β-glucanase from suspension-cultured poplar cells, Plant Cell Physiol
36: 607-614
Ohmiya Y, Samejima M, Amano Y, Kanda T, Sakai F, Hayashi T (2000) Evidence that
endo-1,4-ß-glucanase act on cellulose in suspension-cultured poplar cells. Plant J 24:
147-158
Ohmiya Y, Nakai T, Park YW, Aoyama T, Oka A, Sakai F, Hayashi T (2003) The role of
PopCel1 and PopCel2 in poplar leaf growth and cellulose biosynthesis, Plant J 33:
1087-1097
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 22: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/22.jpg)
22
Otsamo R (1998) Effect of nurse tree species on early growth of Anisoptera marginata Korth.
(Dipterocarpaceae) on an Imperata cylindrica (L.) Beauv. grassland site in south
Kalimantan, Indonesia. Forest Ecol Manage 105: 303-311
Park YW, Tominaga R, Sugiyama J, Furuta Y, Tanimoto E, Samejima M, Sakai F,
Hayashi T (2003) Enhancement of growth by expression of poplar cellulase in Arabidopsis
thaliana. Plant J 33: 1099-106
Ragaukas AJ, Williams CK, Davison BH, Britovsek G, Cairney J, Eckert CA, Frederick
Jr WJ, Hallett JP, Leak DJ, Liotta CL, Mielenz JR, Murphy R, Templer R,
Tschaplinski T (2006) The path forward for biofuels and biomaterials. Science 311:
484-489
Shani Z, Dekel M, Tsabary G, Goren R, Shoseyov O (2004) Growth enhancement of
transgenic poplar plants by overexpression of Arabidopsis thaliana endo-1,4-β-glucanase
(cel1). Molecular Breed 14: 321-330
Shively GE, Zelek CA, Midmore DJ, Nissen TM (2004) Carbon sequestration in a tropical
landscape: an economic model to measure its incremental cost. Agroforest Systems 60:
189-197
Siregar UJ, Rachmi A, Massijaya MY, Ishibashi N, Ando K (2007) Economic analysis of
sengon (Paraserianthes falcataria) community forest plantation, a fast growing species in
East Java, Indonesia. Forest Policy Economics 9: 822-829
Takeda T, Furuta Y, Awano T, Mizuno K, Mitsuishi Y, Hayashi T (2002) Suppression and
acceleration of cell elongation by integration of xyloglucans in pea stem segments. Proc Natl
Acad Sci USA 99: 9055-9060
Tominaga R, Samejima M, Sakai F, Hayashi T (1999) Occurrence of
cello-oligosaccharides in the apoplast of auxin-treated pea stems. Plant Physiol. 199:
249-254
Ueda M, Nakamura Y (2007) Chemical basis of plant leaf movement. Plant Cell Physiol 48:
900-907
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 23: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/23.jpg)
23
Vengadesan G, Amutha S, Muruganantham M, Anand RP, Ganapathi A (2006)
Transgenic Acacia sinuata from Agrobacterium tumefaciens-mediated transformation of
hypocotyls. Plant Cell Rep 25: 1174-1180
Table I. Xyloglucan and cellulose content in cell walls
Xyloglucan was determined from 24%KOH-soluble fractions.
——————————————————————————— Petiolule pulvinus Main vein
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 24: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/24.jpg)
24
Plant —————————— —————————— Xyloglucan Cellulose Xyloglucan Cellulose ———————————————————————————
µg mg-1 dry weight
wt 41.1 ± 2.2 370 ± 32 16.0 ± 2.2 454 ± 23
trg1 9.1 ± 1.4 371 ± 18 8.1 ± 0.9 460 ± 55
trg2 8.3 ± 1.3 372 ± 20 9.1 ± 1.2 455 ± 32
trg3 8.8 ± 1.8 378 ± 21 8.2 ± 0.8 461 ± 31
trg4 10.4 ± 1.5 377 ± 28 8.7 ± 1.6 451 ± 43
trg5 11.6 ± 1.8 374 ± 32 8.9 ± 0.9 452 ± 53
trg6 10.1 ± 2.1 385 ± 38 7.9 ± 1.3 460 ± 47
trg7 12.0 ± 2.8 366 ± 24 8.2 ± 1.4 458 ± 44 ——————————————————————————— Three separate main veins for each plant were used for the determination.
