![Page 1: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/1.jpg)
Multiple Sequence Alignment
Colin DeweyBMI/CS 576
www.biostat.wisc.edu/bmi576/[email protected]
Fall 2015
![Page 2: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/2.jpg)
Key concepts
• The Multiple Sequence Alignment Problem• Scoring Multiple Sequence Alignments
– Scoring an alignment of a “profile” and a sequence
• Heuristic Algorithms for Multiple Sequence Alignment– General strategies
• Progressive alignment– Star alignment– Tree-based alignment
• Iterative alignment
![Page 3: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/3.jpg)
What is multiple sequence alignment?
Given: three or more related biological sequences
Do: identify the subsets of positions across sequences that are truly related
In other words: find a simultaneous alignment of all input sequences such that the implied pairwise alignments identify the truly related positions between each pair of sequences
![Page 4: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/4.jpg)
An example multiple sequence alignment
![Page 5: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/5.jpg)
Why multiple sequence alignment?
• Build phylogenetic trees (next module)– Determine evolutionary relationships between sequences
• A multiple sequence alignment can represent a family of proteins with similar function– Compare new sequence to a “family” of known proteins– For example the BLOCKS database used for BLOSUM contains several
ungapped alignments for known protein families
• Discover common signatures or protein domains among a group of proteins
• Identify genetic variation among individuals of a population
![Page 6: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/6.jpg)
The tasks in Multiple Sequence Alignment
• Scoring an alignment• Algorithms for creating an alignment
![Page 7: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/7.jpg)
Some notation
• Let m denote a Multiple Sequence Alignment• mi is the ith column of the alignment m
• mij is the ith column and jth row
• cia count of residue a in column i
![Page 8: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/8.jpg)
Example using notation
G A R F I E L D T H E F A T C A TG A R F I E L D T H E - - - C A T G A R F I E L D T H A T - - C A TG A R R Y - L I K E D A - - C A T
![Page 9: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/9.jpg)
Scoring a Multiple Sequence Alignment (MSA)
• Key issue: how do we score a multiple sequence alignment?
• Usually, we assume that columns of an alignment are independent
• For now, we will simplify the score by assuming a linear gap penalty
gap function score of ith column
![Page 10: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/10.jpg)
Gap penalty (G)
• We will use a simple linear gap penalty function • Penalty for a space: s
• Let S(a,b) denote the cost of substituting a by b. • Linear gap penalty can be incorporated into the substitution
matrix• S(a,-)=-s=S(-,a)• S(-,-)=0
![Page 11: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/11.jpg)
Two common ways of scoring a multiple alignment
• Entropy based scores
• Sum of pairs
![Page 12: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/12.jpg)
Entropy of a distribution
• A measure of uncertainty of an outcome• For a discrete distribution P(X), where X takes k values x1, .. xk
it is defined as
• Entropy is greatest when we are most uncertain, that is, for a uniform distribution
• Entropy is least when we are most certain, e.g. deterministic event
![Page 13: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/13.jpg)
Score of a column: Entropy based
• This has an entropy-based interpretation• First, the probability of a column mi
• Second, maximize this probability by setting pia to be the frequency of character a in column i
• Third, taking log on both sides and putting a “-” sign gives us the entropy-based score
• Score of the ith column of alignment m is
![Page 14: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/14.jpg)
Scoring an alignment: Entropy based score
• Taking log on both sides and putting a “-” sign gives us the entropy-based score
• This looks similar to entropy of a random variable specifying the character a in this column.
