Supplementary Figure 1
Exchange of the noncoding region is sufficient to confer robust drive to the ATP6[1] genome.
(a) PacBio sequencing of a second recombinant genome (GenBank KU764535) showed that its coding sequence (amber) is the same as that of the ATP6[1] genome, whereas the entire noncoding region matches that of the mt:ND2
del1 + mt:CoI
T300I genome. Black arrows
indicate approximate points of exchange, with the given range defined by the nearest neighboring polymorphisms. (b) A restriction fragment length polymorphism distinguishes the noncoding regions of the ATP6[1] and mt:ND2
del1 + mt:CoI
T300I genomes, while
sensitivity to XhoI cleavage tracks the allele state of mt:CoI. As shown in the Southern blot using the indicated probe (purple; mt1579–2369), the fragments present at generation 3 (G3) are consistent with predominance of the mt:ND2
del1 + mt:CoI
T300I genome (XhoI-
resistant 11.5-kb band), a minority of the ATP6[1] genome (XhoI-sensitive 9.9-kb band), which has declined from its starting level (~80%), and no detectable recombinant. At generation 10 (G10) at 29 °C, a recombinant (XhoI-sensitive 11.5-kb band) has become dominant and the ATP6[1] genome has been lost. DNA isolated from 40 adults for each generation was cut with EcoRI in the presence or absence of XhoI. (c) The predominance of the recombinant genome in the population was further confirmed by qPCR in individual flies at generation 20 (G20) at 29 °C. qPCR was performed as described in Figure 1 and the Online Methods.
Nature Genetics: doi:10.1038/ng.3587
Supplementary Figure 2
A summary of variations in noncoding sequences.
(a) The origin regions and repeat structure of the Drosophila noncoding region. The central panel shows type I (brown) and type II (gray) repeats of a typical D. melanogaster mitochondrial genome (for example, mt:ND2
del1 + mt:CoI
T300I). Individual repeats for each
type are highly conserved1. The ATP6[1] genome lacks two entire type I repeats (B1 and A/C) and two entire type II repeats (B2 and
C)2, whereas the D. yakuba genome lacks the majority (>75%) of the repeated sequences
3. Nucleotide sequences near the origins of
replication for the heavy (OH) and light (OL) chains for the mt:ND2del1
+ mt:CoIT300I
, ATP6[1] and D. yakuba genomes show conservation with potentially significant polymorphisms. The direction of replication is indicated by an arrow. The 5′ ends of mtDNA were mapped to define the sites at which mtDNA synthesis began in the D. yakuba genome: the nucleotides in the green boxes are the sites where the ends were mapped for OH and OL (ref. 4). (b) Rapid divergence of the noncoding region suggests positive selection. The divergence of the noncoding region is so fast and includes so many deletions and insertions that it is difficult to make a meaningful determination of the number of changes separating the genomes of different species. Recently reported complete genome sequences for 13 mitochondrial haplotypes from diverse wild strains of D. melanogaster
5 allowed us to compare more recently diverged genomes. Even
among these, the number of changes makes some comparisons difficult. We selected four pairs of strains where each pair represents two especially closely related genomes and each pair represents a different branch of the tree of relatedness for the 13 sequenced genomes
5. The tree shown here (left) gives the relatedness of the four pairs of sequences we analyzed. For comparison, the
relatedness to D. yakuba, the reference sequence for D. melanogaster (NC 024511), and the sequence we obtained for the temperature-sensitive genome used in this study (derived from a laboratory stock of w1118) are also indicated. Because the target size for synonymous mutation in protein-coding sequence is about one-third of the total, the ~12 kb of protein-coding sequence for the mitochondrial genome provides about 4,000 potential sites for synonymous changes, an amount roughly equal to the total number of sites in the non-coding region. As synonymous changes are in general considered neutral, the number of synonymous changes in the protein-coding regions should reflect the neutral mutation rate, and if the number of changes in the noncoding region is substantially higher positive selection could be invoked. The distribution of sequence differences distinguishing the members of each pair is shown on the right. (c) Southern blot analysis showing length polymorphism of the noncoding region of mtDNA from several Drosophila species. Total DNA was isolated from flies homoplasmic for various mitochondrial genotypes and then digested with XbaI and HindIII. The Southern blot was probed with a DIG-labeled DNA fragment recognizing mt21–400 (pink).