SE values were calculated from three samples per line.
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 25: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/25.jpg)
25
FIGURE LEGENDS
Figure 1. Regenerating shoots and roots in the transgenic and wild-type plants.
(A) Regenerating shoots of the transgenic plants. Arrows indicate adventitious buds (bar = 3
mm). (B) Growth of regenerated transgenic shoots. The shoots had pinnate leaflets during
elongation (bar = 2.0 cm). (C) Regenerating transgenic roots. The plantlets producing roots
had pinnate leaves (bar = 1 cm). (D) Regenerated plantlets of the wild-type plants (bar = 1 cm).
Figure 2. Analysis of PaPopCel1 expression in the main vein with petiolule pulvinus.
(A) RT-PCR Southern blot analysis of PaPopCel1 mRNA. The relative amounts of mRNAs
by reverse transcription-PCR analysis at 15 cycles are shown. (B) Western blot analysis of cell
wall proteins. Five µg of protein was used for each. (C) Level of cellulase activity.
(D) Level of cello-oligosaccharides. Three separate main veins for each plant were used for
the determination.
Figure 3. Effect of PaPopCel1 transgenes on stem growth.
(A) Increase in stem length. (B) Increase in stem diameter. Closed circle, trg1; open circle,
trg2; closed square, trg3; open square, trg4; open triangle, wild-type.
Figure 4. Wild-type and transgenic (trg1) plants.
The wild-type and transgenic plants are shown on the left and right, respectively, at 390 days
after adventitious shoot formation. (A) Whole plants (bar = 10 cm). (B) Leaves (bar = 1.5 cm).
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 26: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/26.jpg)
26
Figure 5. Leaf movements of upper, middle, and lower parts of petioles in the wild-type and
the transgenic plants. (A) Opening: all the leaves are open (left, bar = 4 cm). (B) Closing:
closing leaves are distinguishable as yellow and white leaves (left, bar = 4 cm). The lower part
of the petiole was defined as the 2nd petiole from the bottom; the middle part as 5th or 6th
petiole from the bottom; and the upper part as the 9th or 10th (or newest) petiole. All the leaves
in the petiole were observed to determine the opening and closing times of leaf pairs from start
to finish. SE values were calculated from four lines of trg1, trg2, trg3, and trg4.
Figure 6. Closing movements of leaves whose main vein was excised.
Leaves in the vein at the upper, middle, and lower parts of petioles are shown from left to right.
SE values were calculated from four lines of trg1, trg2, trg3, and trg4. Bar = 2 cm.
Figure 7. In situ xyloglucan endotransglucosylase activity incorporating green-fluorescent
whole xyloglucan for 15 min on the transverse section (200 µm) of the petiolule pulvinus
attached to the main vein of trg1. The tissues of the pulvinus and vein are shown in the upper
and lower areas, respectively, in the images of the wild-type (A) and transgenic plant (B). The
arrow indicates the incorporated whole xyloglucan in the parenchyma motor cells. The red
color is due to the autofluorescence of chloroplasts. Bar = 0.5 mm.
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 27: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/27.jpg)
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 28: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/28.jpg)
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 29: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/29.jpg)
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 30: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/30.jpg)
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 31: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/31.jpg)
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 32: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/32.jpg)
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.
![Page 33: Overexpression of poplar cellulase accelerates growth and disturbs](https://reader035.vdocuments.us/reader035/viewer/2022081323/5881e3111a28ab17198b6635/html5/thumbnails/33.jpg)
www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.