• High entropy: More uniform distribution/more variability of characters
• Low entropy: Less uniform distribution/less variability of characters
![Page 15: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/15.jpg)
Scoring of a column: Sum of Pairs
• Compute the sum of the pairwise scores
Substitution score from a substitution/match matrix such as BLOSUM or PAM
Iterate over all pairs of rows in the column
![Page 16: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/16.jpg)
Algorithms for performing a Multiple Sequence Alignment
• Dynamic programming– Not practical
• Progressive alignment algorithms– Star alignment– Guide tree approach
• Iterative alignment algorithms
![Page 17: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/17.jpg)
Dynamic Programming (DP) for global multiple sequence alignment
• Assume columns are independent– Score of alignment is sum of scores per column
• Generalization of methods for pairwise alignment– consider k-dimensional matrix for k sequences (instead
of 2-dimensional matrix)– each matrix element represents alignment score for k
prefixes (instead of 2 prefixes)
![Page 18: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/18.jpg)
Notation for DP
• Assume we have k sequences• i1 denotes the length of the prefix for sequence 1
• i2 denotes the length of the prefix for sequence 2• …
• ik denotes the length of the prefix for sequence k
• denotes the character at ik position of sequence xk
• F: k-dimensional matrix where
denotes the score of the best alignment of the i1, i2.. ik prefixes of the sequences
![Page 19: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/19.jpg)
Recall the DP for the pairwise alignment
![Page 20: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/20.jpg)
DP for Multiple sequence alignment
max score of alignment for the k prefixes
How many items do we need to maximize over? 2k -1
![Page 21: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/21.jpg)
DP algorithm is too expensive
• For k sequences each of length n– Space complexity: O(nk) – Time complexity: O(nk2k)
![Page 22: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/22.jpg)
Heuristic algorithms to Multiple sequence alignment
• Progressive alignment– Build the alignment of larger number of sequences from partial
alignments of subsets of sequences
• Iterative alignment– Possibly remove some of the aligned sequences and re-align to see if
score improves
![Page 23: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/23.jpg)
Progressive alignment
• Key heuristic: Align the “most similar” sequences first• Rely on pre-computed pairwise similarity/distance
– Pairwise sequence alignments– Algorithms differ in the extent to which the pairwise similarity
influences the final alignments
• Two strategies– Star alignment– Tree alignments
– Simple (quick and dirty) tree– At each time combine two, possibly singleton, sets of sequences
![Page 24: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/24.jpg)
Star Alignment Approach
• Given: k sequences to be aligned
– pick one sequence as the “center”– for each determine an optimal alignment
between and– Aggregate pairwise alignments
• Shift entire columns when incorporating gaps
• return: multiple alignment resulting from aggregate
![Page 25: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/25.jpg)
Picking the center in star alignments
Two possible approaches:1. try each sequence as the center, return the best multiple
alignment2. compute all pairwise alignments and select the string that
maximizes:
![Page 26: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/26.jpg)
Aligning to an existing partial alignment
• Need to treat each “partial alignment” as a single entity– Partial alignment should not be changed other than gap insertions
• Shift entire columns when incorporating gaps
-TGT AAC-TGT -ACATGT --CATGT GGC
TGTTAAC -TGTTAAC-TGT-AAC-TGT--ACATGT---CATGT-GGC
![Page 27: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/27.jpg)
Star Alignment Example
ATTGCCATT
ATGGCCATTATTGCCATT
ATC-CAATTTTATTGCCATT--
ATCTTC-TTATTGCCATT
ATTGCCGATTATTGCC-ATT
ATTGCCATT
ATGGCCATT
ATCCAATTTT
ATCTTCTT
ATTGCCGATT
Given:
![Page 28: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/28.jpg)
• Aggregate pairwise alignments
Star Alignment Example
ATTGCCATTATGGCCATT
ATGGCCATTATTGCCATT1.
ATC-CAATTTTATTGCCATT--
ATTGCCATT--ATGGCCATT--ATC-CAATTTT
2.
present pair Current multiple alignment
![Page 29: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/29.jpg)
Star Alignment Example
ATCTTC-TTATTGCCATT
ATTGCCATT--ATGGCCATT--ATC-CAATTTTATCTTC-TT--
3.
ATTGCCGATTATTGCC-ATT
ATTGCC- A TT--ATGGCC- A TT--ATC-CA- A TTTTATCTTC- - TT--ATTGCCG A TT--
4.