Nature Genetics: doi:10.1038/ng.3587
Supplementary Figure 3
D. mauritiana mtDNA rapidly outcompeted three D. melanogaster mitochondrial genotypes at 25 °C in the D. melanogaster nuclear background.
(a) The starting abundance for endogenous wild-type D. melanogaster mtDNA was high, but the abundance decreased to a low percent after four generations in two heteroplasmic lineages. PCR using primers to common sequences amplified a region of mtDNA (mt11517–12529) from both genomes. XhoI cutting was used to selectively cleave the product derived from D. mauritiana. Separation on agarose gels showed one large band representing the D. melanogaster genome and two smaller bands representing the D. mauritiana genome. The changing ratio of the top two bands illustrates the declining relative abundance of the D. melanogaster genome and the increase in the D. mauritiana genome. (b) qPCR performed as described in the Online Methods showed that the level of D. mauritiana mtDNA increased quickly when the recipients were flies homoplasmic for mt:ND2
del1 + mt:CoI
T300I or mt:ND2
del1. After a
few generations, D. melanogaster flies were left with only D. mauritiana mtDNA.
Nature Genetics: doi:10.1038/ng.3587
1
Supplementary materials Supplementary Table 1: Lifespan assay details for five stocks differing in their mitochondrial
genome: a) The numbers of female and male individuals used for the lifespan assay (Figure 3c). b)
Ratios of median survival of pairs of lines (95% confidence interval, CI) homoplasmic for genomes
that were also pitted against each other in the indicated heteroplasmic lines. c) Log-rank test showing
the pairwise statistical differences in survivorship of homplasmic lines carrying genomes that were
also tested in the indicated heteroplasmic partnerships.
a)
Mitochondrial genotype
Number of animal Median lifespan (days)
Temp Female Male Female Male
25 °C wt (Canton S) 88 90 52 43
ATP6[1] 80 98 19 21
mt:ND2del1 + mt:CoIT300I 100 100 13 13
D. mel (mito-yakuba) 86 95 67 45
mt:ND2del1 83 80 51 44
29 °C wt (Canton S) 86 90 31 23
ATP6[1] 111 80 13 11
mt:ND2del1 + mt:CoIT300I 80 80 3 3
D. mel (mito-yakuba) 80 90 33 21
mt:ND2del1 89 84 27 17
b)
Temp
Heteroplasmic pairs (winner/loser)*
Median survival ratio (95% CI of ratio)#
Female Male
25 °C wt (Canton S) / D. mel (mito-yakuba) 0.78 (0.58 – 1.05) 0.96 (0.72 – 1.28)
mt:ND2del1 / D. mel (mito-yakuba) 0.76 (0.56 – 1.04) 0.87 (0.64 – 1.17)
mt:ND2del1 + mt:CoIT300I / ATP6[1]‡ 0.68 (0.51 – 0.92) 0.62 (0.47 – 0.82)
ATP6[1] / D. mel (mito-yakuba)‡ 0.28 (0.21 – 0.39) 0.47 (0.35 – 0.62)
mt:ND2del1 + mt:CoIT300I / D. mel (mito-yakuba) 0.19 (0.15 – 0.26) 0.29 (0.22 – 0.38)
29 °C wt (Canton S) / D. mel (mito-yakuba) 0.94 (0.69 – 1.27) 1.10 (0.82 – 1.47)
mt:ND2del1 / D. mel (mito-yakuba) 0.82 (0.61 – 1.11) 0.81 (0.60 – 1.66)
mt:ND2del1 + mt:CoIT300I / ATP6[1] 0.23 (0.16 – 0.33) 0.27 (0.19 – 0.40)
ATP6[1] / D. mel (mito-yakuba) 0.39 (0.30 – 0.53) 0.52 (0.39 – 0.71)
mt:ND2del1 + mt:CoIT300I / D. mel (mito-yakuba)^ 0.09 (0.06 – 0.13) 0.14 (0.10 – 0.21)
c)
Temp
Heteroplasmic pairs (winner/loser)*