present pair
shift entire columnswhen incorporating a gap
Current multiple alignment
![Page 30: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/30.jpg)
Comments about Star alignment
• Conceptually simple• Dependent only upon pairwise alignments• Does not consider any position-specific information of the
partial multiple sequence alignment while aligning a new sequence to it
![Page 31: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/31.jpg)
Tree-based progressive alignments
• Align sequences according to a guide tree– leaves represent sequences– internal nodes represent alignments
• Determine alignments from bottom of tree upward– return multiple alignment represented at the root of
the tree• One common variant: the CLUSTALW algorithm
[Thompson et al. 1994]
![Page 32: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/32.jpg)
Tree-based progressive alignment
• Depending on the internal node in the tree, we may have to align a– a sequence with a sequence– a sequence with a partial alignment– a partial alignment with a partial alignment
• In all cases we have the option of inserting gaps or substitutions– For aligning alignments, we will use sum of pairs scoring– To choose between options we will use an idea similar
to the pairwise sequence alignment case
![Page 33: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/33.jpg)
Tree alignment example
• Starting sequences
• Create a guide tree– Using pairwise distances (we will cover this in subsequent lectures)– Approach similar to but simpler than phylogenetic trees
TGTAACTGTACATGTCATGTGGC
TGTTAAC
![Page 34: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/34.jpg)
Tree Alignment Example
TGTAAC TGTAC ATGTC ATGTGGC
TGTAACTGT-AC
TGTTAAC
![Page 35: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/35.jpg)
Tree Alignment Example
TGTAAC TGTAC
ATGT--CATGTGGC
ATGTC ATGTGGC
TGTAACTGT-AC
TGTTAAC
![Page 36: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/36.jpg)
Tree Alignment Example
TGTAAC TGTAC
ATGT--CATGTGGC
ATGTC ATGTGGC
TGTAACTGT-AC
-TGTAAC-TGT-ACATGT--CATGTGGC
TGTTAAC
Aligning two alignments
![Page 37: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/37.jpg)
Tree Alignment Example
TGTAAC TGTAC
ATGT--CATGTGGC
ATGTC ATGTGGC
TGTAACTGT-AC
-TGTAAC-TGT-ACATGT--CATGTGGC
TGTTAAC
-TGTTAAC-TGT-AAC-TGT--ACATGT---CATGT-GGC
Aligning sequence to alignment
![Page 38: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/38.jpg)
Scoring an alignment of partial alignments
• Recall the sum of pairs score for a column i
• Let 1 to n represent sequences from the first alignment• Let n+1 to N represent sequences from the second alignment,
N denotes total number of sequences• Alignment at column i can be written as
Within first alignment
Within second alignment
Between two alignments
![Page 39: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/39.jpg)
Computing the sum of scores for two alignments
• Assume we have two alignments corresponding to intermediate nodes of the guide tree
• At each step we maximize over score from– aligning column i in A1 to a column j in A2– aligning column i in A1 to gaps in A2– aligning column j in A2 to gaps in A1
• ClustalW uses an average of all pairwise comparisons between two alignments
AAAC-GAC
AGCACC
Alignment A1 Alignment A2
![Page 40: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/40.jpg)
ClustalW scores for aligning columns from two alignments
AAAC-GAC
AGCACC
Alignment 1
Alignment 2
Score of aligning column 3 from Alignment 1 and column 2 from alignment 2
Assume a score of 1 for mismatch, 2 for match and 0 for gap
![Page 41: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/41.jpg)
Comments about tree-based progressive alignment
• Exploits partial alignment information• But, greedy
– The tree might not be correct, that is, reflect an incorrect ordering of how sequences should be stacked up in the alignment
– Final results prone to errors in alignment• Some positions might be misaligned (that is have a lower score than if a
different ordering is used).
![Page 42: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/42.jpg)
Ordering matters
Consider aligning GG, DGG and DGD
D G D- G G
D G DG G -
Are as good. But when we include DGG
D G D- G GD G G
D G DG G -D G G
1 is better than 2, assuming a match score of 2, mismatch score =1, gap penalty=-2
1 2
1 2
![Page 43: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/43.jpg)
Iterative refinement methods
• The order of selection of sequences can influence the alignment– ClustalW overcomes some of these issues but has many heuristics and
parameters
• How to avoid committing to a non-optimal pairwise decision?– Revisit alignments– This is the focus of iterative alignments
![Page 44: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/44.jpg)
Additional notes about the ClustalW algorithm
• Tailored to handle very divergent sequences: 25-30% similarity
• Dynamically varies the gap penalties in a position and residue specific manner
• Weight different sequences differently– Closely related sequences need to be down-weighted – Divergent sequences are up-weighted
• Dynamically switch between substitution matrices depending upon the average similarity between sequences being aligned
![Page 45: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/45.jpg)
Applying ClustalW to SH3 domain proteins
Proteins share <12% sequence identity
Alignment blocks correspond to beta strand secondary structures
Thomson et al, 1994
![Page 46: Multiple Sequence Alignment Colin Dewey BMI/CS 576 colin.dewey@wisc.edu Fall 2015](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f2b5503460f94c463eb/html5/thumbnails/46.jpg)
Summary
• Multiple sequence alignment is the problem of finding corresponding positions among more than two sequences
• Scoring function: – Entropy based– Sum of pairs
• Algorithms– Progressive
• Star– Dependent upon a center– Keep adding all pairs of aligned sequences with the current alignment
• Tree– Create an approximate guide tree– Use tree to align the sequences
– Iterative• Don’t commit to the fixed ordering, revisit the alignment until score does not
change