p value based on log-rank test##
Female Male
25 °C wt (Canton S) / D. mel (mito-yakuba) p < 0.0001^^ p = 0.0023^^
mt:ND2del1 / D. mel (mito-yakuba) p < 0.0001^^ p < 0.0001^^
mt:ND2del1 + mt:CoIT300I / ATP6[1] p < 0.0001^^ p < 0.0001
ATP6[1] / D. mel (mito-yakuba) p < 0.0001 p < 0.0001
mt:ND2del1 + mt:CoIT300I / D. mel (mito-yakuba) p < 0.0001 p < 0.0001
29 °C wt (Canton S) / D. mel (mito-yakuba) p = 0.0303^^ p = 0.1692^^
mt:ND2del1 / D. mel (mito-yakuba) p < 0.0001^^ p < 0.0001^^
mt:ND2del1 + mt:CoIT300I / ATP6[1] p < 0.0001 p < 0.0001
ATP6[1] / D. mel (mito-yakuba) p < 0.0001 p < 0.0001
mt:ND2del1 + mt:CoIT300I / D. mel (mito-yakuba)^ p < 0.0001 p < 0.0001
Nature Genetics: doi:10.1038/ng.3587
2
*Shows the heteroplasmic combinations created in this study and indicates which genome (winner)
displaces the other (loser) when the genomes co-exist and compete for transmission.
#This ratio of the median survival of homoplasmic strains carrying the genomes indicated in the
second column is one measure of the relative function of these genomes. A ratio significantly less
than 1 (shaded) shows that the winning genome succeeded despite a fitness cost, an indication of
selfish drive. In no case can the success of the winner be attributed to significant fitness advantage.
‡Note that the ATP6[1] genome is a loser in a pairing in which it has a functional advantage, and a
winner in a pairing where it has functional disadvantage as indicated by the ratio of median survival,
arguing strongly against selection based on function.
^ The D. yakuba genome, while limited to low relative abundance in a heteroplasmic combination
with the temperature sensitive genome at 29 °C was nonetheless retained, and hence only a “partial”
loser at this temperature.
##The log-rank test is a powerful test that assesses the likelihood that two lifetime curves are the
same. Its quantitative accuracy depends on a constant proportionality of the hazards across time.
^^These lifespan curves indicate that the ratio of hazards is not constant across these curves either
because they cross or because there is evidence of two phases of decline in survivors.
Nature Genetics: doi:10.1038/ng.3587
3
Supplementary Table 2: Primers used in this study
Primers Sequences Function
mt186F ttaagctactgggttcatacccc Sequencing fragment I
mt774F tctattaatcatttaggatgaatatt Sequencing fragment I
mt1579F cgagctgaattaggacatcc Sequencing fragment I
mt2126F ttgacccagcgggaggaggagat Sequencing fragment I
mt2884F tgagaaagtttagtatcacaacga Sequencing fragment I
mt3567F cttgaacagtacctgctttagg Sequencing fragment I
mt4807R agctcctgttaatggtcatggac Sequencing fragment I
mt4583F tagctgcaggtaaccaagaag Sequencing fragment I
mt5326F caactttttatatggccactgg Sequencing fragment I
mt6115F tctttaattgaagccaaaaagagg Sequencing fragment I
mt7519R ccctactcctgtctctgct Sequencing fragment II
mt7229F gctttaaataaagcatgagttaataaatga Sequencing fragment II
mt7963F acttattcaatcaaaaagaaaagttataac Sequencing fragment II
mt8701F tatgagcaacagatgaataagc Sequencing fragment II
mt9382F cacaacctaaaaaataagaaatttctgatc Sequencing fragment II
mt10358F ctttatctttaaataaattatataattttcccac Sequencing fragment II
mt11003F ttgctgttgataatgccac Sequencing fragment II
mt11517F agctcgaccagttgaagaacc Sequencing fragment II
mt12043F cagcaaaatcaaaaggattccg Sequencing fragment II
mt12822F aaccaacctggcttacacc Sequencing fragment II
mt13296F cgtccaaccattcattccagcc Sequencing fragment II
mt14797R gtgccagcagtcgcggttatac Sequencing fragment II
mt14439F taagtaaggtccatcgtgg Sequencing fragment III
mt400R gtagatattaaattattattatctcttaatagggg Sequencing fragment III
PCR and qPCRprimers
mt186F ttaagctactgggttcatacccc F primer for fragment I
mt7519R ccctactcctgtctctgct R primer for fragment I
mt7229F gctttaaataaagcatgagttaataaatga F primer for fragment II
mt14797R gtgccagcagtcgcggttatac R primer for fragment II
mt12822F aaccaacctggcttacacc F primer for fragment III
mt400R gtagatattaaattattattatctcttaatagggg R primer for fragment III
mt361F cttttatccccctattaagag Common F primer (qPCR)
mt412R gaagcttctgtagatattaaattatta Common R primer (qPCR)
mt12517R ggttgaggaattcctattaaaccaac Reverse primer
D. yakuba mt774F tctattaatcatttaggatgaatatt D. yakuba specific F primer (qPCR)
D. yakuba mt824R tgattctctaatcattaaagatctt D. yakuba specific R primer (qPCR)
D. mauritiana mt774F tctatcaatcatttaggatgaatatta D. mauritiana specific F primer (qPCR)
D. mauritiana mt824R tgattctctaattattaaagatctt D. mauritiana specific R primer (qPCR)
ATP6[1] mt774F tcaattaatcatttagggtgaatat ATP6[1] specific F primer (qPCR)
ATP6[1] mt824R tgattctctaattattaaagatctt ATP6[1] specific R primer (qPCR)
D. yakuba mt6237F cttttaatggttaaattccatttata Common F primer (qPCR)
D. yakuba mt6314R ttattattacaatgaaaatgtaaggt Common R primer (qPCR)
D. yakuba mt6652F aaatcatattgaacctaaaaataatg D. yakuba specific F primer (qPCR)
D. yakuba mt6811R ttatataatttgtttacctgggta D. yakuba specific R primer (qPCR)
Southern primers
mt21F ggattaccttgatagggtaaatca Forward primer
mt400R gtagatattaaattattattatctcttaatagggg Reverse primer
mt1579F cgagctgaattaggacatcc Forward primer
mt2365R ctacatctattccaacggtaaatata Reverse primer
Nature Genetics: doi:10.1038/ng.3587
4
References for supplementary figures:
1. Lewis, D. L., Farr, C. L., Farquhar, A. L. & Kaguni, L. S. Sequence, organization, and evolution of
the A+T region of Drosophila melanogaster mitochondrial DNA. Mol Biol Evol 11, 523–538 (1994).
2. Ma, H. & O'Farrell, P. H. Selections that isolate recombinant mitochondrial genomes in animals.
Elife 4, e07247 (2015).
3. Tsujino, F. et al. Evolution of the A+T-rich region of mitochondrial DNA in the melanogaster
species subgroup of Drosophila. J. Mol. Evol. 55, 573–583 (2002).
4. Saito, S., Tamura, K. & Aotsuka, T. Replication origin of mitochondrial DNA in insects. Genetics
171, 1695–1705 (2005).
5. Wolff, J. N., Camus, M. F., Clancy, D. J. & Dowling, D. K. Complete mitochondrial genome
sequences of thirteen globally sourced strains of fruit fly (Drosophila melanogaster) form a
powerful model for mitochondrial research. Mitochondrial DNA 1–3 (2015).
doi:10.3109/19401736.2015.1106496
Nature Genetics: doi:10.1038/ng.3587